Composition comprising exosomes derived from induced pluripotent stem cell-derived mesenchymal stem cell progenitor for prevention or treatment of non-alcoholic steatohepatitis

12594303 ยท 2026-04-07

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure relates to a pharmaceutical composition for prevention or treatment of non-alcoholic steatohepatitis, the composition comprising, as an active ingredient, exosomes isolated from induced pluripotent stem cell-derived mesenchymal stem cells which have been or have not been treated with a pretreatment material. The exosomes of the present disclosure exhibit a more improved effect of preventing or treating non-alcoholic steatohepatitis, compared to those isolated from conventional mesenchymal stem cells and as such, can be advantageously used for relevant research and development, and productization.

Claims

1. A method for treating non-alcoholic steatohepatitis, comprising step of: administering, to a subject, a composition comprising exosomes isolated from induced pluripotent stem cell-derived mesenchymal stem cells (MSC) treated with a pretreatment material selected from the group consisting of 1-(6-benzothiazolysulfonyl)-5-chloro-1H-indole-2-butanoic acid and exendin-4; wherein the induced pluripotent stem cell-derived mesenchymal stem cells are derived from a progenitor of induced pluripotent stem cell-derived mesenchymal stem cells which does not express SSEA-4 (stage-specific embryonic antigen 4) protein, wherein the exosomes do not contain the pretreatment material.

2. The method of claim 1, wherein the induced pluripotent stem cells are induced pluripotent stem cells of human origin.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1a is a graph showing the mean size and distribution of exosomes (BxC-e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC).

(2) FIG. 1b is an electron microscopic image of exosomes (BxC-e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC).

(3) FIG. 2a shows microscopic images illustrating inhibitory effects of exosomes (BxC-e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) on lipogenesis.

(4) FIG. 2b is a graph illustrating inhibitory effects of exosomes (BxC-e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) on lipogenesis.

(5) FIG. 3a is a graph showing the mean size and distribution of exosomes (BxC-V37e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) pretreated with LANIFIBRANOR.

(6) FIG. 3b is an electron microscopic image of exosomes (BxC-V37e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) pretreated with LANIFIBRANOR.

(7) FIG. 4a is a graph showing the mean size and distribution of exosomes ((BxC-G63e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) pretreated with exendin-4.

(8) FIG. 4b is an electron microscopic image of exosomes (BxC-G63e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) pretreated with exendin-4.

(9) FIG. 5 is a graph showing inhibitory effects of exosomes (BxC-e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) and exosomes (BxC-V37e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) pretreated with LANIFIBRANOR on lipogenesis in steatosis-induced hepatocytes.

(10) FIGS. 6a and 6b are graphs showing inhibitory effects of exosomes (BxC-e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) and exosomes (BxC-V37e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) pretreated with LANIFIBRANOR on inflammation in steatosis-induced hepatocytes.

(11) FIG. 7 is a graph showing inhibitory effects of exosomes (BxC-e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) and exosomes (BxC-V37e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) pretreated with LANIFIBRANOR on ER stress in steatosis-induced hepatocytes.

(12) FIGS. 8a, 8b and 8c are graphs showing inhibitory effects of exendin-4 and exosomes (BxC-G63e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) pretreated with exendin-4 on lipogenesis in steatosis-induced hepatocytes.

(13) FIGS. 9a and 9b are graphs showing inhibitory effects of exendin-4 and exosomes (BxC-G63e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) pretreated with exendin-4 on inflammation in steatosis-induced hepatocytes.

(14) FIG. 10 is a graph showing inhibitory effects of exendin-4 and exosomes (BxC-G63e) isolated from induced pluripotent stem cell-derived mesenchymal stem cells (BxC) pretreated with exendin-4 on ER stress in steatosis-induced hepatocytes.

(15) FIG. 11a shows microphotographic images of the non-treated normal group (Normal), the PBS-treated control (MCD-PBS), and the BxC-V37e-treated group (MCD-V37e) of hepatocytes from steatosis-induced mice after hematoxylin & eosin (H&E) staining.

(16) FIG. 11b shows microphotographic images of the non-treated normal group (Normal), the PBS-treated control (MCD-PBS), and the BxC-V37e-treated group (MCD-V37e) of hepatocytes from steatosis-induced mice after oil red O staining.

(17) FIG. 12a shows microphotographic images of the non-treated normal group (Normal), the PBS-treated control (MCD-PBS), and the BxC-G63e-treated group (MCD-G63e) of hepatocytes from steatosis-induced mice after hematoxylin & eosin (H&E) staining.

(18) FIG. 12b shows microphotographic images of the non-treated normal group, the PBS-treated control (MCD-PBS), and the BxC-G63e-treated group (MCD-G63e) of hepatocytes from steatosis-induced mice after oil red O staining.

(19) FIG. 13a is a graph showing NAS scores of the non-treated normal group (Normal), the PBS-treated control (MCD-PBS), and the BxC-V37e-treated group (MCD-V37e) of hepatocytes from steatosis-induced mice.

(20) FIG. 13b is a graph showing NAS scores of the non-treated normal group, the PBS-treated control (MCD-PBS), and the BxC-G63e-treated group (MCD-G37e) of hepatocytes from steatosis-induced mice.

(21) FIG. 14a shows microphotographic images of the non-treated normal group (Normal), the PBS-treated control (MCD-PBS), and the BxC-V37e-treated group (MCD-V37e) of hepatocytes from steatosis-induced mice after immunohistochemical staining.

(22) FIG. 14b shows microphotographic images of the non-treated normal group (Normal), the PBS-treated control (MCD-PBS), and the BxC-G63e-treated group (MCD-G63e) of hepatocytes from steatosis-induced mice after immunohistochemical staining.

(23) FIG. 15a shows photographic images of the non-treated normal group (Normal), the PBS-treated control (TAA-PBS), and the BxC-V37e-treated group (TAA-V37e) of liver tissues from fibrosis-induced mice.

(24) FIG. 15b shows photographic images of the non-treated normal group (Normal), the PBS-treated control (TAA-PBS), and the BxC-G63e-treated group (TAA-G63e) of liver tissues from fibrosis-induced mice.

(25) FIG. 16a shows microphotographic images of the non-treated normal group (Normal), the PBS-treated control (TAA-PBS), and the BxC-V37e-treated group (TAA-V37e) of hepatocytes from fibrosis-induced mice after hematoxylin & eosin (H&E) staining.

(26) FIG. 16b shows microphotographic images of the non-treated normal group (Normal), the PBS-treated control (TAA-PBS), and the BxC-G63e-treated group (TAA-G63e) of hepatocytes from fibrosis-induced mice after hematoxylin & eosin (H&E) staining.

(27) FIG. 17a shows microphotographic images of the non-treated normal group (Normal), the PBS-treated control (TAA-PBS), and the BxC-V37e-treated group (TAA-V37e) of hepatocytes from fibrosis-induced mice after picrosirius red staining.

(28) FIG. 17b shows microphotographic images of the non-treated normal group (Normal), the PBS-treated control (TAA-PBS), and the BxC-G63e-treated group (TAA-G63e) of hepatocytes from fibrosis-induced mice after picrosirius red staining.

BEST MODE FOR CARRYING OUT THE INVENTION

(29) The present disclosure is concerned with a pharmaceutical composition comprising exosomes isolated from induced pluripotent stem cell (iPSC)-derived mesenchymal stem cells (MSC) as an active ingredient for prevention, alleviation, inhibition, or treatment of non-alcoholic steatohepatitis.

Detailed Description

(30) Hereinafter, the present disclosure will be described in detail with reference to examples. These examples are only for illustrating the present disclosure more specifically, and it will be apparent to those skilled in the art that the scope of the present disclosure is not limited by these examples.

(31) Throughout the description, the term % used to express the concentration of a specific material, unless otherwise particularly stated, refers to (wt/wt) % for solid/solid, (wt/vol) % for solid/liquid, and (vol/vol) % for liquid/liquid.

Preparation Example: Isolation and Culturing of Induced Pluripotent Stem Cell (iPSC)-Derived Mesenchymal Stem Cell (BxC)

(32) First, induced pluripotent stem cells (iPSC) were cultured for 7 days in DMEM supplemented with 10% FBS and 10 ng/ml bFGF. From the cultured induced pluripotent stem cells, SSEA-4 () cells that did not express SSEA-4 (stage-specific embryonic antigen 4) protein were separated as progenitor cells of induced pluripotent stem cell-derived mesenchymal stem cells by FACS. The separated SSEA-4 () cells were additionally cultured for 7 days in the same medium by passage to obtain induced pluripotent stem cell-derived mesenchymal stem cells according to the present disclosure. The induced pluripotent stem cell-derived mesenchymal stem cells were named BxC (Brexogen stem cells).

(33) The induced pluripotent stem cell-derived mesenchymal stem cells, named BxC, were further cultured in a culture medium [high glucose DMEM (Gibco, Cat no. 11995-065), 10% Fetal bovine Serum (HyClone), 1% MEM Non-Essential Amino Acids Solution (100) (Gibco, Cat no. 11140-050)].

Example 1: Isolation of Exosomes (BxC-e) from Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells (BxC)

(34) The induced pluripotent stem cell-derived mesenchymal stem cells (hereinafter referred to as BxC) culture obtained in Preparation Example was collected and centrifuged at 300g for 10 minutes to remove the cells and cell debris. The supernatant was filtered through a 0.22-m filter and then centrifuged at 10000g and 4 C. for 70 minutes in a high-speed centrifuge. The supernatant thus obtained was centrifuged at 100,000g and 4 C. for 90 minutes in an ultracentrifuge to obtain exosomes as a pellet. The exosomes were diluted in phosphate buffered saline (PBS) before subsequent experiments.

Experimental Example 1: Characterization of Exosomes (BxC-e) Isolated from Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells

(35) The exosomes isolated in Example 1 (hereinafter referred to as BxC-e) were analyzed for size distribution by nanoparticle tracking assay (NanoSight NS300, Malvern) and for morphology by electron microscopy.

(36) As can be seen in FIGS. 1a and 1b, the exosomes isolated from BxC according to the present disclosure retained the traits of exosome themselves.

Experimental Example 2: Inhibitory Effect of Exosomes (BxC-e) Isolated from Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells on Adipose Differentiation

(37) The exosomes isolated in Example 1 was examined for an inhibitory effect on adipose differentiation.

(38) Human adipocytes (primary human adipocyte, ATCC, USA) were seeded into 6-well plates and cultured at 37 C. in DMEM supplemented with 1% penicillin-streptomycin and 10% CS (Gibco, USA) in a 5% CO.sub.2 incubator until growth to confluence (6 days at maximum).

(39) After 6 days of incubation, the adipocytes were cultured for an additional 5 days in a base medium in which DMEM medium supplemented with 1% penicillin-streptomycin and 10% FBS (Gibco, USA) was mixed with a lipid differentiation medium [34 M pantothenate (Sigma), 66 M biotin (Sigma), 0.5 mM insulin (Sigma), 1 mM dexamethasone (Sigma), and 0.05 M IBMX (Sigma)]. Then, incubation was continued for an additional 9 days in a mixture of DMEM (Gibco, USA) and a lipid differentiation medium [34 M pantothenate (Sigma), 66 M biotin (Sigma), 0.5 mM insulin (Sigma), and 1 mM dexamethasone (Sigma)].

(40) Adipocytes were cultured for 14 days in DMEM supplemented with 10% FBS for use as a negative control, for 14 days in a lipid differentiation condition without BxC-e treatment for use as a vehicle control, and for 14 days in a lipid differentiation condition containing BxC-e for use as a BxC-e-treated group.

(41) After complete removal of the culture medium, the cells were washed twice with PBS and fixed for 1 hour by adding a 10% formalin solution at a concentration of 400 l/well. After washing with PBS, Oil-red O working solution was added at a concentration of 400 l/well to stain lipids within adipocytes differentiated for 2 hours. Then, the Oil-red O working solution was aspirated and the residual Oil-red O working solution on walls of the wells was completely removed using secondary distilled water. The plates were dried for 5 minutes in a drier, followed by adding 500 l of isopropyl alcohol to each well.

(42) Absorbance was read at 490 nm on a microplate reader (Model 680 microplate reader, Bio-Rad, USA) to quantitatively compare lipids.

(43) As shown in FIGS. 2a and 2b, the BxC-derived exosomes (BxC-e) of the present disclosure exhibited an excellent inhibitory effect on lipogenesis.

Example 2: Isolation of Exosomes from Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells According to Treatment with Pretreatment Material

(44) 2-1. Exosomes (BxC-V37e) Isolated from Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells According to Treatment with Lanifibranor

(45) The induced pluripotent stem cell (iPSC)-derived mesenchymal stem cells (BxC) prepared in Preparation Example were cultured for 24 hours in a culture medium [high glucose DMEM (Gibco, Cat no. 11995-065); 10% fetal bovine Serum (HyClone), 1% MEM Non-Essential Amino Acids Solution (100) (Gibco, Cat no. 11140-050)] supplemented with 10 M LANIFIBRANOR.

(46) After completion of culturing, the LANIFIBRANOR-pretreated BxC was washed and incubated for an additional 72 hours in a culture medium supplemented with exosome-depleted, 10% fetal bovine serum (FBS). The use of exosome-depleted FBS is to prevent the incorporation of FBS-derived exosomes other than the exosomes secreted from the mesenchymal stem cells of the present disclosure because general fetal bovine serum per se contains a large amount of exosomes.

(47) After 72 hours of incubation, the culture of BxC treated with the pretreatment material was collected and centrifuged at 300g for 10 minutes to remove the cells and cell debris. The supernatant thus formed was filtered through a 0.22-m filter, followed by centrifugation at 10,000g and 4 C. for 70 minutes in a high-speed centrifuge. The resulting supernatant was subjected to ultracentrifugation at 100,000g and 4 C. for 90 minutes. Exosomes were obtained as a pellet which was then diluted in PBS (phosphate buffered saline) for use in subsequence experiments.

(48) 2-2. Exosomes (BxC-G63e) Isolated from Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells Treated with Exendin-4

(49) Exosomes were isolated from in the same manner as in Example 2-1, with the exception that the cells were treated with Exendin-4 (20 nM) instead of Lanifibranor.

Experimental Example 3: Characterization of Exosomes Isolated from Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells Treated with Pretreatment Material

(50) Exosomes (BxC-V37e and BxC-G63e) isolated in Example 2 were each examined for size distribution by using nanoparticle tracking assay (NanoSight NS300, Malvern) and for morphology by using an electron microscope.

(51) As shown in FIGS. 3a to 4b, the exosomes isolated from BxC treated with IVA337 (FIGS. 3a and 3b) and with exendin-4 (FIGS. 4a and 4b) were both observed to retain the traits of exosomes themselves.

Experimental Example 4: Assay for Therapeutic Activity of Exosomes (BxC-V37e) Isolated from LANIFIBRANOR-Treated, Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells for Non-Alcoholic Steatohepatitis

(52) The following experiments were conducted with exosomes isolated in Example 1 (BxC-e) and Example 2-1 (BxC-V37e).

(53) 4-1. Steatosis Induction

(54) Materials and Reagents

(55) A purchase was made of DMEM (Dulbecco's modified Eagle's medium) from Hyclone (Pittsburgh, PA, USA) and of FBS (fetal bovine serum) from Gibco (Grand Island, NY, USA). Fatty acid-free bovine serum albumin (BSA), palmitate, and oleate were purchased from Sigma (St. Louis, MO, USA).

(56) Human Hepatocyte (HepG2) Culturing

(57) Human hepatocytes (HepG2, ATTC) were cultured at 37 C. in DMEM supplemented with 10% FBS (Gibco) and 1% penicillin-streptomycin under a 5% CO.sub.2 condition. The cultured cells were seeded at a predetermined concentration (510.sup.5 cells/1000 l/well) into 6-well plates and incubated until the cells became completely adherent to the wells with the intact morphology thereof and reached 95% confluency before use.

(58) Free Fatty Acid (FFA) Preparation

(59) (1) Preparation of 1 M Palmitate and 1 M Oleate Storage Solution

(60) The solution was prepared at 60 C. using 70% ethanol and deionized distilled water (ddH.sub.2O) as solvents, followed by filtration through a 0.2-m filter and sterilization.

(61) (2) Preparation of 1% (w/v) BSA Solution Containing No Free Fatty Acid

(62) The solution was prepared using deionized distilled water as a solvent, followed by sterilization and refrigeration at 4 C.

(63) (3) Preparation of Mixed Fatty Acid Having 100 mM of Palmitate and Oleate

(64) The fatty acid prepared in (1) was diluted to a concentration of 100 mM using the 1% (w/v) BSA solution containing no free fatty acids, prepared in (2), as a solvent. [10 l of 1 M palmitate prepared in (1)+290 l of 1% (w/v) BSA (33 mM)] and [10 l of 1 M oleate prepared in (1)+140 l of 1% (w/v) BSA (66 mM)] were mixed at a volume ratio of 1:1 in a heat block maintained at 70 C.

(65) (4) Preparation of 1 mM Mixed, Free Fatty Acid (FFA)

(66) With 10 l of the 100 mM mixed fatty acid prepared in (3) (oleate and palmitate in 1% (w/v) BSA were mixed at a concentration ratio of 2:1), 990 l of serum-free DMEM supplemented with 1% penicillin-streptomycin was mixed so that the FFA had a final concentration of 1 mM.

(67) (5) Preparation of BSA Control Solution

(68) The BSA prepared in (2) was used as a control solution.

(69) Steatosis Induction

(70) After the medium thereof was discarded, the HepG2 that had reached 95% confluence was washed once with PBS. Then, the 1 mM mixed free fatty acid prepared in (4) was added in an amount of 1 ml/well to the 6-well plates. For a vehicle control, a serum-free medium treated with the same amount of a vehicle was added. All treatments were conducted overnight (16 hours).

(71) 4-2. Assay for Therapeutic Activity for Non-Alcoholic Steatohepatitis

(72) The HepG2 cells treated for 16 hours were washed once with PBS and then incubated with 100 g of each of BxC-e and BxC-V37e, isolated in Examples 1 and 2, respectively, in a 1 ml serum-free medium for 24 hours before the following experiments.

(73) {circle around (1)} Inhibitory Effect on Lipogenesis

(74) To each well of the 6-well plates, Trizol solution was added in an amount of 1 ml to lyse the human hepatocytes. The cell lysate was mixed with 200 l of chloroform and vortexed, followed by centrifugation at 4 C. and 12,000 rpm for 15 minutes. The supernatant thus formed was transferred to a new tube and mixed with 500 l of isopropanol. The tube was turned upside down 50 times, left on ice for 5 min, and then centrifuged at 12,000 rpm and 4 C. for 10 minutes. The supernatant was discarded and the pellet was added with 1 ml of 70% ethanol and briefly spun down at 12,000 rpm and 4 C. for 5 minutes. After removal of ethanol, the RNA pellet in the tube was dried at room temperature to invisibility. Then, the RNA pellet was dissolved in nuclease-free water. Concentrations of the RNA samples were measured using Nanodrop at 260 nm/280 nm. From the RNA sample, cDNA was synthesized using an RT premix.

(75) On the synthesized cDNA, real time-polymerase chain reaction (PCR) was performed with synthesized primers (COSMOgenetech) (see Table 1 below) to monitor mRNA expression of FABP4.

(76) TABLE-US-00001 TABLE1 Gene Primer Sequence(5-3) FABP4 F GCATGGCCAAACCTAACATG (SEQIDNO:1) R CCTGGCCCAGTATGAAGGAA (SEQIDNO:2)

(77) As shown in FIG. 5, a lower expression level of FABP4 gene, which is involved in lipogenesis, was detected in the group where the human hepatocytes had undergone steatosis induction and then treatment with BxC-V37e than in the non-treated groups. These data imply that BxC-V37e has highly inhibitory activity against lipogenesis.

(78) {circle around (2)} Inhibitory Effect on Inflammation

(79) mRNA expression changes of TNF- and MCP1 were examined in a similar manner to that of Example 4-{circle around (1)}. The primers used are listed in Table 2, below.

(80) TABLE-US-00002 TABLE2 Gene Primer Sequence(5-3) TNF- F GAGCTGAACAATAGGCTGTTCCCA (SEQIDNO:3) R AGAGGCTCAGCAATGAGTGACAGT (SEQIDNO:4) MCP1 F TCTGTGCCTGCTGCTCATAG (SEQIDNO:5) R GGGCATTGATTGCATCTGGC (SEQIDNO:6)

(81) As can be seen in FIGS. 6a and 6b, the group where the human hepatocytes had undergone steatosis induction and treatment with BxC-V37e was observed to significantly decrease in expression levels of TNF- and MCP-1, which are expressed upon inflammation induction, compared to the non-treated groups, demonstrating the excellent anti-inflammatory activity of BxC-V37e in a lipogenesis-induced inflammatory condition.

(82) {circle around (3)} Inhibitory Effect on ER Stress

(83) A mRNA expression change of CHOP was examined in a similar manner to that of Example 4-{circle around (1)}. The primers used are listed in Table 3, below.

(84) TABLE-US-00003 TABLE3 Gene Primer Sequence(5-3) CHOP F AGGGAGAACCAGGAAACGGAAACA (SEQIDNO:7) R TCCTGCTTGAGCCGTTCATTCTCT (SEQIDNO:8)

(85) As understood from the data of FIG. 7, the expression level of CHOP gene, which is responsible for ER stress, was significantly decreased in the group where the human hepatocytes had undergone steatosis induction and treatment with BxC-V37e, compared to the non-treated groups, implying that BxC-V37e has excellent inhibitory activity against lipogenesis-induced ER stress.

Experimental Example 5: Assay for Therapeutic Activity of Exosomes (BxC-G63e) Isolated from Exendin-4-Treated, Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells for Non-Alcoholic Steatohepatitis

(86) The following experiments were conducted with exendin-4 and exosomes isolated in Example 2-2 (BxC-G63e).

(87) 5-1. Steatosis Induction

(88) Materials and Reagents

(89) A purchase was made of DMEM (Dulbecco's modified Eagle's medium) from Hyclone (Pittsburgh, PA, USA) and of FBS (fetal bovine serum) from Gibco (Grand Island, NY, USA). Fatty acid-free bovine serum albumin (BSA), palmitate, and oleate were purchased from Sigma (St. Louis, MO, USA).

(90) Human Hepatocyte (HepG2) Culturing

(91) Human hepatocytes (HepG2, ATTC) were cultured at 37 C. in DMEM supplemented with 10% FBS (Gibco) and 1% penicillin-streptomycin under a 5% CO.sub.2 condition. The cultured cells were seeded at a predetermined concentration (510.sup.5 cells/1000 l/well) into 6-well plates and incubated until the cells became completely adherent to the wells with the intact morphology thereof and reached 95% confluency before use.

(92) Free Fatty Acid (FFA) Preparation

(93) (1) Preparation of 1 M Palmitate and 1 M Oleate Storage Solution

(94) The solution was prepared at 60 C. using 70% ethanol and deionized distilled water (ddH.sub.2O) as solvents, followed by filtration through a 0.2-m filter and sterilization.

(95) (2) Preparation of 1% (w/v) BSA Solution Containing No Free Fatty Acid

(96) The solution was prepared using deionized distilled water as a solvent, followed by sterilization and refrigeration at 4 C.

(97) (3) Preparation of Mixed Fatty Acid Having 100 mM of Palmitate and Oleate

(98) The fatty acid prepared in (1) was diluted to a concentration of 100 mM using the 1% (w/v) BSA solution containing no free fatty acids, prepared in (2), as a solvent. [10 l of 1 M palmitate prepared in (1)+290 l of 1% (w/v) BSA (33 mM)] and [10 l of 1 M oleate prepared in (1)+140 l of 1% (w/v) BSA (66 mM)] were mixed at a volume ratio of 1:1 in a heat block maintained at 70 C.

(99) (4) Preparation of 1 mM Mixed, Free Fatty Acid (FFA)

(100) With 10 l of the 100 mM mixed fatty acid prepared in (3) (oleate and palmitate in 1% (w/v) BSA were mixed at a concentration ratio of 2:1), 990 l of serum-free DMEM supplemented with 1% penicillin-streptomycin was mixed so that the FFA had a final concentration of 1 mM.

(101) (5) Preparation of BSA Control Solution

(102) The 1% (w/v) BSA prepared in (2) was used as a control solution.

(103) Steatosis Induction

(104) After the medium thereof was discarded, the HepG2 that had reached 95% confluence was washed once with PBS. Then, the 1 mM mixed free fatty acid prepared in (4) was added in an amount of 1 ml/well to the 6-well plates. For a vehicle control, a serum-free medium treated with the same amount of a vehicle was added. All treatments were conducted overnight (16 hours).

(105) 5-2. Assay for Therapeutic Activity for Non-Alcoholic Steatohepatitis

(106) The HepG2 cells treated for 16 hours were washed once with PBS and then incubated with 100 g of each of 20 nM exendin-4 and BxC-G63e isolated in Example 2 in a 1 ml serum-free medium for 24 hours before the following experiments.

(107) {circle around (1)} Inhibitory Effect on Lipogenesis

(108) To each well of the 6-well plates, Trizol solution was added in an amount of 1 ml to lyse the human hepatocytes. The cell lysate was mixed with 200 l of chloroform and vortexed, followed by centrifugation at 4 C. and 12,000 rpm for 15 minutes. The supernatant thus formed was transferred to a new tube and mixed with 500 l of isoprophanol. The tube was turned upside down 50 times, left on ice for 5 min, and then centrifuged at 12,000 rpm and 4 C. for 10 minutes. The supernatant was discarded and the pellet was added with 1 ml of 70% ethanol and briefly spun down at 12,000 rpm and 4 C. for 5 minutes. After removal of ethanol, the RNA pellet in the tube was dried at room temperature to invisibility. Then, the RNA pellet was dissolved in nuclease-free water. Concentrations of the RNA samples were measured using Nanodrop at 260 nm/280 nm. From the RNA sample, cDNA was synthesized using an RT premix.

(109) On the synthesized cDNA, real time-polymerase chain reaction (PCR) was performed with synthesized primers (COSMOgenetech) (see Table 4 below) to monitor mRNA expression of FABP4, ACC1, and SREBP1.

(110) TABLE-US-00004 TABLE4 Gene Primer Sequence(5-3) FABP4 F GCATGGCCAAACCTAACATG (SEQIDNO:1) R CCTGGCCCAGTATGAAGGAA (SEQIDNO:2) ACC1 F GCTCCTTGTCACCTGCTTCT (SEQIDNO:9) R CAAGGCCAAGCCATCCTGTA (SEQIDNO:10) SREBP1 F GGAGGGGTAGGGGCCAACGC (SEQIDNO:11) R CATGTCTTCGAAAGTGCAAT (SEQIDNO:12)

(111) As shown in FIGS. 8a to 8c, lower expression levels of FABP4, ACC1, and SREBP1 gene, which are involved in lipogenesis, were detected in the groups where the human hepatocytes had undergone steatosis induction and then treatment with BxC-G63e than in the non-treated groups. These data imply that BxC-G63e has highly inhibitory activity against lipogenesis.

(112) {circle around (2)} Inhibitory Effect on Inflammation

(113) mRNA expression changes of TNF- and IL-10 were examined in a similar manner to that of Example 5-{circle around (1)}. The primers used are listed in Table 5, below.

(114) TABLE-US-00005 TABLE5 Gene Primer Sequence(5-3) TNF- F GAGCTGAACAATAGGCTGTTCCCA (SEQIDNO:3) R AGAGGCTCAGCAATGAGTGACAGT (SEQIDNO:4) IL-10 F TGAAAACAAGAGCAAGGCCG (SEQIDNO:13) R GCCACCCTGATGTCTCAGTT (SEQIDNO:14)

(115) As can be seen in FIGS. 9a and 9b, the groups where the human hepatocytes had undergone steatosis induction and treatment with BxC-G63e were observed to significantly decrease in expression level of TNF-, which is a pro-inflammatory factor, and significantly increased in expression level of IL-10, which is an anti-inflammatory factor, compared to the non-treated groups, demonstrating the excellent anti-inflammatory activity of BxC-G63e in a lipogenesis-induced inflammatory condition.

(116) {circle around (3)} Inhibitory Effect on ER Stress

(117) A mRNA expression change of CHOP was examined in a similar manner to that of Example 5-{circle around (1)}. The primers used are listed in Table 3, above

(118) As understood from the data of FIG. 10, the expression level of CHOP gene, which is responsible for ER stress, was significantly decreased in the group the human hepatocytes had undergone steatosis induction and treatment with BxC-G63e, compared to the non-treated groups, implying that BxC-G63e has excellent inhibitory activity against lipogenesis-induced ER stress.

Experimental Example 6: Assay for Therapeutic Activity of BxC-V37e and BxC-G63e for Non-Alcoholic Steatohepatitis in MCD-Diet Mouse Model

(119) The following experiments were conducted with the exosomes isolated in Examples 2-1 (BxC-V37e) and 2-2 (BxC-G63e).

(120) 6-1. Induction of Steatosis in MCD-Diet Mouse

(121) MCD Diet Mouse Raising Condition

(122) C57BL/6NHsd male mice were raised in the environment which was set for temperature 233 C., relative humidity 5515%, ventilation 10-20 times/hr, lightening 12 hours (light on a.m. 8-light off p.m. 8), and illumination intensity 150-300 Lux. The environment was monitored regularly.

(123) MCD Diet Feeding

(124) The C57BL/6NHsd male mice at 6 weeks of age were allowed to freely approach MCD diet and normal diet for 12 weeks in such a pattern as to feed MCD diet for first 5 days and the normal diet for subsequent 2 days.

(125) Preparation and Administration of Test Substance

(126) BxC-G63e and BxC-V37e were diluted in PBS to prepare respective test substances. The test substance was intravenously injected at a dose of 100 g/head to 400 g/head on the basis of the protein therein once a day and three times a week for 4 weeks. The test substance was slowly injected at a speed of 1 mL/min via the tail vein using a syringe with 26-gauge needle after the six-week-old C57BL/6NHsd male mice were restrained in a holder.

(127) 6-2. Assay for Therapeutic Activity for Non-Alcoholic Steatohepatitis

(128) The liver was excised from the C57BL/6NHsd male mice injected with the test substance, photographed, and weighed. The right lobe was fixed in 10% neutral buffered formalin while the left lobe was quenched with liquid nitrogen before use in the following experiments.

(129) {circle around (1)} Inhibitory Effect on Lipogenesis

(130) Histopathological Examination

(131) After general tissue processes including trimming, dehydration, paraffin embedding, and sectioning, the fixed liver tissue was prepared into specimens for histopathological examination. The specimens were stained with hematoxylin & eosin (H&E) and oil red O and examined for histopathological change under an optical microscope (Olympus BX53, Japan).

(132) NAS Scoring

(133) Microvesicular steatosis, macrovesicular steatosis, and hepatocellular hypertrophy were scored and graded into 0-3 points, based on the percentage of the total area affected on fields of view at 40 to 100 magnifications under a microscope. Inflammation was scored for five foci on the field of view at 100 magnification into 0-3 points, followed by comparison among groups.

(134) As can be seen in FIGS. 11a to 11b and FIGS. 12a and 12b, the groups which had been treated with BxC-G63e or BxC-V37e after induction of steatosis with MCD diet were observed to remarkably decrease in the size and number of lipid droplets, compared to the untreated control.

(135) In addition, as shown in FIG. 13a or 13b, NAS scores for microvesicular steatosis, macrovesicular steatosis, and hepatocellular hypertrophy were all decreased in the treated groups. The data imply the BxC-G63e or BxC-V37e has excellent inhibitory activity against lipogenesis.

(136) {circle around (2)} Inhibitory Effect on Inflammation

(137) After general tissue processes including trimming, dehydration, paraffin embedding, and sectioning, the fixed liver tissue was prepared into specimens for immunohistochemical staining. The specimens were reacted with an anti-TNF- antibody as a primary antibody and then with a secondary antibody specific therefor before examination on expression levels of TNF- protein.

(138) As shown in FIGS. 14a and 14b, the groups which had been treated with BxC-G63e or BxC-V37e after induction of steatosis with MCD diet were observed to remarkably decrease in the expression level of TNF- protein, compared to the PBS-treated control. In addition, as shown in FIG. 13a, low inflammation scores were imparted to the groups treated with BxC-V37e. Therefore, the data show that BxC-G63e or BxC-V37e has excellent inhibitory activity against inflammation.

Experimental Example 7: Assay for Non-Alcoholic Steatohepatitis of BxC-V37e and BxC-G63e in TAA Mouse Model

(139) The following experiments were conducted with the exosomes isolated in Examples 2-1 (BxC-V37e) and 2-2 (BxC-G63e).

(140) 7-1. Fibrosis Induction in TAA Mouse

(141) TAA Diet Mouse Raising Condition

(142) C57BL/6 male mice were raised in the environment which was set for temperature 233 C., relative humidity 5515%, ventilation 10-20 times/hr, lightening 12 hours (light on a.m. 8-light off p.m. 8), and illumination intensity 150-300 Lux. The environment was monitored regularly.

(143) TAA Drug Administration

(144) To the C57BL/6 male mice 6 weeks old, TAA was administered at a dose of 200 mg/kg once a day and three times a week for 12 weeks.

(145) Preparation and Administration of Test Substance

(146) BxC-G63e and BxC-V37e were diluted in PBS to prepare respective test substances. The test substance was subcutaneously injected at a dose of 400 g/head once a day and three times a week for 4 weeks. At the same time, TAA was injected at a dose of 200 mg/kg once a day and twice a week for 4 weeks. For injection of the substance, the injection site was sterilized with 70% alcohol. The skin of the right thigh in the mouse was pulled with the thumb and index finger to create a space between the skin and the muscle. An insulin syringe was poked into the subcutaneous space created with the thumb and index finger from the front of the animal and administered as it was.

(147) 7-2. Assay for Therapeutic Activity for Non-Alcoholic Steatohepatitis

(148) The liver was excised from the C57BL/6 male mice injected with the test substance, photographed, and weighed. The right lobe was fixed in 10% neutral buffered formalin while the left lobe was quenched with liquid nitrogen before use in the following experiments.

(149) {circle around (1)} Inhibitory Effect on Fibrosis

(150) Histopathological Examination

(151) After general tissue processes including trimming, dehydration, paraffin embedding, and sectioning, the fixed liver tissue was prepared into specimens for histopathological examination. The specimens were stained with hematoxylin & eosin (H&E) and picrosirius red and examined for histopathological change under an optical microscope (Olympus BX53, Japan).

(152) As shown in FIGS. 15a and 15b, the liver tissue of the TAA-PBS group was not smooth, compared to that of the non-treated, normal group. Treatment with BxC-G63e or BxC-V37e was observed to significantly recover the liver tissue.

(153) In addition, as can be seen in FIGS. 16a and 16b, H&E staining results showed the liver tissue damaged by TAA was remarkably recuperated by BxC-G63e or BxC-V37e.

(154) The picrosirius red staining data of FIGS. 17a and 17b show that the amounts of collagen accumulated by TAA in the liver tissues were greatly reduced by BxC-G63e or BxC-V37e.

(155) Collectively, the data demonstrate that BxC-G63e or BxC-V37e has excellent inhibitory activity against fibrosis.

Conclusion

(156) As described hitherto, BxC-e, BxC-V37e, and BxC-G63e according to the present disclosure is understood to inhibit lipogenesis, inflammation, and ER stress in steatosis-induced hepatocytes, thus finding highly advantageous applications in preventing or treating non-alcoholic steatohepatitis.

INDUSTRIAL APPLICABILITY

(157) The present disclosure relates to a composition for prevention or treatment of non-alcoholic steatohepatitis, the composition comprising, as an active ingredient, exosomes isolated from induced pluripotent stem cell-derived mesenchymal stem cells which have been or have not been treated with a pretreatment material.

(158) This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted herewith as the sequence listing text file. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. 1.52(e).