Microorganism of <i>Corynebacterium </i>genus having enhanced L-arginine or L-citrulline productivity and a method for producing L-arginine or L-citrulline using the same

12595461 ยท 2026-04-07

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure relates to a Corynebacterium sp. mutant strain having increased L-arginine or L-citrulline productivity and a method of producing L-arginine or L-citrulline using the same. The Corynebacterium sp. mutant strain has enhanced activity of acetylglutamate kinase involved in the L-arginine biosynthesis pathway, and thus is capable of producing L-arginine or L-citrulline in an increased yield compared to a parent strain.

Claims

1. A Corynebacterium sp. mutant strain having increased L-arginine or L-citrulline productivity by having enhanced activity of acetylglutamate kinase, wherein said acetylglutamate kinase of the Corynebacterium sp. mutant strain having increased L-citrulline productivity has a substitution of aspartic acid for histidine at amino acid position 245 in the amino acid sequence of SEQ ID NO: 2, wherein said acetylglutamate kinase of the Corynebacterium sp. mutant strain having increased L-arginine productivity has a substitution of leucine for glutamic acid at amino acid position 258 or a substitution of aspartic acid for histidine at amino acid position 245 in the amino acid sequence of SEQ ID NO: 2.

2. The Corynebacterium sp. mutant strain of claim 1, which is Corynebacterium glutamicum.

3. A method for producing L-arginine or L-citrulline comprising steps of: culturing the Corynebacterium sp. mutant strain of claim 1 in a medium; and recovering L-arginine or L-citrulline from the cultured mutant strain or the medium in which the mutant strain has been cultured.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the structure of a pk19msb+argB-E258L vector containing a gene encoding an acetylglutamate kinase having a substitution of leucine for glutamic acid at amino acid position 258 according to one embodiment of the present disclosure.

(2) FIG. 2 shows the structure of a pk19msb+argB-E258A vector containing a gene encoding an acetylglutamate kinase having a substitution of alanine for glutamic acid at amino acid position 258 according to one embodiment of the present disclosure.

(3) FIG. 3 shows the structure of a pk19msb+argB-H245D vector containing a gene encoding an acetylglutamate kinase having a substitution of aspartic acid for histidine at amino acid position 245 according to one embodiment of the present disclosure.

DETAILED DESCRIPTION

(4) Hereinafter, the present disclosure will be described in more detail. However, these descriptions are provided for illustrative purposes only to aid in the understanding of the present disclosure, and the scope of the present disclosure is not limited by these illustrative descriptions.

Example 1. Construction of Corynebacterium glutamicum Mutant Strain

(5) To construct a Corynebacterium glutamicum mutant strain having enhanced activity of acetylglutamate kinase, Corynebacterium glutamicum 14GR (KCCM13219P) strain, which is an L-arginine-producing strain, and E. coli DH5a (HIT Competent Cells, Cat No. RH618) were used.

(6) The Corynebacterium glutamicum 14GR strain was cultured in an ARG-broth medium (pH 7.2) containing 10.5 g of 98% glucose, 1 g of beef extract, 4 g of yeast extract, 2 g of polypeptone, 2 g of NaCl and 40 g of (NH.sub.4).sub.2SO.sub.4 in 1 L of distilled water at a temperature of 30 C.

(7) The E. coli DH5a was cultured on an LB medium containing 10.0 g of tryptone, 10.0 g of NaCl and 5.0 g of yeast extract in 1 L of distilled water at a temperature of 37 C.

(8) The antibiotic kanamycin used was the product of Sigma.

(9) DNA sequencing was performed by Macrogen, Inc.

(10) 1-1. Recombinant Vector

(11) Mutation was induced in acetylglutamate kinase to enhance the biosynthesis pathway in the strain. In the method used in this Example, the argB gene encoding acetylglutamate kinase was subjected to site-directed mutagenesis in order to increase expression of the gene. Glutamic acid at amino acid position 258 of the acetylglutamate kinase encoded by the argB gene was substituted with leucine, and the left arm portion (1,614 bp) and the right arm portion (854 bp) with respect to the center of the argB gene on the Corynebacterium glutamicum genome were amplified by PCR and ligated together by overlap PCR, followed by cloning into a pk19msb vector. The resulting plasmid was named pk19msb+argB-E258L (see FIG. 1). To construct the plasmid, the primers shown in Table 1 below were used for amplification of each gene fragment.

(12) TABLE-US-00001 TABLE1 Primer(5.fwdarw.3) SEQIDNO Amplification argB-F1 tgattacgccactgacacggtggataaggaaac 9 primersforleft argB-F2 actgacacggtggataaggaaac 10 homologousarmof E258L-R1 agcagcaacaccgagtgc 11 argB E258L-R2 ggtcaaaagcagcagcaaca 12 Amplification E258L-F1 gcttttgaccatgggtggaattggcacg 13 primersforright E258L-F2 atgggtggaattggcacg 14 homologousarmof argB-R1 catcgggaacaacgccat 15 argB argB-R2 atggtcaccacatcgggaa 16

(13) Using the above-described primers, PCR was performed under the following conditions. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc., Japan) in a reaction solution containing 100 M of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 1 M oligonucleotide, 10 ng of the chromosomal DNA of Corynebacterium glutamicum ATCC 13032 as a template, and 1 unit of pfu-X DNA polymerase mixture (Solgent). PCR was performed for 25 to 30 cycles, each consisting of (i) denaturation at 94 C. for 30 sec, (ii) annealing at 58 C. for 30 sec, and (iii) extension at 72 C. for 1 to 2 min (a polymerization time of 2 min per kb).

(14) The gene fragments prepared as described above were cloned into a pk19msb vector by self-assembly cloning. The vector was transformed into E. coli DH5a which was then plated on an LB-agar plate containing 50 g/ml of kanamycin, and cultured at 37 C. for 24 hours. The finally formed colony was isolated and whether the insert was exactly present in the vector was checked. Next, the vector was isolated and used for recombination of the Corynebacterium glutamicum strain.

(15) As a process commonly performed in the above method, the corresponding genes were amplified by PCR from the genomic DNA of Corynebacterium glutamicum ATCC 13032 and inserted into the pk19msb vector by the self-assembled cloning method according to the strategy, and the resulting plasmid was selected in E coli DH5a. For chromosomal base substitution, the gene fragments were amplified individually and ligated together by overlap PCR, thereby preparing the desired DNA fragment. For genetic manipulation, Ex Taq polymerase (Takara) and Pfu polymerase (Solgent) were used as PCR polymerases, and various restriction enzymes and DNA modifying enzymes purchased from NEB were used, and they were used according to manufacturer's provided buffers and protocols.

(16) 1-2. Corynebacterium glutamicum Mutant Strain AB1

(17) Mutant strain AB1 was constructed using a cloning vector. The cloning vector was prepared at a final concentration of 1 g/l or more and electroporated into a Corynebacterium glutamicum 14GR strain (see Tauch et al., FEMS Microbiology letters 123 (1994) 343-347) to induce first recombination. In this case, the electroporated strain was plated on an agar medium containing 50 g/l of kanamycin, colonies were isolated, and then whether the vector was properly inserted at the desired position on the genome was checked by PCR and sequencing. Each of the isolated strains was inoculated again in a liquid medium to induce second recombination, cultured overnight or more, and then plated on an agar medium containing 10% sucrose, and colonies were isolated. Whether the finally isolated colonies were resistant to kanamycin was checked, and then whether mutation was introduced into the acetylglutamate kinase in the strains having no antibiotic resistance was checked by sequencing (see Schafer et al., Gene 145 (1994) 69-73). As a result, Corynebacterium glutamicum mutant strain AB1 capable of producing L-arginine was constructed, which has a substitution of leucine for glutamic acid at position 258 in the amino acid sequence of acetylglutamate kinase (SEQ ID NO: 2).

Example 2. Construction of Corynebacterium glutamicum Mutant Strain

(18) A Corynebacterium glutamicum mutant strain having enhanced activity of acetylglutamate kinase was constructed in the same manner as in Example 1, a recombinant vector (pk19msb+argB-E258A) containing an argB gene encoding an acetylglutamate kinase having a substitution of alanine for glutamic acid at amino acid position 258 was used.

(19) More specifically, glutamic acid at amino acid position 258 of the acetylglutamate kinase encoded by the argB gene was substituted with alanine, and the left arm portion (1,614 bp) and the right arm portion (854 bp) with respect to the center of the argB gene on the Corynebacterium glutamicum genome were amplified by PCR and ligated together by overlap PCR, followed by cloning into a pk19msb vector. The resulting plasmid was named pk19msb+argB-E258A (see FIG. 2). To construct the plasmid, the primers shown in Table 2 below were used for amplification of each gene fragment.

(20) TABLE-US-00002 TABLE2 Primer(5.fwdarw.3) SEQIDNO Amplification argB-F1 tgattacgccactgacacggtggataaggaaac 9 primersforleft argB-F2 actgacacggtggataaggaaac 10 homologousarmof E258A-R1 gccagcaacaccgagt 17 argB E258A-R2 ggtcaaaagcgccagcaaca 18 Amplification E258L-F1 gcttttgaccatgggtggaattggcacg 13 primersforright E258L-F2 atgggtggaattggcacg 14 homologousarmof argB-R1 catcgggaacaacgccat 15 argB argB-R2 atggtcaccacatcgggaa 16

(21) As a result, Corynebacterium glutamicum mutant strain AB2 capable of producing L-arginine was constructed, which has a substitution of alanine for glutamic acid at position 258 in the amino acid sequence of acetylglutamate kinase (SEQ ID NO: 2).

Example 3. Construction of Corynebacterium glutamicum Mutant Strain

(22) A Corynebacterium glutamicum mutant strain having enhanced activity of acetylglutamate kinase was constructed in the same manner as in Example 1, a recombinant vector (pk19msb+argB-H245D) containing an argB gene encoding an acetylglutamate kinase having a substitution of aspartic acid for histidine at amino acid position 245 was used.

(23) More specifically, histidine at amino acid position 245 of the acetylglutamate kinase encoded by the argB gene was substituted with aspartic acid, and the left arm portion (1,583 bp) and the right arm portion (885 bp) with respect to the center of the argB gene on the Corynebacterium glutamicum genome were amplified by PCR and ligated together by overlap PCR, followed by cloning into the recombinant vector pk19msb. The resulting plasmid was named pk19msb+argB-H245D (see FIG. 3). To construct the plasmid, the primers shown in Table 3 below were used for amplification of each gene fragment.

(24) TABLE-US-00003 TABLE3 Primer(5.fwdarw.3) SEQIDNO Amplification argB-F1 tgattacgccactgacacggtggataaggaaac 9 primersforleft argB-F2 actgacacggtggataaggaaac 10 homologousarmof H245D-R1 caatgacatcagcagcgctta 19 argB H245D-R2 atgcggccgtcaatgac 20 Amplification H245D-F1 acggccgcatcgcgcactcggtgttgct 21 primersforright H245D-F2 cgcgcactcggtgttgct 22 homologousarmof argB-R1 catcgggaacaacgccat 15 argB argB-R2 atggtcaccacatcgggaa 16

(25) As a result, Corynebacterium glutamicum mutant strain AB3 capable of producing L-arginine was constructed, which has a substitution of aspartic acid for histidine at position 245 in the amino acid sequence of acetylglutamate kinase (SEQ ID NO: 2).

Experimental Example 1. Evaluation of L-Arginine Productivities of Corynebacterium glutamicum Mutant Strains

(26) The L-arginine productivities of the Corynebacterium glutamicum mutant strains AB1 to AB3 constructed in Examples 1 to 3 were evaluated in comparison with that of the parent strain.

(27) Each strain was patched on a flask solid seed medium and cultured at 30 C. for 24 hours. Each cultured colony was inoculated into a 10-ml flask titer medium and cultured at 200 rpm at 32 C. for 30 hours. The compositions of the media used here are shown in Table 4 below. After completion of the culturing, each culture was diluted 100-fold with distilled water and filtered through a 0.45-m filter, and then the amount of L-arginine produced was analyzed using high-performance liquid chromatography (HPLC) (Agilent Technologies 1260 Infinity, Agilent Technologies) equipped with a column (DionexIonPac CS12A) and a UV detector (195 mm), and the results are shown in Table 5 below. In Table 5, L-arginine (%) denotes the amount (percentage) of arginine produced by each strain, and fermentation yield (Yp/s) (%) denotes the amount of L-arginine produced per glucose consumed.

(28) TABLE-US-00004 TABLE 4 Flask 10.5 g of 98% glucose, 1 g of beef extract, 4 g of solid seed yeast extract, 2 g of polypeptone, 2 g of NaCl, 40 g medium of (NH.sub.4).sub.2SO.sub.4 and 20 g of agar (per L) Flask titer 120 g of 98% glucose, 1 g of MgSO.sub.4, 2 g of KH.sub.2PO.sub.4, medium 45 g of (NH.sub.4).sub.2SO.sub.4, 20 mg of FeSO.sub.4, 20 mg of MnSO.sub.4, (per L) 100 g of biotin, 100 g of thiamine, 4 g of YSP and 2 g of urea

(29) TABLE-US-00005 TABLE 5 Strain OD.sub.610 L-arginine (%) Fermentation yield (%) Parent strain 35.0 1.63 16.27 AB1 37.0 2.53 25.32 AB2 29.0 2.42 24.25 AB3 32.0 2.60 26.04

(30) As shown in Table 5 above, it was confirmed that the Corynebacterium glutamicum mutant strains AB1 to AB3 had significantly increased L-arginine productivity compared to the parent strain due to a substitution of an optimal amino acid for the amino acid at position 258 or 245 in the amino acid sequence of acetylglutamate kinase.

Example 4. Construction of Corynebacterium glutamicum Mutant Strain

(31) Corynebacterium glutamicum mutant strain CB1 having a substitution of leucine for glutamic acid at position 258 in the amino acid sequence of acetylglutamate kinase (SEQ ID NO: 2) and capable of producing L-citrulline was constructed in the same manner as in Example 1, except that the pk19msb+argB-E258L cloning vector of Example 1-1 was introduced into Corynebacterium glutamicum 15GD (KCCM13220P) in place of Corynebacterium glutamicum 14GR.

Example 5. Construction of Corynebacterium glutamicum Mutant Strain

(32) Corynebacterium glutamicum mutant strain CB2 having a substitution of alanine for glutamic acid at position 258 in the amino acid sequence of acetylglutamate kinase (SEQ ID NO: 2) and capable of producing L-citrulline was constructed in the same manner as in Example 1, except that the pk19msb+argB-E258A cloning vector of Example 2 was introduced into Corynebacterium glutamicum 15GD in place of Corynebacterium glutamicum 14GR.

Example 6. Construction of Corynebacterium glutamicum Mutant Strain

(33) Corynebacterium glutamicum mutant strain CB3 having a substitution of aspartic acid for histidine at position 245 in the amino acid sequence of acetylglutamate kinase (SEQ ID NO: 2) and capable of producing L-citrulline was constructed in the same manner as in Example 1, except that the pk19msb+argB-H245D cloning vector of Example 3 was introduced into Corynebacterium glutamicum 15GD in place of Corynebacterium glutamicum 14GR.

Experimental Example 2. Evaluation of L-Citrulline Productivities of Corynebacterium glutamicum Mutant Strains

(34) The L-citrulline productivities of the Corynebacterium glutamicum mutant strains CB1 to CB3 constructed in Examples 4 to 6 were evaluated in comparison with that of the parent strain.

(35) Each strain was patched on a flask solid seed medium and cultured at 30 C. for 24 hours. Each cultured colony was inoculated into a 10-ml flask titer medium and cultured at 200 rpm at 32 C. for 30 hours. The compositions of the media used here are shown in Table 6 below. After completion of the culturing, each culture was diluted 100-fold with distilled water and filtered through a 0.45-m filter, and then the amount of L-citrulline produced was analyzed using high-performance liquid chromatography (HPLC) (Agilent Technologies 1260 Infinity, Agilent Technologies) equipped with a column (DionexIonPac CS12A) and a UV detector (195 mm), and the results are shown in Table 7 below. In Table 7, L-citrulline (%) denotes the amount (percentage) of citrulline produced by each strain, and fermentation yield (Yp/s) (%) denotes the amount of L-citrulline produced per glucose consumed.

(36) TABLE-US-00006 TABLE 6 Flask 10.5 g of 95% glucose, 10 g of beef extract, 10 g of solid seed yeast extract, 10 g of polypeptone, 2.5 g of NaCl and medium 100 mg of arginine (per L) Flask titer 105.3 g of 95% glucose, 1 g of MgSO.sub.4, 4 g of YPA, 0.8 g medium of KH.sub.2PO.sub.4, 1.2 g of Na.sub.2HPO.sub.4, 30 g of (NH.sub.4).sub.2SO.sub.4, 20 mg (per L) of FeSO.sub.4, 20 mg of MnSO.sub.4, 10 mg of ZnSO.sub.4, 100 mg of arginine, 100 g of biotin and 200 g of thiamine

(37) TABLE-US-00007 TABLE 7 Strain OD.sub.610 L-citrulline (%) Fermentation yield (%) Parent strain 14.0 1.67 16.70 CB1 16.0 1.87 18.70 CB2 14.0 1.91 19.10 CB3 17.0 1.88 18.80

(38) As shown in Table 7 above, it was confirmed that the Corynebacterium glutamicum mutant strains CB1 to CB3 had significantly increased L-citrulline productivity compared to the parent strain due to a substitution of an optimal amino acid for the amino acid at position 258 or 245 in the amino acid sequence of acetylglutamate kinase.

(39) These results suggest that L-arginine and L-citrulline productivities were increased by enhancing enzymatic activity through site-directed mutation in the nucleic acid sequence or amino acid sequence of the acetylglutamate kinase involved in the L-arginine biosynthesis pathway.

(40) So far, the present disclosure has been described with reference to the embodiments. Those of ordinary skill in the art to which the present disclosure pertains will appreciate that the present disclosure may be embodied in modified forms without departing from the essential characteristics of the present disclosure. Therefore, the disclosed embodiments should be considered from an illustrative point of view, not from a restrictive point of view. The scope of the present disclosure is defined by the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present disclosure.

(41) [Accession Number]

(42) Depository authority: Korean Culture Center of Microorganisms (KCCM)

(43) Accession number: KCCM13219P

(44) Deposit date: Jun. 29, 2022

(45) Depository authority: Korean Culture Center of Microorganisms (KCCM)

(46) Accession number: KCCM13220P

(47) Deposit date: Jun. 29, 2022