DISCOVERY AND EVOLUTION OF BIOLOGICALLY ACTIVE METABOLITES

20230151354 · 2023-05-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The disclosure provides systems, methods, reagents, apparatuses, vectors, and host cells for the discovery and evolution of metabolic pathways that produce small molecules that modulate enzyme function.

    Claims

    1. A method for the discovery and evolution of metabolic pathways that produce molecules that modulate protein function, comprising: contacting a plurality of host cells that comprise a protein of interest with a plurality of expression vectors that each comprise different a metabolic pathway of a plurality of metabolic pathways under conditions sufficient to express components of the plurality of metabolic pathways in the plurality of host cells; expressing the plurality of metabolic pathways in the plurality of host cells, wherein a host cell or subset of the plurality of host cells produces a detectable output when a metabolic pathway of the plurality of metabolic pathways produces one or more products that modulates the protein of interest; screening the host cell or the subset of the population of host cells under conditions that enable measurement of the detectable output in the host cell or the subset of the plurality of host cells; isolating the host cell or the subset of the plurality of host cells that produce the detectable output; isolating expression vectors of the plurality of expression vectors that yield detectable outputs higher than the output of a reference vector that harbors a reference pathway; and characterizing the one or more products of metabolic pathways of the plurality of metabolic pathways comprised by the expression vectors that yield the detectable outputs that are higher than the output of the reference vector in the host cell or the subset of the plurality of host cells.

    2. The method of claim 1, wherein the plurality of host cells further comprises a genetically encoded system in which the activity of a protein of interest controls the assembly of a protein complex with an activity that is not possessed by components of the protein complex when the components are dissociated, thereby yielding a detectable output in proportion to the amount of protein complex formed.

    3. The method of claim 1, wherein each of the plurality of host cells further comprises a genetically encoded system in which the activity of the protein of interest controls the assembly of a protein complex with an activity that is not possessed by components of the protein complex when the components are dissociated, thereby yielding a detectable output, and wherein the protein of interest is an enzyme that adds a post-translational modification to a component of the protein complex that causes the component to form the protein complex with another component of the protein complex, wherein the component and the another component are two proteins that are initially dissociated.

    4. The method of claim 2, wherein the components of the protein complex comprise two proteins with a dissociation constant (K.sub.d) less than or equal to the K.sub.d of binding between SH2 domains and their phosphorylated substrates.

    5. The method of claim 1, wherein the one or more products comprise phenylpropanoids or nonribosomal peptides.

    6. The method of claim 1, wherein each of the plurality of metabolic pathways comprises a mutation in one or more genes within a starting metabolic pathway relative to an otherwise identical starting metabolic pathway that does not comprise the mutation.

    7. The method of claim 1, wherein one or more of the plurality of metabolic pathways comprises a set of genes of unknown biosynthetic capability.

    8. The method of claim 1, wherein the expression vectors that were isolated comprise one or more metabolic pathways of the plurality of metabolic pathways that produce a product of the one or more products that differs from a reference product of another metabolic pathway of the plurality of metabolic pathways.

    9. The method of claim 1, wherein the expression vectors that were isolated comprise one or more metabolic pathways of the plurality of metabolic pathways that produce a larger quantity of a product of the one or more products than a quantity of a reference product generated by another metabolic pathway of the plurality of metabolic pathways.

    10. The method of claim 1, wherein the expression vectors that were isolated comprise one or more metabolic pathways of the plurality of metabolic pathways that exhibit a lower cellular toxicity than a reference cellular toxicity exhibited by another metabolic pathway of the plurality of metabolic pathways.

    11. The method of claim 1, wherein the characterizing the one or more products of the metabolic pathways is performed by analytical methods comprising one or more of gas chromatography-mass spectrometry (GC/MS), liquid chromatography-mass spectrometry (LC/MS), and/or nuclear magnetic resonance (NMR) spectroscopy.

    12. The method of claim 1, further comprising isolating the one or more products of the metabolic pathways encoded by the expression vectors that yield the detectable outputs that are higher than the output of the reference vector in the host cell or the subset of the plurality of host cells.

    13. The method of claim 12, further comprising: concentrating the one or more products of the metabolic pathways encoded by the expression vectors that yield the detectable outputs that are higher than the output of the reference vector in the cell or the subset of the plurality of host cells.

    14. The method of claim 1, further comprising testing the effects of the one or more products on the protein of interest.

    15. The method of claim 1, wherein the protein of interest is a ubiquitin ligase, a SUMO transferase, a methyltransferase, a demethylase, an acetyltransferase, a glycosyltransferase, a palmitoyltransferase, or a related hydrolase.

    16.-28. (canceled)

    29. The method of claim 12, further comprising: testing the effects of the one or more products of the metabolic pathways encoded by the expression vectors that yield the detectable outputs that are higher than the output of the reference vector in the host cell or the subset of the plurality of host cells on the protein of interest.

    30. The method of claim 13, wherein the concentrating the one or more products is performed using a rotary evaporator.

    31. The method of claim 3, wherein the components of the protein complex are covalently coupled to each other to form the protein complex.

    32. The method of claim 1, wherein the reference pathway does not produce molecules with concentrations, potencies, or a combination thereof that are sufficient to modulate the activity of the protein of interest in the host cell or the subset of the population of host cells

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0039] FIGS. 1A-1E. Development of a bacterial-two hybrid system that links the inhibition of PTP1B to antibiotic resistance. FIG. 1A, A bacterial two-hybrid (B2H) system that detects phosphorylation-dependent protein-protein interactions. Major components include (i) a substrate domain fused to the omega subunit of RNA polymerase (yellow), (ii) an SH2 domain fused to the 434 phage cI repressor (light blue), (iii) an operator for 434cI (dark green), (iv) a binding site for RNA polymerase (purple), (v) Src kinase, and (vi) PTP1B. Src-catalyzed phosphorylation of the substrate domain enables a substrate-SH2 interaction that activates transcription of a gene of interest (GOI, black). PTP1B-catalyzed dephosphorylation of the substrate domain prevents that interaction; inhibition of PTP1B re-enables it. FIG. 1B, A version of the B2H system that both (i) lacks PTP1B and (ii) contains p130cas as the substrate domain and luxAB as the GOI. Inducible plasmids were used to increase expression of specific components in E. coli; secondary induction of Src from one such plasmid enhanced luminescence. FIG. 1C, A version of the B2H system that both (i) lacks PTP1B and Src and (ii) includes an SH2 domain (SH2*) with an enhanced affinity for phosphopeptides, a variable substrate domain, and LuxAB as the GOI. An inducible plasmid was used to increase expression of Src in E. coli. Sequences for substrates p130cas (SEQ ID NO: 24), MidT (SEQ ID NO: 25), EGFR (SEQ ID NO: 27), and ShcA (SEQ ID NO: 26) are shown. FIG. 1D, The B2H system from c with either p130cas or MidT as substrates. A second plasmid was used to overexpress either (i) Src and PTP1B or (ii) Src and an inactive variant of PTP1B (C215S) in E. coli. Right: Two single-plasmid B2H systems. FIG. 1E, The optimized system includes SH2*, the midT substrate, optimized promoters and ribosome binding sites (bb034 from FIG. 1D), and SpecR as the GOI. Inactivation of PTP1B enabled a strain of E. coli harboring this plasmid-borne system to survive at high concentrations of spectinomycin (>250 μg/ml). Error bars in FIG. 1B-FIG. 1D denote standard error with n=3 replicates.

    [0040] FIGS. 2A-2C. Biosynthesis of PTP1B-inhibiting terpenoids enables cell survival. FIG. 2A, A plasmid-borne pathway for terpenoid biosynthesis: (i) pMBIS, which harbors the mevalonate-dependent isoprenoid pathway of S. cerevisiae, converts mevalonate to isopentyl pyrophosphate (IPP) and farnesyl pyrophosphate (FPP). (ii) pTS, which encodes a terpene synthase (TS) and, when necessary, a geranylgeranyl diphosphate synthase (GGPPS), converts IPP and FPP to sesquiterpenes or diterpenes. FIG. 2B, Four terpene synthases: amorphadiene synthase (ADS), γ-humulene synthase (GHS), abietadiene synthase (ABS), and taxadiene synthase (TXS). FIG. 2C, The spectinomycin resistance of strains of E. coli that harbor both (i) the bacterial two-hybrid (B2H) system (ii) a TS-specific terpenoid pathway (pTS includes GGPPS only when ABS or TXS are present). ADS enabled survival in the presence of high concentrations of spectinomycin. Note: ABS.sub.D404A/D621A is catalytically inactive. B2H* contains PTP1B.sub.C215S, which is inactive.

    [0041] FIGS. 3A-3G. Strategy for microbially assisted directed evolution (MADE). FIG. 3A, Error-prone PCR and/or site-saturation mutagenesis of a subset of genes within a metabolic pathway yield a library of metabolic pathways. FIG. 3B, Microbes, each of which harbors both (i) the B2H system and (ii) a member of the pathway library, are grown in liquid culture. Note: The system shown is an E. coli host that harbors both (i) the B2H system and (ii) mutated terpenoid pathways (i.e., pMBIS+pTS with mutations; see FIG. 2A). FIG. 3C, After liquid culture, the transformants are plated on solid media with different concentrations of antibiotic; hits comprise colonies that grow at antibiotic concentrations at which the wild-type pathway does not permit growth. FIG. 3D, The pathways of the hits are sequenced; their mutations are reintroduced into the wild-type pathway; and these reconstructed pathway variants are rescreened with drop-based plating (10 μL) on solid media with different concentrations of antibiotic. This step removes false positives (e.g., colonies that survived because of mutations located outside of the target genes). FIG. 3E, The confirmed hits are grown in liquid culture; their products are extracted with a hexane overlay, as needed, and concentrated in a rotary evaporator. FIG. 3F, GC/MS enables the identification and quantification of mutant products; NMR can assist with identification. FIG. 3G, Interesting metabolites (purchased or purified from culture extract) are characterized with in vitro kinetic measurements or cell studies of target modulation and/or ITC analyses of target-metabolite binding.

    [0042] FIGS. 4A-4D. Genetically encoded systems that detect metabolite-mediated modulation of post-translational modification (PTM) enzymes. FIG. 4A, A genetically encoded system that detects metabolite-mediated activation of enzymes E1 and/or E2. E1 adds a PTM to protein P1, allowing it to bind to P2; the newly formed P1-P2 complex activates transcription of a gene of interest (GOI, black). E2 removes the PTM from P1 and, thus, prevents complex formation. When the GOI confers a fitness advantage, inhibitors of E2 or activators of E1 enhance cell survival. When the GOI is toxic, inhibitors of E1 or activators of E2 enhance cell survival. FIG. 4B, An alternative detection system. E1 adds a PTM to protein P1, allowing it to bind to P2; the newly formed P1-P2 complex assembles a split protein (e.g., a fluorescent protein, a luciferase, or an enzyme that confers antibiotic resistance). E2 removes the PTM from P1 and, thus, prevents complex formation. When the reconstituted split protein confers a fitness advantage, inhibitors of E2 or activators of E1 enhance cell survival. When, by contrast, the reconstituted protein is toxic, inhibitors of E1 or activators of E2 enhance cell survival. FIG. 4C, A genetically encoded system that detects metabolite-mediated activation of PTM enzymes that control protein ligation (e.g., a SUMO transferase, a ubiquitin ligase, or associated peptidases). E1 attaches P1 to a lysine residue (K) of P2, and the newly formed P1-P2 complex activates transcription of a GOI. E2 breaks this complex apart. FIG. 4D, An alternative system. E1 attaches P1 to P2, and the newly formed P1-P2 complex permits the assembly of a split protein. E2-mediated proteolysis breaks this complex apart.

    [0043] FIGS. 5A-5C. Alternative metabolic pathways. FIG. 5A, Phenylpropanoid pathways developed by Young-Soo Hong and colleagues.sup.45. Abbreviations: TAL, ammonia-lyase from S. espanaensis; Sam5, 4-coumarate 3-hydroxylase form S. espanaensis; COM, O-methyltransferase from A. thaliana; ScCCL, cinnamate/4-coumarate:CoA ligase from Streptomyces coelicolor; CHS, chalcone synthase from A. thaliana; STS, stilbene synthase from Arachis hypogaea. FIG. 5B, The pathways encoded by the plasmids from FIG. 5A. FIG. 5C, A genetically encodable yersiniabactin (Ybt) synthetase, as described by Khosla and colleagues.sup.46. Ybt is a polyketide-nonribosomal peptide. The substrates necessary for Ybt production appear in blue. Abbreviations: ArCP, aryl carrier protein; A, adenylation; PCP, peptidyl carrier proteins; Cy, cyclization; KS, ketosynthase; ACP, acyl carrier protein; AT, acyltransferase; KR, NADPH-dependent ketoreductase; MT, methyltransferase; SAM, S-adenosylmethionine; TE, thioesterase. See the text for details on biosynthesis.

    [0044] FIGS. 6A-6B. An approach for the discovery of cryptic metabolic pathways. FIG. 6A, Mutagenesis and/or reorganization of a multi-step pathway inactivates a biosynthetic gene and, thus, permits the accumulation of a metabolic intermediate. FIG. 6B, Mutagenesis and/or reorganization of a multi-step pathway inactivates a repressor gene and, thus, permits the expression of pathway genes.

    [0045] FIGS. 7A-7I. Microbial evolution of terpenoid inhibitors. FIG. 7A-7B, Homology models for (FIG. 7A) ADS and (FIG. 7B) GHS show the locations of residues targeted for site-saturation mutagenesis (SSM). A substrate analogue from an aligned structure of 5-epi-aristolochene synthase (pdb entry Seat) appears in blue. FIG. 7C-7D, Measurements of the spectinomycin resistance conferred by mutants of (c) ADS (LB plates) and (FIG. 7D) GHS (TB plates). ALP corresponds to a quintuple mutant of GHS (A336C/T445C/S484C/I562L/M565L) that generates α-longipinene as a major product. Shades denote colony densities: diffuse 10 colonies, light gray), circular diffuse (gray), and circular lawn (black). FIG. 7E, The product profiles of mutants of ADS that enable growth at higher antibiotic concentrations than the wild-type enzyme. FIG. 7F, ADS.sub.G43S/K51N and ADS yield similar amorphadiene titers in liquid cultures. FIG. 7G, ADS.sub.G43S/K51N yields higher colony densities than the wild-type enzyme in the presence of an inactive B2H system (B2Hx); these densities suggest that ADS.sub.G43S/K51N is less toxic than ADS. FIG. 7H, The product profiles of wild-type GHS and several GHS mutants that yield enhanced antibiotic resistance; discrepancies between profiles of these mutants suggest differences in the composition of intracellular terpenoids that might give rise to enhanced antibiotic resistance. FIG. 7I, GHS.sub.A319Q yields a higher terpenoid titer than GHS. Error bars in FIG. 7F and FIG. 7I denote standard deviation with n=3 biological replicates.

    [0046] FIGS. 8A-8D. Analysis of evolved mutants. FIG. 8A, Analysis of the antibiotic resistance conferred by mutants of ADS. Images show the growth of E. coli on LB plates seeded from drops of liquid culture (10 μL). Each mutant was prepared by using site-directed mutagenesis to introduce mutations identified in the selection experiment (i.e., hits) into the starting ADS plasmid. Shades denote colony densities: diffuse (≥10 colonies, light gray), circular diffuse (gray), and circular lawn (black) FIG. 8B, A replicate of the experiment described in FIG. 8A. FIG. 8C, Analysis of the antibiotic resistance conferred by mutants of GHS. Images show the growth of E. coli on TB plates seeded from drops of liquid culture (10 μL). FIG. 8D, A replicate of the experiment described in FIG. 8C. In FIG. 8A-FIG. 8D, blue highlights denote mutants that enabled growth at higher concentrations of spectinomycin than the wild-type enzymes in two biological replicates (i.e., these mutants appear in FIGS. 3C and 3d).

    [0047] FIGS. 9A-9C. Analysis of the products of different terpene synthases. FIG. 9A, Titers of the dominant terpenoids (i.e., amorphadiene, γ-humulene, taxadiene, or abietadiene) generated by each TS-specific strain in the absence (top) and presence (bottom) of the B2H system. Similar titers indicate that the B2H system does not interfere with terpenoid biosynthesis. FIG. 9B, GC/MS chromatograms of the terpenoids generated by each strain in the absence (top) and presence (bottom) of the B2H system (m/z=204). Similar profiles indicate that the B2H system does not alter product distributions. FIG. 9C, Analysis of the contributions of either (i) TS activity or (ii) B2H function to the death and survival of various strains. Inactivation of GHS does not enhance the survival of the GHS strain, an indication that this enzyme does not produce growth-inhibiting terpenoids. Inactivation of either ADS or the B2H system, by contrast, weakens the antibiotic resistance of the ADS strain, an indication that maximal resistance requires both terpenoid production and B2H activation. Labels denote the following controls: GHS.sub.D/A, an inactive GHS; ADS.sub.D/A, an inactive ADS; B2H*, a constitutively active B2H; B2H.sub.x, an inactive B2H. Note: The left and right images show LB plates seeded with drops of liquid culture (10 μL) from two biological replicates. Error bars in FIG. 9A denote standard error for n≥3 biological replicates.

    [0048] FIGS. 10A-10E. Analysis of the products of various terpenoids. FIG. 10A, Chromatograms show expected dominant products (*) for each TS-specific strain from FIG. 2C (the B2H system is present). FIG. 10B, Titers of major products generated by ADS and TXS. FIG. 10C, Initial rates of PTP1B-catalyzed hydrolysis of pNPP in the presence of increasing concentrations of amorphadiene and taxadiene. Lines show fits to a Michaelis-Menten model, which provides evidence of noncompetitive inhibition (amorphadiene) and mixed inhibition (taxadiene). FIG. 10D, A depiction of a HEK293T/17 cell. Insulin stimulates phosphorylation of the membrane-bound insulin receptor (IR); PTP1B dephosphorylates IR, and the inhibition of PTP1B restores phosphorylation. FIG. 10E, ELISA-based measurements of IR phosphorylation in starved wild-type HEK293T/17 cells exposed to 3% dimethyl sulfoxide (DMSO, n=2), 930 μM amorphadiene (AD, in 3% DMSO, n=3), and 405 μM α-bisabolene (Abis, 3% DMSO, n=1) for 10 minutes. The results indicate that both amorphadiene and α-bisabolene can cross the cell membrane, inhibit intracellular PTP1B, and, thus, increase IR phosphorylation. Error bars in FIG. 10B denote standard error with n=3 biological replicates. Error bars in FIG. 10C denote standard error with n≥3 measurements. Error bars in FIG. 10E denote standard error with n values indicated (we note: for these measurements, we subtracted a reference signal produced by lysis buffer alone, n=3).

    [0049] FIGS. 11A-11d. Analysis of alternative terpene synthases. FIG. 11A-FIG. 11B, The spectinomycin resistance of strains of E. coli that harbor (i) an active or inactive bacterial two-hybrid system (B2H and B2Hx, respectively, as in FIGS. 1, 2, and 7-9) and (ii) the terpenoid pathway from FIG. 2 with each of the following terpene synthases: γ-humulene synthase from Abies grandis (GHS), β-bisabolene synthase from Zingiber officinale (ZoBBA), β-bisabolene synthase from Santalum album (SaBBA), and α-bisabolene synthase (ABB) from Abies grandis (ABS). SaBBA and, most prominently, ABB enable survival at high concentrations of spectinomycin. FIG. 11C, chemical structures of β-bisabolene and α-bisabolene. FIG. 11D, analysis of PTP1B activity on p-nitrophenyl phosphate (pNPP) in the presence of increasing concentrations of α-bisabolene (measured as amorphadiene equivalents) purified from culture extract. Lines show fits to a Michaelis-Menten Model.

    [0050] FIGS. 12A-12G. Analysis of selective inhibitors of PTP1B. FIG. 12A, Initial rates of pNPP hydrolysis by PTP1B.sub.321, TCPTP.sub.292, and PTP1B.sub.282 in the presence of increasing concentrations of amorphadiene. Lines show fits to models of inhibition. A comparison of the first and second plots (or, more specifically, the IC.sub.50's derived from the plotted data) indicates that amorphadiene is a ˜five-fold more potent inhibitor of PTP1B.sub.321 than TCPTP.sub.292, the most closely related PTP in the human genome (by sequence identity); this selectivity suggests that amorphadiene binds outside of the active site of PTP1B. A comparison of the second and third plots, in turn, indicate that amorphadiene inhibits PTP1B.sub.282 ˜four-fold less potently than PTP1B.sub.321; this discrepancy suggests that the α7 helix, which is present in PTP1B.sub.321 but missing in PTP1B.sub.282 (and which is proximal to a known allosteric binding site of PTP1B), is involved in the PTP1B.sub.321-amorphadiene interaction. FIG. 12B, the chemical structure of amorphadiene. FIG. 12C, a preliminary crystal structure of PTP1B bound to amorphadiene. FIG. 12D, Data used to solve the structure in FIG. 12C shows electron density near the allosteric site of PTP1B (F280 appears on the left of this image); this density is consistent with the structure of amorphadiene. FIG. 12E, the chemical structure of α-bisabolol, a structural analogue of α-bisabolene. FIG. 12F, a preliminary crystal structure of PTP1B bound to α-bisabolol. FIG. 12G, Data used to solve the structure in FIG. 12F shows electron density near the allosteric site of PTP1B (F280 appears in the upper left of this image); this density is consistent with the structure of α-bisabolol.

    [0051] FIG. 13. Optimization of the bacterial-two hybrid (B2H) system. FIG. 13, We optimized the transcriptional response of the B2H system by adjusting the strength of various genetic elements. In three sequential phases, we changed (1) the promoter for Src/CDC37, (2) the ribosome binding site (RBS) for Src/CDC37, and (3) and the RBS for PTP1B. In phases 1 and 2, we used a PTP1B-deficient system with either a wild-type (WT, EPQYEEIPYL (SEQ ID NO:1)) or non-phosphorylatable (Mut, EPQFEEIPYL (SEQ ID NO:2)) substrate domain. Here, “none” indicates that absence of an additional promoter; the labeled “Prol” controls the transcription of all five genes to its left. In phase 3, we used a complete B2H system with either a wild-type (WT) or catalytically inactive (C215S, Mut) variant of PTP1B. The remaining B2H component of each phase are detailed in TABLE 2. Error bars denote standard error with n≥3 biological replicates.

    [0052] FIG. 14. Analysis of different selection conditions. FIG. 14, A comparison of the antibiotic resistance conferred by B2H systems with different RBSs for PTP1B (see TABLE 2 for the remaining components of each system). Images show the growth of E. coli on agar plates (LB) seeded from drops of liquid culture (10 μL) with two biological replicates for each condition. The RBS bb034 confers a greater sensitivity to spectinomycin on agar plates; concentrations of spectinomycin in the liquid culture, by contrast, do not have a strong influence on bacterial growth. Informed by this analysis, we incorporated bb034 into our “optimized” B2H system and ceased adding spectinomycin to liquid culture.

    [0053] FIGS. 15A-15B. FIG. 15A, A GC chromatogram of pure amorphadiene (purchased from Ambeed). FIG. 15B, The mass spectrum of the indicated peak from FIG. 15A.

    [0054] FIGS. 16A-16B. GC/MS analysis of custom-character-humulene production. FIG. 16A, A GC chromatogram shows the production of custom-character-humulene by a strain of E. coli engineered to produce it (i.e., pMBIS+pGHS). FIG. 16B, The mass spectrum of the indicated peak from FIG. 16A.

    [0055] FIGS. 17A-17B. Supplementary FIG. 4|GC/MS analysis of abietadiene production. FIG. 17A, A GC chromatogram shows the production of abietadiene by a strain of E. coli engineered to produce it (i.e., pMBIS+pABS). FIG. 17B, The mass spectrum of the indicated peak from FIG. 17A.

    [0056] FIGS. 18A-18B. GC/MS analysis of taxadiene production. FIG. 18A, A GC chromatogram shows the production of pure taxadiene (a kind gift from Phil Baran). FIG. 18B, The mass spectrum of the indicated peak from FIG. 18A.

    [0057] FIGS. 19A-19B. GC/MS analysis of β-bisabolene production. FIG. 19A, A GC chromatogram shows the production of β-bisabolene by a strain of E. coli engineered to produce it (i.e., pMBIS+pGHS.sub.L450G). FIG. 19B, The mass spectrum of the indicated peak from FIG. 19A.

    [0058] FIG. 20. Standard curve for pNPP assay. This standard curve was generated by dissolving various concentrations of p-nitrophenol (p-NP) in 100 μL water and measuring their absorbance with a plate reader. Absorbance measurements collected in our pNPP kinetics analysis were converted to concentrations using this curve.

    [0059] FIGS. 21A-21E. Development of a bacterial-two hybrid system that links the inhibition of PTP1B to antibiotic resistance. This figure elaborates on FIG. 1 by including the orientation of genes. FIG. 21A, A bacterial two-hybrid (B2H) system in which a phosphorylation-dependent protein-protein interaction modulates transcription of a gene of interest (GOI, black). Major components include (i) a substrate domain fused to the omega subunit of RNA polymerase (yellow), (ii) an SH2 domain fused to the 434 phage cI repressor (light blue), (iii) Src kinase and PTP1B, (iv) an operator for 434cI (dark green), (v) a binding site for RNA polymerase (purple), and (vi) a gene of interest (GOI, black). FIG. 21B, The luminescence generated by a B2H system with a p130cas substrate, LuxAB as the GOI, and no PTP1B. We used an inducible plasmid to increase expression of specific components.

    [0060] FIG. 21C, The luminescence generated by B2H systems with an SH2 domain that exhibits enhanced affinity for phosphopeptides (SH2*), one of four substrate domains, LuxAB as the GOI, and no Src or PTP1B. We used an inducible plasmid to control the expression of Src. Sequences for substrates p130cas (SEQ ID NO: 24), MidT (SEQ ID NO: 25), EGFR (SEQ ID NO: 27), and ShcA (SEQ ID NO: 26) are shown. FIG. 21D, The B2H system from c with either p130cas or MidT substrates. We used a second plasmid to control the expression of Src and an active or inactive (C215) variant of PTP1B. Right: Two optimized single-plasmid systems. FIG. 21E, The final B2H system. Inactivation of PTP1B enabled a strain of E. coli harboring this system to survive at high concentrations of spectinomycin (>250 μg/ml). Error bars in FIGS. 21B-21D denote standard error with n=3 biological replicates.

    [0061] FIGS. 22A-22G. Biosynthesis of PTP1B-inhibiting terpenoids enables cell survival. This figure elaborates on FIGS. 2 and 10. FIG. 22A, The plasmid-borne pathway for terpenoid biosynthesis: (i) pMBIS.sub.CmR, which harbors the mevalonate-dependent isoprenoid pathway of S. cerevisiae, converts mevalonate to isopentyl pyrophosphate (IPP) and farnesyl pyrophosphate (FPP). (ii) pTS, which encodes a terpene synthase (TS) and, when necessary, a geranylgeranyl diphosphate synthase (GGPPS), converts IPP and FPP to sesquiterpenes or diterpenes. FIG. 22B, Five terpene synthases examined in this study: amorphadiene synthase (ADS), γ-humulene synthase (GHS), α-bisabolene synthase (ABA), abietadiene synthase (ABS), and taxadiene synthase (TXS). FIG. 22C, The spectinomycin resistance of strains of E. coli that harbor both (i) the bacterial two-hybrid (B2H) system (ii) a TS-specific terpenoid pathway. Note: ABS*, a positive control, has a constitutively active B2H (i.e., it includes PTP1B.sub.C215S). FIG. 22D, Chromatograms show expected major products (i.e., namesake; *) for each TS-specific strain from c in the presence of the B2H system. Values are normalized to the largest peak within a given sample. FIG. 22E, Initial rates of PTP1B-catalyzed hydrolysis of pNPP in the presence of increasing concentrations of (AD) amorphadiene or (AB) α-bisabolene. Lines show the best-fit kinetic models of inhibition (TABLE 12). FIG. 22F, Estimated IC.sub.50's. FIG. 22G, Titers of the major products generated by ADS and ABA. Error bars denote (FIG. 22E) standard error and (FIG. 22F) 95% confidence intervals for n≥3 independent measurements, and (FIG. 22G) standard deviation for n=3 biological replicates.

    [0062] FIGS. 23A-23H. Biophysical analysis of terpenoid-mediated inhibition. This figure builds on FIG. 12 by including additional kinetic measurements. FIG. 23A. Aligned X-ray crystal structures of PTP1B bound to TCS401, a competitive inhibitor (yellow protein, orange highlights, and green spheres; pdb entry 5k9w), and BBR, an allosteric inhibitor (gray protein, blue highlights, and light blue spheres; pdb entry 1t4j). FIG. 23B, Aligned structures of PTP1B bound to BBR (white protein and light blue ligand) and amorphadiene (cyan protein and dark blue ligand, pdb entry 6W30). FIG. 23C, Dihydroartemisinic acid (DHA), a structural analogue of amorphadiene with a carboxyl group likely to disrupt binding to the hydrophobic cleft. FIG. 23D, DHA is eight-fold less potent than amorphadiene. Lines show the best-fit kinetic models of inhibition (TABLE 12). Error bars denote standard error for n=3 independent measurements with a 95% confidence interval for the IC.sub.50. FIG. 23E, Dixon plot showing V.sub.o.sup.−1 vs. [TCS401] at various concentrations of AD (black, blue, purple markers). The parallel lines indicate that TCS401 and AD cannot bind simultaneously. FIG. 23F, Dixon plot showing V.sub.o.sup.−1 vs. [orthovanadate] at various concentrations of AD (black, blue, purple markers). The intersecting lines indicate that orthovanadate and AD can bind simultaneously. FIG. 23G, Both amorphadiene and α-bisabolene inhibit PTP1B much more potently than TC-PTP; the removal of the α7 helix (or equivalent) from both enzymes reduces the selectivity of AD, but not AB. Error bars show propagated 95% confidence intervals estimated from n≥3 independent measurements at each condition. FIG. 23H, Amorphadiene (930 μM) and α-bisabolene (405 μM) stimulate IR phosphorylation in HEK293T/17 cells; at the same concentrations, dihydroartemisinic acid (DHA) and α-bisabolol (ABOL) exhibit reduced signals consistent with their reduced potencies (#: p<0.05, compared to negative control,*: p<0.05). All inhibitors are dissolved in 3% DMSO (v/v; negative control). Error bars in FIGS. 23D-f denote standard error for n=3-12 biological replicates. Error bars in FIG. 23G denote propagated 95% confidence intervals for n≥3 independent measurements. Error bars in FIG. 23H denote standard error propagated from a buffer-only control (n=3 biological replicates).

    [0063] FIGS. 24A-24E. Analysis of uncharacterized terpene synthase genes. FIG. 24A, A bioinformatic analysis of terpene synthases. We assembled a cladogram of 4,464 members of the largest terpene synthase family (PF03936) and annotated it with functional data. We selected three genes from each of eight clades (curved boxes): six with no characterized genes (i.e., genes with known functions) and two with no characterized genes. FIG. 24B, The spectinomycin resistance conferred by the selected genes alongside pMBIS.sub.CmR and pB2H.sub.opt. Hits with robust growth beyond 400 ug/mL spectinomycin appear in blue. “n.m.” indicates the condition was not measured. FIG. 24C, A0A0C9VSL7 produces (+)-1(10),4-cadinadiene as a dominant product (m/z=204). FIG. 24D, Structure of (+)-1(10),4-cadinadiene. FIG. 24E, The inhibition of PTP1B by (+)-1(10),4-cadinadiene (85% purity, 10% DMSO). Lines show the best-fit kinetic models of inhibition (TABLE 12).

    [0064] FIGS. 25A-25C.| Extension to other disease-related PTPs. FIG. 25A, The spectinomycin resistance of strains harboring B2H systems modified to detect the inactivation of different disease-relevant PTPs. Inactivating mutations.sup.86-88 confer survival at high concentrations of antibiotic. FIG. 25B, A comparison of the resistance conferred by PTP1B- and TC-PTP-specific B2H systems in the presence of metabolic pathways for amorphadiene and α-bisabolene (i.e., pMBIS.sub.CmR+ADS or ABA). The PTP1B-specific system exhibits a prominent survival advantage, a finding consistent with the selectivity of both terpenoids for this enzyme. FIG. 25C, The titers of AD and AB in strains harboring both the B2H systems and associated metabolic pathways are indistinguishable between strains.

    [0065] FIG. 26A-26D. Analysis of the products of different terpene synthases. This figure builds on FIG. 9 by including additional measurements. FIG. 26A, Total terpene titers generated by each TS-specific strain in the absence (red) and presence (blue) of the B2H system. These results indicate that the B2H system does not disrupt terpenoid biosynthesis. FIG. 26B, GC/MS chromatograms of the terpenoids generated by the diterpene synthases in the absence (top) and presence (bottom) of the B2H system (m/z=272). FIG. 26C, GC/MS chromatograms of the terpenoids generated by the sesquiterpene synthases in the absence (top) and presence (bottom) of the B2H system (m/z=204). Similar profiles in FIG. 26B and FIG. 26C indicate that the B2H system does not alter product distributions. FIG. 26D, Analysis of the contributions of either (i) TS activity or (ii) B2H function to the death and survival of GHS, ADS, and ABA strains. Inactivation of GHS does not enhance survival, an indication that this enzyme does not produce growth-inhibiting terpenoids. Inactivation of either ADS, ABA, or the B2H system, by contrast, weakens the antibiotic resistance of the ADS and ABA strains; maximal resistance thus requires both terpenoid production and B2H activation. Labels denote the following controls: D/A, an inactive terpene synthase (contains a D/A mutation at the catalytic aspartic acid, preventing the initial metal-binding step in terpene cyclization); *, a constitutively active B2H (contains PTP1B.sub.C215S, preventing dephosphorylation); X, an inactive B2H (contains a substrate domain with a Y/F mutation, prohibiting phosphorylation and thus binding with the SH2 domain). Images show LB plates seeded with drops of liquid culture (10 μL) from two biological replicates. TABLE 2 details the B2H systems used for these analyses. Error bars in FIG. 26A denote standard deviation for n≥3 biological replicates.

    [0066] FIG. 27. An annotated cladogram of terpene synthases. This cladogram of the PF03936 family is surrounded by a heatmap that shows the presence/absence of known EC numbers of the form 4.2.3.# (which includes terpene cyclization reactions) from the Uniprot database. We selected three genes from each of eight clades: six with no characterized genes (red) and two with characterized genes (blue). TABLE 1 summarizes the genes.

    [0067] FIG. 28. Analysis of selected genes. We searched for sesquiterpene inhibitors of PTP1B by screening each of the 24 uncharacterized genes alongside the FPP pathway (i.e., pMBIS). These pictures show the antibiotic resistance conferred by each gene. We selected strains with antibiotic resistance exceeding 400 μg/ml as hits (blue). Importantly, for these genes, the reduced survival of B2Hx controls indicates that enhanced resistance requires activation of the B2H system. In the top diagrams, n.m. indicates conditions that were not measured.

    [0068] FIG. 29. Product profiles of selected hits. The product profiles of selected hits (extracted ion chromatograms, m/z=204). In brief, we grew up hits (i.e., pB2H.sub.opt, pMBIS.sub.CmR, and pTS) in liquid culture for 72 hours. With the exception of A0A0G2ZSL3, all hits were grown in 10 mL of 2% TB; A0A0G2ZSL3 was grown in a 4-mL culture of 2% TB. Notably, both A0A0C9VSL7 and A0A2H3DKU3 generate one dominant product: (+)-1(10),4-cadinadiene and β-farnesene, respectively. We focused on A0A0C9VSL7 because (+)-1(10),4-cadinadiene is a structural analog of amorphadiene, an inhibitor identified in our initial screen.

    [0069] FIG. 30. Crystallographic analysis of PTP1B bound to AD. Crystal structures of PTP1B collected in the (left) presence or (right) absence of AD. Resolutions: 2.10 Å (PTP1B-AD) and 1.94 Å (PTP1B). We refined these structures by modeling (top) the PTP1B-AD complex or (bottom) the apo form PTP1B. For PTP1B soaked with AD (left), the 1.0 σ 2Fo-Fc electron density supports the modeled position of AD but suggest multiple conformations; this density appears even when AD is excluded from the model. For apo PTP1B (right), the 1.0 σ 2Fo-Fc electron does not support a bound AD molecule; small regions of unexplained density may reflect water molecules or partial occupancy of the α7 helix.sup.15.

    [0070] FIG. 31. Crystallographic analysis of PTP1B bound to ABol. Crystal structures of PTP1B collected in the (left) presence or (right) absence of ABol. Resolutions: 2.11 Å (PTP1B-ABol) and 1.94 Å (PTP1B). We refined these structures by modeling (top) the PTP1B-ABol complex or (middle/bottom) the apo form PTP1B. For PTP1B soaked with ABol (left), the 0.90 σ 2Fo-Fc electron density is consistent with the modeled position of ABol, but it becomes less pronounced when ABol is excluded from the model. The apo form of PTP1B (right) shows similar density for both models; small differences in the shape of the 0.90 σ 2Fo-Fc electron density between datasets suggests that this density may have a different origin (e.g., a ligand vs. partial occupancy of the α7 helix). The unambiguous determination of a binding site for α-bisabolol requires additional data.

    [0071] FIGS. 32A-32C. Evidence of multiple bound conformations. FIG. 32A, Snapshots from molecular dynamics (MD) simulations of PTP1B bound to amorphadiene (AD). Arrows indicate clusters of ligand. FIG. 32B, A crystal structure of PTP1B bound to AD highlights residues that undergo high-frequency contacts. Here, contacts have residue-ligand distances <4 Å, and high frequencies exceed 10% of all snapshots in the MD simulations. FIG. 32C, Estimates of the average root-mean-square deviation (RMSD) of the complete system (PL), the protein (P), the protein core (P.sub.core; residues 1-287), the disordered region of the protein (P.sub.tail; residues 288-321), and the ligand (L) over MD simulations indicate that both AD and the disordered region of the protein are mobile (the latter more so than the former), while the protein core remains fixed. The average RMSDs of both (i) the re-centered ligand (Int), a metric for rotational and vibrational fluctuations, and (ii) the center of mass (COM) of the ligand, a metric for its positional deviation, are large, an indication that the ligand can adopt multiple bound conformations and/or positions.

    [0072] FIGS. 33A-33M. Summary of kinetics analyses. FIG. 33A, Aligned crystal structures of PTP1B (gray, pdb entry 5k9w) and TC-PTP (blue, pdb entry 118k). Highlights on PTP1B: a competitive inhibitor (orange), the α7 helix (red), and truncation points used for kinetic studies (281 and 283, the 281-equivalent of TC-PTP). FIG. 33B, Sequence alignment of the α6/7 regions of PTP1B (SEQ ID NO: 140) and TC-PTP (SEQ ID NO: 141). The truncation points used in our kinetics analysis. FIG. 33C, aligned structures of the binding sites of BBR (gray, pdb entry 1t4j) and amorphadiene (blue). FIG. 33D-FIG. 33M, Initial rates of pNPP hydrolysis by various PTPs in the presence of increasing concentrations of (FIG. 33D-FIG. 33G) amorphadiene, (FIG. 33H-FIG. 33K) α-bisabolene, (FIG. 33L) dihydroartimesinic acid, and (FIG. 33M) α-bisabolol inhibition. In all figures, lines show the best-fit models of inhibition (TABLE 12). Error bars in FIG. 33D-FIG. 33M represent standard error of at least 3 measurements. Error in IC.sub.50's represent 95% confidence intervals determined from fits to models of inhibition (TABLE 12).

    [0073] FIGS. 34A-34D. Expanded analysis of selectivity. FIG. 34A, Initial rate data for AD inhibition of SHP1. The lower panel shows the same data as % inhibition for a subset of points at two different substrate concentrations (open vs. closed circles). FIG. 34B, Initial rate data for AD inhibition of SHP2. The lower panel shows the same data as % inhibition for a subset of points at two different substrate concentrations (open vs. closed circles). FIG. 34C, Initial rate data for AB inhibition of SHP1. The lower panel shows the same data as % inhibition for a subset of points at two different substrate concentrations (open vs. closed circles). FIG. 34D, Initial rate data for AB inhibition of SHP2. The lower panel shows the same data as % inhibition for a subset of points at two different substrate concentrations (open vs. closed circles). In FIG. 34A, FIG. 34C, and FIG. 34D, our inability to measure inhibition >25% (lower panel) at the solubility limit of AD, in combination with the high K.sub.m for 4-methylumbelliferyl phosphate (4-MUP), precluded accurate inhibition model fitting, K.sub.I, and IC.sub.50 determination. However, the weak inhibition observed suggests AD/AB are less potent inhibitors of these enzymes than PTP1B. In all panels, error bars denote standard error of n=3 biological replicates and lines show fit to a noncompetitive inhibition model.

    [0074] FIG. 35A-35C. Analysis of PTP1B-mediated IR dephosphorylation. FIG. 35A, A depiction of insulin signaling in HEK293T/17 cells. Extracellular insulin binds to the transmembrane insulin receptor (IR), triggering phosphorylation of its intracellular domain. PTP1B, which localizes to the endoplasmic reticulum (ER) of mammalian cells, dephosphorylates this domain to regulate downstream signaling pathways. In starved cells, exogenously supplied inhibitors can permeate the cell membrane and inhibit PTP1B-mediated dephosphorylation of the IR. FIG. 35B, A screen of inhibitor concentrations for enzyme-linked immunosorbent assay (ELISAs). An enzyme-linked immunosorbent assay (ELISA) of IR phosphorylation in HEK293T/17 cells incubated with various concentrations of amorphadiene, α-bisabolene, and their structural analogues. We used this screen to identify biologically active concentrations of amorphadiene and α-bisabolene to study further. FIG. 35C, ELISA-based measurements of IR phosphorylation in HEK293T/17 cells incubated with amorphadiene (AD), α-bisabolene (AB), dihydroartimesnic acid (DHA), and α-bisabolol (ABOL). Curves denote fits to the four-parameter logistic equation: y=d+(a−d)/(1+(x/c){circumflex over ( )}b), where y is absorbance at 450 nm, and x is the sample dilution (e.g., 1 denotes no dilution, 0.5 denotes a 2-fold dilution, and so on). These signals indicate that amorphadiene and α-bisabolene can increase IR phosphorylation over a negative control (3% DMSO) and their less inhibitory analogs. Error bars denote standard error with n≥3 biological replicates.

    [0075] FIGS. 36A-36C. Full datasets for B2H-mediated antibiotic resistance. FIG. 36A, Biological replicates for FIG. 22C. FIG. 36B, Biological replicates for FIG. 25A. FIG. 36C, Biological replicates for FIG. 25B. Orange highlights correspond to the data displayed in FIGS. 2C and 5A-5B.

    [0076] FIGS. 37A-37B. GC/MS analysis of α-bisabolene production. FIG. 37A, A GC/MS chromatogram shows the production of α-bisabolene by a strain of E. coli engineered to produce it (i.e., pMBIS+pABA). FIG. 37B, The mass spectrum of the indicated peak from FIG. 37A.

    [0077] FIGS. 38A-38B. Supplementary FIG. 20|GC/MS analysis of (+)-1(10),4-Cadinadiene. FIG. 38A, A GC/MS chromatogram shows the production of (+)-1(10),4-Cadinadiene by a strain of E. coli engineered to produce it (i.e., pMBIS+pA0A0C9VSL7). FIG. 38B, The mass spectrum of the indicated peak from FIG. 38A.

    [0078] FIGS. 39A-39B. A standard curve for p-nitrophenol (p-NP). This figure elaborates on FIG. 20 by including additional measurements. FIG. 39A, We dissolved different amounts of p-nitrophenol (p-NP) in 100 μL buffer (50 mM HEPES, pH=7.3) and measured the absorbance of the resulting solutions with a SpectraMax M2 plate reader. A linear fit to this curve allowed us to convert absorbance measurements taken during kinetic assays (pNPP) to p-NP concentrations. FIG. 39B, We dissolved different amounts of 4-methyl umbelliferone (4-MU) in 100 μL buffer (50 mM HEPES, pH=7.3) and measured the FLUORESCECE of the resulting solutions with a SpectraMax M2 plate reader. A linear fit to this curve allowed us to convert absorbance measurements taken during kinetic assays (4-MUP) to 4-MU concentrations.

    DETAILED DESCRIPTION

    [0079] E. coli is a valuable platform for the production of terpenoids.sup.27-29. The inventors hypothesized that a strain of E. coli programmed to detect the inactivation of a human drug target might enable the rapid discovery and biosynthesis of terpenoids that inhibit that target. To program such a strain, a bacterial two-hybrid (B2H) system was assembled in which a protein tyrosine kinase (PTK) and protein tyrosine phosphatase (PTP) from H. sapiens control gene expression. PTKs are targets of over 30 FDA-approved drugs.sup.30; PTPs lack clinically approved inhibitors but contribute to an enormous number of diseases.sup.31,32. The first proof-of-concept system was specifically designed to detect inhibitors of protein tyrosine phosphatase 1B (PTP1B), an elusive therapeutic target for the treatment of type 2 diabetes, obesity, and breast cancer (FIG. 1A).sup.31-35. In this system, Src kinase phosphorylates a substrate domain, enabling a protein-protein interaction that activates transcription of a gene of interest (GOI). PTP1B dephosphorylates the substrate domain, preventing that interaction, and the inactivation of PTP1B re-enables it. E. coli is a particularly good host for this detection system because its proteome is sufficiently orthogonal to the proteome of H. sapiens to minimize off-target growth defects that can result from the regulatory activities of Src and PTP1B.sup.36.

    [0080] B2H development was carried out in several steps. To begin, a luminescent “base” system was assembled in which Src modulates the binding of a substrate domain to a substrate homology 2 (SH2) domain; this system was based on a previous design in which protein-protein association controls GOI expression.sup.37. The initial system did not yield a phosphorylation-dependent transcriptional response, however, so it was complemented with inducible plasmids—each harboring a different system component—to identify proteins that might exhibit suboptimal activities. Notably, secondary induction of Src increased luminescence, an indication that insufficient substrate phosphorylation depressed GOI expression in the base system (FIG. 1B). Accordingly, this system was modified by swapping in different substrate domains, by adding mutations to the SH2 domain that enhance its affinity for phosphopeptides.sup.38, and by removing the gene for Src. With this configuration, induction of Src from a second plasmid increased luminescence most prominently for the MidT substrate (FIG. 1C); simultaneous induction of both Src and PTP1B, in turn, prevented that increase (FIG. 1D). The MidT system was finalized by integrating genes for Src and PTP1B, by adjusting promoters and ribosome binding sites to amplify its transcriptional response further (FIGS. 1D, 13, and 14), and by adding a gene for spectinomcyin resistance (SpecR) as the GOI. The final plasmid-borne detection system required the inactivation of PTP1B to permit growth at high antibiotic concentrations (FIG. 1E).

    [0081] The B2H system was used to identify new inhibitors of PTP1B by coupling it with metabolic pathways that might generate such molecules in E. coli. Previous screens of plant extracts have identified structurally complex terpenoids that inhibit PTP1B.sup.39; pathways were, thus, constructed for several simpler terpenoid scaffolds that lack established inhibitory effects: amorphadiene, γ-humulene, abietadiene, and taxadiene. Abietadiene is a metabolic precursor to a weak inhibitor of PTP1B.sup.40; the other three terpenoids represent a structurally diverse set of molecules. Each pathway consisted of two plasmid-borne modules (FIG. 2A): (i) the mevalonate-dependent isoprenoid pathway from S. cerevisiae.sup.41 and (ii) a terpene synthase supplemented—when necessary for diterpenoid production—with a geranylgeranyl diphosphate synthase. These modules enabled terpenoid titers of 0.5-100 μM in E. coli (FIG. 9).

    [0082] Each pathway was screened for its ability to produce inhibitors of PTP1B by transforming E. coli with plasmids harboring both the pathway of interest and the B2H system. GC-MS traces confirmed that all pathways generated terpenoids in the presence of the B2H system (FIG. 2D). Surprisingly, the amorphadiene pathway permitted survival at high concentrations of antibiotic; importantly, maximal resistance required a functional B2H system (FIG. 9C). This result suggests that the amorphadiene pathway produces an inhibitor of PTP1B.

    [0083] Microbially-assisted directed evolution (MADE) refers to the approach described herein for using microbial systems to discover and evolve metabolic pathways that produce inhibitors or activators of a therapeutically relevant enzyme target, wherein both the metabolic pathway and the target enzyme exist within a host cell, for example, an E. coli cell (FIG. 3). Some aspects of this approach provide a method for building a genetically encoded system that detects the activity of a target enzyme within a host cell, for example a system that links changes in the activity of a target enzyme to changes in the antibiotic resistance of the host cell (FIG. 1).

    [0084] Previous work demonstrated (i) the assembly of a detection system that links the activities of a protein kinase and a protein phosphatase to antibiotic resistance (FIG. 1) and (ii) the use of that system, in combination with MADE, to discover inhibitors of a protein phosphatase (FIG. 2). These results are detailed in PCT/US2019/40896.

    [0085] Described herein are strategies, systems, methods, and reagents to expand the scope of capabilities of MADE and to address the needs of previously described evolution experiments. The MADE methods herein utilize one or more of the following: 1) target enzymes that post-translationally modify proteins (PTM enzymes) in a manner other than adding or removing a phosphate group; 2) a metabolic pathway that generates phenylpropanoids or nonribosomal peptides; 3) a cryptic gene cluster that encodes putative natural products; and 4) natural products with specific inhibitory effects.

    [0086] In some embodiments, provided are methods for using MADE to discover and evolve metabolic pathways that produce inhibitors or activators of PTM enzymes (FIG. 3), wherein said PTM enzymes modulate a protein-protein interaction that controls a detectable output, wherein both the PTM enzymes and the detectable output are encoded by at least one plasmid or one genome, wherein a metabolic pathway that produces natural products is encoded by at least one plasmid or one genome, and wherein said plasmids and genomes exist within the same host cell. In some embodiments, a pool of said host cells, each of which contains a different metabolic pathway, is screened for a detectable output, and the cells that yield the highest detectable output are selected as hits. These hits are analyzed with the following steps: 1) their metabolic pathways are reassembled from a starting pathway; 2) the reassembled pathways are re-screened in host cells (a confirmation step); 3) the cells that yield the highest detectable outputs are, once again, selected as hits; 4) these selected cells are grown in liquid culture; 5) the products generated in said liquid culture are identified and quantified with standard analytical methods, for example, gas chromatography-mass spectrometry (GC/MS); 6) the products generated in liquid culture are concentrated with a rotary evaporator; and 7) the modulatory effects of the concentrated products are tested on purified PTM enzymes (FIG. 3).

    [0087] In some embodiments, the target PTM enzyme naturally inhibits the growth of a host cell, for example, an S. cerevisiae cell in which a heterologously expressed kinase slows cell growth.

    [0088] In some embodiments, the PTM enzymes are ubiquitin ligases, SUMO transferases, methyltransferases, demethylases, acetyltransferases, glycosyltransferases, palmitoyltransferases, and/or related hydrolases. In some embodiments, a bacterial two-hybrid (B2H) system links the activity of one or more PTM enzymes to the transcription of a gene of interest (GOI; FIG. 4A). In some embodiments, the PTM enzymes modulate the assembly of a split protein, for example, a fluorescent protein, a luciferase, or an enzyme that confers antibiotic resistance (FIG. 4B). In some embodiments, the target enzymes covalently link or proteolyze two proteins, wherein the assembly of these proteins activates the transcription of a gene of interest (FIG. 4C) or reassembles a split protein (FIG. 4D).

    [0089] In some embodiments, provided are methods for the discovery and evolution of phenylpropanoids or nonribosomal peptides that inhibit or activate a target enzyme, wherein a metabolic pathway that produces phenylpropanoids or nonribosomal peptides is encoded by at least one plasmid or one genome (FIG. 5), wherein said plasmid and said genome exist within a host cell, wherein mutagenesis and/or modulation of said metabolic pathways permit the production of an inhibitor or activator of the target enzyme, and wherein MADE enables the identification of pathways thus mutated and/or reconfigured.

    [0090] In some embodiments, provided are methods for the discovery and evolution of cryptic metabolic pathways that generate inhibitors or activators of a target enzyme, wherein said cryptic metabolic pathways comprise a set of genes with unknown or poorly characterized products, or wherein said cryptic metabolic pathways comprise a set of genes in which one gene hinders the biosynthesis of an important product, wherein subsequent mutagenesis and/or reconfiguration of said pathway causes it to generate more of that product, and wherein MADE enables the discovery of a pathway thus mutated and/or reconfigured. For example, the removal of a biosynthetic gene may enable the accumulation of a metabolic intermediate that modulates the activity of a target enzyme (FIG. 6A); alternatively, the removal of a gene for a transcriptional repressor may permit the activation of the entire metabolic pathway (FIG. 6B).

    [0091] In some embodiments, provided are methods for the discovery and evolution of metabolic pathways with higher titers and/or lower toxicities, wherein starting pathways are mutated and/or reconfigured to create a library of pathways, and said library of pathways is screened using MADE to identify pathways that (i) produce higher quantities of inhibitor or activator than the starting pathway and/or (ii) exhibit a lower toxicity than the starting pathway (FIG. 7). For example, mutagenized and/or reconfigured pathways may contain genes for a mutant enzyme, for example, a terpene synthase, that exhibits a higher activity than the wild-type enzyme; alternatively, mutagenized and/or reconfigured pathways may contain genes for a mutant terpene synthase that is more soluble or otherwise less toxic than a wild-type enzyme.

    [0092] Some aspects of this disclosure provide molecules that inhibit protein tyrosine phosphatases (PTPs), for example, protein tyrosine phosphatase 1B (PTP1B; FIGS. 9 and 10). Examples include amorphadiene and derivatives, taxadiene and derivatives, β-bisabolene and derivatives, α-bisabolene and derivatives, and α-longipinene and derivatives. In some embodiments, these molecules are provided as drugs or drug leads for the treatment of diseases to which PTPs contribute, for example, type 2 diabetes.sup.42, HER2-positive breast cancer.sup.43, or Rett syndrome.sup.44, as are methods of treatment of such diseases by administering an effective amount of the molecule(s) to a subject in need of such treatment.

    [0093] Also provided are compositions or systems that include a population of host cells that comprise a protein of interest and a population of expression vectors comprising different metabolic pathways, wherein a cell or subset of the population of host cells produce a detectable output when the metabolic pathway produces a product that modulates the protein of interest, and optionally wherein the expression vectors yield detectable outputs higher than the output of a reference vector that harbors a reference pathway, for example, a vector that encodes a pathway that does not produce molecules with concentrations and/or potencies sufficient to modulate the activity of a protein of interest, in the cell or the subset of the population of host cells.

    [0094] In some embodiments, the host cells comprise a genetically encoded system in which the activity of a protein of interest controls the assembly of a protein complex with an activity that is not possessed by either of two or more components of the complex and, thus, yields a detectable output in proportion to the amount of complex formed. In some embodiments, the protein of interest is an enzyme that adds a post-translational modification that causes two proteins, which are initially dissociated, to be covalently linked or to form a noncovalent complex. In some embodiments, the complex is formed by two proteins with a dissociation constant (K.sub.d) less than or equal to the K.sub.d of the complexes formed between SH2 domains and their phosphorylated substrates.

    [0095] In some embodiments, the metabolic pathways encoded by the expression vectors produce phenylpropanoids or nonribosomal peptides. In some embodiments, the expression vectors comprising different metabolic pathways comprise a library of pathways generated by mutating one or more genes within a starting metabolic pathway. In some embodiments, one or more of the metabolic pathways comprises a set of genes of unknown biosynthetic capability.

    [0096] In some embodiments, one or more of the metabolic pathways that produces a detectable output higher than the output of the reference pathway produces a product that differs from the products of other metabolic pathways. In some embodiments, one or more of the metabolic pathways that produces a detectable output higher than the output of the reference pathway produces a larger quantity of a product than the quantity of product generated by other metabolic pathways. In some embodiments, one or more of the metabolic pathways that produces a detectable output higher than the output of the reference pathway exhibits a lower cellular toxicity than other metabolic pathways.

    [0097] In some embodiments, the protein of interest is a ubiquitin ligase, a SUMO transferase, a methyltransferase, a demethylase, an acetyltransferase, a glycosyltransferase, a palmitoyltransferase, or a related hydrolase.

    [0098] Also provided herein are kits that include a population of expression vectors as described herein. In some embodiments, the kits also include the population of host cells that comprise a protein of interest as described herein.

    [0099] The summary above is meant to illustrate, in a non-limiting manner, some of the embodiments, advantages, features, and uses of the technology described herein. Other embodiments, advantages, features, and uses of the technology disclosed herein will be apparent from the Detailed Description, Drawings, Examples, and Claims.

    Definitions

    [0100] The term “metabolic pathway,” as used herein, refers to a collection of genes that enable the synthesis of metabolite.

    [0101] The term “metabolite,” as used herein, refers to an organic molecule assembled within a living system.

    [0102] The term “small molecule,” as used herein, refers to a molecule with a molecular weight less than 900 daltons.

    [0103] The term “phenylpropanoids,” as used herein, refers to an organic compound synthesized from the amino acids phenylalanine and/or tyrosine.

    [0104] The term “nonribosomal peptide,” as used herein, refers to peptides synthesized without messenger RNA. For example, peptides synthesized from nonribosomal peptide synthases.

    [0105] The term “modulator,” as used herein, refers to a molecule, peptide, protein, polynucleotide, or entity that changes the activity of another molecule, peptide, protein, polynucleotide, or entity.

    [0106] The term “inhibitor,” as used herein, refers to a small molecule that reduces the activity of an enzyme.

    [0107] The term “activator,” as used herein, refers to a small molecule that increases the activity of an enzyme.

    [0108] The term “natural product,” as used herein, refers to a chemical compound or substance produced by a living organism.

    [0109] The term “detection system,” as used herein, refers to a system that links the activity of a target enzyme to a detectable output.

    [0110] The term “bacterial two-hybrid (B2H) system,” as used herein, refers to a genetically encoded system that links a protein-protein interaction to a detectable output.

    [0111] The term “detectable output,” as used herein, refers to an output that can be detected with standard analytical instrumentation. Examples include fluorescence, luminescence, antibiotic resistance, or microbial growth.

    [0112] The term “split protein,” as used herein, refers to a protein that exists as two separate halves, which, upon reassembly, restore the function of the protein.

    [0113] The term “substrate domain,” as used herein, refers to a protein that includes a peptide fragment or protein component acted upon by a protein of interest. For example, a substrate domain may include the peptide fragment of a receptor protein targeted by a kinase or phosphatase of interest.

    [0114] The term “vector,” as used herein, refers to a deoxyribonucleic acid (DNA) molecule used as a vehicle to artificially carry foreign genetic material into a cell.

    [0115] The term “host cell,” as used herein, refers to a cell that can host the genetically encoded systems, on vectors or genomes, necessary for MADE. For example, as host cell may contain plasmids that encode both (i) a genetically encoded detection system that links the activity of a target enzyme to a detectable output and (ii) a metabolic pathway capable of synthesizing molecules that might or might not inhibit said target enzyme.

    EXAMPLES

    Example 1

    [0116] In previous work, a strain of E. coli was generated with two genetically encoded modules—a B2H system that links the inhibition of PTP1B to the expression of a gene for antibiotic resistance, and a metabolic pathway for the production of amorphadiene—exhibited greater antibiotic resistance that similar strains with different metabolic pathways (FIG. 2). In recent work, this result was explored further. First, it was shown that maximal resistance required both an active amorphadiene synthase (ADS) and a functional B2H system (FIG. 9). Second, the inhibitory effect of amorphadiene, the dominant product of ADS, was confirmed by measuring its influence on PTP1B-catalyzed hydrolysis of p-nitrophenyl phosphate (pNPP; FIG. 10C). Initial rates exhibited a saturation behavior characteristic of noncompetitive or uncompetitive inhibition; most importantly, the IC.sub.50 for amorphadiene was ˜53 μM, a concentration lower than the 72 μM generated in liquid culture. For comparison, the IC.sub.50 for taxadiene was 119 μM, a concentration far lower than its titer in liquid culture. Results of the in vitro studies thus indicate that amorphadiene confers antibiotic resistance by inhibiting PTP1B. Finally, an enzyme-linked immunosorbent assay (ELISA) was used to demonstrate the ability of amorphadiene to inhibit PTP1B inside of a HEK293T/17 cell (FIG. 10D-10E).

    [0117] The microbial system provides an interesting opportunity to explore how metabolic pathways evolve to generate functional molecules. To look for evolutionarily accessible changes in the activities ADS and GHS that improve their ability to generate inhibitors of PTP1B, mutants of both enzymes were prepared. For ADS, error-prone PCR and site-saturation mutagenesis of poorly conserved residues was used; for GHS, site-saturation mutagenesis of the wild-type enzyme was paired with a screen of several previously developed mutants with distinct product profiles.sup.47 (FIGS. 7A, 7B). At least one mutant from each library consistently conferred survival at higher antibiotic concentrations than the wild-type enzyme (FIG. 7C, 7D).

    [0118] The G34S/K51N mutant of ADS, which improved antibiotic resistance more than other mutants, is particularly intriguing because its mutated residues are located outside of the active site and alter neither product profile nor titer (FIG. 7E, 7F). It was hypothesized that these mutations might reduce a minor growth deficiency caused by heterologous ADS expression (e.g., they might reduce the formation of inclusion bodies). To test this hypothesis, the survival conferred by wild-type and mutant strains in the presence of an inactive B2H system was compared; the mutant strain showed more robust growth at high concentrations of antibiotic (FIG. 7G). These results suggest that the engineered strain can select for less toxic enzyme mutants which, in the presence of other stresses, might improve production of inhibitory metabolites.

    [0119] Intriguingly, the mutants of GHS that conferred enhanced antibiotic resistance (relative to the wild-type enzyme) altered product profile and/or titer (FIGS. 7H and 7I). Two examples include GHS.sub.A336C/T445C/S484C/I562L/M565L (or ALP), which primarily generates α-longipinene, and GHS.sub.A319Q, which enhances terpenoid titer by ˜tenfold. The GHS mutants thus indicate that the engineered strain can select for enzyme mutants that generate different products and/or higher titers than a starting wild-type enzyme.

    [0120] To expand the study, the survival conferred by terpene synthases that primarily generate β-bisabolene and α-bisabolene was also examined. Both of these enzymes enhanced antibiotic resistance; strikingly, kinetic studies of α-bisabolene purified from culture supernatant indicate that this molecule is particularly potent (i.e., IC.sub.50˜20 μM in 10% DMSO; FIG. 11).

    [0121] The results of the analyses of terpene synthases suggest that amorphadiene and derivatives, taxadiene and derivatives, α-longipinene and derivatives, β-bisabolene and derivatives, and α-bisabolene and derivatives, and may provide an important source of pharmaceutically relevant PTP inhibitors.

    Methods

    [0122] Bacterial strains. E. coli DH10B, chemically competent NEB Turbo, or electrocompetent One Shot Top10 (Invitrogen) were used to carry out molecular cloning and to perform preliminary analyses of terpenoid production; E. coli BL2-DE31 were used to express proteins for in vitro studies; and E. coli s1030.sup.48 were used for luminescence studies and for all experiments involving terpenoid-mediated growth (i.e., evolution studies).

    [0123] For all strains, chemically competent cells were generated by carrying out the following steps: (i) each strain was plated on LB agar plates with the required antibiotics. (ii) One colony of each strain was used to inoculate 1 mL of LB media (25 g/L LB with appropriate antibiotics listed in TABLE 2) in a glass culture tube, and this culture was grew overnight (37° C., 225 RPM). (iii) The 1-mL culture was used to inoculate 100-300 mL of LB media (as above) in a glass shake flask, and this culture was grown for several hours (37° C., 225 RPM). (iv) When the culture reached an OD of 0.3-0.6, the cells were centrifuged (4,000×g for 10 minutes at 4° C.), the supernatant was removed, and the cells were resuspended in 30 mL of ice cold TFB1 buffer (30 mM potassium acetate, 10 mM CaCl.sub.2, 50 mM MnCl.sub.2, 100 mM RbCl, 15% v/v glycerol, water to 200 mL, pH=5.8, sterile filtered), and the suspension was incubated at 4° C. for 90 min. (v) Step iv was repeated, but resuspended in 4 mL of ice cold TFB2 buffer (10 mM MOPS, 75 mM CaCl.sub.2, 10 mM RbCl.sub.2, 15% glycerol, water to 50 mL, pH=6.5, sterile filtered). (iv) The final suspension as split into 100 aliquots and frozen at −80° C. until further use.

    [0124] Electrocompetent cells were generated by following an approach similar to the one above. In step iv, however, the cells were resuspended in 50 mL of ice cold MilliQ water and repeated this step twice—first with 50 mL of 20% sterile glycerol (ice cold) and, then, with 1 mL of 20% sterile glycerol (ice cold). The pellets were frozen as before.

    Materials. Methyl abietate was purchased from Santa Cruz Biotechnology; trans-caryophyllene, farnesol, tris(2-carboxyethyl)phosphine (TCEP), bovine serum albumin (BSA), M9 minimal salts, phenylmethylsulfonyl fluoride (PMSF), and DMSO (dimethyl sulfoxide) were purchased from Millipore Sigma; glycerol, bacterial protein extraction reagent II (B-PERII), and lysozyme from were purchased VWR; cloning reagents were purchased from New England Biolabs; amorphadiene was purchased from Ambeed, Inc.; and all other reagents (e.g., antibiotics and media components) were purchased from Thermo Fisher. Taxadiene was a kind gift from Phil Baran of the The Scripps Research Institute. Mevalonate was prepared by mixing 1 volume of 2 M DL-mevalanolactone with 1.05 volumes of 2 M KOH and incubating this mixture at 37° C. for 30 minutes.
    Cloning and molecular biology. All plasmids were constructed by using standard methods (i.e., restriction digest and ligation, Golden Gate and Gibson assembly, Quikchange mutagenesis, and circular polymerase extension cloning). TABLE 1 describes the source of each gene; TABLES 2 and 3 describe the composition of all final plasmids.

    [0125] Construction of the B2H system was begun by integrating the gene for HA4-rpoZ from pAB094a into pAB078d and by replacing the ampicillin resistance marker of pAB078d with a kanamycin resistance marker (Gibson Assembly). The resulting “combined” plasmid was modified, in turn, by replacing the HA4 and SH2 domains with kinase substrate and substrate recognition (i.e., SH2) domains, respectively (Gibson assembly), and by integrating genes for Src kinase, CDC37, and PTP1B in various combinations (Gibson assembly). The functional B2H system was finalized by modifying the SH2 domain with several mutations known to enhance its affinity for phosphopeptides (K15L, T8V, and C10A, numbered as in Kaneko et. al..sup.40), by exchanging the GOI for luminescence (LuxAB) with one for spectinomycin resistance (SpecR), and by toggling promoters and ribosome binding sites to enhance the transcriptional response (Gibson assembly and Quickchange Mutagenesis, Agilent Inc.). Note: For the last step, Prol to ProD was also converted by using the Quikchange protocol. When necessary, plasmids with arabinose-inducible components were constructed by cloning a single component from the B2H system into pBAD (Golden Gate assembly). TABLES 4 and 5 list the primers and DNA fragments used to construct each plasmid.

    [0126] Pathways for terpenoid biosynthesis were assembled by purchasing plasmids encoding the first module (pMBIS) and sesquiterpene synthases (ADS or GHS in pTRC99a) from Addgene, and by building the remaining plasmids. Genes for ABS, TXS, and GGPPS were integrated into pTRC99t (i.e., pTRC99a without BsaI sites), and a version of pADS was modified by adding a gene for P450.sub.BM3 with three mutations that enable the epoxidation of amorphadiene (F87A, R47L, and Y51F; P450G3; Gibson Assembly and Quickchange Mutagenesis).sup.49. TABLE 6 lists the primers and DNA fragments used to construct each plasmid.

    Luminescence assays. Preliminary B2H systems (which contained LuxAB as the GOI) were characterized with luminescence assays. In brief, necessary plasmids were transformed into E. coli s1030 (TABLE 2), the transformed cells were plated onto LB agar plates (20 g/L agar, 10 g/L tryptone, 10 g/L sodium chloride, and 5 g/L yeast extract with antibiotics described in TABLE 2), and all plates were incubated overnight at 37° C. Individual colonies were used to inoculate 1 ml of terrific both (TB at 2%, or 12 g/L tryptone, 24 g/L yeast extract, 12 mL/L 100% glycerol, 2.28 g/L KH.sub.2PO.sub.4, 12.53 g/L K.sub.2HPO.sub.4, pH=7.0, and antibiotics described in TABLE 2), and we incubated these cultures overnight (37° C. and 225 RPM). The following morning, each culture was diluted by 100-fold into 1 ml of TB media (above), and these cultures were incubated in individual wells of a deep 96-well plate for 5.5 hours (37° C., 225 RPM). (Note: When pBAD was present, the TB media was supplemented with 0-0.02 w/v % arabinose). An amount of 100 μL of each culture was transferred into a single well of a standard 96-well plate and measured both OD.sub.600 and luminescence (gain: 135, integration time: 1 second, read height: 1 mm) on a Biotek Synergy plate reader. Analogous measurements of cell-free media were performed to measure background signals, which were subtracted from each measurement prior to calculating OD-normalized luminescence (i.e., Lum/OD.sub.600).
    Analysis of antibiotic resistance. The spectinomycin resistance conferred by various B2H systems in the absence of terpenoid pathways was evaluated by carrying out the following steps: (i) E. coli were transformed with the necessary plasmids (TABLE 2) and the transformed cells were plated onto LB agar plates (20 g/L agar, 10 g/L tryptone, 10 g/L sodium chloride, 5 g/L yeast extract, 50 μg/ml kanamycin, 10 μg/ml tetracycline). (ii) Individual colonies were used to inoculate 1-2 ml of TB media (12 g/L tryptone, 24 g/L yeast extract, 12 mL/L 100% glycerol, 2.28 g/L KH.sub.2PO.sub.4, 12.53 g/L K.sub.2HPO.sub.4, 50 μg/ml kanamycin, 10 μg/ml tetracycline, pH=7.0), and these cultures were incubated overnight (37° C., 225 RPM). In the morning, each culture was diluted by 100-fold into 4 ml of TB media (as above) with 0-500 μg/ml spectinomycin (spectinomycin was used only for the results depicted in FIG. 14), and these cultures were incubated in deep 24-well plates until wells containing 0 μg/ml spectinomycin reached an OD.sub.600 of 0.9-1.1. (iv) Each 4-ml culture was diluted by 10-fold into TB media with no antibiotics and plated 10-μL drops of the diluent onto agar plates with various concentrations of spectinomycin. (v) Plates were incubated overnight (37° C.) and photographed the following day.

    [0127] To examine terpenoid-mediated resistance, steps i and ii were performed as described above with the addition of 34 μg/ml chloramphenicol and 50 μg/ml carbenicillin in all liquid/solid media. The experiment then proceeded with the following steps: (iii) Samples were diluted from 1-ml cultures to an OD.sub.600 of 0.05 in 4.5 ml of TB media (supplemented with 12 g/L tryptone, 24 g/L yeast extract, 12 mL/L 100% glycerol, 2.28 g/L KH.sub.2PO.sub.4, 12.53 g/L K.sub.2HPO.sub.4, 50 μg/ml kanamycin, 10 μg/ml tetracycline, 34 μg/ml chloramphenicol, and 50 μg/ml carbenicillin), which were incubated in deep 24-well plates (37° C., 225 RPM). (iv) At an OD.sub.600 of 0.3-0.6, 4 ml of each culture was transferred to a new well of a deep 24-well plate, 500 μM isopropyl β-D-1-thiogalactopyranoside (IPTG) and 20 mM of mevalonate was added, and incubated for 20 hours (22° C., 225 RPM). (v) Each 4-ml culture was diluted to an OD.sub.600 of 0.1 with TB media and plated 10 μL of the diluent onto either LB or TB plates supplemented with 500 μM IPTG, 20 mM mevalonate, 50 μg/ml kanamycin, 10 μg/ml tetracycline, 34 μg/ml chloramphenicol, 50 μg/ml carbenicillin, and 0-1200 μg/ml spectinomycin (for both plates, 20 g/L agar was used with media and buffer components described above). Note: to control the range of antibiotic resistance, LB plates were used for ADS and its mutants, and TB plates, which improve terpenoid titers, were used for GHS and its mutants. (iv) All plates were incubated at 30° C. and photographed after 2 days.

    Terpenoid biosynthesis. E. coli were prepared for terpenoid production by transforming cells with plasmids harboring requisite pathway components (TABLE 2) and plating them onto LB agar plates (20 g/L agar, 10 g/L tryptone, 10 g/L sodium chloride, and 5 g/L yeast extract with antibiotics described in TABLE 2). One colony from each strain was used to inoculate 2 ml TB (12 g/L tryptone, 24 g/L yeast extract, 12 mL/L 100% glycerol, 2.28 g/L KH.sub.2PO.sub.4, 12.53 g/L K.sub.2HPO.sub.4, pH=7.0, and antibiotics described in TABLE 2) in a glass culture tube for ˜16 hours (37° C. and 225 RPM). These cultures were diluted by 75-fold into 10 ml of TB media and the new cultures were incubated in 125 mL glass shake flasks (37° C. and 225 RPM). At an OD.sub.600 of 0.3-0.6, 500 μM IPTG and 20 mM mevalonate were added. After 72-88 hours of growth (22° C. and 225 RPM), terpenoids were extracted from each culture.

    [0128] To measure terpenoid production over time, the approach described above was used with the following modifications: (i) Overnight cultures were diluted with 1:75 mL in 4.5 mL TB supplemented with antibiotics in a glass culture tube. (ii) When cultures reached an OD.sub.600 of 0.3-0.6, 4 mL of each culture were moved to a new culture tube and 500 μM IPTG, 20 mM mevalonate, 0-800 μg/mL spectinomycin, and 1 mL dodecane were added (to extract terpenoids). Every 4 hours, 100 μL of the dodecane sample was removed for GC/MS analysis.

    Protein expression and purification. PTPs were expressed and purified as described previously.sup.42. Briefly, E. coli BL21(DE3) cells were transformed with pET21b vectors, and induced with 500 μM IPTG at 22° C. for 20 hours. PTPs were purified from cell lysate by using desalting, nickel affinity, and anion exchange chromatography (HiPrep 26/10, HisTrap HP, and HiPrep Q HP, respectively; GE Healthcare). The final protein (30-50 μM) was stored in HEPES buffer (50 mM, pH 7.5, 0.5 mM TCEP) in 20% glycerol at −80° C.
    Extraction and purification of terpenoids. Hexane was used to extract terpenoids generated in liquid culture. For 10-mL cultures, 14 mL of hexane was added to 10 ml of culture broth in 125-mL glass shake flasks, the mixture (100 RPM) shaken for 30 minutes, centrifuged (4000×g), and 10 mL of the hexane layer was withdrawn for further analysis. For 4-mL cultures, 600 μL hexane were added to 1 mL of culture broth in a microcentrifuge tube, the tubes were vortexed for 3 minutes, the tubes were centrifuged for 1 minute (17000×g), and 300-400 μL of the hexane layer was saved for further analysis.

    [0129] To purify amorphadiene, 500-1000 mL culture broth was supplemented with hexane (16.7% v/v), the mixture was shaken for 30 minutes (100 RPM), the hexane layer was isolated with a separatory funnel, the isolated organic phase was centrifuged (4000×g), and the hexane layer withdrawn. To concentrate the terpenoid products, excess hexane was evaporated in a rotary evaporator to bring the final volume to 500 μL, and the resulting mixture was passed over a silica gel one or two times (Sigma-Aldrich; high purity grade, 60 Å pore size, 230-400 mesh particle size)). Elution fractions (100% hexane) were analyzed on the GC/MS and pooled fractions with the compound of interest (amorphadiene). Once purified, pooled fractions were dried under a gentle stream of air, the terpenoid solids were resuspended in DMSO, and the final samples were quantified as outlined below.

    GC-MS analysis of terpenoids. Terpenoids generated in liquid culture were measured with a gas chromatograph/mass spectrometer (GC-MS; a Trace 1310 GC fitted with a TG5-SilMS column and an ISQ 7000 MS; Thermo Fisher Scientific). All samples were prepared in hexane (directly or through a 1:100 dilution of DMSO) with 20 μg/ml of caryophyllene or methyl abietate as an internal standard. When the peak area of an internal standard exceeded ±30% of the average area in hexane samples containing only standard, the corresponding samples were re-analyzed. For all runs, the following GC method was used: hold at 80° C. (3 min), increase to 250° C. (15° C./min), hold at 250° C. (6 min), increase to 280° C. (30° C./min), and hold at 280° C. (3 min). To identify various analytes, m/z ratios were scanned from 50 to 550.

    [0130] Sesquiterpenes generated by variants of ADS were examined by using select ion mode (SIM) to scan for the molecular ion (m/z=204). For quantification, we used Eq. 1:

    [00001] C i = C std * A i A std * R ( Eq . 1 ) R = A std , o / C std , o A ref , o / C ref , o ( Eq . 2 )

    [0131] where A.sub.i is the area of the peak produced by analyte i, A.sub.std is the area of the peak produced by C.sub.std of caryophyllene in the sample, and R is the ratio of response factors for caryophyllene and amorphadiene in a reference sample.

    [0132] Sesquiterpenes generated by variants of GHS were quantified by using the aforementioned procedure with several modifications: Methyl abietate was used as an internal standard (several mutants of GHS generate caryophyllene as a product); both m/z=204 and m/z=121, a common ion between sesquiterpenes and methyl abietate were scanned for; a ratio of response factors for amorphadiene and methyl abietate at m/z=121 for R was used; and peak areas were calculated at m/z=121. For all analyses, the analysis was focused on peaks with areas that exceeded 1% of the total area of all peaks at m/z=204.

    [0133] Diterpenoids were quantified by, once again, accompanying the general procedure with several modifications: A different molecular ion (m/z=272) and an ion common to both diterpenoids and caryophyllene (m/z=93) was scanned for; a ratio of response factors for pure taxadiene (a kind gift from Phil Baran) and caryophyllene at m/z=93 was used; and peak areas m/z=93 were calculated. For all analyses, only peaks with areas that exceeded 1% of the total area of all peaks at m/z=272 were examined.

    [0134] Molecules were identified by using the NIST MS library and, when necessary, this identification was confirmed with analytical standards or mass spectra reported in the literature. Note: The assumption of a constant response factor for different terpenoids (e.g., all sesquiterpenes and diterpenes ionize like amorphadiene and taxadiene, respectively) can certainly yield error in estimates of their concentrations; the analyses described herein, which are consistent with those of other studies of terpenoid production in microbial systems.sup.50,51, thus supply rough estimates of concentrations for all compounds except amorphadiene and taxadiene (which had analytical standards).

    Homology modeling of ADS and GHS. Homology models of ADS and GHS were constructed by using SWISS-MODEL with structures for α-bisabolol synthase (pdb entry 4gax) and α-bisabolene synthase (pdb entry 3sae) as templates, respectively.sup.52. This software package uses ProMod3 to build models from a target-template alignment, which preserves the structures of conserved regions and remodels insertions and deletions with a fragment library.sup.53,54.
    Preparation of mutant libraries. Libraries of enzyme mutants were prepared by using site-saturation mutagenesis (SSM) and error-prone PCR (ePCR). For SSM, the following steps were performed: (i) Genes were amplified with NNK primers that targeted select sites. (ii) The amplified genes were digested with DpnI, purified with gel electrophoresis, and either Gibson Assembly or circular polymerase extension cloning (CPEC).sup.55 was used to integrate them into plasmids (pTS.sub.xx). (iii) Heat shock was used to transform the fully assembled plasmids into chemically competent NEB Turbo cells. (iv) Library size was determined by plating dilutions of the transformation reactions on several LB agar plates (20 g/L agar, 10 g/L tryptone, 10 g/L sodium chloride, 5 g/L yeast extract, 50 μg/ml carbenicillin), and all remaining cells were plated over 9-10 plates for subsequent analysis. (v) Colonies were sequenced to verify that at least 5 of 6 transformants contained mutated genes. (vi) Plates were scraped into LB media (25 g/L LB broth mix, no antibiotics) and the final transformants were miniprepped to recover the DNA Library. (vii) All final libraries were frozen in MilliQ water at −20° C.

    [0135] For ePCR, the Genemorph II kit (Agilent) was used with ˜0.5-2.5 mutations/kb. The final plasmids were dialyzed and electroporated into One Shot electrocompetent Top 10 cells, and the final plasmids were sequenced, extracted, and stored as described above.

    Analysis of mutant libraries. Each mutant library was screened by carrying out the following steps: (i) 100 ng of each site-specific SSM library for a given terpene synthase was pooled. (ii) Each complete library (i.e., ePCR or pooled SSM) was dialyzed for 2 hours. (iii) Up to 10 μL (<1 μg) of each library was electroporated into a strain of E. coli harboring both the pMBIS pathway and the B2H system. (iv) 1 mL of SOC was added to the transformed cells and incubated for 1 hour (37° C. and 225 RPM). (v) 100 μL of the SOC outgrowth was serial diluted and plated onto LB agar plates (20 g/L agar, 10 g/L tryptone, 10 g/L sodium chloride, 5 g/L yeast extract, 50 μg/ml carbenicillin, 10 μg/ml tetracycline, 50 μg/ml kanamycin, and 34 μg/ml chloramphenicol) and the plates were incubated overnight (37° C.). This step allowed for quantification of the number of transformants screened (i.e., a number determined by counting colonies). (vi) The remaining 900 μL of transformed cells was added to 100 mL of TB (12 g/L tryptone, 24 g/L yeast extract, 12 mL/L 100% glycerol, 2.28 g/L KH.sub.2PO.sub.4, 12.53 g/L K.sub.2HPO.sub.4, 50 μg/ml carbenicillin, 10 μg/ml tetracycline, 34 μg/ml chloramphenicol, 50 μg/ml kanamaycin, pH=7.0) in 500-mL Erlenmeyer flasks, and these flasks were incubated overnight (37° C. and 225 RPM). (vii) In the morning, an aliquot of each culture was diluted to an OD.sub.600 of 0.05 in 4 mL of TB and incubated in glass culture tubes (37° C. and 225 RPM). (viii) At an OD.sub.600 of 0.3-0.6, terpenoid production was induced by adding 5-20 mM mevalonate and 500 μM IPTG, and the resulting cultures were incubated for 20 hours (22° C. and 225 RPM). (ix) Each culture was diluted to an OD.sub.600 of 0.001 and 100 μL of diluent was plated onto agar plates containing 500 μM IPTG, 5-20 mM mevalonate, 50 μg/ml kanamycin, 10 μg/ml tetracycline, 34 μg/ml chloramphenicol, 50 μg/ml carbenicillin, and 0-1000 μg/ml spectinomycin. (x) Colonies that survived high concentrations of spectinomycin were used to inoculate 4 mL of LB media (25 g/L LB broth mix, 50 μg/ml carbenicillin, 10 μg/ml tetracycline, 34 μg/ml chloramphenicol, 50 μg/ml kanamaycin, which was incubated overnight (37° C., 225 RPM). (xi) Plasmid DNA was extracted from the overnight culture for Sanger sequencing.

    [0136] The influence of interesting mutations—and a check for false positive—were confirmed by rescreening them in freshly prepared mutants. Site directed mutagenesis was used to introduce mutations found in the hits and then their antibiotic resistance was analyzed using the drop-based plating method described above.

    Enzyme kinetics. To examine terpenoid-mediated inhibition, PTP1B-catalyzed hydrolysis of p-nitrophenyl phosphate (pNPP) was measured in the presence of various concentrations of terpenoids. Each reaction included PTP1B (0.05 μM), pNPP (0.33, 0.67, 2, 5, 10, and 15 mM), inhibitors (110 μM, 50 μM, and 15 μM for amorphadiene; 100 μM, 50 μM, and 16.7 μM for taxadiene), and buffer (50 mM HEPES pH=7.5, 0.5 mM TCEP, 50 μg/ml BSA, 10% DMSO). The formation of p-nitrophenol was monitored by measuring absorbance at 405 nm every 10 seconds for 5 minutes on a Spectramax M2 plate reader.

    [0137] Kinetic models were evaluated in three steps: (i) Initial-rate measurements collected in the absence and presence of inhibitors were fitted to Michaelis-Menten and inhibition models, respectively (here, the nlinfit and fminsearch functions from MATLAB were used). (ii) An F-test was used to compare the mixed model to the single-parameter model with the least sum squared error (here, the fcdf function from MATLAB was used to assign p-values), and the mixed model was accepted when p<0.05. (iii) The Akaike's Information Criterion (AIC) was used to compare the best-fit single parameter model to each alternative single parameter model, and the “best-fit” model was accepted when the difference in AIC (Δ.sub.i) exceed 10 for all comparisons..sup.56 Note: For amorphadiene, this criterion was not met; both noncompetitive and uncompetitive models, however, yielded indistinguishable IC.sub.50's.

    [0138] The half maximal inhibitory concentration (IC.sub.50) of inhibitors were estimated by using the best-fit kinetic models to determine the concentration of inhibitor required to reduce initial rates of PTP-catalyzed hydrolysis of 15 mM of pNPP by 50%. The MATLAB function “nlparci” was used to determine the confidence intervals of kinetic parameters, and those intervals were propagated to estimate corresponding confidence on IC.sub.50's.

    REFERENCES FOR EXAMPLE 1

    [0139] 1. Newman, D. J. & Cragg, G. M. Natural Products as Sources of New Drugs from 1981 to 2014. Journal of Natural Products 79, 629-661 (2016). [0140] 2. Koehn, F. E. & Carter, G. T. The evolving role of natural products in drug discovery. Nature Reviews Drug Discovery 4, 206-220 (2005). [0141] 3. Harvey, A. L., Edrada-Ebel, R. & Quinn, R. J. The re-emergence of natural products for drug discovery in the genomics era. Nat. Rev. Drug Discov. 14, 111-129 (2015). [0142] 4. Rodrigues, T., Reker, D., Schneider, P. & Schneider, G. Counting on natural products for drug design. Nature Chemistry 8, 531-541 (2016). [0143] 5. Pathan, H. & Williams, J. Basic opioid pharmacology: an update. Br. J. Pain 6, 11-16 (2012). [0144] 6. Vidal, V. et al. Library-Based Discovery and Characterization of Daphnane Diterpenes as Potent and Selective HIV Inhibitors in Daphne gnidium. (2011). doi:10.1021/np200855d [0145] 7. Weaver, B. A. How Taxol/paclitaxel kills cancer cells. 25, (2014). [0146] 8. Camuesco, D. et al. The intestinal anti-inflammatory effect of quercitrin is associated with an inhibition in iNOS expression. Br. J. Pharmacol. 143, 908-918 (2004). [0147] 9. Ling, T., Lang, W. H., Maier, J., Quintana Centurion, M. & Rivas, F. Cytostatic and Cytotoxic Natural Products against Cancer Cell Models. Molecules 24, 2012 (2019). [0148] 10. Jantan, I., Ahmad, W. & Bukhari, S. N. A. Plant-derived immunomodulators: An insight on their preclinical evaluation and clinical trials. Frontiers in Plant Science 6, (2015). [0149] 11. Galanie, S., Thodey, K., Trenchard, I. J., Filsinger Interrante, M. & Smolke, C. D. Complete biosynthesis of opioids in yeast. Science. 349, 1095-1100 (2015). [0150] 12. Luo, X. et al. Complete biosynthesis of cannabinoids and their unnatural analogues in yeast. Nature (2019). doi:10.1038/s41586-019-0978-9 [0151] 13. Zhang, R. K. et al. Enzymatic assembly of carbon-carbon bonds via iron-catalysed sp 3 C—H functionalization. Nature (2019). doi:10.1038/s41586-018-0808-5 [0152] 14. Davis, A. M., Plowright, A. T. & Valeur, E. Directing evolution: The next revolution in drug discovery? Nature Reviews Drug Discovery 16, 681-698 (2017). [0153] 15. Maier, M. E. Design and synthesis of analogues of natural products. Organic and Biomolecular Chemistry 13, 5302-5343 (2015). [0154] 16. Chen, M. S. & White, M. C. A predictably selective aliphatic C—H oxidation reaction for complex molecule synthesis. Science. 318, 783-787 (2007). [0155] 17. Cho, I., Jia, Z. J. & Arnold, F. H. Site-selective enzymatic C—H amidation for synthesis of diverse lactams. Science. 364, 575-578 (2019). [0156] 18. Harvey, A. L. Natural products in drug discovery. Drug Discovery Today 13, 894-901 (2008). [0157] 19. Henrich, C. J. & Beutler, J. A. Matching the power of high throughput screening to the chemical diversity of natural products. Nat. Prod. Rep. 30, 1284-1298 (2013). [0158] 20. Medema, M. H. et al. AntiSMASH: Rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (2011). [0159] 21. Jensen, P. R. Natural Products and the Gene Cluster Revolution. Trends Microbiol. 24, 968-977 (2016). [0160] 22. Yan, Y. et al. Resistance-gene-directed discovery of a natural-product herbicide with a new mode of action. (2018). doi:10.1038/s41586-018-0319-4 [0161] 23. Zhabinskii, V. N., Khripach, N. B. & Khripach, V. A. Steroid plant hormones: Effects outside plant kingdom. Steroids 97, 87-97 (2015). [0162] 24. Li, Y. et al. Complete biosynthesis of noscapine and halogenated alkaloids in yeast. Proc. Natl. Acad. Sci. U.S.A. 115, E3922-E3931 (2018). [0163] 25. Zhang, H., Wang, Y., Wu, J., Skalina, K. & Pfeifer, B. A. Complete biosynthesis of erythromycin A and designed analogs using E. coli as a heterologous host. Chem. Biol. 17, 1232-1240 (2010). [0164] 26. Antosch, J., Schaefers, F. & Guider, T. A. M. Heterologous Reconstitution of Ikarugamycin Biosynthesis in E. coli. Angew. Chemie Int. Ed. 53, 3011-3014 (2014). [0165] 27. Choi, O. et al. Biosynthesis of plant-specific phenylpropanoids by construction of an artiWcial biosynthetic pathway in Escherichia coli. J Ind. Microbiol. Biotechnol. (2011). doi:10.1007/s10295-011-0954-3 [0166] 28. Pfeifer, B. A., Wang, C. C. C., Walsh, C. T. & Khosla, C. Biosynthesis of Yersiniabactin, a Complex Polyketide-Nonribosomal Peptide, Using Escherichia coli as a Heterologous Host. Appl. Environ. Microbiol. (2003). doi:10.1128/AEM.69.11.6698-6702.2003 [0167] 29. Ajikumar, P. K. et al. Isoprenoid pathway optimization for Taxol precursor overproduction in Escherichia coli. Science 330, 70-74 (2010). [0168] 30. Chang, M. C. Y., Eachus, R. A., Trieu, W., Ro, D.-K. & Keasling, J. D. Engineering Escherichia coli for production of functionalized terpenoids using plant P450s. Nat. Chem. Biol. 3, 274-277 (2007). [0169] 31. Morrone, D. et al. Increasing diterpene yield with a modular metabolic engineering system in E. coli: Comparison of MEV and MEP isoprenoid precursor pathway engineering. Appl. Microbiol. Biotechnol. 85, 1893-1906 (2010). [0170] 32. Ferguson, F. M. & Gray, N. S. Kinase inhibitors: The road ahead. Nature Reviews Drug Discovery 17, 353-376 (2018). [0171] 33. Stanford, S. M. & Bottini, N. Targeting Tyrosine Phosphatases: Time to End the Stigma. Trends in Pharmacological Sciences (2017). doi: 10.1016/j.tips.2017.03.004 [0172] 34. Tonks, N. K. Protein tyrosine phosphatases: from genes, to function, to disease. Nat. Rev. Mol. Cell Biol. 7, 833-846 (2006). [0173] 35. Tautz, L., Pellecchia, M. & Mustelin, T. Targeting the PTPome in human disease. Expert Opin. Ther. Targets 10, 157-77 (2006). [0174] 36. Tonks, N. K. Protein tyrosine phosphatases—From housekeeping enzymes to master regulators of signal transduction. FEBS Journal 280, 346-378 (2013). [0175] 37. Scott, L. M., Lawrence, H. R., Sebti, S. M., Lawrence, N. J. & Wu, J. Targeting protein tyrosine phosphatases for anticancer drug discovery. Curr. Pharm. Des. 16, 1843-62 (2010). [0176] 38. Montalibet, J. & Kennedy, B. P. Using yeast to screen for inhibitors of protein tyrosine phosphatase 1B. Biochem. Pharmacol. 68, 1807-1814 (2004). [0177] 39. Badran, A. H. et al. Continuous evolution of Bacillus thuringiensis toxins overcomes insect resistance. Nature 533, 58-63 (2016). [0178] 40. Kaneko, T. et al. Superbinder SH2 domains act as antagonists of cell signaling. Sci. Signal. 5, (2012). [0179] 41. Jiang, C.-S., Liang, L.-F. & Guo, Y.-W. Natural products possessing protein tyrosine phosphatase 1B (PTP1B) inhibitory activity found in the last decades. Acta Pharmacol. Sin. 33, 1217-1245 (2012). [0180] 42. Hjortness, M. K. et al. Abietane-Type Diterpenoids Inhibit Protein Tyrosine Phosphatases by Stabilizing an Inactive Enzyme Conformation. Biochemistry 57, 5886-5896 (2018). [0181] 43. Martin, V. J. J., Pitera, D. J., Withers, S. T., Newman, J. D. & Keasling, J. D. Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nat. Biotechnol. 21, 796-802 (2003). [0182] 44. He, R., Yu, Z., Zhang, R. & Zhang, Z. Protein tyrosine phosphatases as potential therapeutic targets. Acta Pharmacol. Sin. 35, 1227-1246 (2014). [0183] 45. Bentires-Alj, M. & Neel, B. G. Protein-tyrosine phosphatase 1B is required for HER2/Neu-induced breast cancer. Cancer Res. (2007). doi:10.1158/0008-5472.CAN-06-4610 [0184] 46. Krishnan, N. et al. PTP1B inhibition suggests a therapeutic strategy for Rett syndrome. J. Clin. Invest. (2015). doi:10.1172/JCI80323 [0185] 47. Yoshikuni, Y., Ferrin, T. E. & Keasling, J. D. Designed divergent evolution of enzyme function. Nature 440, 1078-1082 (2006). [0186] 48. Carlson, J. C., Badran, A. H., Guggiana-Nilo, D. A. & Liu, D. R. Negative selection and stringency modulation in phage-assisted continuous evolution. Nat. Chem. Biol. 10, 216-222 (2014). [0187] 49. Dietrich, J. A. et al. A novel semi-biosynthetic route for artemisinin production using engineered substrate-promiscuous P450BM3. ACS Chem. Biol. 4, 261-267 (2009). [0188] 50. Edgar, S. et al. Mechanistic Insights into Taxadiene Epoxidation by Taxadiene-5α-Hydroxylase. ACS Chem. Biol. 11, 460-469 (2016). [0189] 51. Chen, X. et al. Statistical experimental design guided optimization of a one-pot biphasic multienzyme total synthesis of amorpha-4,11-diene. PLoS One 8, e79650 [0190] 52. Waterhouse, A. et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. (2018). doi:10.1093/nar/gky427 [0191] 53. Guex, N., Peitsch, M. C. & Schwede, T. Automated comparative protein structure modeling with SWISS-MODEL and Swiss-PdbViewer: A historical perspective. Electrophoresis (2009). doi:10.1002/elps.200900140 [0192] 54. Benkert, P., Biasini, M. & Schwede, T. Toward the estimation of the absolute quality of individual protein structure models. Bioinformatics (2011). doi:10.1093/bioinformatics/btq662 [0193] 55. Tian, J. Q. and J. & Quan, J. Circular Polymerase Extension Cloning of Complex Gene Libraries and Pathways. PLoS One 4, e6441 (2009). [0194] 56. Burnham, K. P. & Anderson, D. R. Model Selection and Multimodel Inference: a Practical Information-theoretic Approach, 2nd edn. Springer-Verlag, New York. New York Springer 60, (2002). [0195] 57. Davis, J. H., Rubin, A. J. & Sauer, R. T. Design, construction and characterization of a set of insulated bacterial promoters. Nucleic Acids Res. 39, 1131-1141 (2011). [0196] 58. Salis, H. M. The ribosome binding site calculator. Methods Enzymol. 498, 19-42 (2011). [0197] 59. Sato, M., Ozawa, T., Inukai, K., Asano, T. & Umezawa, Y. Fluorescent indicators for imaging protein phosphorylation in single living cells. Nat Biotechnol 20, 287-294 (2002).

    Example 2

    [0198] The design of small molecules that inhibit disease-relevant proteins represents a longstanding challenge of medicinal chemistry. Here, we describe an approach for encoding this challenge—the inhibition of a human drug target—into a microbial host and using it to guide the discovery and biosynthesis of targeted, biologically active natural products. This approach identified two previously unknown terpenoid inhibitors of protein tyrosine phosphatase 1B (PTP1B), an elusive therapeutic target for the treatment of diabetes and cancer. At least one inhibitor targets an allosteric site, which confers unusual selectivity; both can inhibit PTP1B in living cells. A screen of 24 uncharacterized terpene synthases from a pool of 4,464 genes uncovered additional hits, demonstrating a scalable discovery approach, and the incorporation of different PTPs into the microbial host yielded PTP-specific detection systems. Findings illustrate the potential for using microbes to discover and build natural products that exhibit precisely defined biochemical activities yet possess unanticipated structures and/or binding sites.

    [0199] Despite advances in structural biology and computational chemistry, the design of small molecules that bind tightly and selectively to disease-relevant proteins remains exceptionally difficult.sup.1. The free energetic contributions of rearrangements in the molecules of water that solvate binding partners and structural changes in the binding partners themselves are particularly challenging to predict and, thus, to incorporate into molecular design.sup.2,3. Drug development, as a result, often begins with screens of large compound libraries.sup.4.

    [0200] Nature has endowed living systems with the catalytic machinery to build an enormous variety of biologically active molecules—a diverse natural library.sup.5. These molecules evolved to carry out important metabolic and ecological functions (e.g., the phytochemical recruitment of predators of herbivorous insects.sup.6) but often also exhibit useful medicinal properties. Over the years, screens of environmental extracts and natural product libraries—augmented, on occasion, with combinatorial (bio)chemistry.sup.7-9—have uncovered a diverse set of therapeutics, from aspirin to paclitaxel.sup.10. Unfortunately, these screens tend to be resource intensive.sup.11, limited by low natural titers.sup.12, and largely subject to serendipity.sup.13. Bioinformatic tools, in turn, have permitted the identification of biosynthetic gene clusters.sup.14,15, where co-localized resistance genes can reveal the biochemical function of their products.sup.16,17. The therapeutic applications of many natural products, however, differ from their native functions.sup.18, and many biosynthetic pathways can, when appropriately reconfigured, produce entirely new and, perhaps, more effective therapeutic molecules.sup.19,20. Methods for efficiently identifying and building natural products that inhibit specific disease-relevant proteins remain largely undeveloped.

    [0201] Protein tyrosine phosphatases (PTPs) are an important class of drug targets that could benefit from new approaches to inhibitor discovery. These enzymes catalyze the hydrolytic dephosphorylation of tyrosine residues and, together with protein tyrosine kinases (PTKs), contribute to an enormous number of diseases (e.g., cancer, autoimmune disorders, and heart disease, to name a few).sup.21,22. The last several decades have witnessed the construction of many potent inhibitors of PTKs, which are targets for over 30 approved drugs.sup.23. Therapeutic inhibitors of PTPs, by contrast, have proven difficult to develop. These enzymes possess well conserved, positively charged active sites that make them difficult to inhibit with selective, membrane-permeable molecules.sup.24; they lack targeted therapeutics of any kind.

    [0202] In this study, we describe an approach for using microbial systems to find natural products that inhibit difficult-to-drug proteins. We focused on protein tyrosine phosphatase 1B (PTP1B), a therapeutic target for the treatment of type 2 diabetes, obesity, and HER2-positive breast cancer.sup.25. PTP1B possesses structural characteristics that are generally representative of the PTP family.sup.26 and regulates a diverse set of physiological processes (e.g., energy expenditure.sup.27, inflammation.sup.28, and neural specification in embryonic stem cells.sup.29). In brief, we assembled a strain of Escherichia coli with two genetic modules—(i) one that links cell survival to the inhibition of PTP1B and (ii) one that enables the biosynthesis of structurally varied terpenoids. In a study of five well-characterized terpene synthases, this strain identified two previously unknown terpenoid inhibitors of PTP1B. Both inhibitors were selective for PTP1B, exhibited distinct binding mechanisms, and increased insulin receptor phosphorylation in mammalian cells. A screen of 24 uncharacterized terpene synthases from eight phylogenetically diverse clades uncovered additional hits, demonstrating a scalable approach for finding inhibitor-synthesizing genes. A simple exchange of PTP genes, in turn, permitted the facile extension of our genetically encoded detection system to new targets. Our findings illustrate a versatile approach for using microbial systems to find targeted, readily synthesizable inhibitors of disease-relevant enzymes.

    Development of a Genetically Encoded Objective

    [0203] E. coli is a versatile platform for building natural products from unculturable or low-yielding organisms.sup.30,31. We hypothesized that a strain of E. coli programmed to detect the inactivation of PTP1B (i.e., a genetically encoded objective) might enable the discovery of natural products that inhibit it (i.e., molecular solutions to the objective). To program such a strain, we assembled a bacterial two-hybrid (B2H) system in which PTP1B and Src kinase control gene expression (FIG. 21A). In this system, Src phosphorylates a substrate domain, enabling a protein-protein interaction that activates transcription of a gene of interest (GOI). PTP1B dephosphorylates the substrate domain, preventing that interaction, and the inactivation of PTP1B re-enables it. E. coli is a particularly good host for this detection system because its proteome is sufficiently orthogonal to the proteome of H. sapiens to minimize off-target growth defects that can result from the regulatory activities of Src and PTP1B (Note 1).sup.32.

    [0204] We carried out B2H development in several steps. To begin, we assembled a luminescent “base” system in which Src modulates the binding of a substrate domain to an Src homology 2 (SH2) domain (FIG. 21B); this system, which includes a chaperone that helps Src to fold (Cdc37).sup.33, is similar to other B2H designs that detect protein-protein binding.sup.34. Unfortunately, our initial system did not yield a phosphorylation-dependent transcriptional response, so we complemented it with inducible plasmids—each harboring a different system component—to identify proteins with suboptimal expression levels (FIG. 21b). Interestingly, secondary induction of Src increased luminescence, an indication that insufficient substrate phosphorylation and/or weak substrate-SH2 binding depressed GOI expression in our base system. We modified this system by swapping in different substrate domains, by adding mutations to the SH2 domain that enhance its affinity for phosphopeptides.sup.35, and by removing the gene for Src—a modification that allowed us to control expression exclusively from a second plasmid. With this configuration, induction of Src increased luminescence most prominently for the MidT substrate (FIG. 1C), and simultaneous induction of both Src and PTP1B prevented that increase—an indication of intracellular PTP1B activity (FIG. 21D). We finalized the MidT system by incorporating genes for PTP1B and Src, by adjusting promoters and ribosome binding sites to amplify its transcriptional response further (FIG. 21D, FIG. 13, and FIG. 14), and by adding a gene for spectinomycin resistance (SpecR) as the GOI. The final plasmid-borne detection system required the inactivation of PTP1B to permit growth at high concentrations of antibiotic (FIG. 21E).

    Biosynthesis of PTP1B Inhibitors

    [0205] To search for inhibitors of PTP1B that bind outside of its active site, we coupled the B2H system with metabolic pathways for terpenoids, a structurally diverse class of secondary metabolites with largely nonpolar structures (FIG. 22A), some of which are known to inhibit PTP1B.sup.36,37. Terpenoids include over 80,000 known compounds and represent nearly one-third of all characterized natural products.sup.38 (the basis of approximately 50% of clinically approved drugs.sup.39). To begin, we focused on a handful of structurally diverse terpenoids without established inhibitory effects (FIG. 22B): Amorphadiene (AD), custom-character-humulene, α-bisabolene (AB), abietadiene, and taxadiene. Each terpenoid pathway consisted of two plasmid-borne modules: (i) the mevalonate-dependent isoprenoid pathway from S. cerevisiae (optimized for expression in E. coli.sup.40) and (ii) a terpene synthase previously demonstrated to express and produce one of the five selected terpenoids in E. coli.sup.40-41. The terpene synthase was supplemented, when necessary for diterpenoid production, with a geranylgeranyl diphosphate synthase. These modules generated terpenoids at titers of 0.3-18 mg/L in E. coli (FIG. 26).

    [0206] We screened each pathway for its ability to produce inhibitors of PTP1B by transforming E. coli with plasmids harboring both the pathway of interest and the B2H system (FIG. 22C). To our surprise, pathways for AD and AB permitted survival at high concentrations of antibiotic. Critically, GC-MS traces confirmed that all pathways generated terpenoids in the presence of the B2H system (FIG. 22D, FIG. 26), and maximal resistance of the AD- and AB-producing strains required both an active terpene synthase and a functional B2H system (FIG. 26D).

    [0207] We confirmed the inhibitory effects of purified terpenoids by examining their influence on PTP1B-catalyzed hydrolysis of p-nitrophenyl phosphate (pNPP; FIG. 22E, TABLE 12). The IC.sub.50s for AD and AB were 53±8 μM and 13±2 μM, respectively, in 10% DMSO (FIG. 22F). These IC.sub.50s are surprisingly strong for small, unfunctionalized hydrocarbons; the ligand efficiencies of both inhibitors are high (TABLE 15), and their potencies are similar to those of larger molecules that form hydrogen bonds and other stabilizing interactions with PTP1B.sup.21,45. Both IC.sub.50s are also similar to the respective terpenoid concentrations in liquid culture (FIG. 22G), a finding consistent with in vivo inhibition (terpenoids tend to accumulate intracellularly.sup.46, so in vivo concentrations may be even higher). Our growth-coupled assays, kinetic assays, and production measurements, taken together, indicate that AD and AB activate the B2H system by inhibiting PTP1B inside the cell.

    Biophysical Analysis of PTP1B Inhibitors

    [0208] Allosteric inhibitors of PTPs are valuable starting points for drug development. These molecules bind outside of the well conserved, positively charged active sites of PTPs and tend to have improved selectivities and membrane permeabilities over substrate analogs.sup.21. Motivated by these considerations, an early screen identified a benzbromarone derivative that inhibited PTP1B weakly (IC.sub.50=350 μM) without competing with substrates; subsequent optimization of this compound led to two improved inhibitors (IC.sub.50's=8 and 22 μM) that bind to an allosteric site.sup.45 (FIG. 23A). Over the next 15 years, efforts to find new inhibitors that bind to this or other allosteric regions on the catalytic domain have been largely unsuccessful.sup.47. Benzbromarone derivatives are the only allosteric inhibitors with crystallographically verified binding sites. (Although, an allosteric inhibitor that binds to a disordered region of the full-length protein has been characterized with NMR.sup.25). New approaches for finding allosteric inhibitors are clearly needed.

    [0209] Our microbial system could grant access to new compounds that bind in unexpected ways. AD and AB provide examples. They are highly nonpolar and, thus, incapable of engaging in the hydrogen bonds and electrostatic interactions on which most other PTP inhibitors rely.sup.21,45. To examine their binding mechanisms in detail, we sought to collect X-ray crystal structures of PTP1B bound to AD and α-bisabolol, a soluble analogue of AB (a ligand for which poor solubility precluded soaking experiments). Unfortunately, only the structure of PTP1B bound to AD was sufficient for unambiguous determination of a binding site (FIG. 30 and FIG. 31). This inhibitor binds to the same allosteric site targeted by benzbromarone derivatives. Its binding mode, however, is distinct: (i) AD causes the α7 helix of PTP1B to reorganize to create a hydrophobic cleft (FIG. 23B); this type of reorganization is interesting because it is typically slow (micro- to millisecond).sup.48 and difficult to incorporate into computational ligand design.sup.49. (ii) It likely adopts multiple bound conformations (i.e., the electron density indicates regions of disorder; FIG. 30). This behavior, which is supported by molecular dynamics simulations, is consistent with prior work on the binding of proteins to hydrocarbon moieties, which tend to be “mobile” in their binding pockets.

    [0210] We probed the binding of AD and AB further with several additional analyses. First, we examined the inhibition of PTP1B by dihydroartemisinic acid. This structural analogue of AD has a carboxyl group that, according to our crystal structure, should interfere with binding to the hydrophobic cleft created by the α7 helix (FIG. 23C). The IC.sub.50 of this molecule was eight-fold higher than that of AD, a reduction in potency consistent with its crystallographic pose (FIG. 23d and FIG. 33). Second, we studied the competition between AD and two inhibitors that bind to the active site: (i) TCS401, which causes the WPD loop to adopt a closed conformation, and (ii) orthovanadate, which does not. For background, benzobromarones, upon binding to the C-terminal allosteric site, stabilize the WPD loop in an open conformation that is incompatible with the binding of TCS401, but not orthovanadate. Our kinetic data suggest that AD behaves similarly (FIG. 23E and FIG. 23F), a finding consistent with a shared binding site and mechanism of modulation. Finally, we assessed the inhibitory effects of AD and AB against TC-PTP, the closest homolog of PTP1B. Intriguingly, both molecules inhibited TC-PTP five- to six-fold less potently than PTP1B (FIG. 23G and FIG. 33). This finding is consistent with binding to the poorly conserved allosteric site. Importantly, this selectivity may seem modest, but it matches or exceeds the selectivities of most pre-optimized inhibitors (including benzobromarone derivatives) and is exceedingly rare for unfunctionalized hydrocarbons.sup.50. We assessed the contribution of the α7 helix to selectivity, in turn, by removing the equivalent region from PTP1B and TC-PTP (FIG. 23G). This modification caused a four-fold reduction in the selectivity of AD, an effect consistent with the involvement of the α7 helix in its binding. Intriguingly, the selectivity of AB was insensitive to this modification; the unambiguous determination of the binding site of this ligand requires additional data.

    [0211] AD and AB are lipophilic molecules that could be valuable for their ability to pass through the membranes of mammalian cells. To examine the biological activity of these molecules, we incubated them with HEK293T/17 cells and used an enzyme-linked immunosorbent assay to measure shifts in insulin receptor (IR) phosphorylation. IR is a receptor tyrosine kinase that undergoes PTP1B-mediated dephosphorylation from the cytosolic side of the plasma membrane (PTP1B, in turn, localizes to the endoplasmic reticulum of the cell). Both molecules increased IR phosphorylation over a negative control (FIG. 23H and FIG. 35). We checked for off-target contributions to this signal, in turn, by repeating the ELISA with equivalent concentrations of dihydroartemisinic acid and α-bisabolol. To our satisfaction, both molecules led to a reduction in signal consistent with their reduced potencies.

    [0212] Other PTPs can promote IR dephosphorylation; SHP1 and SHP2 provide two examples.sup.51-53. To examine the potential contribution of these enzymes to the increase in IR phosphorylation observed in our ELISA, we measured their inhibition by AD and AB. Briefly, AD inhibited SHP2 three-fold less potently than PTP1B, and its inhibition of SHP1 was too weak to measure (FIGS. 34A-34B). The low potency of AB against SHP1 and SHP2 also precluded experimental measurement (FIGS. 34C-34D). These potencies, together with the aforementioned analysis of weakly inhibitory structural analogs, suggest that the inhibition of PTP1B by AD and AB is the primary cause of the increase in IR phosphorylation observed in our ELISA experiments.

    A Scalable Approach to Molecular Discovery

    [0213] Our microbial strain provides a powerful tool for screening genes for their ability to generate novel PTP1B inhibitors. Most terpenoids, as a case study, are not commercially available, and even when their metabolic pathways are known, their biosynthesis, purification, and in vitro analysis is a resource-intensive process that is difficult to parallelize with existing methods.sup.54. Our B2H system offers a potential solution: It can identify inhibitor-synthesizing genes with a simple growth-coupled assay. We explored its application to discovery efforts by using it to screen a diverse set of uncharacterized biosynthetic genes. In brief, we carried out a bioinformatic analysis of the largest terpene synthase family (PF03936) by building and annotating a cladogram of its 4,464 constituent members (FIG. 27); from here, we synthesized three uncharacterized genes from each of eight clades: six with no characterized genes and two with some characterized genes (FIG. 24A). We reasoned that these 24 phylogenetically diverse genes (8 from fungi, 13 from plants, and 3 from bacteria) might encode enzymes with distinct product profiles and potentially, through the inclusion of uncharacterized clades, novel sesquiterpene scaffolds.

    [0214] Guided by our initial screen, we searched for sesquiterpene inhibitors by pairing each of the uncharacterized genes with the FPP pathway. To our surprise, six genes conferred a significant survival advantage (FIG. 24B), and maximal resistance required an active B2H system (FIG. 28). Each hit generated distinct product profiles (FIG. 29); we focused our analysis on A0A0C9VSL7, which produced mostly (+)-1(10),4-cadinadiene as a major product (FIGS. 24C-24D). This terpenoid is a structural analog of AD but has a weaker potency (IC.sub.50=165±33 μM; FIG. 24E); a titer of 33±18 μM suggests that intracellular accumulation may allow it to inhibit PTP1B inside the cell. Our ability to detect a weak inhibitor suggests that the B2H system can capture a broad set of scaffolds in molecular discovery efforts. The purification and analysis of additional hits, the incorporation of isoprenoid substrates of different sizes (through the use of geranyl diphosphate synthase or geranyl geranyl diphosphate synthase), and the inclusion of more uncharacterized genes could expand the scope of such efforts.

    Design of Alternative PTP-Specific Objectives

    [0215] We explored the versatility of our B2H system by assessing its ability to detect the inactivation of several other diseases-relevant PTPs. In short, we swapped out the gene for PTP1B with genes for PTPN2, PTPN6, or PTPN12; these enzymes are targets for immunotherapeutic enhancement.sup.55, the treatment of ovarian cancer.sup.56, and acute myocardial infarction.sup.57, respectively. Their catalytic domains share 31-65% sequence identity with the catalytic domain of PTP1B. Interestingly, the new B2H systems were immediately functional; PTP inactivation permitted growth at high concentrations of spectinomycin (FIG. 25A). This finding suggests that our detection system can be easily extended to other members of the PTP family.

    [0216] PTP-specific B2H systems could facilitate the identification of natural products that selectively inhibit one PTP over another. We explored this application by comparing the antibiotic resistance conferred by PTP1B- and TC-PTP-specific systems in response to metabolic pathways for AD and α-bisabolene (FIG. 25B). As expected, the PTP1B-specific system permitted growth at higher concentrations of antibiotic, a result consistent with the selectivity of both terpenoids for PTP1B. Indistinguishable terpenoid titers between the two strains suggest that this survival advantage does not result from difference in intracellular concentration (FIG. 25C). Findings thus indicate that a simple comparison of B2H systems—a potential secondary screen—offers a simple approach for evaluating the selectivity PTP-inhibiting gene products. Notably, high concentrations of inhibitors in two strains could swamp out selective effects; in such cases, terpenoid levels could be reduced with lower mevalonate concentrations.

    [0217] This study addresses an important challenge of medicinal chemistry—the design of molecular structures that inhibit disease-relevant enzymes—by using a desired biochemical activity (i.e., an objective) as a genetically encoded constraint to guide molecular biosynthesis. This approach enabled the identification of two selective, biologically active inhibitors of PTP1B, an elusive drug target.sup.58. These molecules are not drugs, but they are promising scaffolds for lead development. Their mechanisms of modulation—which elicit allosteric conformational changes yet appear to rely on loose, conformationally flexible binding—are unusual (and computationally elusive.sup.59), and demonstrate the ability of microbial systems to find new solutions to difficult challenges in molecular design. Our identification of unusual inhibitors in relatively small libraries, in turn, suggests that microbial systems can access a rich molecular landscape that is not efficiently explored by existing approaches to molecular discovery.

    [0218] The B2H system at the core of our approach is a valuable tool for identifying biologically active natural products, which are structurally complex, difficult to synthesize, and often hidden in cryptic gene clusters.sup.60. It has several key advantages over contemporary approaches to inhibitor discovery: (i) It incorporates synthesizability as a search criterion—an important attribute of drug leads.sup.61. (ii) It is scalable. We used a growth-coupled assay to screen 24 uncharacterized terpene synthases; this type of assay is also compatible with very large mutagenesis libraries (e.g., 1010).sup.62. (iii) It can use cellular machinery to stabilize proteins (e.g., CDC37 for Src); this capability could facilitate the integration of unstable and/or disordered targets. Future efforts to exploit these advantages by incorporating large libraries of mutated and/or reconfigured pathways, alternative biosynthetic enzymes (e.g., cytochromes P450, halogenases, and methyltransferases), or new classes of disease-relevant enzymes would be informative.

    [0219] The B2H system also has important limits. When used alongside metabolic pathways, it links survival not only to the potency of metabolites, but also to their titers, off-target effects, and pathway toxicities. These limitations can be beneficial; they bias the discovery process toward potent, readily synthesizable inhibitors and could, thus, facilitate post-discovery efforts to improve the titers of interesting molecules.sup.63. Nonetheless, they will exclude some types of structurally complex molecules that are difficult to synthesize in E. coli. The use of similar activity-based screens in other organisms (e.g., Streptomyces) could be interesting.

    [0220] The compatibility of our discovery approach with different PTPs is valuable in light of their increasingly well validated potential as a rich—and essentially untapped—source of new therapeutic targets.sup.64. We anticipate that some PTPs will require the use of chaperones and/or transcriptional adjustments to be incorporated into B2H systems. Our systematic optimization of the PTP1B-based system provides an experimental framework for exploring these modifications. Side-by-side comparisons of B2H systems, in turn, offer a promising strategy for evaluating inhibitor selectivity in secondary screens. In future work, new varieties of objectives (e.g., B2H systems or genetic circuits that detect the selective inhibition—or, perhaps, activation—of one PTP over another) could facilitate the discovery of molecules with sophisticated mechanisms of modulation in primary screens. The versatility of genetically encoded objectives highlights the power of using microbial systems to find targeted, biologically active molecules.

    Note 1: The orthogonality of proteomes. E. coli and S. cerevisiae are both well-developed platforms for the production of pharmaceutically relevant natural products.sup.20,65,66. We chose to use E. coli for this study because its machinery for phosphorylating proteins is dissimilar from that of eukaryotic cells and thus less likely to interfere with the function of genetically encoded systems that link the inhibition of PTP1B to cellular growth.sup.67. By contrast, the overexpression of Src kinase in S. cerevisiae is lethal and is mitigated by PTP1B.sup.68; these effects are inconsistent with our biochemical objective. More broadly, S. cerevisiae and humans, despite having evolved from a common ancestor approximately 1 billion years ago.sup.69, share many functionally equivalent proteins; orthologous genes, in fact, account for more than one-third of the yeast genome.sup.70. Most strikingly, a recent study found that nearly half (47%) of 414 essential genes from S. cerevisiae could be replaced with human orthologs without growth defects.sup.71. This finding suggests that yeast is a particularly restrictive host for genetically encoded systems that link arbitrary changes in the activities of human regulatory enzymes to fitness advantage.

    Methods

    [0221] Bacterial strains. We used E. coli DH10B, chemically competent NEB Turbo, or electrocompetent One Shot Top10 (Invitrogen) to carry out molecular cloning and to perform preliminary analyses of terpenoid production; we used E. coli BL2-DE31 to express proteins for in vitro studies; and we used E. coli s1030.sup.72 for our luminescence studies and for all experiments involving terpenoid-mediated growth (i.e., evolution studies).

    [0222] For all strains, we generated chemically competent cells by carrying out the following steps: (i) We plated each strain on LB agar plates with the required antibiotics. (ii) We used one colony of each strain to inoculate 1 mL of LB media (25 g/L LB with appropriate antibiotics listed in TABLE 8) in a glass culture tube, and we grew this culture overnight (37° C., 225 RPM). (iii) We used the 1-mL culture to inoculate 100-300 mL of LB media (as above) in a glass shake flask, and we grew this culture for several hours (37° C., 225 RPM). (iv) When the culture reached an OD of 0.3-0.6, we centrifuged the cells (4,000×g for 10 minutes at 4° C.), removed the supernatant, resuspended them in 30 mL of ice cold TFB1 buffer (30 mM potassium acetate, 10 mM CaCl.sub.2, 50 mM MnCl.sub.2, 100 mM RbCl, 15% v/v glycerol, water to 200 mL, pH=5.8, sterile filtered), and incubated the suspension at 4° C. for 90 min. (v) We repeated step iv, but resuspended in 4 mL of ice cold TFB2 buffer (10 mM MOPS, 75 mM CaCl.sub.2, 10 mM RbCl.sub.2, 15% glycerol, water to 50 mL, pH=6.5, sterile filtered). (iv) We split the final suspension into 100 μL aliquots and froze them at −80° C. until further use.

    [0223] We generated electrocompetent cells by following an approach similar to the one above. In step iv, however, we resuspended the cells in 50 mL of ice cold MilliQ water and repeated this step twice—first with 50 mL of 20% sterile glycerol (ice cold) and, then, with 1 mL of 20% sterile glycerol (ice cold). We froze the pellets as before.

    Materials. We purchased methyl abietate from Santa Cruz Biotechnology; trans-caryophyllene, tris(2-carboxyethyl)phosphine (TCEP), bovine serum albumin (BSA), M9 minimal salts, phenylmethylsulfonyl fluoride (PMSF), and DMSO (dimethyl sulfoxide) from Millipore Sigma; glycerol, bacterial protein extraction reagent II (B-PERII), and lysozyme from VWR; cloning reagents from New England Biolabs; AD from Ambeed, Inc.; and all other reagents (e.g., antibiotics and media components) from Thermo Fisher. Taxadiene was a kind gift from Phil Baran of the The Scripps Research Institute. We prepared mevalonate by mixing 1 volume of 2 M DL-mevalanolactone with 1.05 volumes of 2 M KOH and incubating this mixture at 37° C. for 30 minutes.
    Cloning and molecular biology. We constructed all plasmids by using standard methods (i.e., restriction digest and ligation, Golden Gate and Gibson assembly, Quikchange mutagenesis, and circular polymerase extension cloning). TABLE 7 describes the source of each gene; TABLE 8 and TABLE 3 describe the composition of all final plasmids.

    [0224] We began construction of the B2H system by integrating the gene for HA4-RpoZ from pAB094a into pAB078d and by replacing the ampicillin resistance marker of pAB078d with a kanamycin resistance marker (Gibson Assembly). We modified the resulting “combined” plasmid, in turn, by replacing the HA4 and SH2 domains with kinase substrate and substrate recognition (i.e., SH2) domains, respectively (Gibson assembly), and by integrating genes for Src kinase, CDC37, and PTP1B in various combinations (Gibson assembly). We finalized the functional B2H system by modifying the SH2 domain with several mutations known to enhance its affinity for phosphopeptides (K15L, T8V, and C10A, numbered as in Kaneko et. al..sup.35), by exchanging the GOI for luminescence (LuxAB) with one for spectinomycin resistance (SpecR), and by toggling promoters and ribosome binding sites to enhance the transcriptional response (Gibson assembly and Quickchange Mutagenesis, Agilent Inc.). We note: For the last step, we also converted Prol to ProD by using the Quikchange protocol. When necessary, we constructed plasmids with arabinose-inducible components by cloning a single component from the B2H system into pBAD (Golden Gate assembly). TABLE 4, TABLE 9, and TABLE 10 list the primers and DNA fragments used to construct each plasmid.

    [0225] We assembled pathways for terpenoid biosynthesis by purchasing plasmids encoding the first module (pMBIS) and various sesquiterpene synthases (ADS or GHS in pTRC99a) from Addgene, and by building the remaining plasmids. We replaced the tetracycline resistance in pMBIS with a gene for chloramphenicol resistance to create pMBIS.sub.CmR. We integrated genes for ABS, TXS, ABA, and GGPPS into pTRC99t (i.e., pTRC99a without BsaI sites). TABLE 4, TABLE 9, and TABLE 10 list the primers and DNA fragments used to construct each plasmid.

    Luminescence assays. We characterized preliminary B2H systems (which contained LuxAB as the GOI) with luminescence assays. In brief, we transformed necessary plasmids into E. coli s1030 (TABLE 8), plated the transformed cells onto LB agar plates (20 g/L agar, 10 g/L tryptone, 10 g/L sodium chloride, and 5 g/L yeast extract with antibiotics described in TABLE 8), and incubated all plates overnight at 37° C. We used individual colonies to inoculate 1 ml of terrific both (TB at 2%, or 12 g/L tryptone, 24 g/L yeast extract, 12 mL/L 100% glycerol, 2.28 g/L KH.sub.2PO.sub.4, 12.53 g/L K.sub.2HPO.sub.4, pH=7.3, and antibiotics described in TABLE 8), and we incubated these cultures overnight (37° C. and 225 RPM). The following morning, we diluted each culture by 100-fold into 1 ml of TB media (above), and we incubated these cultures in individual wells of a deep 96-well plate for 5.5 hours (37° C., 225 RPM). (We note: When pBAD was present, we supplemented the TB media with 0-0.02 w/v % arabinose). We transferred 100 μL of each culture into a single well of a standard 96-well clear plate and measured both OD.sub.600 and luminescence on a Biotek Synergy plate reader (gain: 135, integration time: 1 second, read height: 1 mm). Analogous measurements of cell-free media allowed us to measure background signals, which we subtracted from each measurement prior to calculating OD-normalized luminescence (i.e., Lum/OD.sub.600).
    Analysis of antibiotic resistance. We evaluated the spectinomycin resistance conferred by various B2H systems in the absence of terpenoid pathways by carrying out the following steps: (i) We transformed E. coli with the necessary plasmids (TABLE 8) and plated the transformed cells onto LB agar plates (20 g/L agar, 10 g/L tryptone, 10 g/L sodium chloride, 5 g/L yeast extract, 50 μg/ml kanamycin, 10 μg/ml tetracycline). (ii) We used individual colonies to inoculate 1-2 ml of TB media (12 g/L tryptone, 24 g/L yeast extract, 12 mL/L 100% glycerol, 2.28 g/L KH.sub.2PO.sub.4, 12.53 g/L K.sub.2HPO.sub.4, 50 μg/ml kanamycin, 10 μg/ml tetracycline, pH=7.3), and we incubated these cultures overnight (37° C., 225 RPM). In the morning, we diluted each culture by 100-fold into 4 ml of TB media (as above) with 0-500 μg/ml spectinomycin (we used spectinomycin in the liquid culture only for FIG. 14), and we incubated these cultures in deep 24-well plates until wells containing 0 μg/ml spectinomycin reached an OD.sub.600 of 0.9-1.1. (iv) We diluted each 4-ml culture by 10-fold into TB media with no antibiotics and plated 10-μL drops of the diluent onto agar plates with various concentrations of spectinomycin. (v) We incubated plates overnight (37° C.) and photographed them the following day.

    [0226] To examine terpenoid-mediated resistance, we began with steps i and ii as described above with the addition of 34 μg/ml chloramphenicol and 50 μg/ml carbenicillin in all liquid/solid media. We then proceeded with the following steps: (iii) We diluted samples from 1-ml cultures to an OD.sub.600 of 0.05 in 4.5 ml of TB media (supplemented with 12 g/L tryptone, 24 g/L yeast extract, 12 mL/L 100% glycerol, 2.28 g/L KH.sub.2PO.sub.4, 12.53 g/L K.sub.2HPO.sub.4, 50 μg/ml kanamycin, 10 μg/ml tetracycline, 34 μg/ml chloramphenicol, and 50 μg/ml carbenicillin), which we incubated in deep 24-well plates (37° C., 225 RPM). (iv) At an OD.sub.600 of 0.3-0.6, we transferred 4 ml of each culture to a new well of a deep 24-well plate, added 500 μM isopropyl β-D-1-thiogalactopyranoside (IPTG) and 20 mM of mevalonate, and incubated for 20 hours (22° C., 225 RPM). (v) We diluted each 4-ml culture to an OD.sub.600 of 0.1 with TB media and plated 10 μL of the diluent onto either LB or TB plates supplemented with 500 μM IPTG, 20 mM mevalonate, 50 μg/ml kanamycin, 10 μg/ml tetracycline, 34 μg/ml chloramphenicol, 50 μg/ml carbenicillin, and 0-1200 μg/ml spectinomycin (for both plates, we used 20 g/L agar with media and buffer components described above).

    Terpenoid biosynthesis. We prepared E. coli for terpenoid production by transforming cells with plasmids harboring requisite pathway components (TABLE 8) and plating them onto LB agar plates (20 g/L agar, 10 g/L tryptone, 10 g/L sodium chloride, and 5 g/L yeast extract with antibiotics described in TABLE 8). We used one colony from each strain to inoculate 2 ml TB (12 g/L tryptone, 24 g/L yeast extract, 12 mL/L 100% glycerol, 2.28 g/L KH.sub.2PO.sub.4, 12.53 g/L K.sub.2HPO.sub.4, pH=7.0, and antibiotics described in TABLE 8) in a glass culture tube for ˜16 hours (37° C. and 225 RPM). We diluted these cultures by 75-fold into 10 ml of TB media and incubated the new cultures in 125 mL glass shake flasks (37° C. and 225 RPM). At an OD.sub.600 of 0.3-0.6, we added 500 μM IPTG and 20 mM mevalonate. After 72-88 hours of growth (22° C. and 225 RPM), we extracted terpenoids from each culture as outlined below.
    Protein expression and purification. We expressed and purified PTPs as described previously.sup.73. Briefly, we transformed E. coli BL21(DE3) cells with pET16b or pET21b vectors (see TABLE 8 for details), and we induced with 500 μM IPTG at 22° C. for 20 hours. We purified PTPs from cell lysate by using desalting, nickel affinity, and anion exchange chromatography (HiPrep 26/10, HisTrap HP, and HiPrep Q HP, respectively; GE Healthcare). We stored the final protein (30-50 μM) in HEPES buffer (50 mM, pH 7.5, 0.5 mM TCEP) in 20% glycerol at ˜80° C.
    Extraction and purification of terpenoids. We used hexane to extract terpenoids generated in liquid culture. For 10-mL cultures, we added 14 mL of hexane to 10 ml of culture broth in 125-mL glass shake flasks, shook the mixture (100 RPM) for 30 minutes, centrifuged it (4000×g), and withdrew 10 mL of the hexane layer for further analysis. For 4-mL cultures, we added 600 μL hexane to 1 mL of culture broth in a microcentrifuge tube, vortexed the tubes for 3 minutes, centrifuged the tubes for 1 minute (17000×g), and saved 300-400 μL of the hexane layer for further analysis.

    [0227] To purify AD, AB, and (+)-1(10),4-cadinadiene, we supplemented 500-1000 mL culture broth with hexane (16.7% v/v), shook the mixture for 30 minutes (100 RPM), isolated the hexane layer with a separatory funnel, centrifuged the isolated organic phase (4000×g), and withdrew the hexane layer. To concentrate the terpenoid products, we evaporated excess hexane in a rotary evaporator to bring the final volume to 500 μL, and we passed the resulting mixture over a silica gel 1-3 times (Sigma-Aldrich; high purity grade, 60 Å pore size, 230-400 mesh particle size). We analyzed elution fractions (100% hexane) on the GC/MS and pooled fractions with the compound of interest (AD). Once purified, we dried pooled fractions under a gentle stream of air, resuspended the concentrated terpenoids in DMSO, and quantified the final samples as outlined below. We repeated the purification process until samples (in DMSO) were >95% pure by GC/MS unless otherwise noted.

    GC-MS analysis of terpenoids. We measured terpenoids generated in liquid culture with a gas chromatograph/mass spectrometer (GC-MS; a Trace 1310 GC fitted with a TG5-SilMS column and an ISQ 7000 MS; Thermo Fisher Scientific). We prepared all samples in hexane (directly or through a 1:100 dilution of DMSO) with 20 μg/ml of caryophyllene as an internal standard. Highly concentrated samples were diluted 10-20× prior to preparation to bring concentrations within the MS detection limit. When the peak area of an internal standard exceeded ±40% of the average area of all samples containing that standard, we re-analyzed the corresponding samples. For all runs, we used the following GC method: hold at 80° C. (3 min), increase to 250° C. (15° C./min), hold at 250° C. (6 min), increase to 280° C. (30° C./min), and hold at 280° C. (3 min). To identify various analytes, we scanned m/z ratios from 50 to 550.

    [0228] We examined sesquiterpenes generated by variants of ADS by using select ion mode (SIM) to scan for the molecular ion (m/z=204). For quantification, we used Eq. 1: where A.sub.i

    [00002] C i = C std * A i A std * R ( Eq . 1 ) R = A std , o / C std , o A ref , o / C ref , o ( Eq . 2 )

    is the area of the peak produced by analyte i, A.sub.std is the area of the peak produced by C.sub.std of caryophyllene in the sample, and R is the ratio of response factors for caryophyllene and AD in a reference sample. TABLE 11 provides the concentrations of all standards and reference compounds used in this analysis.

    [0229] We quantified diterpenoids by, once again, accompanying our general procedure with several modifications: We scanned for a different molecular ion (m/z=272) and an ion common to both diterpenoids and caryophyllene (m/z=93); we used a ratio of response factors for pure taxadiene (a kind gift from Phil Baran) and caryophyllene at m/z=93; and we calculated peak areas m/z=93. For all analyses, we examined only peaks with areas that exceeded 1% of the total area of all peaks at m/z=272.

    [0230] We identified molecules by using the NIST MS library and, when necessary, confirmed this identification with analytical standards or mass spectra reported in the literature. We note: The assumption of a constant response factor for different terpenoids (that is, the assumption that all sesquiterpenes and diterpenes ionize like AD and taxadiene, respectively) can certainly yield error in estimates of their concentrations; our analyses, which are consistent with those of other studies of terpenoid production in microbial systems.sup.74,75, supply rough estimates of concentrations for all compounds except AD and taxadiene (which had analytical standards).

    Bioinformatics. We used a bioinformatic analysis to identify a phylogenetically diverse set of terpene synthases. Briefly, we downloaded (i) all constituent genes of PF03936 (the largest terpene synthase family grouped by a C-terminal domain) from the PFAM Database and (ii) all enzymes with Enzyme Commission (EC) number of 4.2.3.# from the Uniprot Database; this string, which defines carbon oxygen lyases that act on phosphates, includes terpene synthases. We cleaned both datasets in Excel (i.e., we ensured that every identifier had only one row), and we used a custom R script to designate each PF03936 member as characterized (i.e., in possession of a Uniprot-based EC number) or uncharacterized. Finally, we used FastTree.sup.76 with default settings to create a phylogenetic tree of the PF03936 family and the R-package ggtree.sup.77 to visualize the resulting tree and function data as a cladogram and heatmap.

    [0231] After annotating the cladogram by hand, we selected three genes from each of six clades: six with no characterized genes and two with some characterized genes. We avoided clades proximal to known monoterpene synthases or diterpene synthases known to act on GGPP isomers absent in our system (e.g., ent-copalyl diphosphate); these enzymes are unlikely to act on FPP, the primary product of pMBIS.sub.CmR. When selecting enzymes within clades, we biased our choice towards bacterial/fungal species and selected genes with a minimal number of common ancestors within the Glade. The selected genes were synthesized and cloned into the pTrc99a vector by Twist Biosciences and assayed for antibiotic resistance as described above.

    Enzyme kinetics. To examine terpenoid-mediated inhibition, we measured PTP-catalyzed hydrolysis of p-nitrophenyl phosphate (pNPP) or 4-methylumbelliferyl phosphate (4-MUP, used when KM for pNPP was large) in the presence of various concentrations of terpenoids. Each reaction included PTP (0.05 μM PTP1B/TCPTP or 0.1 μM SHP1/SHP2 in 50 mM HEPES, 0.5 mM TCEP, 50 μg/ml BSA), pNPP (0.33, 0.67, 2, 5, 10, and 15 mM) or 4-MUP (0.13, 0.27, 0.8, 2.27, 2.93, 4.53, 7.07, and 8 mM), inhibitor (with concentrations listed in the figures), buffer (50 mM HEPES pH=7.3, 50 μg/ml BSA), and DMSO at 10% v/v. We monitored the formation of p-nitrophenol by measuring absorbance at 405 nm every 10 seconds for 5 minutes on a SpectraMax M2 plate reader and the formation of 4-methylumbelliferyl by measuring fluorescence at 450 nm (370 nm ex, 435 nm cutoff, medium gain).

    [0232] We used a custom MATLAB script to process all raw kinetic data. This script removed all concentration values that fell outside of either (i) the range of our standard curve (absorbance/fluorescence vs. μM; FIG. 39) or (ii) the initial rate regime (>10% of the pNPP or 4-MUP concentration used in the assay). When this step reduced kinetic dataset to fewer than ten points, we re-measured those datasets to collect at least ten. We fit final datasets, in turn, with a linear regression model (using Matlab's backslash operator).

    [0233] We evaluated kinetic models in three steps: (i) We fit initial-rate measurements collected in the absence and presence of inhibitors to Michaelis-Menten and inhibition models, respectively (here, we used the nlinfit and fminsearch functions from MATLAB; TABLE 12). (ii) We used an F-test to compare the mixed model to the single-parameter model with the least sum squared error (here, we used the fcdf function from MATLAB to assign p-values), and we accepted the mixed model when p<0.05. (iii) We used the Akaike's Information Criterion (AIC) to compare the best-fit single parameter model to each alternative single parameter model, and we accepted the “best-fit” model when the difference in AIC (Δ.sub.i) exceed 5 for all comparisons..sup.78 We note: For AD, AB, and (+)1-(10),4-cadinadiene this criterion was not met; both noncompetitive and uncompetitive models, however, yielded indistinguishable IC.sub.50's.

    [0234] We estimated the half maximal inhibitory concentration (IC.sub.50) of inhibitors by using the best-fit kinetic models to determine the concentration of inhibitor required to reduce initial rates of PTP-catalyzed hydrolysis of 15 mM of pNPP by 50%. We used the MATLAB function “nlparci” to determine the confidence intervals of kinetic parameters, and we propagated those intervals to estimate corresponding confidence intervals for each IC.sub.50.

    X-ray crystallography. We prepared crystals of PTP1B by using hanging drop vapor diffusion. In brief, we added 2 μL of PTP1B (˜600 μM PTP1B, 50 mM HEPES, pH 7.3) to 6 μL of crystallization solution (100 mM HEPES, 200 mM magnesium acetate, and 14% polyethylene glycol 8000, pH 7.5) and incubated the resulting droplets over crystallization solution for one week at 4° C. (EasyXtal CrystalSupport, Qiagen). We soaked crystals with ligand by transferring them to droplets formed with 6 μL of crystallization solution and 1 μL of ligand solution (10 mM in DMSO), which we incubated for 2-5 days at 4° C. We prepared all ligands for freezing by soaking them in cryoprotectant formed from a 70/30 (v/v) mixture of buffer (100 mM HEPES, 200 mM magnesium acetate, and 25% polyethylene glycol 8000, pH 7.5) and glycerol.

    [0235] We collected X-ray diffraction data through the Collaborative Crystallography Program at Lawrence Berkeley National Lab (ALS ENABLE, beamline 8.2.1, 100 K, 1.00003 Å). We performed integration, scaling, and merging of X-ray diffraction data using the xia2 software package.sup.79, and we carried out molecular replacement and structure refinement with the PHENIX graphical interface,.sup.80 supplemented with manual model adjustment in COOT.sup.81 and one round of PDB-REDO.sup.82 (the latter, only for the PTP1B-AD complex).

    Molecular dynamics (MD) simulations. Full-length PTP1B contains a disordered region that extends beyond the α7 helix (i.e., 299-435). In this study, we used a well-studied truncation variant (i.e., PTP1B.sub.1-321) that includes residues from the disordered region. To model PTP1B, we used CAMPARI v.2.sup.83 to generate structures of the disordered region of each complex (i.e., residues 288-321 for PTP1B-AD) from a crystal structure without a disordered tail. To quickly thermalize the tail structures, we ran short Monte Carlo (MC) simulations using the ABSINTH implicit-solvent force field.sup.84,85, fixing the coordinates of the atoms in the ligand and the protein core.

    [0236] We performed MD simulations using GROMACS 2020.sup.86. Briefly, we used the CHARMM36m protein force field.sup.87, a CHARMM-modified TIP3P water model.sup.88, and ligand parameters generated by CGenFF.sup.89,90. We solvated each PTP1B-ligand complex (initialized from the corresponding crystal structure) in a dodecahedral box with edges positioned ≥10 Å from the surface of the complex, and we added six sodium ions to neutralize each system. We used the LINCS algorithm.sup.91 to constrain all bonds involving hydrogen atoms, the Verlet leapfrog algorithm to numerically integrate equations of motion with a 2-fs time step, and the particle-mesh Ewald summation.sup.92 (cubic interpolation with a grid spacing of 0.16 nm) to calculate long-range electrostatic interactions; we used a cutoff of 1.2 nm, in turn, for short-range electrostatic and Lennard-Jones interactions. We independently coupled the protein-ligand complex and solvent molecules to a temperature bath (300K) using a modified Berendsen thermostat.sup.93 with a relaxation time of 0.1 ps, and we fixed pressure coupling to 1 bar using the Parrinello-Rahman algorithm.sup.94 with a relaxation time of 2 ps and isothermal compressibility of 4.5×10.sup.−5 bar.sup.−1.

    [0237] For each system, we carried out 30 independent MD simulations to reduce sampling bias. For each MD trajectory, we minimized energy using the steepest decent method followed by 100-ps solvent relaxation in the NVT ensemble and 100-ps solvent relaxation in the NPT ensemble. After an additional 5-ns NPT equilibration, we carried out production runs for 5 ns in the NPT ensemble and registered coordinate data every 10 ps.

    Analysis of PTP1B inhibition in HEK293TCells. We prepared HEK293T/17 cells for an enzyme-linked immunosorbent assay (ELISA) by growing them in 75 cm.sup.2 culture flasks (Corning) with DMEM media supplemented with 10% FBS, 100 units/ml penicillin, and 100 units/ml streptomycin. We replaced the media every day for 3-5 days until the cells reached 80-100% confluency.

    [0238] We measured the influence of inhibitors on insulin receptor (IR) phosphorylation by using an IR-specific ELISA (FIG. 35). Briefly, we starved cells for 48 hours in FBS-free media and incubated the with inhibitors (all at 3% DMSO) for 10 minutes. After incubation, we lysed cells with lysis buffer (9803, Cell Signaling Technology) supplemented with 1× halt phosphatase inhibitor cocktail and 1× halt protease inhibitor cocktail (Thermo Fisher Scientific) for 10 min, pelleted the cell debris, and used the lysis buffer to dilute each sample to 60 mg/ml total protein. We measured IR phosphorylation in subsequent dilutions of the 60 mg/ml samples with the PathScan® Phospho-Insulin Receptor β (panTyr) Sandwich ELISA Kit (Cell Signaling Technology; #7082). We note: To identify biologically active concentrations of AB and AD, we screened several concentrations and chose those that gave the highest signal (405 μM for AB and 930 μM for AD); similar concentrations of weak inhibitors did not yield a detectable signal (FIGS. 35B and 35C).

    Statistical analysis and reproducibility. We determined statistical significance (FIG. 23H) with a two-tailed Student's t-test (details in TABLE 14), and we used an F-test to compare one- and two-parameter models of inhibition (TABLE 12).

    REFERENCES FOR EXAMPLE 2

    [0239] 1. Olsson, T. S. G., Williams, M. a., Pitt, W. R. & Ladbury, J. E. The Thermodynamics of Protein-Ligand Interaction and Solvation: Insights for Ligand Design. J. Mol. Biol. 384, 1002-1017 (2008). [0240] 2. Fox, J. M., Zhao, M., Fink, M. J., Kang, K. & Whitesides, G. M. The Molecular Origin of Enthalpy/Entropy Compensation in Biomolecular Recognition. Annu. Rev. Biophys. 47, (2018). [0241] 3. Mobley, D. L. & Gilson, M. K. Predicting Binding Free Energies: Frontiers and Benchmarks. Annu. Rev. Biophys. 46, 531-558 (2017). [0242] 4. Hert, J., Irwin, J. J., Laggner, C., Keiser, M. J. & Shoichet, B. K. Quantifying biogenic bias in screening libraries. Nat. Chem. Biol. 5, pages 479-483 (2009). [0243] 5. Smanski, M. J. et al. Synthetic biology to access and expand nature's chemical diversity. Nature Reviews Microbiology 14, 135-149 (2016). [0244] 6. Fürstenberg-Hägg, J., Zagrobelny, M. & Bak, S. Plant defense against insect herbivores. Int. J. Mol. Sci. 14, 10242-10297 (2013). [0245] 7. Maier, M. E. Design and synthesis of analogues of natural products. Organic and Biomolecular Chemistry 13, 5302-5343 (2015). [0246] 8. Chen, M. S. & White, M. C. A predictably selective aliphatic C—H oxidation reaction for complex molecule synthesis. Science (80-.). 318, 783-787 (2007). [0247] 9. Cho, I., Jia, Z. J. & Arnold, F. H. Site-selective enzymatic C—H amidation for synthesis of diverse lactams. Science (80-.). 364, 575-578 (2019). [0248] 10. Atanasov, A. G. et al. A Historical overview of natural products in drug discovery. Metabolites 33, 1582-1614 (2012). [0249] 11. Paul, S. M. et al. How to improve RD productivity: The pharmaceutical industry's grand challenge. Nature Reviews Drug Discovery 9, 203-214 (2010). [0250] 12. Li, J. W. H. & Vederas, J. C. Drug discovery and natural products: End of era or an endless frontier? Biomeditsinskaya Khimiya 57, 148-160 (2011). [0251] 13. Jensen, P. R., Chavarria, K. L., Fenical, W., Moore, B. S. & Ziemert, N. Challenges and triumphs to genomics-based natural product discovery. J. Ind. Microbiol. Biotechnol. 41,203-209 (2014). [0252] 14. Medema, M. H. et al. AntiSMASH: Rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, W339-W346 (2011). [0253] 15. Jensen, P. R. Natural Products and the Gene Cluster Revolution. Trends Microbiol. 24, 968-977 (2016). [0254] 16. Yan, Y. et al. Resistance-gene-directed discovery of a natural-product herbicide with a new mode of action. Nature 559, 415-418 (2018). [0255] 17. Culp, E. J. et al. Evolution-guided discovery of antibiotics that inhibit peptidoglycan remodelling. Nature 578, 582-587 (2020). [0256] 18. Zhabinskii, V. N., Khripach, N. B. & Khripach, V. A. Steroid plant hormones: Effects outside plant kingdom. Steroids 97, 87-97 (2015). [0257] 19. Li, Y. et al. Complete biosynthesis of noscapine and halogenated alkaloids in yeast. Proc. Natl. Acad. Sci. U S. A. 115, E3922-E3931 (2018). [0258] 20. Luo, X. et al. Complete biosynthesis of cannabinoids and their unnatural analogues in yeast. Nature 567, 123-126 (2019). [0259] 21. He, R., Yu, Z., Zhang, R. & Zhang, Z. Protein tyrosine phosphatases as potential therapeutic targets. Acta Pharmacol. Sin. 35, 1227-1246 (2014). [0260] 22. Paul, M. K. & Mukhopadhyay, A. K. Tyrosine kinase—Role and significance in Cancer. Int. J. Med. Sci. 1, 101-115 (2012). [0261] 23. Ferguson, F. M. & Gray, N. S. Kinase inhibitors: The road ahead. Nature Reviews Drug Discovery 17,353-376 (2018). [0262] 24. Stanford, S. M. & Bottini, N. Targeting Tyrosine Phosphatases: Time to End the Stigma. Trends in Pharmacological Sciences 38, 524-540 (2017). [0263] 25. Krishnan, N. et al. Targeting the disordered C terminus of PTP1B with an allosteric inhibitor. Nat. Chem. Biol. 10, 558-566 (2014). [0264] 26. Barr, A. J. et al. Large-Scale Structural Analysis of the Classical Human Protein Tyrosine Phosphatome. Cell 136, 352-363 (2009). [0265] 27. Banno, R. et al. PTP1B and SHP2 in POMC neurons reciprocally regulate energy balance in mice. J. Clin. Invest. 120, 720-734 (2010). [0266] 28. Zabolotny, J. M. et al. Protein-tyrosine phosphatase 1B expression is induced by inflammation in vivo. J. Biol. Chem. 283, 14230-14241 (2008). [0267] 29. Matulka, K. et al. PTP1B is an effector of activin signaling and regulates neural specification of embryonic stem cells. Cell Stem Cell 13, 706-719 (2013). [0268] 30. Zhang, H., Wang, Y., Wu, J., Skalina, K. & Pfeifer, B. A. Complete biosynthesis of erythromycin A and designed analogs using E. coli as a heterologous host. Chem. Biol. 17, 1232-1240 (2010). [0269] 31. Antosch, J., Schaefers, F. & Guider, T. A. M. Heterologous Reconstitution of Ikarugamycin Biosynthesis in E. coli. Angew. Chemie Int. Ed. 53, 3011-3014 (2014). [0270] 32. Montalibet, J. & Kennedy, B. P. Using yeast to screen for inhibitors of protein tyrosine phosphatase 1B. Biochem. Pharmacol. 68, 1807-1814 (2004). [0271] 33. Piserchio, A., Cowburn, D. & Ghose, R. Expression and purification of Src-family kinases for solution NMR studies. Methods Mol. Biol. 831, 111-131 (2012). [0272] 34. Badran, A. H. et al. Continuous evolution of Bacillus thuringiensis toxins overcomes insect resistance. Nature 533, 58-63 (2016). [0273] 35. Kaneko, T. et al. Superbinder SH2 domains act as antagonists of cell signaling. Sci. Signal. 5, ra68-ra68 (2012). [0274] 36. Jiang, C. S., Liang, L. F. & Guo, Y. W. Natural products possessing protein tyrosine phosphatase 1B (PTP1B) inhibitory activity found in the last decades. Acta Pharmacologica Sinica (2012). doi:10.1038/aps.2012.90 [0275] 37. Hjortness, M. K. et al. Abietane-Type Diterpenoids Inhibit Protein Tyrosine Phosphatases by Stabilizing an Inactive Enzyme Conformation. Biochemistry 57, 5886-5896 (2018). [0276] 38. Christianson, D. W. Structural and Chemical Biology of Terpenoid Cyclases. Chem. Rev. 106, 3412-3442 (2006). [0277] 39. Newman, D. J. & Cragg, G. M. Natural Products as Sources of New Drugs from 1981 to 2014. Journal of Natural Products 79, 629-661 (2016). [0278] 40. Martin, V. J. J., Pitera, D. J., Withers, S. T., Newman, J. D. & Keasling, J. D. Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nat. Biotechnol. 21, 796-802 (2003). [0279] 41. Morrone, D. et al. Increasing diterpene yield with a modular metabolic engineering system in E. coli: Comparison of MEV and MEP isoprenoid precursor pathway engineering. Appl. Microbiol. Biotechnol. 85, 1893-1906 (2010). [0280] 42. Williams, D. C. et al. Heterologous expression and characterization of a ‘pseudomature’ form of taxadiene synthase involved in paclitaxel (Taxol) biosynthesis and evaluation of a potential intermediate and inhibitors of the multistep diterpene cyclization reaction. Arch. Biochem. Biophys. (2000). doi:10.1006/abbi.2000.1865 [0281] 43. Yoshikuni, Y., Ferrin, T. E. & Keasling, J. D. Designed divergent evolution of enzyme function. Nature 440, 1078-1082 (2006). [0282] 44. Peralta-Yahya, P. P. et al. Identification and microbial production of a terpene-based advanced biofuel. Nat. Commun. (2011). doi:10.1038/ncomms1494 [0283] 45. Wiesmann, C. et al. Allosteric inhibition of protein tyrosine phosphatase 1B. Nat. Struct. Mol. Biol. 11, 730-737 (2004). [0284] 46. Zhang, C., Chen, X., Stephanopoulos, G. & Too, H. P. Efflux transporter engineering markedly improves AD production in Escherichia coli. Biotechnol. Bioeng. (2016). doi:10.1002/bit.25943 [0285] 47. Keedy, D. A. et al. An expanded allosteric network in PTP1B by multitemperature crystallography, fragment screening, and covalent tethering. Elife 7, doi: 10.7554/eLife.36307 (2018). [0286] 48. Vallurupalli, P., Bouvignies, G. & Kay, L. E. Studying ‘invisible’ excited protein states in slow exchange with a major state conformation. J. Am. Chem. Soc. 134, 8148-8161 (2012). [0287] 49. Amamuddy, O. S. et al. Integrated computational approaches and tools for allosteric drug discovery. Int. J Mol. Sci. 21, 847 (2020). [0288] 50. Shimada, T. et al. Selectivity of Polycyclic Inhibitors for Human Cytochrome P450s 1A1, 1A2, and 1B1. Chem. Res. Toxicol. 11, 1048-1056 (1998). [0289] 51. Goldstein, B. J., Bittner-Kowalczyk, A., White, M. F. & Harbeck, M. Tyrosine dephosphorylation and deactivation of insulin receptor substrate-1 by protein-tyrosine phosphatase 1B. Possible facilitation by the formation of a ternary complex with the GRB2 adaptor protein. J. Biol. Chem. 275, 4283-4289 (2000). [0290] 52. Choi, E. et al. Mitotic regulators and the SHP2-MAPK pathway promote IR endocytosis and feedback regulation of insulin signaling. Nat. Commun. 10, (2019). [0291] 53. Dubois, M. J. et al. The SHP-1 protein tyrosine phosphatase negatively modulates glucose homeostasis. Nat. Med. 12,549-556 (2006). [0292] 54. Hubert, J., Nuzillard, J. M. & Renault, J. H. Dereplication strategies in natural product research: How many tools and methodologies behind the same concept? Phytochemistry Reviews 16, 55-95 (2017). [0293] 55. Manguso, R. T. et al. In vivo CRISPR screening identifies Ptpn2 as a cancer immunotherapy target. Nature 547, 413-418 (2017). [0294] 56. Varone, A., Spano, D. & Corda, D. Shpl in Solid Cancers and Their Therapy. Frontiers in Oncology 10, 935 (2020). [0295] 57. Yang, C. F. et al. Targeting protein tyrosine phosphatase PTP-PEST (PTPN12) for therapeutic intervention in acute myocardial infarction. Cardiovasc. Res. 116, 1032-1046 (2020). [0296] 58. Zhang, S. & Zhang, Z. Y. PTP1B as a drug target: recent developments in PTP1B inhibitor discovery. Drug Discov. Today 12, 373-381 (2007). [0297] 59. Oleinikovas, V., Saladino, G., Cossins, B. P. & Gervasio, F. L. Understanding Cryptic Pocket Formation in Protein Targets by Enhanced Sampling Simulations. J. Am. Chem. Soc. 138, 14257-14263 (2016). [0298] 60. Rutledge, P. J. & Challis, G. L. Discovery of microbial natural products by activation of silent biosynthetic gene clusters. Nature Reviews Microbiology 13, 509-523 (2015). [0299] 61. Hartenfeller, M. & Schneider, G. De Novo Drug Design. in Chemoinformatics and Computational Chemical Biology (ed. Bajorath, J.) 299-323 (Humana Press, 2011). doi:10.1007/978-1-60761-839-3_12 [0300] 62. Packer, M. S. & Liu, D. R. Methods for the directed evolution of proteins. Nat. Rev. Genet. 16, 379-394 (2015). [0301] 63. Johnston, C. W., Badran, A. H. & Collins, J. J. Continuous bioactivity-dependent evolution of an antibiotic biosynthetic pathway. Nat. Commun. 11, 4202 (2020). [0302] 64. Chen, M. J., Dixon, J. E. & Manning, G. Genomics and evolution of protein phosphatases. Sci. Signal. 10, 1-17 (2017). [0303] 65. Galanie, S. et al. Complete biosynthesis of opioids in yeast. Science (80-.). 349,1095-1100 (2015). [0304] 66. Paddon, C. J. & Keasling, J. D. Semi-synthetic artemisinin: a model for the use of synthetic biology in pharmaceutical development. Nat. Rev. Microbiol. 12,355-367 (2014). [0305] 67. Grangeasse, C., Nessler, S. & Mijakovic, I. Bacterial tyrosine kinases: Evolution, biological function and structural insights. Philos. Trans. R. Soc. B Biol. Sci. 367, 2640-2655 (2012). [0306] 68. Montalibet, J. et al. Residues distant from the active site influence protein-tyrosine phosphatase 1B inhibitor binding. J. Biol. Chem. 281,5258-5266 (2006). [0307] 69. Douzery, E. J. P., Snell, E. A., Bapteste, E., Delsuc, F. & Philippe, H. The timing of eukaryotic evolution: Does a relaxed molecular clock reconcile proteins and fossils? Proc. Natl. Acad. Sci. U.S.A. 101, 15386-15391 (2004). [0308] 70. O'Brien, K. P., Remm, M. & Sonnhammer, E. L. L. Inparanoid: A comprehensive database of eukaryotic orthologs. Nucleic Acids Res. 33, D476-D480 (2005). [0309] 71. Kachroo, A. H. et al. Systematic humanization of yeast genes reveals conserved functions and genetic modularity. Science (80-.). 348, 921-925 (2015). [0310] 72. Carlson, J. C., Badran, A. H., Guggiana-Nilo, D. A. & Liu, D. R. Negative selection and stringency modulation in phage-assisted continuous evolution. Nat. Chem. Biol. 10, 216-222 (2014). [0311] 73. Hjortness, M. K. et al. Evolutionarily Conserved Allosteric Communication in Protein Tyrosine Phosphatases. Biochemistry 57, 6443-6451 (2018). [0312] 74. Chen, X. et al. Statistical experimental design guided optimization of a one-pot biphasic multienzyme total synthesis of amorpha-4,11-diene. PLoS One 8, e79650 (2013). [0313] 75. Edgar, S. et al. Mechanistic Insights into Taxadiene Epoxidation by Taxadiene-5α-Hydroxylase. ACS Chem. Biol. 11, 460-469 (2016). [0314] 76. Price, M. N., Dehal, P. S. & Arkin, A. P. FastTree 2—Approximately maximum-likelihood trees for large alignments. PLoS One 5, e9490 (2010). [0315] 77. Yu, G., Smith, D. K., Zhu, H., Guan, Y. & Lam, T. T. Y. ggtree: an r package for visualization and annotation of phylogenetic trees with their covariates and other associated data. Methods Ecol. Evol. 8, 28-36 (2017). [0316] 78. Burnham, K. P. & Anderson, D. R. Model Selection and Multimodel Inference: a Practical Information-theoretic Approach, 2nd edn. Springer-Verlag, New York. New York Springer 60, (2002). [0317] 79. Winter, G. Xia2: An expert system for macromolecular crystallography data reduction. J. Appl. Crystallogr. 43, 186-190 (2010). [0318] 80. Afonine, P. V et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr. D. Biol. Crystallogr. 68, 352-67 (2012). [0319] 81. Emsley, P. & Cowtan, K. Coot: Model-building tools for molecular graphics. Acta Crystallogr. Sect. D Biol. Crystallogr. 60, 2126-2132 (2004). [0320] 82. Joosten, R. P., Long, F., Murshudov, G. N. & Perrakis, A. The PDB REDO server for macromolecular structure model optimization. IUCrJ 1, 213-220 (2014). [0321] 83. Vitalis, A. & Pappu, R. V. Chapter 3 Methods for Monte Carlo Simulations of Biomacromolecules. in (ed. Wheeler, R. A. B. T.-A. R. in C. C.) 5, 49-76 (Elsevier, 2009). [0322] 84. Vitalis, A. & Pappu, R. V. ABSINTH: A new continuum solvation model for simulations of polypeptides in aqueous solutions. J. Comput. Chem. 30, 673-699 (2009). [0323] 85. Choi, J.-M. & Pappu, R. V. Improvements to the ABSINTH Force Field for Proteins Based on Experimentally Derived Amino Acid Specific Backbone Conformational Statistics. J. Chem. Theory Comput. 15, 1367-1382 (2019). [0324] 86. Abraham, M. J. et al. Gromacs: High performance molecular simulations through multi-level parallelism from laptops to supercomputers. SoftwareX 1, 19-25 (2015). [0325] 87. Huang, J. et al. CHARMM36m: An improved force field for folded and intrinsically disordered proteins. Nat. Methods 14, 71-73 (2016). [0326] 88. MacKerell, A. D. et al. All-atom empirical potential for molecular modeling and dynamics studies of proteins. J. Phys. Chem. B 102, 3586-3616 (1998). [0327] 89. Vanommeslaeghe, K. et al. CHARMM general force field: A force field for drug-like molecules compatible with the CHARMM all-atom additive biological force fields. J. Comput. Chem. 31, 671-690 (2010). [0328] 90. Yu, W., He, X., Vanommeslaeghe, K. & MacKerell, A. D. Extension of the CHARMM general force field to sulfonyl-containing compounds and its utility in biomolecular simulations. J. Comput. Chem. 33, 2451-2468 (2012). [0329] 91. Hess, B., Bekker, H., Berendsen, H. J. C. & Fraaije, J. G. E. M. LINCS: A linear constraint solver for molecular simulations. J. Comput. Chem. 18, 1463-1472 (1997). [0330] 92. Darden, T., York, D. & Pedersen, L. Particle mesh Ewald: An N.Math.log(N) method for Ewald sums in large systems. J. Chem. Phys. 98, 10089 (1993). [0331] 93. Bussi, G., Donadio, D. & Parrinello, M. Canonical sampling through velocity rescaling. J. Chem. Phys. 126, 014101 (2007). [0332] 94. Parrinello, M. Polymorphic transitions in single crystals: A new molecular dynamics method. J. Appl. Phys. 52, 7182 (1981). [0333] 95. Li, H. et al. Crystal Structure and Substrate Specificity of PTPN12. Cell Rep. (2016). doi:10.1016/j.celrep.2016.04.016 [0334] 96. Paling, N. R. D. & Welham, M. J. Role of the protein tyrosine phosphatase SHP-1 (Src homology phosphatase-1) in the regulation of interleukin-3-induced survival, proliferation and signalling. Biochem. J. 368, 885-894 (2002). [0335] 97. Van Vliet, C. et al. Selective regulation of tumor necrosis factor-induced Erk signaling by Src family kinases and the T cell protein tyrosine phosphatase. Nat. Immunol. 6, 253-260 (2005).

    Tables

    [0336]

    TABLE-US-00001 TABLE 1 Gene Sources Component Organism Plasmid Source Src H. sapiens pDONR223_ Addgene: 82165 SRC_WT CDC37 H. sapiens pBACgus4x/ Addgene: 40398 cdc37/ RocCOR LRRK2 1867-2176 PTP1B H. sapiens pGEX-2T Addgene: 8602 PTP-1B SHP2 H. sapiens PTPN11 Addgene: 38965 TC-PTP H. sapiens pBG100- Addgene: 33365 TCPTP LuxAB pAB078d8 Addgene: 79206 RpoZ Escherichia pAB094a Addgene: 79241 coli cI434 Escherichia pAB078d8 Addgene: 79206 virus Lambda SH2 Rous Addgene: 78302 sarcoma virus p130cas H. sapiens Synthetic Integrated DNA Technologies, Inc. midT H. sapiens Synthetic Integrated DNA Technologies, Inc. EGFR H. sapiens Synthetic Integrated DNA Technologies, Inc. ShcA H. sapiens Synthetic Integrated DNA Technologies, Inc. MBIS S. cerevisiae pMBIS Addgene: 17817 ADS Artemisia pADS Addgene: 19040 annua GHS Abies grandis pTrcHUM Addgene: 19003 ABS Abies grandis pSBET/ Ruben Peters, Iowa AgAs State University TXS Taxus M60 David W. brevifola Christianson, University of Pennsylvania GGPPS Taxus gBlock Integrated DNA Canadensis Technologies, Inc.

    TABLE-US-00002 TABLE 2 Plasmids Anti- Add- Plasmid Description biotic* gene F-plasmid The F-plasmid from the T 105063 S1030 strain of E. coli. pB2H.sub.1b An early version of B2H that K TBD lacks PTP1B and contains LuxAB as the GOT pBAD.sub.1b.Src Enables inducible expression P TBD of Src and CDC37 pBAD.sub.1b.SH2 Enables inducible expression P TBD of the SH2 domain. pBAD.sub.1b.S Enables inducible expression P TBD of the substrate domain. pBAD.sub.1b.All Enables inducible expression P TBD of Src, CDC37, the SH2 domain, and the substrate domain. pB2H.sub.1c.p130cas An early version of B2H that (i) K TBD lacks PTP1B and Src, (ii) contains LuxAB, and (iii) includes a substrate from p130cas. pB2H.sub.1c.midT An early version of B2H that (i) K TBD lacks PTP1B and Src, (ii) contains LuxAB, and (iii) includes a substrate from midT. pB2H.sub.1c.ShcA An early version of B2H that (i) K TBD lacks PTP1B and Src, (ii) contains LuxAB, and (iii) includes a substrate from ShCA. pB2H.sub.1c.EGFR An early version of B2H that (i) K TBD lacks PTP1B and Src, (ii) contains LuxAB, and (iii) includes a substrate from EGFR. pBAD.sub.1c Enables inducible expression P TBD of Src and CDC37. pBAD.sub.1d Enables inducible expression P TBD of Src and PTP1B. pBAD.sub.1d.mut Enables inducible expression P TBD of Src and catalytically inactive PTP1B (C215S). pB2H.sub.S1.1Pro1 An early version of B2H that (i) K TBD lacks PTP1B, (ii) contains LuxAB, (iii) places expression of Src, CDC37, the SH2 domain, and the substrate domain under control of the same Pro1 promoter, and (iv) uses the BB034 RBS for Src. pB2H.sub.S1.1Pro1. Identical to pB2H.sub.S1.1Pro1 K TBD .sub.mut except for a mutation in the substrate (Y4F) pB2H.sub.S1.1ProD An early version of B2H that (i) K TBD lacks PTP1B, (ii) contains LuxAB, and (iii) includes the ProD promoter and pro RBS for Src. pB2H.sub.S1.1ProD. Identical to pB2H.sub.S1.1ProD K TBD .sub.mut except for a mutation in the substrate (Y4F) pB2H.sub.S1.2pro An early version of B2H that K TBD (i) lacks PTP1B, (ii) contains LuxAB, and (iii) includes the pro RBS for Src. pB2H.sub.S1.2pro. Identical to pB2H.sub.S1.2pro K TBD .sub.mut except for a mutation in the substrate (Y4F) pB2H.sub.S1.2Sal28 An early version of B2H that (i) K TBD lacks PTP1B, (ii) contains LuxAB, and (iii) includes the Sal28 RBS for Src. pB2H.sub.S1.2Sal28. Identical to pB2H.sub.S1.2Sal28 except K TBD .sub.mut for a mutation in the substrate (Y4F) pB2H.sub.S1.3RBS30 An early version of B2H that K TBD (i) contains LuxAB and (ii) includes the bb030 RBS for PTP1B. pB2H.sub.S1.3RBS30 Identical to pB2H.sub.S1.3RBS30 K TBD except for a mutation in the substrate (Y4F) pB2H.sub.S1.3RBS34 An early version of B2H that K TBD (i) contains LuxAB and (ii) includes the bb034 RBS for PTP1B. pB2H.sub.S1.3RBS34 Identical to pB2H.sub.S1.3RBS34 K TBD except for a mutation in the substrate (Y4F) pB2H.sub.S2RBS30 An early version of B2H that K TBD (i) contains SpecR and (ii) includes the bb030 RBS for PTP1B. pB2H.sub.S2RBS30. Identical to pB2H.sub.S2RBS30 K TBD .sub.mut except for an inactivating mutation in PTP1B (C215S) pB2H.sub.opt Final, optimized B2H that K TBD (i) contains SpecR and (ii) includes the bb034 RBS for PTP1B. pB2H.sub.opt* Identical to pB2H.sub.opt except for K TBD an inactivating mutation in PTP1B (C215S) pB2H.sub.optX K TBD pMBIS A plasmid that harbors genes T 17817 for the mevalonate- dependent isoprenoid pathway from S. cerevisiae and harbors a tetracycline resistance marker. pMBIS.sub.CmR A plasmid that harbors P TBD genes for the mevalonate- dependent isoprenoid pathway from S. cerevisiae and harbors a chloramphenicol resistance marker. pTrc99t A pTrc99a variant with BsaI C TBD removed for use in Golden Gate cloning PTS.sub.ADS A plasmid that harbors ADS. C TBD PTS.sub.ADS(G349A) A plasmid that harbors ADS (G349A). C TBD PTS.sub.ADS(G400C) A plasmid that harbors ADS (G400C). C TBD PTS.sub.ADS(D299A) A plasmid that harbors ADS C TBD (D299A, inactivating). PTS.sub.ADS(F514E) A plasmid that harbors ADS (F514E). C TBD pTS.sub.ADS(G400L) A plasmid that harbors ADS (G400L). C TBD PTS.sub.ADS(F514S) A plasmid that harbors ADS (F514S). C TBD PTS.sub.ADS(F514V) A plasmid that harbors ADS (F514V). C TBD pTS.sub.ADS(V292I) A plasmid that harbors ADS (V292I). C TBD PTS.sub.ADS(I90S/ A plasmid that harbors ADS C TBD .sub.F340S) (I90S/F340S). PTS.sub.ADS(I490V/ A plasmid that harbors ADS C TBD .sub.M528K) (I490V/M528K). PTS.sub.ADS(G34S/ A plasmid that harbors ADS C TBD .sub.K51N) (G34S/K51N). pTS.sub.ADSF370Y A plasmid that harbors ADS (F370Y). C TBD PTS.sub.ADSR527L A plasmid that harbors ADS (R527L). C TBD pTS.sub.GHS A plasmid that harbors GHS. C TBD pTS.sub.GHS(BFN) A plasmid that harbors GHS C TBD (W315P). PTS.sub.GHS(SIB) A plasmid that harbors GHS C TBD (F312Q/M339A/M447F). PTS.sub.GHS(HUM) A plasmid that harbors GHS C TBD (M339N/S484C/M565I). pTS.sub.GHS(BBA) A plasmid that harbors GHS C TBD (A336V/M447H/I562T). pTS.sub.GHS(ALP) A plasmid that harbors GHS C TBD (A336C/T445C/S484C/ I562L/M565L). pTS.sub.GHS(LFN) A plasmid that harbors GHS C TBD (A317N/A337S/S484C/I562V). pTS.sub.GHS(A319Q) A plasmid that harbors GHS C TBD (A319Q). pTSGHS A plasmid that harbors GHS (S561C). C TBD (S561C) pTSGHS A plasmid that harbors GHS C TBD (Y415C) (Y415C). pTS.sub.GHS(S484L) A plasmid that harbors GHS (S484L). C TBD PTS.sub.GHS(450Y) A plasmid that harbors GHS (L450Y). C TBD PTS.sub.GHS(450G) A plasmid that harbors GHS (L450G). C TBD PTS.sub.GHS(450K) A plasmid that harbors GHS (L450K). C TBD PTS.sub.GHS(450T) A plasmid that harbors GHS (L450T). C TBD pTS.sub.GHS(T455I) A plasmid that harbors GHS (T455I). C TBD PTS.sub.ABS A plasmid that harbors C TBD ABS and GGPPS. PTS.sub.TXS A plasmid that harbors C TBD TXS and GGPPS. *Antibiotic resistance: carbenicillin (C, 50 μg/ml), kanamycin (K, 50 μg/ml), tetracycline (T, 10 μg/ml), chloramphenicol (P, 34 μg/ml), and spectinomycin (S, conditional).

    TABLE-US-00003 TABLE 3 Components of various B2H systems. DNA Amino Acid SEQ SEQ Component Name ID NO: DNA ID NO: Amino Acid Kinase c-Src  3 ATGGGCTCCAAGCCGCAGACTCAGG 21 MGSKPQTQGLAKDAWEIP GCCTGGCCAAGGATGCCTGGGAGAT RESLRLEVKLGQGCFGEV CCCTCGGGAGTCGCTGCGGCTGGAG WMGTWNGTTRVAIKTLKP GTCAAGCTGGGCCAGGGCTGCTTTG GTMSPEAFLQEAQVMKKL GCGAGGTGTGGATGGGGACCTGGAA RHEKLVQLYAVVSEEPIYIV CGGTACCACCAGGGTGGCCATCAAA TEYMSKGSLLDFLKGETGK ACCCTGAAGCCTGGCACGATGTCTC YLRLPQLVDMAAQIASGM CAGAGGCCTTCCTGCAGGAGGCCCA AYVERMNYVHRDLRAANI GGTCATGAAGAAGCTGAGGCATGAG LVGENLVCKVADFGLARLI AAGCTGGTGCAGTTGTATGCTGTGG EDNEYTARQGAKFPIKWTA TTTCAGAGGAGCCCATTTACATCGT PEAALYGRFTIKSDVWSFGI CACGGAGTACATGAGCAAGGGGAG LLTELTTKGRVPYPGMVNR TTTGCTGGACTTTCTCAAGGGGGAG EVLDQVERGYRMPCPPECP ACAGGCAAGTACCTGCGGCTGCCTC ESLHDLMCQCWRKEPEERP AGCTGGTGGACATGGCTGCTCAGAT TFEYLQAFLEDYFTSTEPQY CGCCTCAGGCATGGCGTACGTGGAG QPGENL* CGGATGAACTACGTCCACCGGGACC TTCGTGCAGCCAACATCCTGGTGGG AGAGAACCTGGTGTGCAAAGTGGCC GACTTTGGGCTGGCTCGGCTCATTG AAGACAATGAGTACACGGCGCGGC AAGGTGCCAAATTCCCCATCAAGTG GACGGCTCCAGAAGCTGCCCTCTAT GGCCGCTTCACCATCAAGTCGGACG TGTGGTCCTTCGGGATCCTGCTGACT GAGCTCACCACAAAGGGACGGGTGC CCTACCCTGGGATGGTGAACCGCGA GGTGCTGGACCAGGTGGAGCGGGGC TACCGGATGCCCTGCCCGCCGGAGT GTCCCGAGTCCCTGCACGACCTCAT GTGCCAGTGCTGGCGGAAGGAGCCT GAGGAGCGGCCCACCTTCGAGTACC TGCAGGCCTTCCTGGAGGACTACTT CACGTCCACCGAGCCCCAGTACCAG CCCGGGGAGAACCTCTAA Chaperone CDC37  4 ATGGTGGACTACAGCGTGTGGGACC 22 MVDYSVWDHIEVSDDEDE ACATTGAGGTGTCTGATGATGAAGA THPNIDTASLFRWRHQARV CGAGACGCACCCCAACATCGACACG ERMEQFQKEKEELDRGCRE GCCAGTCTCTTCCGCTGGCGGCATC CKRKVAECQRKLKELEVA AGGCCCGGGTGGAACGCATGGAGC EGGKAELERLQAEAQQLR AGTTCCAGAAGGAGAAGGAGGAAC KEERSWEQKLEEMRKKEK TGGACAGGGGCTGCCGCGAGTGCAA SMPWNVDTLSKDGFSKSM GCGCAAGGTGGCCGAGTGCCAGAG VNTKPEKTEEDSEEVREQK GAAACTGAAGGAGCTGGAGGTGGC HKTFVEKYEKQIKHFGMLR CGAGGGCGGCAAGGCAGAGCTGGA RWDDSQKYLSDNVHLVCE GCGCCTGCAGGCCGAGGCACAGCAG ETANYLVIWCIDLEVEEKC CTGCGCAAGGAGGAGCGGAGCTGG ALMEQVAHQTIVMQFILEL GAGCAGAAGCTGGAGGAGATGCGC AKSLKVDPRACFRQFFTKI AAGAAGGAGAAGAGCATGCCCTGG KTADRQYMEGFNDELEAF AACGTGGACACGCTCAGCAAAGACG KERVRGRAKLRIEKAMKE GCTTCAGCAAGAGCATGGTAAATAC YEEEERKKRLGPGGLDPVE CAAGCCCGAGAAGACGGAGGAGGA VYESLPEELQKCFDVKDVQ CTCAGAGGAGGTGAGGGAGCAGAA MLQDAISKMDPTDAKYHM ACACAAGACCTTCGTGGAAAAATAC QRCIDSGLWVPNSKASEAK GAGAAACAGATCAAGCACTTTGGCA EGEEAGPGDPLLEAVPKTG TGCTTCGCCGCTGGGATGACAGCCA DEKDVSV* AAAGTACCTGTCAGACAACGTCCAC CTGGTGTGCGAGGAGACAGCCAATT ACCTGGTCATTTGGTGCATTGACCTA GAGGTGGAGGAGAAATGTGCACTCA TGGAGCAGGTGGCCCACCAGACAAT CGTCATGCAATTTATCCTGGAGCTG GCCAAGAGCCTAAAGGTGGACCCCC GGGCCTGCTTCCGGCAGTTCTTCACT AAGATTAAGACAGCCGATCGCCAGT ACATGGAGGGCTTCAACGACGAGCT GGAAGCCTTCAAGGAGCGTGTGCGG GGCCGTGCCAAGCTGCGCATCGAGA AGGCCATGAAGGAGTACGAGGAGG AGGAGCGCAAGAAGCGGCTCGGCC CCGGCGGCCTGGACCCCGTCGAGGT CTACGAGTCCCTCCCTGAGGAACTC CAGAAGTGCTTCGATGTGAAGGACG TGCAGATGCTGCAGGACGCCATCAG CAAGATGGACCCCACCGACGCAAAG TACCACATGCAGCGCTGCATTGACT CTGGCCTCTGGGTCCCCAACTCTAA GGCCAGCGAGGCCAAGGAGGGAGA GGAGGCAGGTCCTGGGGACCCATTA CTGGAAGCTGTTCCCAAGACGGGCG ATGAGAAGGATGTCAGTGTGTAA Phosphatase PTP1B  5 ATGGAGATGGAAAAGGAGTTCGAG 23 MEMEKEFEQIDKSGSWAAI CAGATCGACAAGTCCGGGAGCTGGG YQDIRHEASDFPCRVAKLP CGGCCATTTACCAGGATATCCGACA KNKNRNRYRDVSPFDHSRI TGAAGCCAGTGACTTCCCATGTAGA KLHQEDNDYINASLIKMEE GTGGCCAAGCTTCCTAAGAACAAAA AQRSYILTQGPLPNTCGHF ACCGAAATAGGTACAGAGACGTCAG WEMVWEQKSRGVVMLNR TCCCTTTGACCATAGTCGGATTAAA VMEKGSLKCAQYWPQKEE CTACATCAAGAAGATAATGACTATA KEMIFEDTNLKLTLISEDIK TCAACGCTAGTTTGATAAAAATGGA SYYTVRQLELENLTTQETR AGAAGCCCAAAGGAGTTACATTCTT EILHFHYTTWPDFGVPESPA ACCCAGGGCCCTTTGCCTAACACAT SFLNFLFKVRESGSLSPEHG GCGGTCACTTTTGGGAGATGGTGTG PVVVHCSAGIGRSGTFCLA GGAGCAGAAAAGCAGGGGTGTCGT DTCLLLMDKRKDPSSVDIK CATGCTCAACAGAGTGATGGAGAAA KVLLEMRKFRMGLIQTAD GGTTCGTTAAAATGCGCACAATACT QLRFSYLAVIEGAKFIMGD GGCCACAAAAAGAAGAAAAAGAGA SSVQDQWKELSHEDLEPPP TGATCTTTGAAGACACAAATTTGAA EHIPPPPRPPKRILEPHN* ATTAACATTGATCTCTGAAGATATC AAGTCATATTATACAGTGCGACAGC TAGAATTGGAAAACCTTACAACCCA AGAAACTCGAGAGATCTTACATTTC CACTATACCACATGGCCTGACTTTG GAGTCCCTGAATCACCAGCCTCATT CTTGAACTTTCTTTTCAAAGTCCGAG AGTCAGGGTCACTCAGCCCGGAGCA CGGGCCCGTTGTGGTGCACTGCAGT GCAGGCATCGGCAGGTCTGGAACCT TCTGTCTGGCTGATACCTGCCTCTTG CTGATGGACAAGAGGAAAGACCCTT CTTCCGTTGATATCAAGAAAGTGCT GTTAGAAATGAGGAAGTTTCGGATG GGGCTGATCCAGACAGCCGACCAGC TGCGCTTCTCCTACCTGGCTGTGATC GAAGGTGCCAAATTCATCATGGGGG ACTCTTCCGTGCAGGATCAGTGGAA GGAGCTTTCCCACGAGGACCTGGAG CCCCCACCCGAGCATATCCCCCCAC CTCCCCGGCCACCCAAACGAATCCT GGAGCCACACAATTGA Substrate p130cas  6 TGGATGGAGGACTATGACTACGTCC 24 WMEDYDYVHLQG ACCTACAGGGG Substrate midT  7 GAACCGCAGTATGAAGAAATTCCGA 25 EPQYEEIPIYL TTTATCTG Substrate ShcA  8 GATCATCAGTATTATAACGATTTTCC 26 DHQYYNDFPG GGGC Substrate EGFR  9 CCGCAGCGCTATCTGGTGATTCAGG 27 PQRYLVIQGD GCGAT Substrate p130cas 10 TGGATGGAGGACTTTGACTTCGTCC 28 WMEDFDFVHLQG Y/F ACCTACAGGGG Substrate midT Y/F 11 GAACCGCAGTTTGAAGAAATTCCGA 29 EPQFEEIPIYL TTTATCTG Promoter pBAD 12 AGAAACCAATTGTCCATATTGCATC — N/A AGACATTGCCGTCACTGCGTCTTTTA CTGGCTCTTCTCGCTAACCAAACCG GTAACCCCGCTTATTAAAAGCATTC TGTAACAAAGCGGGACCAAAGCCAT GACAAAAACGCGTAACAAAAGTGTC TATAATCACGGCAGAAAAGTCCACA TTGATTATTTGCACGGCGTCACACTT TGCTATGCCATAGCATTTTTATCCAT AAGATTAGCG Promoter Pro1.sup.57 13 TTCTAGAGCACAGCTAACACCACGT   N/A CGTCCCTATCTGCTGCCCTAGGTCTA TGAGTGGTTGCTGGATAACTTTACG GGCATGCATAAGGCTCGGTATCTAT ATTCAGGGAGACCACAACGGTTTCC CTCTACAAATAATTTTGTTTAACTTT TACTAGAG Promoter placZopt.sup.39 14 CATTAGGCACCCCGGGCTTTACTCG   N/A TAAAGCTTCCGGCGCGTATGTTGTG TCGACCG Promoter ProD.sup.57 13 TTCTAGAGCACAGCTAACACCACGT   N/A CGTCCCTATCTGCTGCCCTAGGTCTA TGAGTGGTTGCTGGATAACTTTACG GGCATGCATAAGGCTCGGTATCTAT ATTCAGGGAGACCACAACGGTTTCC CTCTACAAATAATTTTGTTTAACTTT TACTAGAG RBS Pro 15 GTGCAGTTAAAGAGGAGAAAGGTC   N/A RBS Sal28.sup.‡ 16 CGAAAAAAAGTAAGGCGGTAATCC   N/A RBS BB030 17 TCTAGAGATTAAAGAGGAGAAATAC   N/A TAG RBS BB034 18 TCTAGAAAAGAGGAGAAATACTAG   N/A GOI LuxAB 19 ATGAAATTTGGAAACTTTTTGCTTAC 30 MKFGNFLLTYQPPQFSQTE ATACCAACCTCCCCAATTTTCCCAA VMKRLVKLGRISEECGFDT ACAGAGGTAATGAAACGTTTGGTTA VWLLEHHFTEFGLLGNPYV AATTAGGTCGCATCTCTGAGGAGTG AAAYLLGATKKLNVGTAA TGGTTTTGATACCGTATGGTTACTGG IVLPTAHPVRQLEDVNLLD AGCATCATTTCACGGAGTTTGGTTTG QMSKGRFRFGICRGLYNKD CTTGGTAACCCTTATGTCGCTGCTGC FRVFGTDMNNSRALAECW ATATTTACTTGGCGCGACTAAAAAA YGLIKNGMTEGYMEADNE TTGAATGTAGGAACTGCCGCTATTG HIKFHKVKVNPAAYSRGG TTCTTCCCACAGCCCATCCAGTACGC APVYVVAESASTTEWAAQ CAACTTGAAGATGTGAATTTATTGG FGLPMILSWIINTNEKKAQL ATCAAATGTCAAAAGGACGATTTCG ELYNEVAQEYGHDIHNIDH GTTTGGTATTTGCCGAGGGCTTTACA CLSYITSVDHDSIKAKEICR ACAAGGACTTTCGCGTATTCGGCAC KFLGHWYDSYVNATTIFDD AGATATGAATAACAGTCGCGCCTTA SDQTRGYDFNKGQWRDFV GCGGAATGCTGGTACGGGCTGATAA LKGHKDTNRRIDYSYEINP AGAATGGCATGACAGAGGGATATAT VGTPQECIDIIQKDIDATGIS GGAAGCTGATAATGAACATATCAAG NICCGFEANGTVDEIIASMK TTCCATAAGGTAAAAGTAAACCCCG LFQSDVMPFLKEKQRSLLY CGGCGTATAGCAGAGGTGGCGCACC YGGGGSGGGGSGGGGSGG GGTTTATGTGGTGGCTGAATCAGCT GGSKFGLFFLNFINSTTVQE TCGACGACTGAGTGGGCTGCTCAAT QSIVRMQEITEYVDKLNFE TTGGCCTACCGATGATATTAAGTTG QILVYENHFSDNGVVGAPL GATTATAAATACTAACGAAAAGAAA TVSGFLLGLTEKIKIGSLNHI GCACAACTTGAGCTTTATAATGAAG ITTHHPVRIAEEACLLDQLS TGGCTCAAGAATATGGGCACGATAT EGRFILGFSDCEKKDEMHF TCATAATATCGACCATTGCTTATCAT FNRPVEYQQQLFEECYEIIN ATATAACATCTGTAGATCATGACTC DALTTGYCNPDNDFYSFPK AATTAAAGCGAAAGAGATTTGCCGG ISVNPHAYTPGGPRKYVTA AAATTTCTGGGGCATTGGTATGATT TSHHIVEWAAKKGIPLIFK CTTATGTGAATGCTACGACTATTTTT WDDSNDVRYEYAERYKAV GATGATTCAGACCAAACAAGAGGTT ADKYDVDLSEIDHQLMILV ATGATTTCAATAAAGGGCAGTGGCG NYNEDSNKAKQETRAFISD TGACTTTGTATTAAAAGGACATAAA YVLEMHPNENFENKLEEIIA GATACTAATCGCCGTATTGATTACA ENAVGNYTECITAAKLAIE GTTACGAAATCAATCCCGTGGGAAC KCGAKSVLLSFEPMNDLMS GCCGCAGGAATGTATTGACATAATT QKNVINIVDDNIKKYHTEY CAAAAAGACATTGATGCTACAGGAA T* TATCAAATATTTGTTGTGGATTTGAA GCTAATGGAACAGTAGACGAAATTA TTGCTTCCATGAAGCTCTTCCAGTCT GATGTCATGCCATTTCTTAAAGAAA AACAACGTTCGCTATTATATTATGG CGGTGGCGGTAGCGGCGGTGGCGGT AGCGGCGGTGGCGGTAGCGGCGGTG GCGGTAGCAAATTTGGATTGTTCTTC CTTAACTTCATCAATTCAACAACTGT TCAAGAACAGAGTATAGTTCGCATG CAGGAAATAACGGAGTATGTTGATA AGTTGAATTTTGAACAGATTTTAGT GTATGAAAATCATTTTTCAGATAAT GGTGTTGTCGGCGCTCCTCTGACTGT TTCTGGTTTTCTGCTCGGTTTAACAG AGAAAATTAAAATTGGTTCATTAAA TCACATCATTACAACTCATCATCCTG TCCGCATAGCGGAGGAAGCTTGCTT ATTGGATCAGTTAAGTGAAGGGAGA TttattTTAGGGTTTAGTGATTGCGA AAAAAAAGATGAAATGCATTTTTTT AATCGCCCGGTTGAATATCAACAGC AACTATTTGAAGAGTGTTATGAAAT CATTAACGATGCTTTAACAACAGGC TATTGTAATCCAGATAACGATTTTTA TAGCTTCCCTAAAATATCTGTAAATC CCCATGCTTATACGCCAGGCGGACC TCGGAAATATGTAACAGCAACCAGT CATCATATTGTTGAGTGGGCGGCCA AAAAAGGTATTCCTCTCATCTTTAA GTGGGATGATTCTAATGATGTTAGA TATGAATATGCTGAAAGATATAAAG CCGTTGCGGATAAATATGACGTTGA CCTATCAGAGATAGACCATCAGTTA ATGATATTAGTTAACTATAACGAAG ATAGTAATAAAGCTAAACAAGAGAC GCGTGCATTTATTAGTGATTATGTTC TTGAAATGCACCCTAATGAAAATTT CGAAAATAAACTTGAAGAAATAATT GCAGAAAACGCTGTCGGAAATTATA CGGAGTGTATAACTGCGGCTAAGTT GGCAATTGAAAAGTGTGGTGCGAAA AGTGTATTGCTGTCCTTTGAACCAAT GAATGATTTGATGAGCCAAAAAAAT GTAATCAATATTGTTGATGATAATA TTAAGAAGTACCACACGGAATATAC CTAA GOI SpecR 20 ATGAGGGAAGCGGTGATCGCCGAA 31 MREAVIAEVSTQLSEVVGV GTATCGACTCAACTATCAGAGGTAG IERHLEPTLLAVHLYGSAV TTGGCGTCATCGAGCGCCATCTCGA DGGLKPH SDIDLLVTVTVR ACCGACGTTGCTGGCCGTACATTTG LDETTRRALINDLLETSASP TACGGCTCCGCAGTGGATGGCGGCC GESEILRAVEVTIVVHDDIIP TGAAGCCACACAGTGATATTGATTT WRYPAKRELQFGEWQRND GCTGGTTACGGTGACCGTAAGGCTT ILAGIFEPATIDIDLAILLTK GATGAAACAACGCGGCGAGCTTTGA AREHSVALVGPAAEELFDP TCAACGACCTTTTGGAAACTTCGGC VPEQDLFEALNETLTLWNS TTCCCCTGGAGAGAGCGAGATTCTC PPDWAGDERNVVLTLSRIW CGCGCTGTAGAAGTCACCATTGTTG YSAVTGKIAPKDVAADWA TGCACGACGACATCATTCCGTGGCG MERLPAQYQPVILEARQAY TTATCCAGCTAAGCGCGAACTGCAA LGQEEDRLASRADQLEEFV TTTGGAGAATGGCAGCGCAATGACA HYVKGEITKVVGK* TTCTTGCAGGTATCTTCGAGCCAGCC ACGATCGACATTGATCTGGCTATCTT GCTGACAAAAGCAAGAGAACATAG CGTTGCCTTGGTAGGTCCAGCGGCG GAGGAACTCTTTGATCCGGTTCCTG AACAGGATCTATTTGAGGCGCTAAA TGAAACCTTAACGCTATGGAACTCG CCGCCCGACTGGGCTGGCGATGAGC GAAATGTAGTGCTTACGTTGTCCCG CATTTGGTACAGCGCAGTAACCGGC AAAATCGCGCCGAAGGATGTCGCTG CCGACTGGGCAATGGAGCGCCTGCC GGCCCAGTATCAGCCCGTCATACTT GAAGCTAGACAGGCTTATCTTGGAC AAGAAGAAGATCGCTTGGCCTCGCG CGCAGATCAGTTGGAAGAATTTGTC CACTACGTGAAAGGCGAGATCACCA AGGTAGTCGGCAAATGA .sup.‡RBS designed computationally using the Ribosome Binding Site Calculator..sup.58

    TABLE-US-00004 TABLE 4 Primers used to assemble the bacterial two-hybrid system. F Primer R Primer SEQ SEQ Component ID NO: F Primer ID NO: R Primer RpoZ/HA4 with 32 GTGCAGTAAGGAGGAAAAAA 54 GTCAGGGGCGGGGTTTTTTTT pAB078d8 TAGGGCCCTACTGACTGTTAG overhangs CAGGTGCGGTAATTGA pAB078d8 with 33 CAGTCAGTAGGGCCCTAAAA 55 CACAGTTCTCGTCATCAGCTC RpoZ/HA4 TCTGGTTGCTTTAGCTAATAC overhang piece 1 ACCATAAGCATTTTCC pAB078d8 with 34 TAGCTAAAGCAACCAGAGAG 56 CAGTTACGCGTGCCATTTTTT RpoZ/HA4 TTTCCTCCTTACTGCACTTAG overhang piece 2 CGTTTCGGCGCCGGAT Src/CDC37 into 35 CAATTCCCCTCTAGAAATAA 57 GTCAGGGGCGGGGTTTTTTTT pAB078d8 TTTTG TAGGGCCCTACTGACTGTTAC ACACTGACATCCTTCTCATCG Insulin Receptor 36 CGCTGTAGAGAAAATTGGTA 58 CAGGGGCGGGGTTTTTTTTTA Substrate RpoZ GGGCCCTACTGACTGTTATTA fusion into GCCAAGATCCATCTTCA pAB078d8* Insulin Receptor 37 GACGCGGAATGGTACTGGGG 59 GTTACGCGTGCCATTTTTTTT SH2_cI fusion TCCTCCTTACTGCACTTATTA into pAB078d8* CGAAACCGGATACAACA Src/CDC37 into 38 ATATGGTCTCACATGTCCAA 60 ATATGGTCTCATTTACACACT pBAD33t GCCGCAGACTCAG GACATCCTTCTCATCG RpoZ/pl30cas 39 ATATGGTCTCACATGGCACG 61 ATATGGTCTCATTTACCCCTG substrate into CGTAACTGTTC TAGGTGGACG pBAD33t cI/SH2 into 40 ATATGGTCTCACATGAGTAT 62 ATATGGTCTCATTTAGCAGAC pBAD33t CAGCAGCAGGGTAAAAAG GTTGGTCAGGC pB2H.sub.1b Gibson 41 ATGACTACGTCCACCTACAG 63 AAGATAAAAAGAATAGATCCC piece 1 GGGTAATAACAATTCCCCTC AGCCCTGTGTATAACTCACTA TAGAAATAATTTTGTTTAAC CTTTAGTCAGTTCCGCA pB2H.sub.1b Gibson 42 TGAGTTATACACAGGGCTGG 64 CCCCTGTAGGTGGACGTAGTC piece 2 ATAGTCCTCCATCCACGCAGC TGCACGACGA pB2H.sub.1b Gibson 43 GTGCAGTAAGGAGGAAAAAA 65 GCCCATGGTATATCTCCTTCT piece 3 AATGGC TAAAGT pB2H.sub.1b Gibson 44 TAAAATTCGTAGACTACAAG 66 ACAGTTACGCGTGCCATTTTT piece 4 GACGACGATGACAAGTGGTA TTTTCCTCCTTACTGCACTTA TTTTGGGAAGATCACTCGT GCAGACGTTGGTCAGGC B2H ShcA 45 TAATAACAATTCCCCTCTAG 67 GGGAATTGTTATTAGCCCGGA substrate AAATAATTTTGTTTAACTTT AAATCGTTATAATACTGATGA AAG TCCGCAGCTGCACGACG B2H EGFR 45 TAATAACAATTCCCCTCTAG 68 GGGAATTGTTATTAATCGCCC Substrate AAATAATTTTGTTTAACTTT TGAATCACCAGATAGCGCTGC AAG GGCGCAGCTGCACGACG B2H MidT 45 TAATAACAATTCCCCTCTAG 69 GAATTGTTATTACAGATAAAT Substrate AAATAATTTTGTTTAACTTT CGGAATTTCTTCATACTGCGG AAG TTCCGCAGCTGCACGACG BB034 PTP1B.sub.1-321 46 GTCAGTGTGTAAGTGCAGAA 70 CTCATCCGCCAAAACAGCCTC into pBAD.sub.1c AGAGGAGAAATACTAGATGG AATTGTGTGGCTCCAGGATTC AGATGGAAAAGGAGTTCGAG G BB034 47 TAATCTAGAGAAAGAGGAGA 71 TTACACACTGACATCCTTCTC Src/CDC37 AATACTAGATGTCCAAGCCG ATCG CAGACTC ProD into B2H 48 CTCTAGTAAAAGTTAAACAA 72 TTCTAGAGCACAGCTAACACC AATTATTTGTAGAGGG AC ProD Overhang 49 AACTTTTACTAGAGGAATTC 63 AAGATAAAAAGAATAGATCCC ProRBS GAGCTCTTAAAGAGGAGAAA AGCCCTGTGTATAACTCACTA Src/CDC37 GGTCATGGGCTCCAAGCCGC CTTTAGTCAGTTCCGCA Sal28 RBS 50 AACTTTTACTAGAGCGAAAA 73 GAACCAATGAATGATTTGATG Src/CDC37 AAAGTAAGGCGGTAATCCAT AGC GGGCTCCAAGCCGC BB030 PTP1B 51 AGTGTGTAAGTGCAGATTAA 74 GTTTTTTTTTAGGGCCCTACT into pB2H.sub.S1.2Sal28 AGAGGAGAAATACTAGATGG GACTGTCAATTGTGTGGCTCC AGATGGAAAAGGAGTTCGAG AGGATTC BB034 PTP1B 52 TCAGTGTGTAAGTGCAGTCA 74 GTTTTTTTTTAGGGCCCTACT into pB2H.sub.1.2Sal28 CACAGGAAAGTACTAGATGG GACTGTCAATTGTGTGGCTCC AGATGGAAAAGGAGTTCGAG AGGATTC B2H Swap 53 GCGTACATTGGCTCCGTTCA 75 GACCTGCAGATTAAAGAGGGA LuxAB/SpecR TTTGCCGACTACCTTGGTGA AAAATGAGGGAAGCGGTGATC TC G *Insulin receptor substrate/SH2 domains.sup.59 were used initially, but failed to activate the operon (data not shown)

    TABLE-US-00005 TABLE 5 Primers used to assemble pathways for terpenoid biosynthesis. F Primer R Primer Component SEQ ID NO: F Primer SEQ ID NO: R Primer GGPPS into 76 TATTGAGCTCCACCGCGGA 80 TATTGTCGACTTATTTATTAC pTrc99t GGAGGAATG GCTGGATGATGTAGTC TXS into pTrc99t 77 TATTGGTCTCCCATGAGCA 81 TATTGGTCTCCGTCCTTCCAA GCAGCACTGGCAC CGCATTCAACATGTTG ABS into pTrc99t 78 ATAAAGGTCTCCCATGGTG 82 TATTAGGTCTCGAGCTCTTAG AAACGAGAATTTCCTCCAG GCAACTGGTTGGAAGAGGC pMBIS TetR- 79 AGATCACTACCGGGCGTAT 83 GCCGCCGGCTTCCATTTATTA >CmR TTTTTGAGTTATCGAGATT CGCCCCGCCCTG TTCAGGAGCTAAGGAAGCT AAAATGGAGAAAAAAATCA CTGGATATACCAC

    TABLE-US-00006 TABLE 6 Primers used for site-directed mutagenesis. F Primer R Primer Mutant SEQ ID NO: F Primer SEQ ID NO: R Primer PTP1B  84 GTCCAGTACTTTATTGGGGTT 107 ATCTCGGACATGCTCAGTTCC (C215S) CAGGCGGATGGAACTGAGCAT ATCCGCCTGAACCCCAATAAA GTCCGAGAT GTACTGGAC ABS  85 GAGAGAGAATCCTGTTCCTAG 108 GAAGGCCCATGGCTGTATCCG (D404A) TATTGCGGATACAGCCATGGG CAATATCAGGAACAGGATTCT CCTTC CTCTC ABS  86 ACAAAAACTTCCAATTTCACT 109 CCATGGGCGTCATAAAGATCC (D621A) GTTATTTTAGCGGATCTTTAT GCTAAAATAACAGTGAAATTG GACGCCCATGG GAAGTTTTTGT ADS  87 CGTAAGCATCGTAAGTGTCCG 110 GCTGTTATCACCCTGATCGCG (D299A) CGATCAGGGTGATAACAGC GACACTTACGATGCTTACG GHS  88 CCCATGCGTGTCGTATAAGTC 111 CGATCTTGATGACAATGTTAG (D343A) CGCTAACATTGTCATCAAGAT CGGACTTATACGACACGCATG CG GG GHS  89 CAATGGCACCCCCAACNNKGG 112 GTTGGGGGTGCCATTGTTC (T455X) TATGTGTGTACTTAATCTGAT CCCG GHS  90 CAACACCGGTATGTGTGTANN 113 TACACACATACCGGTGTTGGG (L450X) KAATCTGATCCCGTTGCTGCT TATG GHS  91 AAACGCTTGGGAACGCNNKCT 114 GCGTTCCCAAGCGTTTTTG (Y415X) GGAAGCGTATTTGCAGGATG GHS  92 CTTCTGGATGGCCGCGNNKAT 115 CGCGGCCATCCAGAAGT (A319X) TTCAGAACCAGAATTTAGTGG CTC GHS  93 ACCATCTGATTGAACTGGCTN 116 AGCCAGTTCAATCAGATGGTG (S484X) NKCGACTGGTCGATGATGCGA G G GHS  94 CGTCCTGGCGCGGNNKATTCA 117 CCGCGCCAGGACGTG (S561X) GTTTATGTATAACCAGGGGGA C ADS  95 CAACTGCGGTAAAGAGTTTGT 118 TTCTTTAACAAACTCTTTACC (F370X) TAAAGAANNKGTACGTAACCT GCAGTTG GATGGTTGAAGC ADS  96 CATGACCCGGTTGTTATCATC 119 GGTGATGATAACAACCGGGTC (G400X) ACCNNKGGTGCAAACCTGCTG ATG ACCAC ADS  97 CCGGCGGTGCAAACCTGNNKA 120 CAGGTTTGCACCGCCGG (L405X) CCACCACTTGCTATCTGGG ADS  98 CTGTTCCGTTACTCCGGTATT 121 CAGAATACCGGAGTAACGGAA (G439X) CTGNNKCGTCGTCTGAACGAC CAG CTGATG ADS  99 GGCAGTAATCTACCTGTGCCA 122 CTGGCACAGGTAGATTACTGC (F514X) GNNKCTGGAAGTACAGTACGC C TGGTAAAG MidT 100 CAGCTGCGGAACCGCAGTTTG 123 ATCGGAATTTCTTCAAACTGC Substrate AAGAAATTCCGAT GGTTCCGCAGCTG (Y/F) p130Cas 101 TGGATGGAGGACTTTGACTTC 124 GTCAAAGTCCTCCATCCACGC Substrate GTCCACCTACAGGGGTAATAA AGCTGCACGACG (Y/F) CAATTC SH2 102 CTCTCCGTTTCTGACTTTGAC 125 AAGTCAGAAACGGAGAGGGCA (Superbinder AACGCCAAGGGGCTCAATGTG TAGGCACCTTTTACCGTCTCG mutations) CTGCACTACAAGATCCGCAAG CTCTCCCG CTG SH2 103 AAACACTACCTGATCCGCAAG 126 GCTGTCCAGCTTGCGGATCAG (L13K CTGGACAGC GTAGTGTTTCACATTGAGCCC K15L)* CTTGGC* pTrc99a 104 TATTGGTCTCTCGCGGTATCA 127 TATTGGTCTCAGTGACCCCAC (remove TTGCAGCAC ACTACCATCGG BsaI sites) piece 1 pTrc99a 105 TATTGGTCTCATCACCCCATG 128 TATTGGTCTCACGCGTGACCC (remove CGAGAGTAGG ACGCTCACCG BsaI sites) piece 2 ADS ep 106 AACAATTTCACACAGGAAACA 129 GCCTGCAGGTCGACTCTAGA PCR GACC *The original superbinder primer mutated the incorrect lysine residue (13 vs. 15). This primer corrects that error. The residue numbering system used for this protein matches that of Kaneko et. al..sup.40

    TABLE-US-00007 TABLE 7 Gene sources. Component Organism Plasmid Source Src H. sapiens pDONR223_ Addgene: 82165 SRC_WT CDC37 H. sapiens pBACgus4x/ Addgene: 40398 cdc37/RocCOR LRRK2 1867-2176 PTP1B H. sapiens pET21B_ Nicholas PTP1B Tonks, Cold Spring Harbor TC-PTP H. sapiens pBG100- Addgene: 33365 TCPTP PTPN6 H. sapiens: pGEX-2T Addgene: 8594 SHP1 WT PTPN12 H. sapiens DONR223_ Addgene: 81528 PTPN12_ p.E57D LuxAB pAB078d8 Addgene: 79206 RpoZ Escherichia coli pAB094a Addgene: 79241 cI434 Escherichia pAB078d8 Addgene: 79206 virus Lambda SH2 Rous sarcoma Kras-SRC Addgene: 78302 virus FRET Biosensor p130cas H. sapiens Synthetic Integrated DNA Technologies, Inc. midT H. sapiens Synthetic Integrated DNA Technologies, Inc. EGFR H. sapiens Synthetic Integrated DNA Technologies, Inc. ShcA H. sapiens Synthetic Integrated DNA Technologies, Inc. MBIS S. cerevisiae pMBIS Addgene: 17817 ADS Artemisia pADS Addgene: 19040 annua GHS Abies grandis pTrcHUM Addgene: 19003 ABS Abies grandis pSBET/AgAs Reuben Peters, Iowa State University TXS Taxus brevifola M60 David W. Christianson, University of Pennsylvania ABA Abies grandis pTrc99a Addgene: 35153 GGPPS Taxus gBlock Integrated DNA canadensis Technologies, Inc. A0A166A5J3 S. Suecicum Synthetic Twist Bioscience HHB10207 ss-3 A0A0D9X487 L. perrieri Synthetic Twist Bioscience F2DRF1 H. vulgare Synthetic Twist Bioscience A2XI80 O. sativa Synthetic Twist Bioscience A0A0D9ZGD1 O. glumipatula Synthetic Twist Bioscience A0A0K9RZT8 S. olaracea Synthetic Twist Bioscience A0A1I1AC30 A.aquimarinus Synthetic Twist Bioscience A0A1S3XW43 N. tabacum Synthetic Twist Bioscience A0A0D3D8G7 B. oleracea Synthetic Twist Bioscience B9IF04 P. trichocarpa Synthetic Twist Bioscience A0A067L3D3 J. curcas Synthetic Twist Bioscience A0A0C2TFL3 A.Muscaria Synthetic Twist Bioscience Koide BX008 A0A022S1C8 E. guttata Synthetic Twist Bioscience G4TNA6 S. indica Synthetic Twist Bioscience A0A1L7WMZ8 P. subalpine Synthetic Twist Bioscience A0A078IZJ5 B. napus Synthetic Twist Bioscience A0A0C9VSL7 S. stellatus Synthetic Twist Bioscience SS14 G2QRS0 T. terrestris Synthetic Twist Bioscience ATCC 38088 A0A2H3DKU3 A. gallica Synthetic Twist Bioscience A0A0D2L718 H. sublateritium Synthetic Twist Bioscience FD-334 SS-4 S9Q0922 C. Fuscus Synthetic Twist Bioscience DSM 2262 T1LTV1 T. urartu Synthetic Twist Bioscience A0A287XU99 H. vulgare Synthetic Twist Bioscience A0A0G2ZSL3 A. gephyra Synthetic Twist Bioscience

    TABLE-US-00008 TABLE 8 Plasmids Anti- Avail- Plasmid Description biotic* ability F-plasmid The F-plasmid from the T AG: S1030 strain of E. coli. 105063.sub.*.sup.* pB2H.sub.1b An early version of B2H that K Fox Lab lacks PTP1B and contains LuxAB as the GOI. pBAD.sub.1b.Src Enables inducible expression P Fox Lab of Src and CDC37 pBAD.sub.1b.SH2 Enables inducible expression P Fox Lab of the SH2 domain. pBAD.sub.1b.S Enables inducible expression P Fox Lab of the substrate domain. pBAD.sub.1b.All Enables inducible expression P Fox Lab of Src, CDC37, the SH2 domain, and the substrate domain. pB2H.sub.1c.p130cas An early version of B2H that (i) K Fox Lab lacks PTP1B and Src, (ii) contains LuxAB, and (iii) includes a substrate from p130cas. pB2H.sub.1c.midT An early version of B2H that (i) K Fox Lab lacks PTP1B and Src, (ii) contains LuxAB, and (iii) includes a substrate from midT. pB2H.sub.1c.ShcA An early version of B2H that (i) K Fox Lab lacks PTP1B and Src, (ii) contains LuxAB, and (iii) includes a substrate from ShCA. pB2H.sub.1c.EGFR An early version of B2H that (i) K Fox Lab lacks PTP1B and Src, (ii) contains LuxAB, and (iii) includes a substrate from EGFR. pBAD.sub.1d Enables inducible expression of P Fox Lab Src and PTP1B. pBAD.sub.1d.mut Enables inducible expression of P Fox Lab Src and catalytically inactive PTP1B (C215S). pB2H.sub.S1.1Pro1 An early version of B2H that (i) K Fox Lab lacks PTP1B, (ii) contains LuxAB, (iii) places expression of Src, CDC37, the SH2 domain, and the substrate domain under control of the same Pro1 promoter, and (iv) uses the BB034 RBS for Src. pB2H.sub.S1.1Pro1. Identical to pB2H.sub.S1.1Pro1 except K Fox Lab .sub.mut for a mutation in the substrate (Y4F) pB2H.sub.S1.1ProD An early version of B2H that (i) K Fox Lab lacks PTP1B, (ii) contains LuxAB, and (iii) includes the ProD promoter and pro RBS for Src. pB2H.sub.S1.1ProD. Identical to pB2H.sub.S1.1ProD except K Fox Lab .sub.mut for a mutation in the substrate (Y4F) pB2H.sub.S1.2pro An early version of B2H that (i) K Fox Lab lacks PTP1B, (ii) contains LuxAB, and (iii) includes the pro RBS for Src. pB2H.sub.S1.2pro.mut Identical to pB2H.sub.S1.2pro except K Fox Lab for a mutation in the substrate (Y4F) pB2H.sub.S1.2Sal28 An early version of B2H that (i) K Fox Lab lacks PTP1B, (ii) contains LuxAB, and (iii) includes the Sal28 RBS for Src. pB2H.sub.S1.2Sal28. Identical to pB2H.sub.S1.2Sal28 K Fox Lab .sub.mut except for a mutation in the substrate (Y4F) pB2H.sub.S1.3RBS30 An early version of B2H that (i) K Fox Lab contains LuxAB and (ii) includes the bb030 RBS for PTP1B. pB2Hs.sub.S1.3RBS30. Identical to pB2H.sub.S1.3RBS30 K Fox Lab .sub.mut except for a mutation in the substrate (Y4F) pB2H.sub.S1.3RBS34 An early version of B2H that (i) K Fox Lab contains LuxAB and (ii) includes the bb034 RBS for PTP1B. pB2H.sub.S1.3RBS34. Identical to pB2H.sub.S1.3RBS34 K Fox Lab .sub.mut except for a mutation in the substrate (Y4F) pB2H.sub.S2RBS30 An early version of B2H that (i) K Fox Lab contains SpecR and (ii) includes the bb030 RBS for PTP1B. pB2H.sub.S2RBS30. Identical to pB2H.sub.S2RBS30 K Fox Lab .sub.mut except for an inactivating mutation in PTP1B (C215S) pB2H.sub.opt Final, optimized B2H that (i) K AG: contains SpecR and (ii) 163830 includes the bb034 RBS for PTP1B. pBH.sub.opt* Identical to pB2H.sub.opt except for K AG: an inactivating mutation in 163831 PTP1B (C215S) pB2H.sub.optX Identical to pB2H.sub.opt except for a K AG: mutation in the substrate 163832 domain (Y4F) pB2H.sub.2 Identical to pB2H.sub.opt with TC- K AG: PTP in place of PTP1B 163833 pB2H.sub.2* Identical to pB2H.sub.2 except for an K AG: inactivating mutation in 163834 TC-PTP (R222M) pB2H.sub.6 Identical to pB2H.sub.opt with SHP1 K AG: (catalytic domain) in place 163835 of PTP1B pB2H.sub.6* Identical to pB2H.sub.6 except for an K AG: inactivating mutation in 163836 SHP1 (R459M) pB2H.sub.12 Identical to pB2H.sub.opt with K AG: PTPN12 in place of PTP1B 163837 pB2H.sub.12* Identical to pB2H.sub.12 except for K AG: an inactivating mutation in 163838 PTPN12 (Y64A) pMBIS A plasmid that harbors genes T AG: for the mevalonate- 17817 dependent isoprenoid pathway from S. cerevisiae and harbors a tetracycline resistance marker. pMBIS.sub.CmR A plasmid that harbors genes P Fox Lab for the mevalonate- dependent isoprenoid pathway from S. cerevisiae and harbors a chloramphenicol resistance marker. pTrc99t A pTrc99a variant with BsaI C Fox Lab removed for use in Golden Gate cloning PTS.sub.ADS A plasmid that harbors ADS. C AG: 19040 pTS.sub.ADS(D299A) A plasmid that harbors ADS C Fox Lab (D299A, inactivating). pTS.sub.GHS A plasmid that harbors GHS. C AG: 19003 pTS.sub.GHS(D343A) A plasmid that harbors GHS C Fox Lab (D343A, inactivating). pTS.sub.ABA A plasmid that harbors ABA. C Fox Lab pTS.sub.ABA(D566A) A plasmid that harbors ABA C Fox Lab (D566A, inactivating). pTS.sub.ABS A plasmid that harbors ABS C AG: and GGPPS. 163840 pTS.sub.ABS(D404A/ A plasmid that harbors ABS C Fox Lab .sub.D621A) (D404A/D621A, inactivating) and GGPPS. pTS.sub.TXS A plasmid that harbors TXS C AG: and GGPPS. 163839 pTS.sub.A0A166A5J3 A plasmid that harbors C Fox Lab A0A166A5J3 (Clade 1) pTS.sub.A0A0D9X4S7 A plasmid that harbors C Fox Lab A0A0D9X487 (Clade 1) pTS.sub.F2DRF1 A plasmid that harbors C Fox Lab F2DRF1 (Clade 1) pTS.sub.A2XI80 A plasmid that harbors C Fox Lab A2XI80 (Clade 2) pTS.sub.A0AOD9ZGD1 A plasmid that harbors C Fox Lab A0A0D9ZGD1 (Clade 2) pTS.sub.A0A0K9RZT8 A plasmid that harbors C Fox Lab A0A0K9RZT8 (Clade 2) pTS.sub.A0A1I1AC30 A plasmid that harbors C Fox Lab A0A1I1AC30 (Clade 3) pTS.sub.A0A1S3XW43 A plasmid that harbors C Fox Lab A0A1S3XW43 (Clade 3) pTS.sub.A0A0D3D8G7 A plasmid that harbors C Fox Lab A0A0D3D8G7 (Clade 3) pTS.sub.B9IF04 A plasmid that harbors C Fox Lab B9IF04 (Clade 4) pTS.sub.A0A067L3D3 A plasmid that harbors C Fox Lab A0A067L3D3 (Clade 4) pTS.sub.A0A0C2TFL3 A plasmid that harbors C Fox Lab A0A0C2TFL3 (Clade 4) pTS.sub.A0A022S1C8 A plasmid that harbors C Fox Lab A0A022S1C8 (Clade 5) pTS.sub.G4TNA6 A plasmid that harbors C Fox Lab G4TNA6 (Clade 5) pTS.sub.A0A1L7WMZ8 A plasmid that harbors C Fox Lab A0A1L7WMZ8 (Clade 5) pTS.sub.A0A078IZJ5 A plasmid that harbors C Fox Lab A0A078IZJ5 (Clade 6) pTS.sub.A0A0C9VSL7 A plasmid that harbors C AG: A0A0C9VSL7 (Clade 6) 163841 pTS.sub.G2QRS0 A plasmid that harbors C Fox Lab G2QRS0 (Clade 6) pTS.sub.A0A2H3DKU3 A plasmid that harbors C Fox Lab A0A2H3DKU3 (Clade 7) pTS.sub.A0A0D2L718 A plasmid that harbors C Fox Lab A0A0D2L718 (Clade 7) pTS.sub.S9Q922 A plasmid that harbors C Fox Lab S9Q922 (Clade 7) pTS.sub.T1LTV1 A plasmid that harbors C Fox Lab T1LTV1 (Clade 8) pTS.sub.A0A2S7XU99 A plasmid that harbors C Fox Lab A0A287XU99 (Clade 8) pTSA.sub.0A0G2ZSL3 A plasmid that harbors C Fox Lab A0A0G2ZSL3 (Clade 8) pET21b.sub.ptp1b A plasmid that encodes a His- C N/A.sup.+ tagged catalytic domain of PTP1B (for protein expression) pET16B.sub.TCPTP A plasmid that encodes a His- C Fox Lab tagged catalytic domain of TCPTP (for protein expression) *Antibiotic resistance: carbenicillin (C, 50 μg/ml), kanamycin (K, 50 μg/ml), tetracycline (T, 10 μg/ml), chloramphenicol (P, 34 μg/ml), and spectinomycin (S, conditional). .sup.+This plasmid was a kind gift from Nicholas Tonks of Cold Spring Harbor Laboratory. .sub.*.sup.*AG = Addgene accession # (Addgene.com).

    TABLE-US-00009 TABLE 9 Primers used to assemble pathways for terpenoid biosynthesis. F Primer R Primer Component SEQ ID NO: F Primer SEQ ID NO: R Primer GGPPS into  76 TATTGAGCTCCACCGCGGA  80 TATTGTCGACTTATTTATTAC pTrc99t GGAGGAATG GCTGGATGATGTAGTC TXS into  77 TATTGGTCTCCCATGAGCA  81 TATTGGTCTCCGTCCTTCCAA pTrc99t GCAGCACTGGCAC CGCATTCAACATGTTG ABS into  78 ATAAAGGTCTCCCATGGTG  82 TATTAGGTCTCGAGCTCTTAG pTrc99t AAACGAGAATTTCCTCCAG GCAACTGGTTGGAAGAGGC pMBIS TetR-  79 AGATCACTACCGGGCGTAT  83 GCCGCCGGCTTCCATTTATTA >CmR TTTTTGAGTTATCGAGATT CGCCCCGCCCTG TTCAGGAGCTAAGGAAGCT AAAATGGAGAAAAAAATCA CTGGATATACCAC ABA into 130 AACAATTTCACACAGGAAA 131 GCCTGCAGGTCGACTCTAGAT pTrc99 CAGACCATGGCGGGTGTTT TACAGCGGCAGCGGTTC CTGCG

    TABLE-US-00010 TABLE 10 Primers used for site-directed mutagenesis. F Primer R Primer Mutant SEQ ID NO: F Primer SEQ ID NO: R Primer PTP1B  84 GTCCAGTACTTTATTGGGGTT 107 ATCTCGGACATGCTCAGTTCCA (C215S) CAGGCGGATGGAACTGAGCAT TCCGCCTGAACCCCAATAAAGT GTCCGAGAT ACTGGAC TCPTP 132 CAGAGAGAAGGTGCCAGACAT 136 TGTAGTGCAGGCATTGGGATGT (R222M) CCCAATGCCTGCACTACA CTGGCACCTTCTCTCTG SHP1 133 CAATGATGGTGCCTGTCATGC 137 CAGCGCCGGCATCGGCATGACA (R459M) CGATGCCGGCGCTG GGCACCATCATTG PTPN12 134 GCTGTGATCAAATGGCAGTAT 138 GAAAAAGAAGAAAATGTTAAAA (Y64A) GTCCTTCGCTCTGTTCTTTTT AGAACAGAGCGAAGGACATACT AACATTTTCTTCTTTTTC GCCATTTGATCACAGC ABS 85 GAGAGAGAATCCTGTTCCTGA 108 GAAGGCCCATGGCTGTATCCGC (D404A) TATTGCGGATACAGCCATGGG AATATCAGGAACAGGATTCTCT CCTTC CTC ABS 86 ACAAAAACTTCCAATTTCACT 109 CCATGGGCGTCATAAAGATCCG (D621A) GTTATTTTAGCGGATCTTTAT CTAAAATAACAGTGAAATTGGA GACGCCCATGG AGTTTTTGT ADS 87 CGTAAGCATCGTAAGTGTCCG 110 GCTGTTATCACCCTGATCGCGG (D299A) CGATCAGGGTGATAACAGC ACACTTACGATGCTTACG GHS 88 CCCATGCGTGTCGTATAAGTC 111 CGATCTTGATGACAATGTTAGC (D343A) CGCTAACATTGTCATCAAGAT GGACTTATACGACACGCATGGG CG MidT 100 CAGCTGCGGAACCGCAGTTTG 123 ATCGGAATTTCTTCAAACTGCG Substrate AAGAAATTCCGAT GTTCCGCAGCTG (Y/F) p130Cas 101 TGGATGGAGGACTTTGACTTC 124 GTCAAAGTCCTCCATCCACGCA Substrate GTCCACCTACAGGGGTAATAA GCTGCACGACG (Y/F) CAATTC SH2 102 CTCTCCGTTTCTGACTTTGAC 125 AAGTCAGAAACGGAGAGGGCAT (Superbinder AACGCCAAGGGGCTCAATGTG AGGCACCTTTTACCGTCTCGCT mutations) CTGCACTACAAGATCCGCAAG CTCCCG CTG SH2 (L13K 103 AAACACTACCTGATCCGCAAG 126 GCTGTCCAGCTTGCGGATCAGG K15L)* CTGGACAGC TAGTGTTTCACATTGAGCCCCT TGGC* pTrc99a 104 TATTGGTCTCTCGCGGTATCA 127 TATTGGTCTCAGTGACCCCACA (remove BsaI TTGCAGCAC CTACCATCGG sites) piece 1 pTrc99a 105 TATTGGTCTCATCACCCCATG 128 TATTGGTCTCACGCGTGACCCA (remove BsaI CGAGAGTAGG CGCTCACCG sites) piece 2 ABA D/A 135 AGGTGTCGTACATGTCCGCCA 139 CTGCAGACCGTTCTGGCGGACA GAACGGTCTGCAG TGTACGACACCT *The original superbinder primer mutated the incorrect lysine residue (13 vs. 15). This primer corrects that error. The residue numbering system used for this protein matches that of Kaneko et. al..sup.20

    TABLE-US-00011 TABLE 11a Scaling factor for amorphadiene/caryophyllene (m/z = 204) Technical A.sub.std A.sub.ref C.sub.std C.sub.ref Replicate (counts*min) (counts*min) (μg/mL) (μg/mL) R 1 74520 88358 20 0.4 0.017 2 71037 142415 20 0.4 0.010 3 75761 49011 20 0.4 0.031 Avg R 0.019 (0.006) *R was computed using eq. 2. Standard error is shown in parentheses.

    TABLE-US-00012 TABLE 11b Scaling factor for taxadiene/caryophyllene (m/z = 93) Technical A.sub.std A.sub.ref C.sub.std C.sub.ref Replicate (counts*min) (counts*min) (μg/mL) (μg/mL) R 1 1399872 847009 20 10 0.83 2 1247250 605265 20 10 1.0 3 1291028 547740 20 10 1.2 Avg R 1.0 (0.10)

    TABLE-US-00013 TABLE 11c Scaling factor for amorphadiene/methyl abietate (m/z = 121) Technical A.sub.std A.sub.ref C.sub.std C.sub.ref Replicate (counts * min) (counts * min) (μg/mL) (μg/mL) R 1 949492  868168 20 3.162 0.17 2 920694  908257 20 3.162 0.16 3 898594 1106474 20 3.162 0.13 Avg R 0.15 (0.01)

    TABLE-US-00014 TABLE 12a Analysis of the inhibition of PTP1B.sub.1-321 by amorphadiene. SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive 0.14 27 Δ.sub.i = 51.2 noncompetitive K.sub.i = 2.85 Uncompetitive** 0.023 27 Δ.sub.i = 1.16 noncompetitive K.sub.i = 46.3 Noncompetitive** 0.023 27 K.sub.i = 52.6* Mixed 0.022 26 F = 0.47 noncompetitive K.sub.i,c = 86.2 p = 0.972 K.sub.i,u = 50.1 *The SSEs of the uncompetitive and noncompetitive models are indistinguishable from one another. **Indicate models of best fit.

    TABLE-US-00015 TABLE 12b Analysis of the inhibition of PTP1B.sub.1-321 by α-bisabolene. SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM)) Competitive 0.082 27 Δ.sub.i = 39.1 noncompetitive K.sub.i = 1.05 Uncompetitive** 0.023 27 Δ.sub.i = 3.81 noncompetitive K.sub.i = 11.7 Noncompetitive** 0.021 27 K.sub.i = 13.1 Mixed 0.020 26 F = 0.24 noncompetitive K.sub.i,c = 9.51 p = 1.0 K.sub.i,u = 13.7

    TABLE-US-00016 TABLE 12c Analysis of the inhibition of PTP1B.sub.1-321 by alpha bisabolol. SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive 0.039 27 Δ.sub.i = 34.4 uncompetitive K.sub.i = 178 Uncompetitive** 0.011 27 K.sub.i = 469 Noncompetitive** 0.013 27 Δ.sub.i = 4.65 uncompetitive K.sub.i = 541 Mixed 0.011 26 F = 0 uncompetitive K.sub.i,c = 3.5e.sup.16 p = 1.0 K.sub.i,u = 469

    TABLE-US-00017 TABLE 12d Analysis of the inhibition of PTP1B.sub.1-321 by dihydroartimesnic acid. SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive 0.129 21 Δ.sub.i = 60.7 noncompetitive K.sub.i = 178 Uncompetitive 0.025 27 Δ.sub.i = 15.2 noncompetitive K.sub.i = 469 Noncompetitive 0.015 27 K.sub.i = 541 Mixed** 0.013 26 F = 2.69 noncompetitive K.sub.i,c = 3.5e.sup.16 p = 6.9e.sup.−3 K.sub.i,u = 469

    TABLE-US-00018 TABLE 12e Analysis of the inhibition of TCPTP.sub.1-317 by amorphadiene. SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive 0.053 27 Δ.sub.i = 41.1 uncompetitive K.sub.i = 87.2 Uncompetitive** 0.012 27 K.sub.i = 356 Noncompetitive** 0.013 27 Δ.sub.i = 2.22 uncompetitive K.sub.i = 400 Mixed 0.012 26 F = 0 uncompetitive K.sub.i,c = 3.7e.sup.15 p = 1.0 K.sub.i,u = 356 *The SSEs of the uncompetitive and noncompetitive models are indistinguishable from one another. **Indicate models of best fit.

    TABLE-US-00019 TABLE 12f Analysis of the inhibition of TCPTP.sub.1-317 by α-bisabolene. SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive 0.046 27 Δ.sub.i = 37.6 uncompetitive K.sub.i = 13.7 Uncompetitive** 0.012 27 K.sub.i = 69.2 Noncompetitive** 0.012 27 Δ.sub.i = 1.12 uncompetitive K.sub.i = 76.2 Mixed 0.012 26 F = 0 uncompetitive K.sub.i,c = 3610 p = 1.0 K.sub.i,u = 69.3

    TABLE-US-00020 TABLE 12g Analysis of the inhibition of PTP1B.sub.1-281 by amorphadiene. SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive 0.010 27 Δ.sub.i = 16.3 noncompetitive K.sub.i = 37.9 Uncompetitive** 0.006 27 Δ.sub.i = 3.51 noncompetitive K.sub.i = 210 Noncompetitive** 0.006 27 K.sub.i = 244 Mixed 0.006 26 F = 0.41 noncompetitive K.sub.i,c = 157 p = 0.99 K.sub.i,u = 271

    TABLE-US-00021 TABLE 12h Analysis of the inhibition of PTP1B.sub.1-281 by α-bisabolene. SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive 0.012 27 Δ.sub.i = 14.4 noncompetitive K.sub.i = 6.51 Uncompetitive** 0.008 27 Δ.sub.i = 1.41 noncompetitive K.sub.i = 40.0 Noncompetitive** 0.007 27 K.sub.i = 46.3 Mixed 0.007 26 F = 0 noncompetitive K.sub.i,c = 39.0 p = 1.0 K.sub.i,u = 47.7

    TABLE-US-00022 TABLE 12i Analysis of the inhibition of TCPTP.sub.1-281 by amorphadiene. SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive 0.005 27 Δ.sub.i = 22.9 uncompetitive K.sub.i = 87.2 Uncompetitive** 0.002 27 K.sub.i = 356 Noncompetitive** 0.002 27 Δ.sub.i = 0.83 uncompetitive K.sub.i = 400 Mixed 0.002 26 F = 0.03 uncompetitive K.sub.i,c = 3.7e.sup.15 p = 1.0 K.sub.i,u = 356

    TABLE-US-00023 TABLE 12j Analysis of the inhibition of TCPTP.sub.1-281 by α-bisabolene. SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive 0.083 27 Δ.sub.i = 39.1 noncompetitive K.sub.i = 13.7 Uncompetitive** 0.023 27 Δ.sub.i = 3.81 noncompetitive K.sub.i = 69.2 Noncompetitive** 0.021 27 K.sub.i = 76.2 Mixed 0.020 26 F = 0 noncompetitive K.sub.i,c = 3610 p = 1.0 K.sub.i,u = 69.3

    TABLE-US-00024 TABLE 12k Analysis of the inhibition of PTP1B.sub.1-321 by (+)1-(10),4-cadinadiene SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive 0.115 27 Δ.sub.i = 48.3 uncompetitive K.sub.i = 14.75 Uncompetitive** 0.020 27 K.sub.i = 168.09 Noncompetitive** 0.022 27 Δ.sub.i = 2.5 uncompetitive K.sub.i = 190.44 Mixed 0.020 26 F = 0 uncompetitive K.sub.i,c = 5689.38 p = 1.0 K.sub.i,u = 168.78

    TABLE-US-00025 TABLE 12l Analysis of the inhibition of SHP2.sub.223-565 by Amorphadiene SSE Fit par. Model (μM.sup.2/s.sup.2) DF Criteria Reference (μM) Competitive  .0024 27 Δ.sub.i = 10.6 noncompetitive K.sub.i = 25.1 Uncompetitive**  .0017 27 Δ.sub.i = 0.5 noncompetitive K.sub.i = 116.51 Noncompetitive**  .0017 27 K.sub.i = 145.69 Mixed 0.0017 26 F = 0.15 noncompetitive K.sub.i,c = 236.21 p = 1.0 K.sub.i,u = 132.37

    TABLE-US-00026 TABLE 13 Data collection and refinement statistics (molecular replacement) PTP1B: amorphadiene PTP1B: α-bisabolol (6W30) (N/A***) Data collection Space group Cell dimensions a, b, c (Å) 89.03, 89.03, 105.56 89.28, 89.28, 105.51 α, β, γ (°) 90.00, 90.00, 120.00 90.00, 90.00, 120.00 Resolution (Å) 62.26-2.10 (2.13-2.10)* 77.32-2.11 (2.15-2.11) R.sub.sym or R.sub.merge 0.130 (0.442) 0.086 (0.331) I/σI 5.4 (1.0) 6.7 (1.1) Completeness (%) 99.8 (93.3) 100.0 (98.5)  Redundancy 10.7 (10.8) 12.1 (12.3) Refinement Resolution (Å) 44.52-2.10 (2.17-2.10) 62.37-2.11 (2.18-2.11) No. reflections 28,654 28,479 R.sub.work/R.sub.free 0.20/0.24 0.19/0.24 No. atoms Protein 2355 2320 Ligand/ion 22 17 Water 170 270 B-factors Protein 37 30 Ligand/ion 90/61 66/37 Water 47 43 R.m.s. deviations Bond lengths (Å) 0.42 0.42 Bond angles (°) 0.56 0.54 *Values in parentheses correspond to the highest-resolution shell. **Number of crystals used for each structure: 1 ***In light of the results detailed in FIG. 31, we elected not to deposit this structure into the protein data bank.

    TABLE-US-00027 TABLE 14 Details of hypothesis testing 95% Null confidence P- FIG. hypothesis Δμ Test DF t intervals value 3h AD-(−) = 0 0.212 t-test, 2 6.61 (0.092, 0.02 unequal 0.332) variance 3h AB-(−) = 0 0.310 t-test, 2 13.5 (0.138, 0.005 unequal 0.482) variance 3h AD- 0.124 t-test, 3 3.59 (0.069, 0.04 DHA = 0 unequal 0.179) variance 3h AB- 0.309 t-test, 3 12.6 (0.170, 0.001 ABOL = 0 unequal 0.447) variance

    TABLE-US-00028 TABLE 15 Ligand efficiency. # Heavy Ligand Efficiency Ligand IC.sub.50 (μM) Atoms (kcal/mol-atom)* Amorphadiene 50 15 0.39 α-bisabolene 13 15 0.44 BBR 8 41 0.17 MSI-1436 0.6 47 0.17 *Ligand efficiency = (−2.303RT)/HAC * log(IC.sub.50), where R is the gas constant, T is the temperature in K, and HAC is the number of heavy atoms.

    OTHER EMBODIMENTS

    [0337] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.

    [0338] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.

    EQUIVALENTS AND SCOPE

    [0339] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.

    [0340] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.

    [0341] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

    [0342] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”

    [0343] The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and/or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

    [0344] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and