COMPOSITION FOR PROTECTING ISLET TRANSPLANTATION

Abstract

The present invention pertains to a composition having a protective effect during islet transplantation, and more specifically, to a composition containing a compound of chemical formula 1 or a pharmaceutically acceptable salt thereof, and capable of providing a protective effect against oxidative stress, inflammation, etc. during islet transplantation.

Claims

1. A composition for protecting islet transplantation comprising as an active ingredient a compound of the following Formula 1 or a pharmaceutically acceptable salt thereof: ##STR00004## wherein n is 0 or 1; X is C or N, provided that n is 0 when X is N, and n is 1 when X is C; R.sup.1 is hydrogen or C.sub.1-C.sub.6 alkyl; R.sup.2 is phenyl or pyridine; R.sup.3 is hydrogen, halogen or C.sub.1-C.sub.6 alkyl; R.sup.4 is hydrogen, halogen, 2-carboxy-pyrrolidin-1-yl, pyrrolidin-1-yl, 4-acetic acid-1,3-thiazolin-2-yl, —CH.sub.2-(1,1-dioxo-thiomorpholin-4-yl) or —CH.sub.2-(2-oxopiperazin-4-yl); R.sup.5 is hydrogen, C.sub.1-C.sub.6 alkyl or C.sub.3-C.sub.6 cycloalkyl; and R.sup.6 is-D-W—R.sup.7, wherein D is cyclopentyl, cyclohexyl, pyrrolidine, tetrahydropyran, tetrahydrofuran or piperidine; W is a direct bond, —SO.sub.2—, —CO— or —C(O)O—; and R.sup.7 is hydrogen, hydroxy or C.sub.1-C.sub.6 alkyl.

2. The composition according to claim 1, wherein the compound of Formula 1 is (tetrahydropyran-4-yl)-[2-phenyl-5-(1,1-dioxo-thiomorpholin-4-yl)methyl-1H-indol yl]amine of the following Formula 2: ##STR00005##

3. The composition according to claim 1, wherein the compound of Formula 1 is treated during isolation of islet.

4. The composition according to claim 1, wherein the compound of Formula 1 is treated during serum-deprived culture of isolated islet.

5. The composition according to claim 3, wherein the compound of Formula 1 reduces the amount of oxidative stress and reactive oxygen species (ROS).

6. The composition according to claim 3, wherein the compound of Formula 1 reduces the expression of c-jun N-terminal kinase, HMGB1 (high mobility group box-1) and proinflammatory cytokines.

7. The composition according to claim 6, wherein the proinflammatory cytokines are interleukin-1β, interleukin-6 and tumor necrosis factor (TNF)-α.

8. The composition according to claim 4, wherein the compound of Formula 1 reduces the accumulation of amyloid and toxic IAPP (islet amyloid polypeptide) oligomers.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0029] FIG. 1 shows the results of evaluating effects of Compound 1 during isolation on in vitro viability, function and pro-inflammatory cytokines expression of isolated hIAPP.sup.+/− mouse islets.

[0030] FIG. 2 shows the results of evaluating effects of Compound 1 during isolation on in vitro viability, function and pro-inflammatory cytokines expression of isolated C57BL/6 mouse islets.

[0031] FIG. 3 shows the results of evaluating effects of Compound 1 during isolation on post-transplantation in vivo outcomes of hIAPP.sup.+/− mouse islets.

[0032] FIG. 4 shows the results of evaluating effects of Compound 1 during serum-deprived culture on the cell viability and ROS in RINm5F cells and hIAPP.sup.+/− mouse islets.

[0033] FIG. 5 shows the results of evaluating effects of Compound 1 during serum-deprived culture on the cell viability and ROS in nonhuman primate (NHP) islets.

[0034] FIG. 6 shows the results of evaluating effects of Compound 1 during serum-deprived culture on in vitro viability, function, pro-inflammatory cytokines expression and oligomer accumulation of isolated hIAPP.sup.+/− mouse islets.

[0035] FIG. 7 shows the results of evaluating effects of Compound 1 during serum-deprived culture on post-transplantation in vivo outcomes of hIAPP.sup.+/− mouse islets.

MODE FOR THE INVENTION

[0036] Hereinafter, the present invention will be described in more detail through preparation examples and examples. However, these examples are only illustrative, and the scope of the present invention is not limited thereto.

I. Experimental Materials and Methods

1. Compound

[0037] (Tetrahydropyran-4-yl)-[2-phenyl-5-(1,1-dioxo-thiomorpholin-4-yflmethyl-1H-indol-7-yl]amine (hereinafter referred to as “Compound 1”) was prepared according to the method described in Example 36 of International Publication No. WO 2009/025478 A1.

2. Experimental Animals and Cell Line

[0038] Islets were isolated from heterozygous human islet amyloid polypeptide transgenic (hIAPP.sup.+/−)FVB/N mice (Jackson Laboratory, Bar Harbor, Me., USA), C.sub.58BL/6 mice (Orientbio, Sungnam, Korea), and cynomolgus monkeys (Macaca fascicularis; Orientbio, Sungnam, Korea). For additional in vitro studies, rat insulinoma cells (RINm5F cells) were treated with or without Compound 1 during culture under tert-butyl hydroperoxide (tBHP) exposure or serum deprivation condition. RINm5F cells were suspended in DMEM medium (Gibco, Grand Island, N.Y., USA) containing 100 IU/mL penicillin and 100 μg/mL streptomycin, and cultured at 37° C. in a fully humidified 5% CO.sub.2 atmosphere. All experimental protocols in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of Samsung Biomedical Research Institute.

3. Islet Isolation

[0039] Mouse islets were isolated from 10- to 12-week-old hIAPP.sup.+/− and C.sub.57BL/6 mice as described previously. Briefly, 0.8 mg/mL of collagenase P (Roche, Indianapolis, Ind., USA) in Hank's buffered saline solution (HBSS, Sigma-Aldrich, St. Louis, Mo., USA) with or without 20 μM Compound 1 were infused into the common bile duct for mouse pancreas digestion. Islets were purified from the digested pancreas using a Ficoll (Biochrom, Berlin, Germany) gradient and washed several times with 1 xHBSS. Isolated islets were cultured while free-floating in 10 mL of RPMI 1640 (Gibco, Grand Island, N.Y., USA). The medium was supplemented with 10% heat-inactivated FBS (fetal bovine serum) at 37° C. and 5% CO.sub.2 incubation prior to the ex vivo and in vivo studies.

4. Nonhuman Primate Islet Isolation

[0040] The dissected nonhuman primate (NHP) pancreas was injected intraductally with a cold Liberase MTF C/T solution (4 mL/g pancreas; Roche). Digestion and isolation were performed using Ricordi's automated isolation technique as described previously. All isolated NHP islets were cultured in a CMRL medium supplemented with 10% heat-inactivated porcine serum at 37° C. and 5% CO.sub.2 incubation prior to the in vitro and in vivo studies.

5. Serum-Deprived Ex Vivo Culture of Isolated Islets

[0041] Purified hIAPP.sup.+/− FVB/N and C57BL/6J mouse were suspended in RPMI 1640 (Gibco, Grand Island, N.Y., USA) containing 100 IU/mL penicillin and 100 μg/mL streptomycin, and cultured at 37° C. in a fully humidified 5% CO.sub.2 atmosphere. Purified NHP islets were suspended in CMRL 1066 medium (Coming Life Sciences, Tewksbury, Mass.; catalog number 99-663-CV) containing 100 IU/mL penicillin and 100 μg/mL streptomycin, and cultured at 37° C. in a fully humidified 5% CO.sub.2 atmosphere. During the ex vivo culture of murine islets, three experimental groups were designated for experiments using hIAPP.sup.+/− FVB/N and C.sub.57BL/6J mice islets: medium supplemented with 10% FBS (Tissue Culture Biologicals, Los Alamitos, Calif., USA; catalog number 101; FBS group), medium supplemented with 0.625% bovine serum albumin (Qbiogene, Carlsbad, Calif., USA; catalog number BSA003; BSA group), and medium supplemented with 0, 0.1, 1, 10 and 20 μM Compoun 1 plus 0.625% BSA (BSA+Compound 1 group). In experiments using NHP islets, the medium was supplemented with 10% FBS (FBS group) and 0-20 μM Compound 1 plus 0.625% human serum albumin (HSA; Greencross, Yongin, Korea) to determine the optimal concentration of Compound 1 for treatment during the serum-deprived culture. Also, the medium was supplemented with 10% FBS (FBS group), 20 μM Compound 1 plus 10% FBS (FBS+Compound 1 group), 0.625% human serum albumin (HSA; Greencross, Yongin, Korea; HSA group), or 20 μM Compound 1 plus 0.625% HSA (HSA+Compound 1 group).

6. Evaluation of Islet Viability by Alamar Blue Assay

[0042] The viability of islets was evaluated using Alamar blue staining according to the manufacturer's protocol (Invitrogen, Grand Island, N.Y., USA). Briefly, islets isolated from hIAPP.sup.+/− mice were cultured at a density of 100 islet equivalents (IE) per well in 24-well plates with RPMI 1640 containing 10% FBS and 0.625% BSA with or without Compound 1. After 1 and 3 days, 10×Alamar blue solution was added directly to each well, and the islets were incubated at 37° C. for 4 hours with protection from direct light. The fluorescence intensity of each well was measured at 570/585 nm (excitation/emission) using a GloMax-Multi Plus Detection System (Promega, Fitchburg, Wis., USA), and the values were normalized to a blank.

7. Acridine Orange/Propidium Iodide (AO/PI) Assay

[0043] Islet viability after isolation and culture was assessed using double fluorescence in acridine orange (0.67 μmon) and propidium iodide (75 μmon) (AO/PI) staining to visualize the living and dead islet cells simultaneously. Fluorescent imaging was performed with a fluorescence microscope (Nikon ECLIPSE 80i, Tokyo, Japan) and live and dead areas were quantified using NIS-Element AR 3.0 (Nikon). The islet viability (%) was calculated as living islet cells/total islet cells×100.

8. ATP Assay

[0044] ATP content of islets was assayed by a luminometric method. The samples were mixed with 200 μL of a commercially available lyophilized ATP monitoring reagent containing firefly luciferase and luciferin (ATP Bioluminescence Assay KIT CLS II, Roche Diagnostics) at first reconstituted in an imidazole buffer (100 mM, pH 7.75). The emitted light was measured in a luminometer (LKB 1250 luminometer). The adenine nucleotide content in samples was determined after correction of the control (no islet or cell) and calculated by reference to ATP standards treated in the same manner as the samples.

9. Fluorescence-Based Intracellular Free Radical Detection and Lipid Peroxidation

[0045] The oxidative stress levels in hIAPP.sup.+/− mouse islets were determined right after islet isolation and after ex vivo culture of isolated islets. The oxidative stress of the islets was quantified using a fluorescence-based intracellular ROS detection method and by estimating the concentration of malondialdehyde (MDA), a by-product of lipid peroxidation. The formation of total ROS, superoxide ion and nitric oxide was determined using a reactive oxygen species detection kit (ENZ-51011, Enzo Life Sciences, Farmingdale, N.Y., USA). The ROS content was measured by levels of DHR123 fluorescence. The kit was applied according to the manufacturer's protocol.

10. Glucose-Stimulated Insulin Secretion (GSIS) Assay

[0046] After hand-picking and washing with PBS, islets were seeded on 12-mm diameter insert wells (Merck Millipore, Billerica, Mass., USA) with 10 islets per well, and preincubated with 60 mg/dL glucose in Kreb's-Ringer buffer (KRB: 129 mM NaCl, 4.8 mM KCl, 2.5 mM CaCl.sub.2, 1.2 mM KH2PO4, 5 mM NaHCO.sub.3, 10 mM HEPES, and 0.2% BSA) for 90 mM at 37° C. After washing, islets were incubated with 300 mg/dL glucose-KRB for 1 hour, followed by additional incubation with 60 mg/dL glucose-KRB for 1 hour. Insulin release into the supernatant by the mouse islets was measured by ELISA (ALPCO, Salem, N.H., USA) and a multiplex kit (Merck Millipore), respectively.

11. RNA Isolation and cDNA Synthesis

[0047] Harvested islets were treated with 500 μL Trizol (Life Technologies, Grand Island, N.Y., USA), and then 100 μL of chloroform was added. After incubation at 4° C. for 5 minutes, the mixture was centrifuged at 12,000 rpm for 15 minutes, and 250 μL of isopropyl alcohol was added to precipitate total RNA. RNA pellets were washed with 75% ethanol, and RNA was eluted from pellets using RNase-Free water (WelGene, Daegu, South Korea). RNA purity was assessed by NanoDrop (Thermo Scientific, Wilmington, Del., USA) and agarose gel electrophoresis. The purity of RNA ranged from 1.9 to 2.0 based on the ratio of optical densities (OD) of 260/230 and 260/280. Total RNA was reverse transcribed to quantify the expression of genes using the SuperScript™ II reverse transcription system (Life Technologies) according to the manufacturer's protocol.

12. Real-Time Quantitative Reverse Transcription (qRT)-PCR

[0048] Real-time qRT-PCR was performed using gene-specific primer pairs (Table 1). Amplified PCR products were normalized to the β-actin PCR product amplified from the same sample. PCR products were separated on 1% agarose gels, and images were obtained using a Gel Doc™ XR instrument (Bio-Rad, Hercules, Calif., USA). To quantify the expression level of genes, real-time PCR was performed using a SYBR premix kit (Takara Bio Inc., Tokyo, Japan) and an ABI Prism 7000 (Applied Biosystems, Foster City, Calif., USA) according to the manufacturers' protocols.

TABLE-US-00001 TABLE 1 Gene-specific primer sequence Genes Forward Reverse Mouse β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCA TGT IL-1β TCAGGCAGGCAGTATCACTC GAAGGTCCACGGGAAAGAC AC IL-6 CTATACCACTTCACAAGTCG GAATTGCCATTGCACAACT CT TNF-α CTGAACTTCGGGGTGATCGG GGCTTGTCACTCGAATTTT GA C-jun CCTGTCCCCTATCGACATGG CTTTTCCGGCACTTGGAGG HMGB1 CGAGAGGCAAAATGTCCTCA TCATAACGAGCCTTGTCAG C IL-1β: Interleukin-1 beta; IL-6: Interleukin-6; TNF-α: Tumor necrosis factors-alpha; HMGB1: High mobility group box 1
13. In Vivo Islet Function of hIAPP.sup.+/− Islets

[0049] A marginal mass renal subcapsular islet transplantation model was used to assess the in vivo islet function of hIAPP.sup.+/− mice. To induce diabetes, 180 mg/kg of streptozotocin (STZ, Sigma-Aldrich) was administered to 8- to 10-week-old FVB/N mice. Mice were considered to have diabetes when two consecutive blood glucose level readings were higher than 300 mg/dL. Equal amounts (400 IEQ of islets per recipient) of islets isolated from hIAPP.sup.+/− mice were allocated to the following two groups: culture medium supplemented with 0.625% BSA (BSA group) and 0.625% BSA plus Compound 1 (BSA+Compound 1 group) to evaluate the combined effect of Compound 1 on islet mass and function during ex vivo culture. After culture for 72 hours, islets were transplanted into the renal subscapular space of diabetic hIAPP.sup.+/− mice. The IE number was calculated using the Ricordi algorithm by classifying islets according to their diameter. After islet transplantation, non-fasting blood glucose levels were measured three times a week for the first 2 weeks and twice a week for the last 2 weeks.

14. Histological Analysis

[0050] At 4 weeks after transplantation, the transplantation site on the kidney of mouse were removed and embedded in paraffin. Immunohistochemical staining is briefly explained in the following. After deparaffinization, 4-μm tissue sections were stained with the polyclonal guinea pig anti-insulin antibody (1:1000, A0546, DAKO, Denmark), glucacon (1:500, ab92517, abcam, United Kingdom) and amyloid (1:2500, #44-344, Invitrogen). Stained slides were observed using an Olympus BX40 light microscope (Olympus, Japan) with ×10/22 numeric aperture and ×40/0.75 numeric aperture objectives. Photographic images were collected with a digital camera (Olympus DP50) and analyzed using the Image-Pro Plus 5.1 software.

[0051] For quantification of the DAB-labeled β-cells, all slides were imaged at 10× on a Vectra 3.0 automated quantitative pathology imaging system and analyzed using inForm software (all from Perkin-Elmer, Waltham, Mass., USA). The transplanted renal tissue sections were scanned for image acquisition and then to set the transplanted tissue segmentation, a number of representative regions of transplanted islet cells and regions to be excluded from the analysis such as renal tissues were examined by learn-by-example interface. For the β-cell segmentation, a spectral library was used to identify the hematoxylin-stained nuclei and the DAB-stained cytoplasm (β-cells) within the transplanted tissue. With these training sets, the algorithm for identifying only the DAB-stained cells in the transplanted tissue was verified. All the captured 10×images were analyzed, and the DAB-stained transplanted β-cells were counted.

15. Evaluation of hIAPP Oligomer Accumulation

[0052] Accumulation of hIAPP oligomers was evaluated using sections of hIAPP.sup.+/− mice islets stained with A11 Ab (anti-oligomer antibody, Invitrogen) and insulin antibody (Dako). Islets were blocked with 10% normal donkey serum and incubated with primary rabbit anti-oligomer (1:100). Islets were washed and incubated with secondary Cy3-conjugated anti-rabbit antibody for 1 hour. After washing, sections were stained with a guinea pig anti-insulin primary antibody (1:500; Dako) followed by an Alexa Fluor 488 anti-guinea pig secondary antibody (1:200; Jackson ImmunoResearch Laboratories). Sections were mounted after counterstaining with 40,6-diamidino-2-phenylindole (DAPI). To quantify accumulation of hIAPP oligomers per islet, the proportion of A11-stained cells among total DAPI+islet cells was determined using confocal microscopy.

16. Evaluation of Amyloid Accumulation

[0053] The sections of islet grafts under the kidney capsule were examined for islet amyloid after 0.5% thioflavin S staining (Sigma) and for β-cells using insulin immunostaining with a guinea pig anti-insulin antibody (1:500; Dako, Carpenteria, Calif.) followed by Cy3-conjugated anti-guinea pig secondary antibody (1:200; Jackson ImmunoResearch Laboratories, West Grove, Pa.). Sections were mounted after staining with DAPI. To quantify accumulation of amyloid per section, the percent proportion of thioflavin S-stained cells (green) among total islet graft site (green+red+blue portion) was determined using confocal microscopy. Original magnification is 100× for panels.

17. Statistical Analysis

[0054] Results are expressed as means±standard deviations (SD) or medians and interquartile ranges, as appropriate. Continuous variables were compared using Student's t-test, one-way analysis of variance (ANOVA), or the Mann—Whitney U test, as appropriate. Longitudinal data were analyzed by two-way ANOVA with Bonferroni post hoc testing using Graphpad Prism 5 (GraphPad Software, La Jolla, Calif., USA). A p value<0.05 was accepted as statistically significant for comparisons.

II. Results

1. Protective Effects Against Oxidative Stress and Proinflammatory Responses During Islet Isolation

[0055] To evaluate the effect of Compound 1 during the islet isolation, islets from hIAPP.sup.+/− FVB/N mice were isolated by collagenase with and without supplementation with 20 μM of Compound 1. The relative ex vivo cell viability assessed by Alamar blue assay was significantly increased in the Compound 1 treated group compared to those non-treated group (FIG. 1A). In addition, Compound 1 treatment during islet isolation presented significantly elevated levels of ATP compared to Compound 1 non-treated group (FIG. 1B). Also, ROS contents and oxidative stress levels in islets treated with Compound 1 during the islet isolation were markedly decreased compared to control islets without Compound 1 treatment (FIGS. 1C and 1D). The stimulation index obtained in the glucose-stimulated insulin secretion (GSIS) assay, presenting the in vitro islet function, showed comparable values between two groups (FIG. 1E). Next, we also examined the transcriptional expression of c-Jun N-terminal kinases and high mobility group box-1 (HMGB1), and proinflammatory cytokines including interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-α in the culture medium after isolation with and without supplementation of Compound 1. These transcriptional expression levels were significantly decreased in Compound 1 treated group compared to non-treated group (FIG. 1F). These results were reproduced in wild type C57BL/6 mouse islets (FIG. 2).

2. Effect on Improvement of Post-Tranplantation Outcomes

[0056] To examine the effect of supplementation of Compound 1 during islet isolation in vivo, marginal mass of islets, isolated with or without supplementation of Compound 1, were transplanted into renal subcapsular space of streptozotocin (STZ)-induced diabetic hIAPP.sup.+/− FVB/N mice (FIG. 3A). The post-transplant glucose levels of Compound 1 treated group were markedly lower than those of non-treated group and removal of the grafted kidney confirmed regain of hyperglycemia in the Compound 1 treated group (FIG. 3B). Compound 1 group demonstrated better post-transplantation outcomes, in terms of diabetes reversal rate and glucose levels during the intraperitoneal glucose tolerance test (IPGTT), compared to those of control group (FIGS. 3C, 3D and 3E). Compound 1 group presented greater proportion of insulin positive area in the grafted tissue compared to that of control group (FIG. 3F).

3. Protection of hIAPP.sup.+/− Transgenic Mice and NHP Islets During Serum-Deprived Culture

[0057] We examined the effect of supplementation of Compound 1 on tert-butyl hydroperoxide (tBHP) exposure or islet culture under serum-deprived condition. Although RINm5F cells exposed to tBHP exerted LDH release and ROS formation, cellular toxicity and ROS contents were markedly reduced after the supplementation of Compound 1 (FIGS. 4A and 4B). The relative cell viability of rat insulinoma cells (RINm5F cells) and islets from hIAPP.sup.+/− FVB/N mice significantly increased serum deprivation-induced cell toxicity by dose-dependent manner from 0.1 μM to 20 μM (FIGS. 4C and 4D). Supplementation of medium with Compound 1 during serum-deprived culture condition also decreased serum deprivation-induced ROS in RINm5F cells and islets from hIAPP.sup.+/− FVB/N mice by dose-dependent manner from 0.1 μM to 20 μM (FIGS. 4E and 4F). Similar results were observed in NHP islets (FIGS. 5A, 5B and 5C).

[0058] FIG. 6A shows cell viability of hIAPP.sup.+/− FVB/N mice islets during serum-deprived culture with or without Compound 1 supplementation assessed by AO/PI staining. Compared to the FBS-treated islets, islets cultured with BSA for 72 hours experienced greater cell death showing the positivity of red PI-positive cells and the impaired cell viability significantly improved by supplementation of Compound 1 (FIGS. 6A and 6B). Transcript levels of TNF-α, IL-1β, IL-6, c-JUN and HMGB1 after 1 and 3 days of ex vivo culture were significantly attenuated in the BSA+Compound 1 group than those in the BSA group (FIGS. 6C and 6D). For evaluating the function of islets, significantly increased stimulation index was observed in islets from hIAPP.sup.+/− mouse when Compound 1 was added to the medium during serum-deprived culture condition (FIG. 6E). After culture in medium with and without Compound 1 for 72 hours under serum deprived culture conditions, proportion of accumulation of hIAPP oligomers in hIAPP.sup.+/− islets was significantly decreased in BSA+Compound 1 group compared to BSA group (FIG. 6F).

4. Improvements of Post-Transplantation Glycemic Outcomes and Graft Islet Amyloid Accumulation

[0059] We investigated whether supplementation of medium with Compound 1 during serum-deprived culture improves posttransplantation outcomes in in vivo mouse models. A marginal mass of islets from hIAPP.sup.+/− FVB/N mice were cultured with and without supplementation of Compound 1 for 72 hours and transplanted into subrenal subcapsular of STZ-induced diabetic hIAPP.sup.+/− FVB/N mice (FIG. 7A). The Compound 1 group demonstrated significantly better posttransplantation outcomes including posttransplant glucose levels, diabetes reversal rate, and glucose levels and AUC of glucose during IPGTT (FIGS. 7B, 7C, 7D and 7E). The insulin positive area in the grafted tissue was greater in Compound 1 group than the proportion in the control group (FIG. 7F). In addition, proportion of accumulation of amyloid was significantly reduced in the sections of islet grafts from Compound 1 group compared to the control group (FIG. 7G).

III. Discussion

[0060] Supplementation of Compound 1 during islet isolation resulted in increased in vitro islet cellular viability, and attenuated oxidative stress, reactive oxygen species (ROS) contents, and the expression of c-Jun, HMGB1 and proinflammatory cytokines. In addition, in vivo studies confirmed improved post-transplantation outcomes by treatment of Compound 1 during islet isolation.

[0061] Furthermore, Compound 1 protected against serum deprivation-induced impairment of in vitro islet viability. More importantly, supplementation of medium with Compound 1 during serum-deprived culture significantly reduced accumulation of amyloid as well as toxic IAPP oligomers, and improved in vivo islet graft function.

[0062] From these results, advantageous effects can be confirmed according to supplementation of Compound 1 during islet isolation as well as serum-deprivation culture in the process of islet transplantation.