APPLICATION OF GERANIOL IN PREPARATION OF FORMULATION FOR PROMOTING SYNTHESIS OF PSEUDOMONAS AERUGINOSA 3OC12-HSL SIGNAL MOLECULES

Abstract

An application of geraniol in preparation of formulation for promoting synthesis of Pseudomonas aeruginosa 3OC.sub.12-HSL signal molecules is provided. It was found that geraniol slightly inhibits growth of Pseudomonas aeruginosa PAO1 strain, but can significantly promote synthesis of the 3OC.sub.12-HSL signal molecules of the bacterium, and thus can be applied to preparation of formulation for promoting synthesis of the Pseudomonas aeruginosa 3OC.sub.12-HSL signal molecules.

Claims

1. An application of geraniol in a preparation of a formulation for promoting a synthesis of Pseudomonas aeruginosa 3OC.sub.12-HSL signal molecules.

2. The application according to claim 1, wherein Pseudomonas aeruginosa is Pseudomonas aeruginosa PAO1.

3. The application according to claim 1, wherein each of the Pseudomonas aeruginosa 3OC.sub.12-HSL signal molecules is a signal molecule of a las quorum sensing system of a bacterium, and is synthesized by a signal molecule synthase LasI.

4. The application according to claim 1, wherein a concentration of the geraniol in a Pseudomonas aeruginosa culture solution is 0.313 μL/mL to 2.5 μL/mL.

5. The application according to claim 2, wherein a concentration of the geraniol in a Pseudomonas aeruginosa culture solution is 0.313 μL/mL to 2.5 μL/mL.

6. The application according to claim 3, wherein a concentration of the geraniol in a Pseudomonas aeruginosa culture solution is 0.313 μL/mL to 2.5 μL/mL.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0014] FIG. 1 is a growth curve of Pseudomonas aeruginosa PAO1 under an action of geraniol.

[0015] FIG. 2 is influence of geraniol on expression of key genes in the Pseudomonas aeruginosa quorum sensing system and virulent genes regulated thereby.

DETAILED DESCRIPTION

[0016] The following embodiments are further illustrations of the present invention, rather than limitations to the present invention.

Embodiment 1

[0017] Preparation of PAO1 [(Pseudomonas aeruginosa) PAO1] bacterial suspension: a PAO1 culture medium in an exponential growth phase was sampled, centrifuged, washed once with PBS buffer, resuspended in PBS, and had a bacterial concentration diluted to 10.sup.8 CFU/mL to obtain PAO1 bacterial suspension.

[0018] 1. Experiment on Influence of Geraniol on Pseudomonas aeruginosa PAO1 Growth

[0019] An LB medium and geraniol were respectively added to test tubes, joined with the PAO1 bacterial suspension in the exponential growth phase, to make total volumes all reach 10 mL, so that PAO1 bacterial concentrations were all 10.sup.6 CFU/mL, and concentrations of geraniol were respectively 0 μL/mL (control), 0.313 μL/mL, 0.625 μL/mL, 1.25 μL/mL, and 2.5 μL/mL. Samples from the experimental groups were respectively added to a honeycomb culture plate dedicated to an automatic growth curve analyzer (Bioscreen C), which has each well added with 350 μL culture medium; and each experimental group has three parallel experiments. The honeycomb culture plate was placed in the automatic growth curve analyzer, for shaking culture at 37° C. for 3 days, with OD.sub.600 measured every hour. Taking OD.sub.600 as an ordinate and culture time as an abscissa, a growth curve of PAO1 under an action of geraniol was drawn to study influence of geraniol on PAO1 growth. Results are shown in FIG. 1.

[0020] 2. Experiment on Influence of Geraniol on Expression of Key Genes in the Pseudomonas aeruginosa Quorum Sensing System and Virulent Genes Regulated Thereby.

[0021] The PAO1 bacterial suspension in a logarithmic growth phase was added to 50 mL sterile LB liquid medium to make a final concentration of the bacterial solution reach 10.sup.6 CFU/mL. Geraniol was added to make a final concentration become 0 μL/mL (three biological replicates in a control group were respectively named A1, A2 and A3) and 1.25 μL/mL (three biological replicates in an experimental group were respectively named B1, B2 and B3); the respective groups were cultured at 37° C. and 180 rpm for 5 h, centrifuged to collect Bacteria, and then snap-frozen at −80° C. for later use.

[0022] Total bacterial RNA was extracted with a kit of Trizol (Thermo Company). After extraction, purity of RNA was detected with an ultra-micro spectrophotometer (Implen, Munich, Germany). An A260/A280 value of each RNA sample should be between 1.8 and 2.0. Reverse transcription and real-time fluorescent quantitative PCR amplification were performed with the PrimeScript RT Master Mix kit (Takara, Dalian, China) and the ETC 811 PCR instrument (Beijing Eastwin Life Sciences, Inc.). A q-PCR reaction system adopted Takara's SYBR Premix Ex TaqII (Tli RNaseH Plus) (Code No. RR820A); the PCR program was pre-denaturation at 95° C. for 30 s; denaturation at 95° C. for 5 s, annealing at 60° C. for 34 s, 40 loops; according to the 10 gene sequences already published on the GenBank website, primers for q-PCR were designed with Primer Premier 5.0 software, and meanwhile, the 16SrRNA gene was used as an internal reference gene. Primer sequence parameters are shown in Table 1.

[0023] Table 1 Genes and primer sequences thereof used in real-time fluorescent quantitative PCR

TABLE-US-00001 TABLE 1 Genes and primer sequences thereof used in real-time fluorescent quantitative PCR SEQ ID Gene name Gene locus Gene description Primer sequence (5′-3′) NO: 16S rRNA PA5369.5 16S ribosomal RNA GCGCAACCCTTGTCCTTAGTT (F)  1 TGTCACCGGCAGTCTCCTTAG(R)  2 lasI PA1432 Acyl-homoserine-lactone TGCGTGCTCAAGTGTTCAAGG (F)  3 synthase CGGCTGAGTTCCCAGATGTGC(R)  4 lasR PA1430 ptional regulator LasR GACCAGTTGGGAGATATCGGTTA (F)  5 TCCGCCGAATATTTCCCATA (R)  6 rhlI PA3476 Acyl-homoserine-lactone AAACCCGCTACATCGTCGC (F)  7 synthase TCTCGCCCTTGACCTTCTGC (R)  8 rhLR PA3477 Transcriptional regulator ATCGCCATCATCCTGAGCATT (F)  9 RhlR TCGGAGGACATACCAGCACAC (R) 10 pqsA PA0996 Anthranilate-CoA ligase GCAATACACCTCGGGTTCCA (F) 11 TCCGCTGAACCAGGGAAAGA (R) 12 pqsR PA1003 Transcriptional regulator TCGTTCTGCGATACGGTGAG (F) 13 (mvfR) MvfR GCACTGGTTGAAGCGGGAG(R) 14 lasA PA1871 Protease LasA GCCGCTGAATGACGACCTGT (F) 15 TCAGGGTCAGCAACACTT (R) 16 lasB PA3724 Elastase LasB AAGGCCTTGCGGGTATCC (F) 17 phzM PA4209 Phenazine-specific GAATGGAAGTCCCGTTGC (F) 19 methyltransferase GCCCTCGACATCCCTCA (R) 20 chiC PA2300 Chitinase CTGGGAGTTCCGCAAGCGTTAC (F) 21 ATCGGTGGCGGTGACGAAATAG (R) 22 toxA PA1148 Exotoxin A CCCGGCGAAGCATGAC (F) 23 GGGAAATGCAGGCGATGA(R) 24 pslB PA2232 Biofilm formation protein CAACGAATCCACCTTCATCC(F) 25 PslB ACTCGCCGCTCTGTACCTC(R) 26 pelF PA3059 Pellicle/biofilm biosynthesis GACTTTCTCCACAGCAAG (F) 27 glycosyltransferase PelF CAGAAGTAATTGACGAAGGA (R) 28

EXPERIMENTAL RESULTS

[0024] The results of growth curves of Pseudomonas aeruginosa PAO1 under action of different concentrations of geraniol are shown in FIG. 1. The experimental results show that geraniol has a concentration-dependent inhibitory effect on growth of PAO1 cells; and the higher the concentration of geraniol, the stronger the antibacterial effect. The 0.313 μL/mL, 0.625 μL/mL, 1.25 μL/mL and 2.5 μL/mL geraniol all slightly inhibit growth of PAO1, especially, the 2.5 μL/mL geraniol treatment group has the highest antibacterial activity. The 2.5 μL/mL geraniol treatment group has a bacterial proliferation rate in the logarithmic growth phase significantly lower than other groups, but has a longer logarithmic growth phase than other groups, and a very short stationary phase, the bacteria have been in slow proliferation after a lag phase, and then enter a decline phase; as a result, a bacterial concentration in the 2.5 μL/mL geraniol treatment group during a period of 33 h to 41 h is even higher than that in other geraniol treatment groups. In conclusion, the 0.313 μL/mL, 0.625 μL/mL, 1.25 μL/mL and 2.5 μL/mL geraniol all slightly inhibit growth of PAO1 cells.

[0025] After treating PAO1 cells with 1.25 μL/mL geraniol for 5 h, transcription levels of key genes of the quorum sensing system and related virulent genes are as shown in FIG. 2. Expression of the signal molecule synthase encoding gene lasI in the las system is up-regulated, and expression of the signal molecule receptor protein encoding gene lasR is down-regulated. Expression of the signal molecule receptor protein encoding gene rhlR in the rhl system is down-regulated, and an expression level of the signal molecule synthase encoding gene rhl does not change significantly. In the pqs system, expression of the signal molecule synthase encoding gene pqsA is down-regulated, and expression of the signal molecule receptor protein encoding gene pqsR is up-regulated. Expression levels of virulent genes lasA, lasB, phzM and chiC are significantly down-regulated, while expression levels of toxA, pslB and pelF are not significantly down-regulated. Thus, it can be seen that, geraniol can inhibit expression of the signal molecule receptor protein encoding gene of the Pseudomonas aeruginosa quorum sensing system las and rhl, and inhibit expression of the signal molecule synthase encoding gene of the pqs system, which further inhibits regulatory pathways of the three quorum sensing systems, and inhibits production of virulent factors regulated by the three quorum sensing systems, thereby controlling virulence and pathogenicity of Pseudomonas aeruginosa.

[0026] To sum up, the experimental results show that low concentration of geraniol slightly inhibits growth of Pseudomonas aeruginosa PAO1 strain (FIG. 1), but can significantly promote synthesis of 3OC.sub.12-HSL signal molecules of the bacterium.