Suprastructure Comprising Modified Influenza Hemagglutinin With Reduced Interaction With Sialic Acid
20230149531 · 2023-05-18
Inventors
- Pierre-Olivier Lavoie (Quebec, CA)
- Hilary E. Hendin (Montreal, CA)
- Brian J. Ward (Montreal, CA)
- Nathalie Landry (St-Jean-Chrysostome, CA)
- Marc-Andre D'Aoust (Quebec, CA)
- Mikael Bedard (Quebec, CA)
- Pooja Saxena (Montreal, CA)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2760/16134
CHEMISTRY; METALLURGY
C12N2760/16152
CHEMISTRY; METALLURGY
C12N2760/16122
CHEMISTRY; METALLURGY
A61K9/0019
HUMAN NECESSITIES
C12N15/8258
CHEMISTRY; METALLURGY
C12N2760/16222
CHEMISTRY; METALLURGY
International classification
Abstract
A suprastructure comprising a modified influenza hemagglutinin (HA) is provided. The modified HA may comprise one or more than one alteration that reduces non-cognate binding of the modified HA to sialic acid (SA) on the surface of a cell, while maintaining cognate interaction with the cell, such as a B cell. A composition comprising the suprastructure and modified HA and a pharmaceutically acceptable carrier is also described. A method of increasing an immunological response or inducing immunity in response to a vaccine comprising the suprastructure and modified HA is also provided.
Claims
1. A suprastructure comprising modified influenza hemagglutinin (HA), the modified HA comprising one or more than one alteration that reduces non-cognate interaction of the modified HA to sialic acid (SA) of a protein on the surface of a cell, while maintaining cognate interaction with the cell.
2. The suprastructure of claim 1 wherein the non-cognate interaction is binding of the modified HA to sialic acid (SA) of the protein on the surface of the cell.
3. The suprastructure of claim 1 or 2 wherein, the alteration comprises a substitution, deletion or insertion of one or more amino acids within the modified HA.
4. The suprastructure of claim 1 wherein the cell is a B cell.
5. The suprastructure of claim 1, wherein the protein on the surface of the cell is a B cell surface receptor.
6. The suprastructure of claim 1 wherein the suprastructure is a virus like particle (VLP).
7. A composition comprising the VLP of claim 6 and a pharmaceutically acceptable carrier.
8. A vaccine comprising the composition of claim 7.
9. A vaccine comprising the composition as defined in claim 7 and an adjuvant.
10. A plant or portion of a plant comprising the VLP of claim 6.
11. A nucleic acid encoding the modified HA of claim 1.
12. A plant or portion of a plant comprising the nucleic acid of claim 11.
13. A method of inducing immunity to influenza virus infection in an animal or subject in need thereof, comprising administering the vaccine as defined in claim 8 to the animal or subject.
14. The method of claim 13, wherein the vaccine is administered to the animal or the subject orally, intradermally, intranasally, intramuscularly, intraperitoneally, intravenously, or subcutaneously.
15. A use of the vaccine of claim 9 for inducing immunity to influenza virus infection in an animal or subject in need thereof.
16. A method of increasing an immunological response in an first animal or a subject in response to an antigen challenge comprising, administering a first vaccine, the first vaccine comprising the vaccine of claim 8 to the animal or subject and determining the immunological response, wherein the immunological response is a cellular immunological response, a humoral immunological response, or both the cellular immunological response and the humoral immunological response, and wherein the immunological response is increased when compared with a second immunological response obtained following administration of a second vaccine comprising virus like particles comprising a corresponding parent HA to a second animal or subject.
17. A method of producing a virus like particle (VLP) comprising, expressing the nucleic acid of claim 11 within a host under conditions that result in the expression of the nucleic acid and production of the VLP.
18. The method of claim 17, wherein the host is harvested and the VLP is purified.
19. A method of producing a suprastructure comprising modified HA in a plant or portion of a plant comprising, introducing the nucleic acid of claim 11 within the plant or portion of the plant, and growing the plant or portion of the plant under conditions that result in the expression of the nucleic acid and production of the suprastructure.
20. The method of claim 19, wherein the suprastructure is a virus like particle (VLP).
21. The method of claim 20, wherein the plant or portion of the plant is harvested and the VLP is purified.
22. A method of producing a suprastructure comprising modified HA in a plant or portion of a plant comprising, growing a plant, or portion of a plant that comprises the nucleic acid as defined in claim 11, under conditions that result in the expression of the nucleic acid and production of the suprastructure.
23. The method of claim 22, wherein the suprastructure is a virus like particle (VLP).
24. The method of claim 23, wherein the plant or portion of the plant is harvested and the VLP is purified.
25. A composition comprising the suprastructure of claim 1 or 2 and a pharmaceutically acceptable carrier.
26. A composition comprising one or more than one VLP as defined in claim 6.
27. The composition of claim 26, wherein at least one of the one or more than one VLP is selected from a VLP comprising the modified HA: i) wherein the modified HA is H1 HA, and wherein the alteration that reduces binding of the modified HA to SA is Y91F; wherein the numbering of the alteration corresponds to the position of reference sequence with SEQ ID NO: 203; ii) wherein the modified HA is H3 HA, and wherein the alteration that reduces binding of the modified HA to SA is selected from Y98F, S136D; Y98F, S136N; Y98F, S137N; Y98F, D190G; Y98F, D190K; Y98F, R222W; Y98F, S228N; Y98F, S228Q; S136D; S136N; D190K; S228N; or S228Q; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 204. iii) wherein the modified HA is H5 HA, and wherein the alteration that reduces binding of the modified HA to SA is Y91F; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 205. iv) wherein the modified HA is H7 HA, and wherein the alteration that reduces binding of the modified HA to SA is Y88F; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 206; v) wherein the modified HA is B HA, and wherein the alteration that reduces binding of the modified HA to SA is selected from S140A; S142A; G138A; L203A; D195G; or L203W; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 207; or vi) a combination thereof.
28. A modified influenza H1 hemagglutinin (HA) comprising one or more than one alteration that reduces binding of the modified H1 HA to sialic acid (SA) of a protein on the surface of a cell, while maintaining cognate interaction with the cell.
29. The modified influenza H1 HA of claim 28, wherein the cell is a B cell.
30. The modified influenza H1 HA of claim 28, wherein the protein on the surface of the cell is a B cell surface receptor.
31. The modified H1 HA of claim 27, wherein the modified H1 HA comprises plant-specific N-glycans or modified N-glycans.
32. A virus like particle (VLP) comprising the modified H1 HA of claim 28.
33. The VLP of claim 32 further comprising one or more than one lipid derived from a plant.
34. A modified influenza H3 hemagglutinin (HA) comprising one or more than one alteration that reduces binding of the modified H3 HA to sialic acid (SA) of a protein on the surface of a cell, while maintaining cognate interaction, with the cell.
35. The modified influenza H3 HA of claim 34, wherein the cell is a B cell.
36. The modified influenza H3 HA of claim 34, wherein the protein on the surface of the cell is a B cell surface receptor.
37. The modified H3 HA of claim 33, wherein the modified H3 HA comprises plant-specific N-glycans or modified N-glycans.
38. A virus like particle (VLP) comprising the modified H3 HA of claim 33.
39. The VLP of claim 38, further comprising one or more than one lipid derived from a plant.
40. A modified influenza H7 hemagglutinin (HA) comprising one or more than one alteration that reduces binding of the modified H7 HA to sialic acid (SA) of a protein on the surface of a cell, while maintaining cognate interaction, with the cell.
41. The modified influenza H7 HA of claim 40, wherein the cell is a B cell.
42. The modified influenza H7 HA of claim 40, wherein the protein on the surface of the cell is a B cell surface receptor.
43. The modified H7 HA of claim 40, wherein the modified H7 HA comprises plant-specific N-glycans or modified N-glycans.
44. A virus like particle (VLP) comprising the modified H7 HA of claim 40.
45. The VLP of claim 41 further comprising one or more than one lipid derived from a plant.
46. A modified influenza H5 hemagglutinin (HA) comprising one or more than one alteration that reduces binding of the modified H7 HA to sialic acid (SA) of a protein on the surface of a cell, while maintaining cognate interaction, with the cell.
47. The modified influenza H5 HA of claim 46, wherein the cell is a B cell.
48. The modified influenza H5 HA of claim 47, wherein the protein on the surface of the cell is a B cell surface receptor.
49. The modified H5 HA of claim 46, wherein the modified H5 HA comprises plant-specific N-glycans or modified N-glycans.
50. A virus like particle (VLP) comprising the modified H5 HA of claim 46.
51. The VLP of claim 50 further comprising one or more than one lipid derived from a plant.
52. A modified influenza B hemagglutinin (HA) comprising one or more than one alteration that reduces binding of the modified B HA to sialic acid (SA) of a protein on the surface of a cell, while maintaining cognate interaction, with the cell.
53. The modified influenza B HA of claim 52, wherein the cell is a B cell.
54. The modified influenza B HA of claim 52, wherein the protein on the surface of the cell is a B cell surface receptor.
55. The modified B HA of claim 48, wherein the modified B HA comprises plant-specific N-glycans or modified N-glycans.
56. A virus like particle (VLP) comprising the modified B HA of claim 52.
57. The VLP of claim 56 further comprising one or more than one lipid derived from a plant.
58. A suprastructure comprising modified influenza hemagglutinin (HA), the modified HA comprising one or more than one alteration, the modified HA being selected from: i) a modified H1 HA, wherein the one or more than one alteration is Y91F; wherein the numbering of the alteration corresponds to the position of reference sequence with SEQ ID NO: 203; ii) a modified H3 HA, wherein the one or more than one alteration is selected from Y98F, S136D; Y98F, S136N; Y98F, S137N; Y98F, D190G; Y98F, D190K; Y98F, R222W; Y98F, S228N; Y98F, S228Q; S136D; S136N; D190K; S228N; and S228Q; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 204. iii) a modified H5 HA, wherein the one or more than one alteration is Y91F; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 205. iv) a modified H7 HA, wherein the one or more than one alteration is Y88F; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 206; v) a modified B HA, wherein the one or more than one alteration is selected from S140A; S142A; G138A; L203A; D195G; and L203W; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 207; or vi) a combination thereof.
59. The suprastructure of claim 58, wherein the modified HA reduces non-cognate interaction of the modified HA to sialic acid (SA) of a protein on the surface of a cell, while maintaining cognate interaction, with the cell.
60. The suprastructure of claim 58, wherein the modified HA increases an immunological response of an animal or a subject in response to an antigen challenge.
61. A vaccine comprising the suprastructure of claim 58 and a pharmaceutically acceptable carrier.
62. A method of increasing an immunological response of an animal or a subject in response to an antigen challenge comprising, administering the vaccine of claim 61 to the animal or subject and determining the immunological response, wherein the immunological response is a cellular immunological response, a humoral immunological response, or both a cellular immunological response and a humoral immunological response, and wherein the immunological response is increased when compared with an immunological response obtained following administration of a vaccine comprising a suprastructure comprising influenza HA that do not comprise the one or more than one alteration.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0056] These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
DETAILED DESCRIPTION
[0079] The following description is of a preferred embodiment.
[0080] As used herein, the terms “comprising”, “having”, “including”, “containing”, and grammatical variations thereof, are inclusive or open-ended and do not exclude additional, un-recited elements and/or method steps. The term “consisting essentially of” when used herein in connection with a product, use or method, denotes that additional elements and/or method steps may be present, but that these additions do not materially affect the manner in which the recited method or use functions. The term “consisting of” when used herein in connection with a product, use or method, excludes the presence of additional elements and/or method steps. A product, use or method described herein as comprising certain elements and/or steps may also, in certain embodiments, consist essentially of those elements and/or steps, and in other embodiments consist of those elements and/or steps, whether or not these embodiments are specifically referred to. In addition, the use of the singular includes the plural, and “or” means “and/or” unless otherwise stated. Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. As used herein, the term “about” refers to an approximately +/−10% variation from a given value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to. The use of the word “a” or “an” when used herein in conjunction with the term “comprising” may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one” and “one or more than one.”
[0081] As used herein the abbreviations “CMI” refers to cell-mediated immunity; “HA” refers to hemagglutinin; “HAI” refers to hemagglutination inhibition; “MN” refers to microneutralization; “PBMC” refers to peripheral blood mononuclear cells; “tRBC” refers to turkey red blood cell; “SA” refers to sialic acid; “SPR” refers to surface plasmon resonance; “UIV” refers to universal influenza vaccine; “VLP” refers to virus-like particle.
[0082] The term host as used herein may comprise any suitable eukaryotic host as would be known to one of skill in the art, for example but not limited to, a eukaryotic cell, a eukaryotic cell culture, a mammalian cell culture, an insect cell, an insect cell culture, a baculovirus cell, an avian cell, an egg cell, a plant cell, a plant, or a portion of a plant.
[0083] The term “portion of a plant”, “plant portion”, “plant matter”, “plant biomass”, “plant material” as used herein, refers to any part of the plant including but not limited to leaves, stem, root, flowers, fruits, a plant cell obtained from leaves, stem, root, flowers, fruits, a plant extract obtained from leaves, stem, root, flowers, fruits, or a combination thereof. The term “plant extract”, as used herein, refers to a plant-derived product that is obtained following treating a plant, a portion of a plant, a plant cell, or a combination thereof, physically (for example by freezing followed by extraction in a suitable buffer), mechanically (for example by grinding or homogenizing the plant or portion of the plant followed by extraction in a suitable buffer), enzymatically (for example using cell wall degrading enzymes), chemically (for example using one or more chelators or buffers), or a combination thereof. A plant extract may comprise plant tissue, cells, or any fraction thereof, intracellular plant components, extracellular plant components, liquid or solid extracts of plants, or a combination thereof.
[0084] A plant extract may be further processed to remove undesired plant components for example cell wall debris. A plant extract may be obtained to assist in the recovery of one or more components from the plant, portion of the plant or plant cell, for example suprastructures, nucleic acids, lipids, carbohydrates, or a combination thereof, from the plant, portion of the plant, or plant cell.
[0085] “Suprastructures” (protein suprastructures) include, but are not limited to, multimeric proteins such for example dimeric proteins, trimeric proteins, polymeric proteins, rosettes comprising proteins, metaproteins, protein complexes, protein-lipid complexes, VLPs, or a combination thereof.
[0086] Furthermore, the suprastructures may be a scaffold comprising protein or multimeric proteins. For example the suprastructures may be nanoparticles, nanostructures, protein nanostructures, polymer such as for example sugar polymer, micelles, vesicles, membranes or membrane fragments comprising protein or multimeric proteins. In an non-limiting example, the suprastructure may have a size range from about 10 nm to about 350 nm, or any amount therebetween.
[0087] If the plant extract comprises proteins, then it may be referred to as a protein extract. A protein extract (or a suprastructure extract) may be a crude plant extract, a partially purified plant or protein extract, or a purified product, that comprises one or more suprastructures, dimeric proteins, trimeric proteins, polymeric proteins, rosettes comprising proteins, metaproteins, protein complexes, protein-lipid complexes, VLPs, or a combination thereof, from the plant tissue. If desired a suprastructure extract, for example a protein extract, or a plant extract, may be partially purified using techniques known to one of skill in the art, for example, the extract may be subjected to salt or pH precipitation, centrifugation, gradient density centrifugation, filtration, chromatography, for example, size exclusion chromatography, ion exchange chromatography, affinity chromatography, or a combination thereof. A suprastructure or protein extract may also be purified, using techniques that are known to one of skill in the art.
[0088] The term “construct”, “vector” or “expression vector”, as used herein, refers to a recombinant nucleic acid for transferring exogenous nucleic acid sequences into host cells (e.g. plant cells) and directing expression of the exogenous nucleic acid sequences in the host cells. “Expression cassette” refers to a nucleotide sequence comprising a nucleic acid of interest under the control of, and operably (or operatively) linked to, an appropriate promoter or other regulatory elements for transcription of the nucleic acid of interest in a host cell. As one of skill in the art would appreciate, the expression cassette may comprise a termination (terminator) sequence that is any sequence that is active the plant host. For example, the termination sequence may be derived from the RNA-2 genome segment of a bipartite RNA virus, e.g. a comovirus, the termination sequence may be a NOS terminator, or terminator sequence may be obtained from the 3′UTR of the alfalfa plastocyanin gene.
[0089] The constructs of the present disclosure may further comprise a 3′ untranslated region (UTR). A 3′ untranslated region contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by effecting the addition of polyadenylic acid tracks to the 3′ end of the mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5′ AATAAA-3′ although variations are not uncommon. Non-limiting examples of suitable 3′ regions are the 3′ transcribed non-translated regions containing a polyadenylation signal of Agrobacterium tumor inducing (Ti) plasmid genes, such as the nopaline synthase (Nos gene) and plant genes such as the soybean storage protein genes, the small subunit of the ribulose-1, 5-bisphosphate carboxylase gene (ssRUBISCO; U.S. Pat. No. 4,962,028; which is incorporated herein by reference), the promoter used in regulating plastocyanin expression.
[0090] By “regulatory region” “regulatory element” or “promoter” it is meant a portion of nucleic acid typically, but not always, upstream of the protein coding region of a gene, which may be comprised of either DNA or RNA, or both DNA and RNA. When a regulatory region is active, and in operative association, or operatively linked, with a nucleotide sequence of interest, this may result in expression of the nucleotide sequence of interest. A regulatory element may be capable of mediating organ specificity or controlling developmental or temporal gene activation. A “regulatory region” includes promoter elements, core promoter elements exhibiting a basal promoter activity, elements that are inducible in response to an external stimulus, elements that mediate promoter activity such as negative regulatory elements or transcriptional enhancers. “Regulatory region”, as used herein, also includes elements that are active following transcription, for example, regulatory elements that modulate gene expression such as translational and transcriptional enhancers, translational and transcriptional repressors, upstream activating sequences, and mRNA instability determinants. Several of these latter elements may be located proximal to the coding region.
[0091] In the context of this disclosure, the term “regulatory element” or “regulatory region” typically refers to a sequence of DNA, usually, but not always, upstream (5′) to the coding sequence of a structural gene, which controls the expression of the coding region by providing the recognition for RNA polymerase and/or other factors required for transcription to start at a particular site. However, it is to be understood that other nucleotide sequences, located within introns, or 3′ of the sequence may also contribute to the regulation of expression of a coding region of interest. An example of a regulatory element that provides for the recognition for RNA polymerase or other transcriptional factors to ensure initiation at a particular site is a promoter element. Most, but not all, eukaryotic promoter elements contain a TATA box, a conserved nucleic acid sequence comprised of adenosine and thymidine nucleotide base pairs usually situated approximately 25 base pairs upstream of a transcriptional start site. A promoter element may comprise a basal promoter element, responsible for the initiation of transcription, as well as other regulatory elements that modify gene expression.
[0092] There are several types of regulatory regions, including those that are developmentally regulated, inducible or constitutive. A regulatory region that is developmentally regulated or controls the differential expression of a gene under its control, is activated within certain organs or tissues of an organ at specific times during the development of that organ or tissue. However, some regulatory regions that are developmentally regulated may preferentially be active within certain organs or tissues at specific developmental stages, they may also be active in a developmentally regulated manner, or at a basal level in other organs or tissues within the plant as well. Examples of tissue-specific regulatory regions, for example see-specific a regulatory region, include the napin promoter, and the cruciferin promoter (Rask et al., 1998, J. Plant Physiol. 152: 595-599; Bilodeau et al., 1994, Plant Cell 14: 125-130). An example of a leaf-specific promoter includes the plastocyanin promoter (see U.S. Pat. No. 7,125,978, which is incorporated herein by reference).
[0093] An inducible regulatory region is one that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed. Typically, the protein factor that binds specifically to an inducible regulatory region to activate transcription may be present in an inactive form, which is then directly or indirectly converted to the active form by the inducer. However, the protein factor may also be absent. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. A plant cell containing an inducible regulatory region may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods. Inducible regulatory elements may be derived from either plant or non-plant genes (e.g. Gatz, C. and Lenk, I. R. P., 1998, Trends Plant Sci. 3, 352-358). Examples, of potential inducible promoters include, but not limited to, tetracycline-inducible promoter (Gatz, C., 1997, Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 89-108), steroid inducible promoter (Aoyama, T. and Chua, N.H., 1997, Plant J. 2, 397-404) and ethanol-inducible promoter (Salter, M. G., et al, 1998, Plant Journal 16, 127-132; Caddick, M. X., et al, 1998, Nature Biotech. 16, 177-180) cytokinin inducible IB6 and CKI1 genes (Brandstatter, I. and Kieber, J. J., 1998, Plant Cell 10, 1009-1019; Kakimoto, T., 1996, Science 274, 982-985) and the auxin inducible element, DR5 (Ulmasov, T., et al., 1997, Plant Cell 9, 1963-1971).
[0094] A constitutive regulatory region directs the expression of a gene throughout the various parts of a plant and continuously throughout plant development. Examples of known constitutive regulatory elements include promoters associated with the CaMV 35S transcript. (p35S; Odell et al., 1985, Nature, 313: 810-812; which is incorporated herein by reference), the rice actin 1 (Zhang et al, 1991, Plant Cell, 3: 1155-1165), actin 2 (An et al., 1996, Plant J., 10: 107-121), or tms 2 (U.S. Pat. No. 5,428,147), and triosephosphate isomerase 1 (Xu et. al., 1994, Plant Physiol. 106: 459-467) genes, the maize ubiquitin 1 gene (Comejo et al, 1993, Plant Mol. Biol. 29: 637-646), the Arabidopsis ubiquitin 1 and 6 genes (Holtorf et al, 1995, Plant Mol. Biol. 29: 637-646), the tobacco translational initiation factor 4A gene (Mandel et al, 1995 Plant Mol. Biol. 29: 995-1004), the Cassava Vein Mosaic Virus promoter, pCAS, (Verdaguer et al., 1996); the promoter of the small subunit of ribulose biphosphate carboxylase, pRbcS: (Outchkourov et al., 2003), the pUbi (for monocots and dicots).
[0095] The term “constitutive” as used herein does not necessarily indicate that a nucleotide sequence under control of the constitutive regulatory region is expressed at the same level in all cell types, but that the sequence is expressed in a wide range of cell types even though variation in abundance is often observed.
[0096] A nucleic acid comprising encoding a modified HA protein as described herein may further comprise sequences that enhance expression of the modified HA protein in the desired host, for example a plant, portion of the plant, or plant cell.
[0097] The term “plant-derived expression enhancer”, as used herein, refers to a nucleotide sequence obtained from a plant, the nucleotide sequence encoding a 5′UTR. Examples of a plant derived expression enhancer are described in WO2019/173924 and PCT/CA2019/050319 (both of which are incorporated herein by reference) or in Diamos A. G. et. al. (2016, Front Plt Sci. 7:1-15; which is incorporated herein by reference). The plant-derived expression enhancer may also be selected from nbMT78, nbATL75, nbDJ46, nbCHP79, nbEN42, atHSP69, atGRP62, atPK65, atRP46, nb30S72, nbGT61, nbPV55, nbPPI43, nbPM64, nbH2A86 as described in PCT/CA2019/050319 (which is incorporated herein by reference), and nbEPI42, nbSNS46, nbCSY65, nbHEL40, nbSEP44 as described in PCT/CA/2019/050319 (which is incorporated herein by reference).
[0098] The plant derived expression enhancer may be used within a plant expression system comprising a regulatory region that is operatively linked with the plant-derived expression enhancer sequence and a nucleotide sequence of interest.
[0099] Sequences that enhance expression may also include a CPMV enhancer element. The term “CPMV enhancer element”, as used herein, refers to a nucleotide sequence encoding the 5′UTR regulating the Cowpea Mosaic Virus (CPMV) RNA2 polypeptide or a modified CPMV sequence as is known in the art. For example, a CPMV enhancer element or a CPMV expression enhancer, includes a nucleotide sequence as described in WO2015/14367; WO2015/103704; WO2007/135480; WO2009/087391; Sainsbury F., and Lomonossoff G. P., (2008, Plant Physiol. 148: pp. 1212-1218), each of which is incorporated herein by reference. A CPMV enhancer sequence can enhance expression of a downstream heterologous open reading frame (ORF) to which they are attached. The CPMV expression enhancer may include CPMV HT, CPMVX (where X=160, 155, 150, 114), for example CPMV 160, CPMVX+(where X=160, 155, 150, 114), for example CPMV 160+, CPMV-HT+, CPMV HT+[WT115], or CPMV HT+[511] (WO2015/143567; WO2015/103704 which are incorporated herein by reference). The CPMV expression enhancer may be used within a plant expression system comprising a regulatory region that is operatively linked with the CPMV expression enhancer sequence and a nucleotide sequence of interest.
[0100] The term “5′UTR” or “5′ untranslated region” or “5′ leader sequence” refers to regions of an mRNA that are not translated. The 5′UTR typically begins at the transcription start site and ends just before the translation initiation site or start codon of the coding region. The 5′ UTR may modulate the stability and/or translation of an mRNA transcript.
[0101] By “operatively linked” it is meant that the particular sequences interact either directly or indirectly to carry out an intended function, such as mediation or modulation of expression of a nucleic acid sequence. The interaction of operatively linked sequences may, for example, be mediated by proteins that interact with the operatively linked sequences.
[0102] Post-transcriptional gene silencing (PTGS) may be involved in limiting expression of transgenes in plants, and co-expression of a suppressor of silencing from the potato virus Y (HcPro) may be used to counteract the specific degradation of transgene mRNAs (Brigneti et al., 1998). Alternate suppressors of silencing are well known in the art and may be used as described herein (Chiba et al., 2006, Virology 346:7-14; which is incorporated herein by reference), for example but not limited to, TEV-p1/HC-Pro (Tobacco etch virus-p1/HC-Pro), BYV-p21, p19 of Tomato bushy stunt virus (TBSV p19), capsid protein of Tomato crinkle virus (TCV-CP), 2b of Cucumber mosaic virus; CMV-2b), p25 of Potato virus X (PVX-p25), p11 of Potato virus M (PVM-p11), p11 of Potato virus S (PVS-p11), p16 of Blueberry scorch virus, (BScV-p16), p23 of Citrus tristexa virus (CTV-p23), p24 of Grapevine leafroll-associated virus-2, (GLRaV-2 p24), p10 of Grapevine virus A, (GVA-p10), p14 of Grapevine virus B (GVB-p14), p10 of Heracleum latent virus (HLV-p10), or p16 of Garlic common latent virus (GCLV-p16). Therefore, a suppressor of silencing, for example, but not limited to, HcPro, TEV-p1/HC-Pro, BYV-p21, TBSV p19, TCV-CP, CMV-2b, PVX-p25, PVM-p11, PVS-p11, BScV-p16, CTV-p23, GLRaV-2 p24, GBV-p14, HLV-p10, GCLV-p16 or GVA-p10, may be co-expressed along with the nucleic acid sequence encoding the protein of interest to further ensure high levels of protein production within a plant.
[0103] The expression constructs as described above may be present in a vector. The vector may comprise border sequences which permit the transfer and integration of the expression cassette into the genome of the organism or host. For example, the construct may be a plant binary vector, for example a binary transformation vector based on pPZP (Hajdukiewicz, et al. 1994). Other example constructs include pBin19 (see Frisch, D. A., L. W. Harris-Haller, et al. 1995, Plant Molecular Biology 27: 405-409).
[0104] The constructs of the present invention can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, micro-injection, electroporation, etc. For reviews of such techniques see for example Weissbach and Weissbach, Methods for Plant Molecular Biology, Academy Press, New York VIII, pp. 421-463 (1988); Geierson and Corey, Plant Molecular Biology, 2d Ed. (1988); and Miki and Iyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism, 2d Ed. D T. Dennis, D H Turpin, D D Lefebrve, D B Layzell (eds), Addison Wesly, Langmans Ltd. London, pp. 561-579 (1997). Other methods include direct DNA uptake, the use of liposomes, electroporation, for example using protoplasts, micro-injection, microprojectiles or whiskers, and vacuum infiltration. See, for example, Bilang, et al. (Gene 100: 247-250 (1991), Scheid et al. (Mol. Gen. Genet. 228: 104-112, 1991), Guerche et al. (Plant Science 52: 111-116, 1987), Neuhause et al. (Theor. Appl Genet. 75: 30-36, 1987), Klein et al., Nature 327: 70-73 (1987); Howell et al. (Science 208: 1265, 1980), Horsch et al. (Science 227: 1229-1231, 1985), DeBlock et al., Plant Physiology 91: 694-701, 1989), Methods for Plant Molecular Biology (Weissbach and Weissbach, eds., Academic Press Inc., 1988), Methods in Plant Molecular Biology (Schuler and Zielinski, eds., Academic Press Inc., 1989), Liu and Lomonossoff (J. Virol Meth, 105:343-348, 2002,), U.S. Pat. Nos. 4,945,050; 5,036,006; and 5,100,792, U.S. patent application Ser. No. 08/438,666, filed May 10, 1995, and Ser. No. 07/951,715, filed Sep. 25, 1992, (all of which are hereby incorporated by reference).
[0105] Transient expression methods may be used to express the constructs of the present invention (see Liu and Lomonossoff, 2002, Journal of Virological Methods, 105:343-348; which is incorporated herein by reference). Alternatively, a vacuum-based transient expression method, as described by Kapila et al. 1997 (incorporated herein by reference) may be used. These methods may include, for example, but are not limited to, a method of Agro-inoculation or Agro-infiltration, however, other transient methods may also be used as noted above. With either Agro-inoculation or Agro-infiltration, a mixture of Agrobacteria comprising the desired nucleic acid enter the intercellular spaces of a tissue, for example the leaves, aerial portion of the plant (including stem, leaves and flower), other portion of the plant (stem, root, flower), or the whole plant. After crossing the epidermis the Agrobacterium infect and transfer t-DNA copies into the cells. The t-DNA is episomally transcribed and the mRNA translated, leading to the production of the protein of interest in infected cells, however, the passage of t-DNA inside the nucleus is transient.
[0106] The term “wild type”, “native”, “native protein” or “native domain”, as used herein, refers to a protein or domain having a primary amino acid sequence identical to wildtype. Native proteins or domains may be encoded by nucleotide sequences having 100% sequence similarity to the wildtype sequence. A native amino acid sequence may also be encoded by a human codon (hCod) optimized nucleotide sequence or a nucleotide sequence comprising an increased GC content when compared to the wild type nucleotide sequence provided that the amino acid sequence encoded by the hCod-nucleotide sequence exhibits 100% sequence identity with the native amino acid sequence.
[0107] By a nucleotide sequence that is “human codon optimized” or a “hCod” nucleotide sequence, it is meant the selection of appropriate DNA nucleotides for the synthesis of an oligonucleotide sequence or fragment thereof that approaches the codon usage generally found within an oligonucleotide sequence of a human nucleotide sequence. By “increased GC content” it is meant the selection of appropriate DNA nucleotides for the synthesis of an oligonucleotide sequence or fragment thereof in order to approach codon usage that, when compared to the corresponding native oligonucleotide sequence, comprises an increase of GC content, for example, from about 1 to about 30%, or any amount therebetween, over the length of the coding portion of the oligonucleotide sequence. For example, from about 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30%, or any amount therebetween, over the length of the coding portion of the oligonucleotide sequence. As described below, a human codon optimized nucleotide sequence, or a nucleotide sequence comprising an increased GC contact (when compared to the wild type nucleotide sequence) exhibits increased expression within a plant, portion of a plant, or a plant cell, when compared to expression of the non-human optimized (or lower GC content) nucleotide sequence.
[0108] By an immune response or immunological response, it is meant the response that is elicited following exposure of a subject to a foreign antigen. This response typically involves cognate and non-cognate interactions between the antigen and components of the immune system that ultimately results in activation of the immune components and leading to defense responses, including the production of antibodies against the foreign antigen. Improving the immune response may result in higher neutralizing antibody titers (HAI and MN) and may include increasing avidity. Changes in an immune response within a subject following administration of the modified HA having reduced or no binding to SA as described herein, may be determined, for example, using hemagglutination inhibition (HAI, see example 3.5), microneutralization (MN, see Example 3.5) and/or avidity (see Example 3.5) assays, and comparing the levels obtained in the subject (the first subject) against those obtained in a second subject that was administered a parent HA, under similar conditions. For example, an improved immune response may be indicated by an increase in HAI titers, MN titers, and/or avidity, in the first subject when compared with the HAI titers, MN titers, and/or avidity in the second subject.
[0109] Therefore the immune or immunological response may be a cellular immunological response, a humoral immunological response, or both a cellular immunological response and a humoral immunological response.
[0110] A cellular or cell-mediated response is an immune response that does not involve antibodies, but rather the involves the activation of phagocytes, antigen-specific cytotoxic T-lymphocytes, and the release of various cytokines in response to an antigen. A humoral immune response is mediated by antibody molecules that are secreted by plasma cells.
[0111] Cognate interactions that drive the B cell or humoral response involve recognition of the conformational or linear epitopes of the antigen by naïve B cells via complementarity loops of the germline B cell receptor. Cognate interactions that drive the T lymphocyte or cellular response include recognition of peptides presented by MHC molecules on the surface of antigen-presenting cells. At a molecular level, cognate interactions may include interactions between the B and T cell receptors and their antigens/epitope. At a larger scale, complex interactions between whole T and B cells that are responding to the same antigen may also considered to be ‘cognate’. Cognate interactions may be determined using any method known in the art, for example but not limited to assaying HAI titers, MN titers, avidity. Epitope-antibody interactions may be determined using any suitable method known in the art, for example but not limited to, ELISA and Western blot analysis.
[0112] Non-cognate interactions of a potential antigen with immune cells can take many forms. As used herein, binding of an antigen, for example HA, with any glycoprotein expressed on the surface of an immune cell via sialic acid (SA) residues may be considered a non-cognate interaction. Therefore, non-cognate interaction as used herewith includes the interaction or binding to sialic acid. Accordingly, a reduction in non-cognate interaction or binding, includes the reduction in interaction or binding to SA residues. Non-cognate interactions may be determined, for example, by assaying hemagglutination or using surface plasmon resonance (SPR), as described herein.
[0113] By “target” it is meant a cell, a cell receptor, a protein on the surface of a cell, a cell surface protein, an antibody, or fragment of an antibody, that is capable of interacting with an antigen. In one example the target may be a protein on the surface of a cell or a cell surface protein.
[0114] For example, the suprastructure as described in the current disclosure may comprise a modified influenza hemagglutinin (HA) with one or more than one alteration that reduces interaction of the modified HA to sialic acid (SA) of a target, while maintaining cognate interaction, with the target. For the example, the target may be a protein on the surface of a cell. Accordingly, the suprastructure may comprise modified influenza hemagglutinin (HA) with one or more than one alteration that reduces interaction of the modified HA to sialic acid (SA) of a protein on the surface of a cell, while maintaining cognate interaction with the cell. The cell may be for example be a B cell.
[0115] B cells may interact with an antigen via receptor signals through CDR driven antigen complementarity (cognate interaction), or via (non-cognate) interactions provided by, for example, antigen affinity to SA, glycans on HA interacting with glycan receptors on the surface of immune cells or other non-cognate interactions between HA and a cell, for example interactions with any cell receptor comprising SA, for example, a B cell surface protein or a T cell receptor surface protein. Naïve B cells may recognize the conformation of the antigen by the complementarity loops of a germline B cell receptor and interact with the antigen. An antibody, or a fragment of an antibody comprising a complimentary paratope, may bind an antigen and be considered a target. A recombinant cell expressing an antibody comprising a corresponding paratope may also bind an antigen and may also be considered a target.
[0116] By avidity it is meant a measure of the overall stability of the antibody-antigen complex, or the strength with which an antibody binds an antigen. Avidity is governed by the intrinsic affinity of the antibody for an epitope, the valency of the antibody and antigen, and the geometric arrangement or conformation of the interacting components. Maturation of the humoral immune response in a subject may be indicated by an increase in antibody avidity over time. Avidity may be determined using competitive inhibition assays over a range of concentration of free antigen, or by eluting the antibody from the antigen using a dissociating agent that disrupts hydrophobic bonds, for example thiocyanate or urea.
[0117] In one aspect, the current disclosure provides suprastructure comprising modified influenza hemagglutinin (HA). The suprastructure may be for example a virus-like particle (VLP). For example the VLP may be an influenza HA-VLP, wherein the VLP comprises or consists of modified influenza HA protein. For example, the modified influenza HA may be a type A influenza such for example an HA from H1, H3, H5 or H7 or the HA may be from a type B influenza such for example an HA from the B Yamagata or B Victoria lineage. The modified HA may comprise one or more than one alteration. For example the HA may be:
[0118] i) a modified H1 HA, wherein the one or more than one alteration is selected from Y91F; wherein the numbering of the alteration corresponds to the position of reference sequence with SEQ ID NO: 203 (H1 A/California/7/09; “H1/California”);
[0119] ii) a modified H3 HA, wherein the one or more than one alteration is selected from Y98F, S136D; Y98F, S136N; Y98F, S137N; Y98F, D190G; Y98F, D190G; Y98F, R222W; Y98F, S228N; Y98F, S228Q; S136D; S136N; D190K; S228N; and S228Q; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 204 (H3 A/Kansas/14/17; “H3/Kansas”);
[0120] iii) a modified H5 HA, wherein the one or more than one alteration is selected from Y91F; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 205 (H5 A/Indonesia/5/05; “H5/Indonesia”);
[0121] iv) a modified H7 HA, wherein the one or more than one alteration is selected from Y88F; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 206 (H7 A/Shanghai/2/12; “H7/Shanghai”);
[0122] v) a modified B HA wherein the one or more than one alteration is selected from S140A; S142A; G138A; L203A; D195G; and L203W; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 207 (B/Phuket/3073/2013: “B/Phuket”);
[0123] vi) a modified B HA wherein the one or more than one alteration is selected from S140A; S142A; G138A; L202A; D194G; and L202W; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 208 (B/Maryland/15/16; “B Maryland”);
[0124] vii) a modified B HA wherein the one or more than one alteration is selected from S140A; S142A; G138A; L201A; D193G; and L201W; wherein the numbering of the alteration corresponds to position of reference sequence with SEQ ID NO: 209 (B/Victoria/705/2018; “B/Victoria”); or
[0125] viii) a combination thereof.
[0126] The modified influenza HA proteins comprising one or more than one alteration as disclosed herewith that have been found to result in HA with improved characteristics as compared to the wildtype HA or unmodified HA proteins. Examples of improved characteristics of the modified HA protein include: [0127] reduction of non-cognate interaction with sialic acid (SA) of a target, while maintaining cognate interaction, with the target; [0128] reduction of non-cognate interaction with sialic acid (SA) of a protein on the surface of a cell, while maintaining cognate interaction, with the cell, such for example a B cell; [0129] modulation and/or increase of an immunological response in an animal or a subject in response to an antigen challenge, when compared to an immunological response, wherein the HA does not comprise the one or more than one alteration; [0130] increased HA protein yield when expressed in plant cells as compared to the wildtype or unmodified HA of the same strain or subtype of influenza that does not comprise the one or more than one alteration; [0131] decreased hemagglutination titer of the modified HA protein when compared to the wildtype or unmodified HA protein.
[0132] For example, the modified HA may be a modified H1 HA comprising an alteration from Y91F, wherein the modified H1 may exhibit i) non-cognate interaction of the modified HA to sialic acid (SA) of a target for example a protein on the surface of a cell, while maintaining cognate interaction, with the target for example a cell such as a B cell and/or ii) wherein the modified HA exhibits decreased hemagglutination titer when compared to a wildtype or unmodified (parent) HA and/or iii) wherein the modified H1 HA may modulate and/or increase an immunological response in an animal or a subject in response to an antigen challenge, when compared to an immunological response, wherein the HA does not comprise the one or more than one alteration.
[0133] Furthermore, the modified HA may be a modified H3 comprising alterations selected from Y98F, S136D; Y98F, S136N; Y98F, S137N; Y98F, D190G; Y98F, D190K; Y98F, R222W; Y98F, S228N; and Y98F, S228Q; S136D; S136N; D190K; S228N; and S228Q, wherein the modified H3 may exhibit i) non-cognate interaction of the modified HA to sialic acid (SA) of a target for example a protein on the surface of a cell, while maintaining cognate interaction, with the target for example a cell such as a B cell and/or ii) wherein the modified HA exhibits decreased hemagglutination titer when compared to a wildtype or unmodified (parent) HA and/or iii) wherein the modified H3 HA may modulate and/or increase an immunological response in an animal or a subject in response to an antigen challenge, when compared to an immunological response, wherein the HA does not comprise the one or more than one alteration.
[0134] The modified HA may be a modified H7 HA comprising an alteration from Y88F, wherein the modified H7 exhibit i) non-cognate interaction of the modified HA to sialic acid (SA) of a target for example a protein on the surface of a cell, while maintaining cognate interaction, with the target for example a cell such as a B cell and/or ii) wherein the modified HA exhibits decreased hemagglutination titer when compared to a wildtype or unmodified (parent) HA and/or iii) wherein the modified H7 HA may modulate and/or increase an immunological response in an animal or a subject in response to an antigen challenge, when compared to an immunological response, wherein the HA does not comprise the one or more than one alteration.
[0135] In another embodiment the modified HA may be a modified H5 HA comprising an alteration from Y91F, wherein the modified H5 HA exhibit i) non-cognate interaction of the modified HA to sialic acid (SA) of a target for example a protein on the surface of a cell, while maintaining cognate interaction, with the target for example a cell such as a B cell and/or ii) wherein the modified HA exhibits decreased hemagglutination titer when compared to a wildtype or unmodified (parent) HA and/or iii) wherein the modified H5 HA may modulate and/or increase an immunological response in an animal or a subject in response to an antigen challenge, when compared to an immunological response, wherein the HA does not comprise the one or more than one alteration.
[0136] In a further embodiment, the modified HA may be a modified B HA comprising alterations selected from S140A; S142A; G138A; L203A; D195G; and L203W, wherein the modified B HA may exhibit i) non-cognate interaction of the modified HA to sialic acid (SA) of a target for example a protein on the surface of a cell, while maintaining cognate interaction, with the target for example a cell such as a B cell and/or ii) modulation and/or increase of immunological response in an animal or a subject in response to an antigen challenge, when compared to an immunological response, wherein the HA does not comprise the one or more than one alteration.
Influenza HA
[0137] The term “influenza virus subtype” as used herein refers to influenza A and influenza B virus variants. Influenza virus subtypes and hemagglutinin (HA) from such virus subtypes may be referred to by their H number, such as, for example but not limited to, “HA of the H1 subtype”, “H1 HA”, or “H1 influenza”. The term “subtype” includes all individual “strains” within each subtype, which usually result from mutations and may show different pathogenic profiles. Such strains may also be referred to as various “isolates” of a viral subtype. Accordingly, as used herein, the terms “strains” and “isolates” may be used interchangeably.
[0138] Influenza results in agglutination of red blood cells (RBCs or erythrocytes) through multivalent binding of influenza HA to SA on the cell-surface. Many influenza strains can be serologically typed using reference anti-sera that prevents non-specific hemagglutination (ie: hemagglutination inhibition assay). Antibodies specific for particular influenza strains may bind to the virus and, thus, prevent such agglutination. Assays determining strain types based on such inhibition are typically known as hemagglutinin inhibition assays (HI assays or HAI assays) and are standard and well-known methods in the art to characterize influenza strains.
[0139] Hemagglutinin proteins from different virus strains also show significant sequence similarity at both the nucleic acid and amino acid levels. This level of similarity varies when strains of different subtypes are compared, with some strains displaying higher levels of similarity than others. This variation is sufficient to establish discrete subtypes and the evolutionary lineage of the different strains, but the DNA and amino acid sequences of different strains may be aligned using conventional bioinformatics techniques (Air, Proc. Natl. Acad. Sci. USA, 1981, 78:7643; Suzuki and Nei, Mol. Biol. Evol. 2002, 19:501).
[0140] An HA protein for use as described herein (i.e. to prepare a modified influenza HA protein that exhibits the property of having reduced, non-detectable, or no non-cognate interaction with SA, for example, reduced, non-detectable or no SA binding) may be derived from a type A influenza, a subtype of type A influenza HA selected from the group of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17 and H18, a type B influenza, a subtype of type B influenza, or a type C influenza. The HA may be from a type A influenza, selected from the group H1, H2, H3, H5, H6, H7, H9 and a type B influenza (for example Yamagata or Victoria lineage). Fragments of the HAs listed above may also be considered an HA protein of interest for use as described herein provided that when modified, the modified HA fragment exhibits reduced, non-detectable, or no non-cognate interaction with SA and that the modified HA fragment elicits an immune response. Furthermore, domains from an HA type or subtype listed above may be combined to produce chimeric HA's (see for example WO2009/076778 which is incorporated herein by reference).
[0141] Based on sequence similarities, influenza virus subtypes can further be classified by reference to their phylogenetic group. Phylogenetic analysis (Fouchier et al., J Virol. 2005 March; 79(5):2814-22) has demonstrated a subdivision of HAs that falls into two main groups (Air, Proc. Natl. Acad. Sci. USA, 1981, 78:7643): the H1, H2, H5 and H9 subtypes in phylogenetic group 1, and the H3, H4 and H7 subtypes in phylogenetic group 2.
[0142] Non limiting examples of subtypes comprising HA proteins that may be used as described herein (for example to prepare a modified influenza HA protein that may exhibit a modulated or increased immunological response in a subject and/or may exhibit the property of having reduced, non-detectable, or no non-cognate interaction with SA) include A/New Caledonia/20/99 (H1N1), A/California/07/09-H1N1 (A/Cal09-H1), A/California/04/2009 (H1N1), A/PuertoRico/8/34 (H1N1), A/Brisbane/59/2007 (H1N1), A/Brisbane/02/2018 (H1N1)pdm09-like virus, A/Solomon Islands 3/2006 (H1N1), A/Idaho/7/18 (H1N1), H1 A/Hawaii/70/19, A/Hawaii/70/2019 (H1N1)pdm09-like virus, A/chicken/New York/1995, A/Singapore/1/57 (H2N2), A/herring gull/DE/677/88 (H2N8), A/Brisbane 10/2007 (H3N2), A/Wisconsin/67/2005 (H3N2), A/Switzerland/9715293/2013-H3N2 (A/Swi-H3), A/Victoria/361/2011 (H3N2), A/Perth/16/2009 (H3N2), A/Kansas/14/17 (H3N2), A/Kansas/14/2017 (H3N2)-like virus, A/Minnesota/41/19 (H3N2), A/Hong Kong/45/2019 (H3N2)-like virus, A/shoveler/Iran/G54/03, A/Anhui/1/2005 (H5N1), A/Vietnam/1194/2004 (H5N1), A/Indonesia/5/2005 (H5N1), A/Vietnam/1194/2004 (H5N1), A/Egypt/N04915/14 (H5N1), A/Teal/HongKong/W312/97 (H6N1), A/Equine/Prague/56 (H7N7), H7 A/Hangzhou/1/13 (H7N9), A/Anhui/1/2013 (H7N9), A/Shanghai/2/2013 (H7N9), A/HongKong/1073/99 (H9N2), A/Texas/32/2003, A/mallard/MN/33/00, A/duck/Shanghai/1/2000, A/northern pintail/TX/828189/02, A/Turkey/Ontario/6118/68(H8N4), A/chicken/Germany/N/1949(H10N7), A/duck/England/56(H11N6), A/duck/Alberta/60/76(H12N5), A/Gull/Maryland/704/77(H13N6), A/Mallard/Gurjev/263/82, A/duck/Australia/341/83 (H15N8), A/black-headed gull/Sweden/5/99(H16N3), B/Brisbane/60/2008, B/Malaysia/2506/2004, B/Florida/4/2006, B/Phuket/3073/2013 (B/; Yamagata lineage), B/Phuket/3073/2013-like virus (B/Yamagata/16/88 lineage), B/Phuket/3073/2013 (B/Yamagata lineage)-like virus, B/Massachusetts/2/12, B/Wisconsin/1/2010, B/Lee/40, C/Johannesburg/66, B/Singapore/INFKK-16-0569/16 (Yamagata lineage), B/Maryland/15/16 (Victoria lineage), B/Victoria/705/18 (Victoria lineage), B/Washington/12/19 (Victoria lineage), B/Washington/02/2019 (B/Victoria lineage)-like virus, B/Darwin/8/19 (Victoria lineage), B/Darwin/20/19 (Victoria lineage), B/Colorado/06/2017-like virus (B/Victoria/2/87 lineage).
[0143] The HA protein for use as described herein (for example to prepare a modified influenza HA protein that may exhibit a modulated or increased immunological response in a subject and/or may exhibit the property of having reduced, non-detectable, or no non-cognate interaction with SA) may be an of influenza A subtype H1, H2, H3, H5, H6, H7, H8, H9, H10, H11, H12, H15, or H16 or the influenza may be an influenza B. For example, the H1 protein may be derived from the A/New Caledonia/20/99 (H1N1), A/PuertoRico/8/34 (H1N1), A/Brisbane/59/2007 (H1N1), A/Brisbane/02/2018 (H1N1)pdm09-like virus, A/Solomon Islands 3/2006 (H1N1), A/Idaho/7/18 (H1N1), H1 A/Hawaii/70/19, /Hawaii/70/2019 (H1N1)pdm09-like virus, A/California/04/2009 (H1N1) or A/California/07/2009 (H1N1) strain. In a further aspect of the invention, the H2 protein may be from the A/Singapore/1/57 (H2N2) strain. The H3 protein may be from the A/Brisbane 10/2007 (H3N2), A/Wisconsin/67/2005 (H3N2), A/Switzerland/9715293/2013-H3N2 (A/Swi-H3), A/Victoria/361/2011 (H3N2), A/Texas/50/2012 (H3N2), A/Kansas/14/17 (H3N2), A/Kansas/14/2017 (H3N2)-like virus, A/Hawaii/22/2012 (H3N2), A/New York/39/2012 (H3N2), A/Perth/16/2009 (H3N2) strain, A/Hong Kong/45/2019 (H3N2) like virus, or A/Minnesota/41/19 (H3N2). The H5 protein may be from the A/Anhui/1/2005 (H5N1), A/Vietnam/1194/2004 (H5N1), A/Vietnam/1194/2004 (H5N1), A/Egypt/N04915/14 (H5N1), or A/Indonesia/5/2005 strain. In an aspect of the invention, the H6 protein may be from the A/Teal/HongKong/W312/97 (H6N1) strain. The H7 protein may be from the A/Equine/Prague/56 (H7N7) strain, or H7 A/Hangzhou/1/2013, A/Anhui/1/2013 (H7N9), or A/Shanghai/2/2013 (H7N9) strain. The H8, H9, H10, H11, H12, H15, or H16 protein may be from the A/Turkey/Ontario/6118/68(H8N4), A/HongKong/1073/99 (H9N2) strain, A/chicken/Germany/N/1949(H10N7), A/duck/England/56(H11N6), A/duck/Alberta/60/76(H12N5), A/duck/Australia/341/83 (H15N8), A/black-headed gull/Sweden/5/99(H16N3). The HA protein for use as described herein may be derived from an influenza virus may be a type B virus, including B/Malaysia/2506/2004, B/Florida/4/2006, B/Brisbane/60/08, B/Massachusetts/2/2012-like virus (Yamagata lineage), or B/Wisconsin/1/2010 (Yamagata lineage), B/Phuket/3073/2013-like virus (B/Yamagata/16/88 lineage), B/Phuket/3073/2013 (B/Yamagata lineage)-like virus, B/Lee/40, B/Singapore/INFKK-16-0569/16 (Yamagata lineage), B/Maryland/15/16 (Victoria lineage), B/Victoria/705/18 (Victoria lineage), B/Washington/12/19 (Victoria lineage), B/Washington/02/2019 (B/Victoria lineage)-like virus, B/Darwin/8/19 (Victoria lineage), B/Darwin/20/19 (Victoria lineage), B/Colorado/06/2017-like virus (B/Victoria/2/87 lineage). Non-limiting examples of amino acid sequences of the HA proteins from H1, H2, H3, H5, H6, H7, H9 or B subtypes include sequences as described in WO 2009/009876, WO 2009/076778, WO 2010/003225, PCT/CA2019/050891, PCT/CA2019/050892, PCT/CA2019/050893 (which are incorporated herein by reference).
[0144] HA proteins (parent HAs), that may be modified as described herein to reduce or eliminate non-cognate interaction with SA, for example having reduced or no SA binding, may include wild type HA proteins, including new HA proteins that emerge over time due to natural modifications of the HA amino acid sequence, or non-native HA proteins, that may be produced as a result of altering the HA proteins (e.g. chimeric HA proteins, or HA proteins that have been altered to achieve a desirable property, for example, increasing expression within a host). Similarly, modified HA proteins as described herein to reduce or eliminate SA binding, may be derived from wild type HA proteins, novel HA proteins that emerge over time due to natural modifications of the HA amino acid sequence, non-modified HA proteins, non-native HA proteins for example, chimeric HA proteins, or HA proteins that have been altered to achieve a desirable property, for example, increasing expression of HA or VLPs within a host.
[0145] By “parent HA” it is meant that the HA protein from which the modified HA protein may be derived. The parent HA does not comprise a modification that reduces or eliminates non-cognate interactions with SA, for example reduced or no SA binding. Preferably, the parent HA protein exhibits antigenic properties similar to that of a corresponding native or wild-type influenza strain, including binding to SA on host cells. The parent HA may comprise a wild type or native HA, however, the parent HA may comprise an altered amino acid sequence, provided the alteration in the sequence is functionally separate from the modification that reduces or eliminates non-cognate interactions with SA, or reduces or eliminates SA binding. Preferably, the parent HA exhibits similar cognate interactions as those observed with a corresponding native or wild type HA, and comprises a conformation that elicits a similar immune response as that are observed with a corresponding native or wild type HA, when the non-modified HA is introduced into a subject. A parent HA may also be referred to as a non-modified HA.
[0146] The HA for use as described herein (i.e. a modified influenza HA protein that exhibits the property of having reduced, non-detectable, or no non-cognate interactions with SA) may also be derived from a parent HA that is non-native and comprises one or more than one amino acid sequence alterations that results in increased expression within a host, for example deletion of the proteolytic loop region of the HA molecule as described in WO2014/153674 (which is incorporated herein by reference), or comprising other substitutions or alterations as described in WO2020/00099, WO2020/000100, WO2020/000101 (each of which is incorporated herein by reference). The HA for use as described herein may also be derived from a non-native (parent) HA comprising one or more than one amino acid sequence alterations that results in an altered glycosylation pattern of the expressed HA protein, for example as described in WO2010/006452, WO2-14/071039, and WO2018/058256 (each of which is incorporated herein by reference).
[0147] The modified HA that exhibits the property of having reduced, non-detectable, or no non-cognate interaction with SA, for example reduced or no SA binding, may also be derived from a parent HA that is a chimeric HA, wherein a native transmembrane domain of the HA is replaced with a heterologous transmembrane domain. The transmembrane domain of HA proteins is highly conserved (see for example
TABLE-US-00001 (SEQ ID NO: 110) iLXiYystvAiSslXlXXmlagXsXwmcs
[0148] Other chimeric, parent, HAs may also be used as described herein, for example a chimeric HA comprising in series, an ectodomain from a virus trimeric surface protein or fragment thereof, fused to an influenza transmembrane domain and cytoplasmic tail as described in WO2012/083445 (which is incorporated herein by reference).
[0149] Therefore, the parent HA protein that may be modified as described herein to produce a modified HA exhibiting reduce or eliminate non-cognate interaction with SA, for example reduced or no SA binding, may have from about 80 to about 100%, or any amount therebetween, amino acid sequence identity, from about 90-100% or any amount therebetween, amino acid sequence identity, or from about 95-100% or any amount therebetween, amino acid sequence identity, to a wild type, or non-modified HA protein obtained from an influenza strain including those influenza strains listed herein, provided that the parent HA protein induces immunity to influenza in a subject, when the parent HA protein is administered to a subject. For example, the parent HA protein that may be modified as described herein to reduce or eliminate SA binding, may have from 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100%, or any amount therebetween, amino acid sequence identity (sequence similarity; percent identity; percent similarity) with a wild type or non-modified HA protein obtained from any influenza strain including those influenza strains listed herein, provided that the parent HA protein induces immunity to influenza in a subject, when the HA protein is administered to the subject.
[0150] For example, it is provided a modified influenza hemagglutinin (HA) protein comprising an amino acid sequence having from about 70% to about 100%, or any amount therebetween, for example 80, 82, 84, 86, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% or any amount therebetween, sequence identity or sequence similarity with a sequence of the sequences of SEQ ID NO: 203 (exemplary H1 sequence), SEQ ID NO: 204 (exemplary H3 sequence), SEQ ID NO: 205 (exemplary H5 sequence), SEQ ID NO: 206 (exemplary H7 sequence), SEQ ID NO: 207 (exemplary B sequence), SEQ ID NO: 208 (exemplary B sequence), and SEQ ID NO: 209 (exemplary B sequence), provided that the influenza HA protein comprises at least one substitution or alteration as described herewith and is able to form VLPs, reduce non-cognate interaction with a protein on the surface of the cell, induces an immune response when administered to a subject, or a combination thereof.
[0151] It is further provided that the modified influenza hemagglutinin (HA) protein may comprise an amino acid sequence having from about 70% to about 100%, or any amount therebetween, sequence identity or sequence similarity or any amount therebetween, for example 80, 82, 84, 86, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% or any amount therebetween sequence identity or sequence similarity, with amino acids 25 to 573 [H1] of SEQ ID NO:2, SEQ ID NO:12, SEQ ID NO: 101, SEQ ID NO:105, SEQ ID NO:195, or SEQ ID NO:197; with amino acids 25 to 574 [H3] of SEQ ID NO:61, SEQ ID NO:65, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:89, SEQ ID NO:93, SEQ ID NO:97, SEQ ID NO:112, SEQ ID NO:114, SEQ ID NO:116, SEQ ID NO:118, SEQ ID NO:120, or SEQ ID NO: 122; with amino acids 25 to 576 [H5] of SEQ ID NO:199 or SEQ ID NO:202; with amino acids 1 to 551 [H5 A/Egypt/N04915/14] of SEQ ID NO:108; with amino acids 25 to 566 [H7] of SEQ ID NO:21 or SEQ ID NO:26; with amino acids 1 to 542 [H7 A/Hangzhou/1/13] of SEQ ID NO: 109; with amino acids 25 to 576 [B] of SEQ ID NO:28, SEQ ID NO:33, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:49, SEQ ID NO:53, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, or SEQ ID NO:136; with amino acids 25 to 575 [B] of SEQ ID NO:138, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO: 145, SEQ ID NO:147, SEQ ID NO:149, or SEQ ID NO:151; with amino acids 25 to 574 [B] of SEQ ID NO:153, SEQ ID NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:165, SEQ ID NO:181, SEQ ID NO:183, SEQ ID NO: 185, SEQ ID NO:187, SEQ ID NO:189, SEQ ID NO: 191, or SEQ ID NO:193; with amino acids 1 to 569 [B] of SEQ ID NO:14; with amino acids 1 to 568 [B] of SEQ ID NO:15; or with amino acids 1 to 567 [B] of SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:19, provided that the modified influenza HA protein comprises at least one substitution or alteration as described herewith and is able to form VLPs, reduce non-cognate interaction with a protein on the surface of a cell, induces an immune response when administered to a subject, or a combination thereof.
[0152] It is further provided that the modified influenza hemagglutinin (HA) protein may comprise an amino acid sequence having from about 70% to about 100%, or any amount therebetween, sequence identity or sequence similarity or any amount therebetween, for example 80, 82, 84, 86, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% or any amount therebetween, sequence identity or sequence similarity with amino acids of SEQ ID NO:2, SEQ ID NO:12, SEQ ID NO:101, SEQ ID NO: 105, SEQ ID NO:195, SEQ ID NO:197; SEQ ID NO:61, SEQ ID NO:65, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85, SEQ ID NO:89, SEQ ID NO:93, SEQ ID NO:97, SEQ ID NO:112, SEQ ID NO:114, SEQ ID NO:116, SEQ ID NO:118, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:199 or SEQ ID NO:202, SEQ ID NO:108, SEQ ID NO:21 SEQ ID NO:26; SEQ ID NO:109; SEQ ID NO:28, SEQ ID NO:33, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:49, SEQ ID NO:53, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, or SEQ ID NO:136; SEQ ID NO:138, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, or SEQ ID NO:151 SEQ ID NO:153, SEQ ID NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:165, SEQ ID NO:181, SEQ ID NO:183, SEQ ID NO:185, SEQ ID NO:187, SEQ ID NO:189, SEQ ID NO:191, SEQ ID NO:193; SEQ ID NO: 14; SEQ ID NO:15; SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:19, provided that the modified influenza HA protein comprises at least one substitution or alteration as described herewith and is able to form VLPs, reduce non-cognate interaction with a protein on the surface of a cell, induces an immune response when administered to a subject, or a combination thereof.
[0153] Hemagglutinin proteins are known to aggregate to form dimers, trimers, multimeric complexes, or larger structures, for example HA rosettes, protein complexes comprising a plurality of HA proteins, multimeric HA complexes comprising a plurality of HA proteins, metaprotein HA complexes comprising a plurality of HA proteins, nanoparticles comprising a plurality of HA proteins, or VLPs comprising HA. Such aggregates of HA proteins are collectively referred to as “suprastructures”. Unless specified otherwise, the terms “multimeric complex”, “VLPs”, “nanoparticles”, and “metaproteins” may be used interchangeably, and they are examples of suprastructures comprising HA. Any form and number of HA proteins, from dimers, trimers, rosettes, multimeric complexes, metaprotein complexes, nanoparticles, VLPs, or other suprastructures comprising HA may be used to prepare immunogenic compositions and used as described herein.
[0154] The terms “percent similarity”, “sequence similarity”, “percent identity”, or “sequence identity”, when referring to a particular sequence, are used for example as set forth in the University of Wisconsin GCG software program, or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology, Ausubel et al., eds. 1995 supplement). Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, using for example the algorithm of Smith & Waterman, (1981, Adv. Appl. Math. 2:482), by the alignment algorithm of Needleman & Wunsch, (1970, J. Mol. Biol. 48:443), by the search for similarity method of Pearson & Lipman, (1988, Proc. Natl. Acad. Sci. USA 85:2444), by computerized implementations of these algorithms (for example: GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.).
[0155] An example of an algorithm suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (1977, Nuc. Acids Res. 25:3389-3402) and Altschul et al., (1990, J. Mol. Biol. 215:403-410), respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and amino acids of the invention. For example, the BLASTN program (for nucleotide sequences) may use as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=−4 and a comparison of both strands. For amino acid sequences, the BLASTP program may use as defaults a word length of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989, Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=−4, and a comparison of both strands. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (see URL: ncbi.nlm.nih.gov/).
Modified HA Protein
[0156] A nucleotide sequence (or nucleic acid) of interest encodes a modified influenza HA protein (also termed modified HA protein, modified HA, modified influenza HA), as described herein, if the modified HA protein exhibits the property of having reduced, non-detectable, or no non-cognate interaction with SA, for example having reduced, non-detectable, or no SA binding. Likewise, a protein of interest, as described herein, is a modified influenza HA protein if the protein of interest exhibits the property of having reduced, non-detectable, or no non-cognate interaction with SA, for example having reduced, non-detectable, or no SA binding. Preferably, the modified HA comprises a conformation that elicits an improved immune response when compared with the immune response observed using the corresponding parent HA, and the modification that results in reduced or non-detectable non-cognate interaction with SA does not alter cognate interactions of the modified HA protein with a target (for example, with targets mediated by the B cell receptor), when compared with the parent HA protein and the same target(s). The modification that results in reduced or non-detectable non-cognate interaction with SA does not alter recognition of the modified HA by antibodies or antigen-specific immune cells (i.e. B cells and T cells), for example, peripheral blood mononuclear cells (PBMC) or B cells expressing antibody against HA following vaccination with HA, or other cells, for example a transfected cell expressing a membrane bound IgM-HA. The modification that reduces non-cognate interactions between the HA and SA may involve substituting, deleting or adding one or more than one amino acid residue in the receptor binding site of HA, or altering the glycosylation pattern at or near the receptor binding site of HA, thereby sterically hindering non-cognate interactions between the HA and SA.
[0157] Amino acids that may be substituted in a HA of interest to reduce or eliminate SA binding may be determined by sequence alignment of a reference HA amino acid sequence with the HA of interest, and identifying the position of the corresponding amino acid(s) (see
TABLE-US-00002 TABLE 1 amino acid residues that may be substituted to produce a modified influenza hemagglutinin (HA) HA Parent strain amino acid # Relative to reference amino strain (parent strain) acid # (reference strain) A/H1 91 (H1) 98 (H3); 88 (H7) A/H3 98 (H3) 91 (H1); 88 (H7) A/H5 91 (H5) 98 (H3); 88 (H7) A/H7 88 (H7) 91 (H1); 98 (H3) B 138 (B/Phuket, B/Maryland, 138 (B/Phuket, B/Maryland, B/Victoria) B/Victoria) B 140 (B/Phuket, B/Maryland, 140 (B/Phuket, B/Maryland, B/Victoria) B/Victoria) B 142 (B/Phuket, B/Maryland, 142 (B/Phuket, B/Maryland, B/Victoria) B/Victoria) B 195 (B/Phuket) 194 (B/Maryland) 193 (B/Victoria) B 194 (B/Maryland) 193 (B/Victoria) 195 (B/Phuket) B 193 (B/Victoria) 194 (B/Maryland) 195 (B/Phuket) B 203 (B/Phuket) 202 (B/Maryland) 201 (B/Victoria) 202 (B/Maryland) 203 (B/Phuket) 201 (B/Victoria) 201 (B/Victoria) 202 (B/Maryland) 203 (B/Phuket)
Amino acid residue numbers correspond to representative HA sequences for each strain with the following sequences: H1 (SEQ ID NO: 203), H3 (SEQ ID NO: 204), H5 (SEQ ID NO: 205), H7 (SEQ ID NO: 206) B/Phuket (SEQ ID NO: 207), B/Maryland (SEQ ID NO: 208), B/Victoria (SEQ ID NO: 209).
[0158] As shown above, residues 194 and 202 in reference strain with SEQ ID NO: 208 (B/Maryland) and residues 193 and 201 in references strain with SEQ ID NO 209 (B/Victoria) correspond to residues 195 and 203 in reference strain of SEQ ID NO: 207 (B/Phuket).
[0159] The property of non-cognate interaction with SA, SA binding (or SA binding affinity), between a wild type (or non-modified) HA and the modified HA, with a blood cell, a transfected cell expressing membrane bound IgM HA, an antibody, a peptide comprising SA, or binding to a target comprising a terminal α-2,3 linked (avian) or α-2,6 linked (human) SA, and cognate interactions between the wild type (or non-modified) HA and the modified HA and a blood cell, or an antibody, may be determined using one or more assays that are known in the art. Non limiting examples of assays or combinations of assays that may be used are described in Hendin H., et. al. (Hendin H., et. al., 2017, Vaccine 35:2592-2599; which is incorporated herein by reference), Whittle J., et. al. (Whittle J., et. al., 2014, J. Virol. 88:4047-4057; which is incorporated herein by reference), Lingwood, D., et. al., (Lingwood, D., et. al., 2012 Nature 489:566-570 (which is incorporated herein by reference), Villar, R., et. al., (Villar, R., et. al., 2016, Scientific Reports (Nature) 6:36298), and may include the use of flow cytometry (see Example 3.7), using wild type (or non-modified) HA, and modified HA with reduced, non-detectable, or no non-cognate interaction with SA, to probe control and transfected cells expressing membrane bound HA. Surface plasmon resonance (SPR) analysis (see example 3.3), and/or hemagglutination assays (Example 3.1), microscopy or imaging (to determine HA-SA binding), coupled with Western blot analysis (to determine HA yield) and/or ELISA, may also be used to derive the amount of HA-SA interaction, and HA-epitope recognition (an example of cognate interaction), that a candidate HA protein exhibits.
[0160] By a modified HA having “reduced, non-detectable or no non-cognate interaction with SA”, or “reduced, non-detectable, or no binding to SA” it is meant that the non-cognate interaction, for example binding, of the modified HA to SA is reduced, reduced to undetectable levels, or eliminated, when compared to the non-cognate interaction, for example binding, of a corresponding parent HA that does not comprise the modification that results in reduced, undetectable, or no non-cognate interaction with SA. The parent HA may include for example, a wild type influenza HA, an HA comprising a sequence that is altered, but the alteration is not associated with non-cognate interaction with SA, for example binding with HA (i.e. a non-modified HA), a suprastructure comprising the parent HA, for example, a VLP. A modified HA having reduced, undetectable, or no non-cognate interaction with SA may exhibit from about 60 to about 100%, or any amount therebetween, binding with SA, when compared to the binding of the corresponding parent HA that does not comprise the modification that alters SA binding, with SA. This may also be restated as the modified HA comprising from about 0 to about 40%, or any amount therebetween, of the binding affinity with SA, when compared to the binding affinity of the corresponding parent HA, that does not comprise the modification, with SA.
[0161] For example, an alteration that reduces binding of the modified HA to SA may reduce binding of the modified HA from about 70 to about 100%, or any amount therebetween, from about 80 to about 100%, or any amount therebetween, or from about 90 to about 100%, or any amount therebetween, when compared to the binding of the corresponding parent HA to SA. For example the alteration may reduce the binding of the modified HA to SA by about 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98 or 100%, or any amount therebetween, when compared to binding of the corresponding parent HA to SA. Alternatively, the alteration that reduces binding of the modified HA to SA may exhibit from about 0 to about 30%, or any amount therebetween, of the binding affinity of a corresponding parent HA to SA, or from about 0 to about 20%, or any amount therebetween, of the binding affinity of a corresponding wild type (or non-modified) HA to SA, or from 0-10%, or any amount therebetween, of the binding affinity of the corresponding parent HA. For example, from about 0, 2, 4, 6, 8, 10, 112, 14, 16, 8, 20, 22, 24, 26, 28 or about 30%, or any amount therebetween, of the binding affinity of a corresponding parent HA to SA.
[0162] A modified HA cognitively interacts with a target, when from about 80 to 100%, or any amount therebetween of the modified HA associates with a target, such as a blood cell for example, a B cell, or other target, while also exhibiting the property of reduced, or non-detectable, binding to SA. Furthermore, a modified HA exhibits cognate interaction with a target if about 85 to about 100%, or any amount therebetween of the modified HA associates with the target, from about 90-100%, or any amount therebetween of the modified HA associates with the target, from about 95-100%, or any amount therebetween of the modified HA associates with the target, or from about 80, 82, 84, 86, 88, 90, 92, 94, 96, 98 or 100%, or any amount therebetween of the modified HA associates with the target, while also exhibiting reduced, or non-detectable, SA binding. Cognate interaction between a modified HA or a parent HA and a target can be determined, for example, by determining the avidity between the modified HA or parent HA and the target.
[0163] The modified influenza HA sequence, nucleic acid, or protein may be derived from a corresponding wild type, non-modified, or altered HA sequence, nucleic acid or protein, from any influenza strain, for example, an influenza strain obtained from the group of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17 and H18, or influenza from a type B strain.
[0164] Modified influenza HA proteins that result in reduced, non-detectable, or no non-cognate interaction with SA, and methods of producing modified influenza HA proteins in a suitable host, for example but not limited to a plant, are described herein.
[0165] The modified influenza HA proteins disclosed herein, that result in reduced or no non-cognate interaction with SA, have been found to result in improved HA characteristics, for example, use of the modified HA protein, suprastructure or VLP comprising the modified HA protein, as an influenza vaccine that exhibits increased immunogenicity and efficacy when compared to the immunogenicity and efficacy of an influenza vaccine comprising the corresponding parent (non-modified, or wild type) influenza HA, suprastructure or VLP comprising the parent HA protein. The alteration in the modified HA reduces binding of the modified HA to SA may be a result of a substitution, a deletion or an insertion of one or more amino acid within the HA sequence, or it may be a result of a chemical modification of the HA protein, for example by altering the glycosylation pattern of HA, or by removing one or more than one glycosylation site of HA.
[0166] Modified influenza HA proteins, suprastructures comprising modified HAs, nanoparticles comprising HAs, suprastructures or VLPs comprising the modified proteins, and methods of producing modified influenza HA proteins, suprastructures or VLPs, in a suitable host, for example but not limited to plants, are also described herein.
[0167] Suprastructures comprising modified HAs, nanoparticles comprising modified HAs, or VLPs comprising modified HA with reduced, non-detectable, or no non-cognate interaction with SA, for example reduced or no SA binding, exhibit improved characteristics when compared to the corresponding suprastructure, nanoparticle, or VLP comprising wildtype HA protein (or unmodified HA protein that exhibits wild type SA binding). For example, use of modified HA protein, suprastructure comprising modified HA, nanoparticle comprising modified HA, or VLP comprising the modified HA protein, as an influenza vaccine exhibited increased immunogenicity and efficacy when compared to the immunogenicity and efficacy of an influenza vaccine comprising the corresponding parent influenza HA, or VLP comprising the parent HA protein. For example, comparison of a binding parent (wild type/non-modified) H1-VLP to a modified (non-binding) H1-VLP (Y91F-H1 HA) in mice demonstrated that the VLP comprising the modified H1 HA elicited higher neutralizing antibody titers (HAI and MN; see
[0168] The mutation Y98F is reported to prevent the binding of H3 A/Aichi to SA (Bradley et al., 2011, J. Virol 85:12387-12398). However, the Y98F mutation does not prevent the binding of H3 A/Kansas to SA as significant hemagglutination occurred (
[0169] Vaccination with Y88F H7-VLP resulted in an increase in IgG compared to parent H7-VLP-vaccinated mice, up to 8 weeks post vaccination (
[0170] Furthermore, modified B-HA comprising a substitution selected from the group: S140A, S142A, G138A, D195G, L203W and L203A was observed to reduce binding between B HA and SA as these modified B HAs resulted in a significant reduction of HA titer (
[0171] The modified HA protein as described herein comprises one or more than one alteration, mutation, modification, or substitution in its amino acid sequence at any one or more amino acid that correspond with amino acids of the parent HA from which the modified HA is derived. By “correspond to an amino acid” or “corresponding to an amino acid”, it is meant that an amino acid corresponds to an amino acid in a sequence alignment with an influenza reference strain, or reference amino acid sequence, as described below (see for example Table 1). Two or more nucleotide sequences, or corresponding polypeptide sequences of HA may be aligned to determine a “consensus” or “consensus sequence” of a subtype HA sequence as is known in the art.
[0172] The amino acid residue number or residue position of HA is in accordance with the numbering of the HA of an influenza reference strain. For example the HA from the following reference strains may be used: [0173] H1 A/California/07/2009 (SEQ ID NO:203, see
[0180] The corresponding amino acid positions may be determined by aligning the sequences of the HA (for example H1, H3, H5, H7 or B HA) with the sequence of HA of their respective reference strain.
[0181] The amino acid residue number or residue position of HA is in accordance with the numbering of the HA of an influenza reference strain, or reference sequence. The reference sequence may be the wild type HA from which the modified HA is derived, or the reference sequence may be another defined reference sequence. For example, the HA reference sequence may be a wild type or non-modified (parent) H1 HA sequence (for example SEQ ID NO: 203), H3 HA sequence (for example SEQ ID NO: 204), H5 HA sequence (for example SEQ ID NO: 205), H7 HA sequence (for example SEQ ID NO: 206), or B HA sequence (for example SEQ ID NO: 207, SEQ ID NO: 208, or SEQ ID NO: 209; also see
[0182] The term “residue” refers to an amino acid, and this term may be used interchangeably with the term “amino acid” and “amino acid residue”.
[0183] As used herein, the term “conserved substitution” or “conservative substitution” refers to the presence of an amino acid residue in the sequence of the HA protein that is different from, but it is in the same class of amino acid as the described substitution. For example, a nonpolar amino acid may be used to replace a nonpolar amino acid, an aromatic amino acid to replace an aromatic amino acid, a polar-uncharged amino acid to replace a polar-uncharged amino acid, and/or a charged amino acid to replace a charged amino acid). In addition, conservative substitutions can encompass an amino acid having an interfacial hydropathy value of the same sign and generally of similar magnitude as the amino acid that is replacing the corresponding wild type amino acid. As used herein, the term: [0184] “nonpolar amino acid” refers to glycine (G, Gly), alanine (A, Ala), valine (V, Val), leucine (L, Leu), isoleucine (I, Ile), and proline (P, Pro); [0185] “aromatic residue” (or aromatic amino acid) refers to phenylalanine (F, Phe), tyrosine (Y, Tyr), and tryptophan (W, Trp); [0186] “polar uncharged amino acid” refers to serine (S, Ser), threonine (T, Thr), cysteine (C, Cys), methionine (M, Met), asparagine (N, Asn) and glutamine (Q, Gln); [0187] “charged amino acid” refers to the negatively charged amino acids aspartic acid (D, Asp) and glutamic acid (E, Glu), as well as the positively charged amino acids lysine (K, Lys), arginine (R, Arg), and histidine (H, His). [0188] amino acids with hydrophobic side chain (aliphatic) refers to Alanine (A, Ala), Isoleucine (I, Ile), Leucine (L, Leu), Methionine (M, Met) and Valine (V, Val); [0189] amino acids with hydrophobic side chain (aromatic) refers to Phenylalanine (F, Phe), Tryptophan (W, Trp), Tyrosine (Y, Tyr); [0190] amino acids with polar neutral side chain refers to Asparagine (N, Asn), Cysteine (C, Cys), Glutamine (Q, Gln), Serine (S, Ser) and Threonine (T, Thr); [0191] amino acids with electrically charged side chains (acidic) refers to Aspartic acid (D, Asp), Glutamic acid (E, Glu); [0192] amino acids with electrically charged side chains (basic) refers to Arginine (R, Arg); Histidine (H, His); Lysine (K, Lys), Glycine G, Gly) and Proline (P, Pro).
[0193] Conservative amino acid substitutions are likely to have a similar effect on the activity of the resultant modified HA protein as the original substitution or modification. Further information about conservative substitutions can be found, for example, in Ben Bassat et al. (J. Bacteriol, 169:751-757, 1987), O'Regan et al. (Gene, 77:237-251, 1989), Sahin-Toth et al. (Protein ScL, 3:240-247, 1994), Hochuli et al (Bio/Technology, 6:1321-1325, 1988).
[0194] The Blosum matrices are commonly used for determining the relatedness of polypeptide sequences (Henikoff et al., Proc. Natl. Acad. Sci. USA, 89:10915-10919, 1992). A threshold of 90% identity was used for the highly conserved target frequencies of the BLOSUM90 matrix. A threshold of 65% identity was used for the BLOSUM65 matrix. Scores of zero and above in the Blosum matrices are considered “conservative substitutions” at the percentage identity. The following table shows examples of conservative amino acid substitutions: Table 2.
TABLE-US-00003 TABLE 2 Exemplary conservative amino acid substitutions. Very Highly - Highly Conserved Original Conserved Substitutions (from the Conserved Substitutions Residue Substitutions Blosum90 Matrix) (from the Blosum65 Matrix) Ala Ser Gly, Ser, Thr Cys, Gly, Ser, Thr, Val Arg Lys Gln, His, Lys Asn, Gln, Glu, His, Lys Asn Gln; His Asp, Gln, His, Lys, Ser, Thr Arg, Asp, Gln, Glu, His, Lys, Ser, Thr Asp Glu Asn, Glu Asn, Gln, Glu, Ser Cys Ser None Ala Gln Asn Arg, Asn, Glu, His, Lys, Met Arg, Asn, Asp, Glu, His, Lys, Met, Ser Glu Asp Asp, Gln, Lys Arg, Asn, Asp, Gln, His, Lys, Ser Gly Pro Ala Ala, Ser His Asn; Gln Arg, Asn, Gln, Tyr Arg, Asn, Gln, Glu, Tyr Ile Leu; Val Leu, Met, Val Leu, Met, Phe, Val Leu Ile; Val Ile, Met, Phe, Val Ile, Met, Phe, Val Lys Arg; Gln; Glu Arg, Asn, Gln, Glu Arg, Asn, Gln, Glu, Ser, Met Leu; Ile Gln, Ile, Leu, Val Gln, Ile, Leu, Phe, Val Phe Met; Leu; Tyr Leu, Trp, Tyr Ile, Leu, Met, Trp, Tyr Ser Thr Ala, Asn, Thr Ala, Asn, Asp, Gln, Glu, Gly, Lys, Thr Thr Ser Ala, Asn, Ser Ala, Asn, Ser, Val Trp Tyr Phe, Tyr Phe, Tyr Tyr Trp; Phe His, Phe, Trp His, Phe, Trp Val Ile; Leu Ile, Leu, Met Ala, Ile, Leu, Met, Thr
[0195] When referring to modifications, mutants or variants, the wild type amino acid residue (also referred to as simply ‘amino acid’) is followed by the residue number and the new or substituted amino acid. For example, which is not to be considered limiting, substitution of tyrosine (Y, Tyr) for phenylalanine (F, Phe) in residue or amino acid at position 98, is denominated Y98F.
[0196] Examples of modifications that may be used as described herein to produce a modified HA that exhibits the property of having reduced, non-detectable, or no non-cognate interaction with SA, for example, reduced, non-detectable or no SA binding, while maintaining cognate interaction of the modified HA protein with a target, and/or a modified HA that modulates and/or increases an immunological response in an animal or a subject in response to an antigen challenge, for example, targets mediated by the B cell receptor, include: [0197] an H1-HA comprising a Y91F substitution. The amino acid substitution at position 91 may be determined by sequence alignment with the H1 reference sequence H1 A/California/7/09 (SEQ ID NO:203). An alternate amino acid substitution at position 91 with an aromatic side chain may include Tryptophan (W, Trp; Y91W); [0198] an H3-HA comprising a Y98F substitution in combination with a substitution selected from the group of S136D, S136N, S137N, D190G, D190K, R222W, S228N, S228Q determined by sequence alignment with the reference sequence H3 A/Kansas/14/17 (SEQ ID NO:204). Alternate amino acid substitutions at position 98 may include an aromatic side chain, Tryptophan (W, Trp; Y98W); alternate substitutions at positions 136, 137 and 228 may include polar uncharged amino acids, for example: Asparagine (N, Asn; S136N; S137N), Cysteine (C, Cys; S136C; S137C; S228C), Glutamine (Q, Gln; S136Q; S137Q), and Threonine (T, Thr; S136T; S137T; S228T); alternate substitutions at position 190 may include electrically charged side chains, for example glutamic acid (E; Glu; D190E); (R, Arg; D190R); Histidine (H, His: D190H); and Proline (P, Pro; D190P); alternate substitutions at position 222 may include Histidine (H, His; R222H); Lysine (K, Lys; R222K), Glycine G, Gly; R222G) and Proline (P, Pro; R222P); [0199] an H3-HA comprising a substitution selected from the group of S136D, S136N, D190K, R222W, S228N or S228Q determined by sequence alignment with the reference sequence H3 A/Kansas/14/17 (SEQ ID NO:204). Alternate substitutions at positions 136 and 228 may include polar uncharged amino acids, for example: Asparagine (N, Asn; S136N), Cysteine (C, Cys; S136C; S228C), Glutamine (Q, Gln; S136Q), and Threonine (T, Thr; S136T; S228T); alternate substitutions at position 190 may include electrically charged side chains, for example glutamic acid (E; Glu; D190E); (R, Arg; D190R); Histidine (H, His: D190H); and Proline (P, Pro; D190P); alternate substitutions at position 222 may include Histidine (H, His; R222H); Lysine (K, Lys; R222K), Glycine G, Gly; R222G) and Proline (P, Pro; R222P); [0200] an H5-HA comprising a Y91F substitution. The amino acid substitution at position 91 may be determined by sequence alignment with the reference sequence H5 A/Indonesia/5/05 (SEQ ID NO:205). An alternate amino acid substitution at position 91 with an aromatic side chain may include Tryptophan (W, Trp; Y91W); [0201] an H7-HA comprising a Y88F substitution. The amino acid substitution at position 88 may be determined by sequence alignment with the reference sequence H7 A/Shanghai/2/12 (SEQ ID NO:206). An alternate amino acid substitution at position 88 with an aromatic side chain may include Tryptophan (W, Trp; Y88W); [0202] a B-HA comprising a substitution selected from the group: S140A, S142A, G138A, D195G, L203W and L203A determined with reference to the B/Phuket/3073/2013 (SEQ ID NO:207). Alternate amino acid substitution at positions 140 and 142 may include polar uncharged amino acids, for example: Asparagine (N, Asn; S140N; S142N), Cysteine (C, Cys; S140C; S142C), Glutamine (Q, Gln; S140Q; S142Q), and Threonine (T, Thr; S140T; S142T); alternate amino acid substitution at position 138 may include other nonpolar amino acids, for example, valine (V, Val; G138V), leucine (L, Leu; G138L), isoleucine (I, Ile; G138I), and proline (P, Pro; G138P); alternate amino acid substitution at position 195 may include the charged amino acid glutamic acid (E, Glu; D195E); alternate amino acid substitution at position 203 may include nonpolar amino acids, for example glycine (G, Gly; L203G), valine (V, Val; L203V), isoleucine (I, Ile; L203I), and proline (P, Pro; L203P). [0203] a B-HA comprising a substitution selected from the group: S140A, S142A, G138A, D194G, L202W and L202A determined with reference to the B/Maryland/15/2016 (SEQ ID NO:208). Alternate amino acid substitution at positions 140 and 142 may include polar uncharged amino acids, for example: Asparagine (N, Asn; S140N; S142N), Cysteine (C, Cys; S140C; S142C), Glutamine (Q, Gln; S140Q; S142Q), and Threonine (T, Thr; S140T; S142T); alternate amino acid substitution at position 138 may include other nonpolar amino acids, for example, valine (V, Val; G138V), leucine (L, Leu; G138L), isoleucine (I, Ile; G138I), and proline (P, Pro; G138P); alternate amino acid substitution at position 194 may include the charged amino acid glutamic acid (E, Glu; D194E); alternate amino acid substitution at position 202 may include nonpolar amino acids, for example glycine (G, Gly; L202G), valine (V, Val; L202V), isoleucine (I, Ile; L202I), and proline (P, Pro; L202P). [0204] a B-HA comprising a substitution selected from the group: S140A, S142A, G138A, D193G, L201W and L201A determined with reference to the B/Victoria/705/2018 (SEQ ID NO:209). Alternate amino acid substitution at positions 140 and 142 may include polar uncharged amino acids, for example: Asparagine (N, Asn; S140N; S142N), Cysteine (C, Cys; S140C; S142C), Glutamine (Q, Gln; S140Q; S142Q), and Threonine (T, Thr; S140T; S142T); alternate amino acid substitution at position 138 may include other nonpolar amino acids, for example, valine (V, Val; G138V), leucine (L, Leu; G138L), isoleucine (I, Ile; G138I), and proline (P, Pro; G138P); alternate amino acid substitution at position 193 may include the charged amino acid glutamic acid (E, Glu; D194E); alternate amino acid substitution at position 201 may include nonpolar amino acids, for example glycine (G, Gly; L201G), valine (V, Val; L201V), isoleucine (I, Ile; L201I), and proline (P, Pro; L201P).
[0205] A nucleic acid encoding the modified HA with reduced, non-detectable, or no non-cognate interaction with SA as described herein is also provided. Furthermore, hosts that comprise the nucleic acid are also described. Suitable hosts are described below, and may include, but are not limited to, a eukaryotic host, cultured eukaryotic cells, an avian host, an insect host, or a plant host. For example, a plant, portion of a plant, plant matter, plant extract, plant cell, may comprise the nucleic acid encoding the modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA.
[0206] Also provided is a method to produce a modified HA with reduced, non-detectable, or no non-cognate interaction with SA, a suprastructure comprising the modified HA, a nanoparticle comprising the modified HA, or a VLP (or suprastructure) comprising the modified HA, by expressing the nucleic acid encoding the modified HA with reduced, non-detectable, or no non-cognate interaction with SA within a suitable host, for example, but not limited to a eukaryotic host, cultured eukaryotic cells, an avian host, an insect host, or a plant host. The method may involve introducing the nucleic acid encoding the modified HA with reduced, non-detectable, or no non-cognate interaction with SA into the plant and growing the plant under conditions that result in the expression of the nucleic acid and production of the modified HA, the suprastructure comprising the modified HA, a nanoparticle comprising the modified HA, or the VLP comprising the modified HA, or a combination thereof, and harvesting the plant. Alternatively, the method may involve growing a plant that already comprises the nucleic acid encoding the modified HA with reduced, non-detectable, or no non-cognate interaction with SA under conditions that result in the expression of the nucleic acid and production of the modified HA, the suprastructure comprising the modified HA, the nanoparticle comprising the modified HA, or the VLP comprising the modified HA, or a combination thereof, and harvesting the plant. The modified HA, the suprastructure comprising the modified HA, the nanoparticle comprising the modified HA, or the VLP comprising modified HA may be purified as described herein or by using purification protocols known to one of skill in the art.
VLPs
[0207] Described herein are VLPs comprising a modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA. Also described is the use of these VLPs as an influenza vaccine that exhibits increased immunogenicity and efficacy when compared to the immunogenicity and efficacy of an influenza vaccine comprising VLPs comprising the corresponding wild type (or non-modified) influenza HA. As described above, a VLP may be considered an example of a nanoparticle or a suprastructure comprising HA or a modified HA, and unless otherwise stated, these terms may be used interchangeably.
[0208] The term “virus like particle” (VLP), or “virus-like particles” or “VLPs” refers to structures that self-assemble and comprise structural proteins such as influenza HA protein. VLPs are generally morphologically and antigenically similar to virions produced in an infection but lack genetic information sufficient to replicate and thus are non-infectious. The VLP may comprise an HA0, HA1 or HA2 peptide. In some examples, VLPs may comprise a single protein species, or more than one protein species. For VLPs comprising more than one protein species, the protein species may be from the same species of virus, or may comprise a protein from a different species, genus, subfamily or family of virus (as designated by the ICTV nomenclature). As described herein, the one or more of the protein species comprising a VLP may be modified from the naturally occurring sequence. VLPs may be produced in suitable host cells including plant and insect host cells. Following extraction from the host cell and upon isolation and further purification under suitable conditions, VLPs may be purified as intact structures.
[0209] In plants, influenza VLPs bud from the plasma membrane therefore the lipid composition of the VLPs reflects their origin. The plant-derived lipids may be in the form of a lipid bilayer and may further comprise an envelope surrounding the VLP. The plant derived lipids may comprise lipid components of the plasma membrane of the plant where the VLP is produced, including, but not limited to, phosphatidylcholine (PC), phosphatidylethanolamine (PE), glycosphingolipids, phytosterols or a combination thereof. A plant-derived lipid may alternately be referred to as a ‘plant lipid’. Examples of phytosterols are known in the art, and include, for example, stigmasterol, sitosterol, 24-methylcholesterol and cholesterol. Therefore, a VLP as described herein may be complexed with a plant-derived lipid bilayer. The phytosterols present in an influenza VLP complexed with a lipid bilayer, such as a plasma-membrane derived envelope may provide for an advantageous vaccine composition. Without wishing to be bound by theory, plant-made VLPs complexed with a lipid bilayer, such as a plasma-membrane derived envelope, may induce a stronger immune reaction than VLPs made in other expression systems, and may be similar to the immune reaction induced by live or attenuated whole virus vaccines. Furthermore, the conformation of the VLP may be advantageous for the presentation of the antigen and enhance the adjuvant effect of VLP when complexed with a plant derived lipid layer.
[0210] PC and PE, as well as glycosphingolipids can bind to CD1 molecules expressed by mammalian immune cells such as antigen-presenting cells (APCs) like dendritic cells and macrophages and other cells including B and T lymphocytes in the thymus and liver (Tsuji M., 2006). CD1 molecules are structurally similar to major histocompatibility complex (MHC) molecules of class I and their role is to present glycolipid antigens to NKT cells (Natural Killer T cells). Upon activation, NKT cells activate innate immune cells such as NK cells and dendritic cells, and also activate adaptive immune cells like the antibody-producing B cells and T-cells.
[0211] The VLP produced within a plant may comprise HA that comprises plant-specific N-glycans. Therefore, a VLP comprising HA having plant specific N-glycans is also described.
[0212] Modification of N-glycan in plants is known (see for example WO2008/151440; WO2010/006452; WO2014/071039; WO/2018058256, each of which is incorporated herein by reference) and HA having modified N-glycans may be produced. HA comprising a modified glycosylation pattern, for example with reduced or non-detectable levels of fucosylated, xylosylated, or both, fucosylated and xylosylated, N-glycans may be obtained, or HA having a modified glycosylation pattern may be obtained, wherein the protein lacks fucosylation, xylosylation, or both, when compared to a wild-type plant expressing HA. Without wishing to be bound by theory, the presence of plant N-glycans on HA may stimulate the immune response by promoting the binding of HA by antigen presenting cells. Therefore, the present invention also includes VLP's comprising HA having modified N-glycans.
[0213] VLPs may be assessed for structure and size by, for example, hemagglutination assay, electron microscopy, gradient density centrifugation, by size exclusion chromatography, ion exchange chromatography, affinity chromatography, or other size determining assay as would be known to one of skill in the art. For example, which is not to be considered limiting, total soluble proteins may be extracted from plant tissue by enzymatic digestion, for example as described in WO2011/035422, WO2011/035423, WO2012/126123 (each of which is incorporated herein by reference), homogenizing (Polytron) samples of fresh or frozen-crushed plant material in extraction buffer, and insoluble material removed by centrifugation or depth filtration. Precipitation with PEG, salt, or pH, may also be used. The soluble protein may be passed through a size exclusion column, an ion exchange column, or an affinity column. Following chromatography, fractions may be further analyzed by PAGE, Western, or immunoblot to determine the protein complement of the fraction. The relative abundance of the modified HA may also be determined using a hemagglutination assay.
Hosts
[0214] The modified influenza HA as described herein, the VLP comprising the modified HA, or both the modified HA and the VLP comprising the modified HA as described herein, may be produced within any suitable host, for example, but not limited to a eukaryotic host, a eukaryotic cell, a mammalian host, a mammalian cell, an avian host, an avian cell, an insect host, an insect cell, a baculovirus cell, or a plant host, a plant or a portion of a plant, a plant cell. For example the host may be an animal or non-human host. For example, a plant may be used to produce a modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA, a VLP comprising the modified HA, or both the modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA and a VLP comprising the modified HA. Therefore, also described are plants that comprise a VLP comprising a modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA. Furthermore, plants that that comprise the modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA are also described.
[0215] Plants may include, but are not limited to, herbaceous plants. Furthermore plants may include, but are not limited to, agricultural crops including for example canola, Brassica spp., maize, Nicotiana spp., (tobacco) for example, Nicotiana benthamiana, Nicotiana rustica, Nicotiana, tabacum, Nicotiana alata, Arabidopsis thaliana, alfalfa (Medicago spp., for example, Medicago trunculata), potato, sweet potato (Ipomoea batatus), ginseng, pea, oat, rice, soybean, wheat, barley, sunflower, cotton, corn, rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), safflower (Carthamus tinctorius), lettuce and cabbage.
Compositions
[0216] Also described herein is a composition comprising one or more than one modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA, or one or more than one VLP comprising one or more than one modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA, and a pharmaceutically acceptable carrier, adjuvant, vehicle, or excipient. The composition comprising the modified influenza HA, or VLP comprising the modified HA protein, may be used as a vaccine for use in administering to a subject in order to induce an immune response. Therefore, the present disclosure provides a vaccine comprising the composition comprising one or more than one modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA, or one or more than one VLP comprising one or more than one modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA.
[0217] The composition may comprise a mixture of VLPs provided that at least one of the VLPs within the composition comprises modified HA protein as described herein. For example, each HA including one or more than one modified HA, from each of the one or more than one influenza subtypes may be expressed and the corresponding VLPs purified. Virus like particles obtained from two or more than two influenza strains (for example, two, three, four, five, six, seven, eight, nine, 10 or more strains or subtypes) may be combined as desired to produce a mixture of VLPs, provided that one or more than one VLP in the mixture of VLPs comprises a modified HA as described herein. The VLPs may be combined or produced in a desired ratio, for example about equivalent ratios, or may be combined in such a manner that one subtype or strain comprises the majority of the VLPs in the composition.
[0218] Selection of the combination of HAs may be determined by the intended use of the vaccine prepared from the VLP. For example a vaccine for use in inoculating birds may comprise any combination of HA subtypes, while VLPs useful for inoculating humans may comprise subtypes one or more than one of subtypes H1, H2, H3, H5, H7, H9, H10, N1, N2, N3 and N7. However, other HA subtype combinations may be prepared depending upon the use of the inoculum. For example, the choice of combination of strains and subtypes may also depend on the geographical area of the subjects likely to be exposed to influenza, proximity of animal species to a human population to be immunized (e.g. species of waterfowl, agricultural animals such as swine, etc) and the strains they carry, are exposed to or are likely to be exposed to, predictions of antigenic drift within subtypes or strains, or combinations of these factors. Examples of combinations used in past years are available (see URL: who.int/csr/disease/influenza/vaccine recommendations1/en).
[0219] Therefore, a composition is provided that comprise a VLP comprising a modified HA as described herein, or that comprises a mixture of VLPs, each VLP comprising a different HA subtype or strain, provided that one of the HA's is a modified HA as described herein.
[0220] The composition comprising a VLP comprising a modified HA, or a composition comprising a mixture of VLPs as described above, may be use for inducing immunity to influenza virus infection in an animal or subject. For example, an effective dose of a vaccine comprising the composition may be administered to an animal or subject. The vaccine may be administered orally, intradermally, intranasally, intramuscularly, intraperitoneally, intravenously, or subcutaneously. For example, which is not to be considered limiting, the subject may be selected from the group comprising humans, primates, horses, pigs, birds, water fowl, migratory birds, quail, duck, geese, poultry, chicken, swine, sheep, equine, horse, camel, canine, dogs, feline, cats, tiger, leopard, civet, mink, stone marten, ferrets, house pets, livestock, rabbits, guinea pigs or other rodents, mice, rats, seal, fish, whales and the like.
[0221] Therefore, the present disclosure also provides a method of inducing immunity to influenza virus infection in an animal or subject in need thereof, comprising administering the VLP comprising the modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA to the animal or subject. As described below, the use of the modified influenza HA with reduced, non-detectable, or no non-cognate interaction with SA elicits an improved immune response when compared with the immune response obtained following vaccination of the subject using the corresponding wild type or non-modified HA that does not comprise a modification that reduces SA binding.
TABLE-US-00004 TABLE 3 Summary of sequences SEQ ID NO: Name FIG./Table SEQ ID NO: 1 PDI-H1 Cal/7/09 DNA FIG. 13A SEQ ID NO: 2 PDI-H1 Cal/7/09 AA FIG. 13B SEQ ID NO: 3 IF-CPMV(fl5′UTR)_SpPDI.c Tab. 4 SEQ ID NO: 4 IF-H1cTMCT.S1-4r Tab. 4 SEQ ID NO: 5 Cloning vector 1190 from left to right T-DNA FIG. 17A SEQ ID NO: 6 Construct 1314 from 2X35S prom to NOS term FIG. 17B SEQ ID NO: 7 H1_Cal(Y91F).r Tab. 4 SEQ ID NO: 8 H1_Cal(Y91F).c Tab. 4 SEQ ID NO: 9 Cloning vector 3637 from left to right T-DNA FIG. 17C SEQ ID NO: 10 Construct 6100 from 2X35S prom to NOS term FIG. 17D SEQ ID NO: 11 PDI-H1 Cal-Y91F DNA 1 FIG. 8C SEQ ID NO: 12 PDI-H1 Cal-Y91F AA FIG. 13D SEQ ID NO: 13 A/Minnesota/41/19 (H3N2) FIG. 1A SEQ ID NO: 14 B/Singapore/INFKK-16-0569/16 (Yamagata) FIG. 1B SEQ ID NO: 15 B/Maryland/15/16 (Victoria) FIG. 1B SEQ ID NO: 16 B/Victoria/705/18 (Victoria) FIG. 1B SEQ ID NO: 17 B/Washington/12/19 (Victoria) FIG. 1B SEQ ID NO: 18 B/Darwin/8/19 (Victoria) FIG. 1B SEQ ID NO: 19 B/Darwin/20/19 (Victoria) FIG. 1B SEQ ID NO: 20 PDI-H7 Shan DNA FIG. 15A SEQ ID NO: 21 PDI-H7 Shan AA FIG. 15B SEQ ID NO: 22 IF-H7Shang.r Tab. 4 SEQ ID NO: 23 H7Shang(Y88F).c Tab. 4 SEQ ID NO: 24 H7Shang(Y88F).r Tab. 4 SEQ ID NO: 25 PDI-H7 Shan-Y88F DNA FIG. 15C SEQ ID NO: 26 PDI-H7 Shan-Y88F AA FIG. 15D SEQ ID NO: 27 PDI-B Phu/3073/2013 DNA FIG. 16A SEQ ID NO: 28 PDI-B Phu/3073/2013 AA FIG. 16B SEQ ID NO: 29 IF.HBPhu3073.c Tab. 4 SEQ ID NO: 30 B_Phuket(S140A).c Tab. 4 SEQ ID NO: 31 B_Phuket(S140A).r Tab. 4 SEQ ID NO: 32 PDI-B Phu-S140A/3073/2013 (S140A) DNA FIG. 16C SEQ ID NO: 33 PDI-B Phu-S140A/3073/2013 (S140A) AA FIG. 16D SEQ ID NO: 34 B_Phuket(S142A).c Tab. 4 SEQ ID NO: 35 B_Phuket(S142A).r Tab. 4 SEQ ID NO: 36 PDI-B Phu-S142A DNA FIG. 16E SEQ ID NO: 37 PDI-B Phu-S142A AA FIG. 16F SEQ ID NO: 38 B_Phuket(G138A).c Tab. 4 SEQ ID NO: 39 B_Phuket(G138A).r Tab. 4 SEQ ID NO: 40 PDI-B Phu-G138A DNA FIG. 16G SEQ ID NO: 41 PDI-B Phu-G138A AA FIG. 16H SEQ ID NO: 42 B_Phuket(L203A).c Tab. 4 SEQ ID NO: 43 B_Phuket(L203A).r Tab. 4 SEQ ID NO: 44 PDI-B Phu-L203A DNA FIG. 16I SEQ ID NO: 45 PDI-B Phu-L203A AA FIG. 16J SEQ ID NO: 46 B_Phuket(D195G).c Tab. 4 SEQ ID NO: 47 B_Phuket(D195G).r Tab. 4 SEQ ID NO: 48 PDI-B Phu-D195G DNA FIG. 16K SEQ ID NO: 49 PDI-B Phu-D195G AA FIG. 16L SEQ ID NO: 50 B_Phuket(L203W).c Tab. 4 SEQ ID NO: 51 B_Phuket(L203W).r Tab. 4 SEQ ID NO: 52 PDI-B Phu-L203W DNA FIG. 16M SEQ ID NO: 53 PDI-B Phu-L203W AA FIG. 16N SEQ ID NO: 54 Cloning vector 2530 from left to right T-DNA FIG. 17E SEQ ID NO: 55 Construct 2835 from 2X35S prom to NOS term FIG. 17F SEQ ID NO: 56 Cloning vector 4499 from left to right T-DNA FIG. 17G SEQ ID NO: 57 Construct 8352 from 2X35S prom to NOS term FIG. 17H SEQ ID NO: 58 Construct 7281 from 2X35S prom to NOS term FIG. 17I SEQ ID NO: 59 Construct 8179 from 2X35S prom to NOS term FIG. 17J SEQ ID NO: 60 PDI-H3 Kan DNA FIG. 14A SEQ ID NO: 61 PDI-H3 Kan AA FIG. 14B SEQ ID NO: 62 IF-H3NewJer.c Tab. 4 SEQ ID NO: 63 IF-H3_Swi_13.r Tab. 4 SEQ ID NO: 64 PDI-H3 Kan-Y98F DNA FIG. 14C SEQ ID NO: 65 PDI-H3 Kan-Y98F AA FIG. 14D SEQ ID NO: 66 H3_Kansas(Y98F).c Tab. 4 SEQ ID NO: 67 H3_Kansas(Y98F).r Tab. 4 SEQ ID NO: 68 PDI-H3 Kan-Y98F + S136D DNA FIG. 14E SEQ ID NO: 69 PDI-H3 Kan-Y98F + S136D AA FIG. 14F SEQ ID NO: 70 H3Kansas(S136D).c Tab. 4 SEQ ID NO: 71 H3Kansas(S136D).r Tab. 4 SEQ ID NO: 72 PDI-H3 Kan-Y98F + S136N DNA FIG. 14G SEQ ID NO: 73 PDI-H3 Kan-Y98F + S136N AA FIG. 14H SEQ ID NO: 74 H3Kansas(S136N).c Tab. 4 SEQ ID NO: 75 H3Kansas(S136N).r Tab. 4 SEQ ID NO: 76 PDI-H3 Kan-Y98F + S137N DNA FIG. 14I SEQ ID NO: 77 PDI-H3 Kan-Y98F + S137N AA FIG. 14J SEQ ID NO: 78 H3Kansas(S137N).c Tab. 4 SEQ ID NO: 79 H3Kansas(S137N).r Tab. 4 SEQ ID NO: 80 PDI-H3 Kan-Y98F + D190G DNA FIG. 14K SEQ ID NO: 81 PDI-H3 Kan-Y98F + D190G AA FIG. 14L SEQ ID NO: 82 H3Kansas(D190G).c Tab. 4 SEQ ID NO: 83 H3Kansas(D190G).r Tab. 4 SEQ ID NO: 84 PDI-H3 Kan-Y98F + D190K DNA FIG. 14M SEQ ID NO: 85 PDI-H3 Kan-Y98F + D190K AA FIG. 14N SEQ ID NO: 86 H3Kansas(D190K).c Tab. 4 SEQ ID NO: 87 H3Kansas(D190K).r Tab. 4 SEQ ID NO: 88 PDI-H3 Kan-Y98F + R222W DNA FIG. 14O SEQ ID NO: 89 PDI-H3 Kan-Y98F + R222W AA FIG. 14P SEQ ID NO: 90 H3Kansas(R222W).c Tab. 4 SEQ ID NO: 91 H3Kansas(R222W).r Tab. 4 SEQ ID NO: 92 PDI-H3 Kan-Y98F + S228N DNA FIG. 14Q SEQ ID NO: 93 PDI-H3 Kan-Y98F + S228N AA FIG. 14R SEQ ID NO: 94 H3Kansas(S228N).c Tab. 4 SEQ ID NO: 95 H3Kansas(S228N).r Tab. 4 SEQ ID NO: 96 PDI-H3 Kan-S228Q DNA FIG. 14S SEQ ID NO: 97 PDI-H3 Kan-S228Q AA FIG. 14T SEQ ID NO: 98 H3Kansas(S228Q).c Tab. 4 SEQ ID NO: 99 H3Kansas(S228Q).r Tab. 4 SEQ ID NO: 100 PDI-H1 Idaho DNA FIG. 13E SEQ ID NO: 101 PDI-H1 Idaho AA FIG. 13F SEQ ID NO: 102 IF-H1_Cal-7-09.c Tab. 4 SEQ ID NO: 103 IF-H1cTMCT.s1-4r Tab. 4 SEQ ID NO: 104 PDI-H1 Idaho-Y91F DNA FIG. 13G SEQ ID NO: 105 PDI-H1 Idaho-Y91F AA FIG. 13H SEQ ID NO: 106 H1_Idaho(Y91F).c Tab. 4 SEQ ID NO: 107 H1_Idaho(Y91F).r Tab. 4 SEQ ID NO: 108 A/Egypt/NO4915/14 (H5N1) FIG. 1A SEQ ID NO: 109 A/Hangzhou/1/13 (H7N9) FIG. 1A SEQ ID NO: 110 transmembrane domain consensus sequence — SEQ ID NO: 111 PDI-H3 Kan-S136D DNA FIG. 14U SEQ ID NO: 112 PDI-H3 Kan-S136D AA FIG. 14V SEQ ID NO: 113 PDI-H3 Kan-S136N DNA FIG. 14W SEQ ID NO: 114 PDI-H3 Kan-S136N AA FIG. 14X SEQ ID NO: 115 PDI-H3 Kan-D190K DNA FIG. 14Y SEQ ID NO: 116 PDI-H3 Kan-D190K AA FIG. 14Z SEQ ID NO: 117 PDI-H3 Kan-R222W DNA FIG. 14AA SEQ ID NO: 118 PDI-H3 Kan-R222W AA FIG. 14AB SEQ ID NO: 119 PDI-H3 Kan-S228N DNA FIG. 14AC SEQ ID NO: 120 PDI-H3 Kan-S228N AA FIG. 14AD SEQ ID NO: 121 PDI-H3 Kan-S228Q DNA FIG. 14AE SEQ ID NO: 122 PDI-H3 Kan-S228Q AA FIG. 14AF SEQ ID NO: 123 PDI-B Sing DNA FIG. 16O SEQ ID NO: 124 PDI-B Sing AA FIG. 16P SEQ ID NO: 125 PDI-B Sing-G138A DNA FIG. 16Q SEQ ID NO: 126 PDI-B Sing-G138A AA FIG. 16R SEQ ID NO: 127 PDI-B Sing-S140A DNA FIG. 16S SEQ ID NO: 128 PDI-B Sing-S140A AA FIG. 16T SEQ ID NO: 129 PDI-B Sing-S142A DNA FIG. 16U SEQ ID NO: 130 PDI-B Sing-S142A AA FIG. 16V SEQ ID NO: 131 PDI-B Sing-D195G DNA FIG. 16W SEQ ID NO: 132 PDI-B Sing-D195G AA FIG. 16X SEQ ID NO: 133 PDI-B Sing-L203A DNA FIG. 16Y SEQ ID NO: 134 PDI-B Sing-L203A AA FIG. 16Z SEQ ID NO: 135 PDI-B Sing-L203W DNA FIG. 16AA SEQ ID NO: 136 PDI-B Sing-L203W AA FIG. 16AB SEQ ID NO: 137 PDI-B Mary DNA FIG. 16AC SEQ ID NO: 138 PDI-B Mary AA FIG. 16AD SEQ ID NO: 139 IF-B-Bris(nat).c FIG. 16AE SEQ ID NO: 140 PDI-B Mary-G138A DNA FIG. 16AF SEQ ID NO: 141 PDI-B Mary-G138A AA FIG. 16AG SEQ ID NO: 142 PDI-B Mary-S140A DNA FIG. 16AH SEQ ID NO: 143 PDI-B Mary-S140A AA FIG. 16AI SEQ ID NO: 144 PDI-B Mary-S142A DNA FIG. 16AJ SEQ ID NO: 145 PDI-B Mary-S142A AA FIG. 16AK SEQ ID NO: 146 PDI-B Mary-D194G DNA FIG. 16AL SEQ ID NO: 147 PDI-B Mary-D194G AA FIG. 16AM SEQ ID NO: 148 PDI-B Mary-L202A DNA FIG. 16AN SEQ ID NO: 149 PDI-B Mary-L202A AA FIG. 16AO SEQ ID NO: 150 PDI-B Mary-L202W DNA FIG. 16AP SEQ ID NO: 151 PDI-B Mary-L202W AA FIG. 16AQ SEQ ID NO: 152 PDI-B Wash DNA FIG. 16AR SEQ ID NO: 153 PDI-B Wash AA FIG. 16AS SEQ ID NO: 154 PDI-B Wash-G138A DNA FIG. 16AT SEQ ID NO: 155 PDI-B Wash-G138A AA FIG. 16AU SEQ ID NO: 156 PDI-B Wash-S140A DNA FIG. 16AV SEQ ID NO: 157 PDI-B Wash-S140A AA FIG. 16AW SEQ ID NO: 158 PDI-B Wash-S142A DNA FIG. 16AX SEQ ID NO: 159 PDI-B Wash-S142A AA FIG. 16AY SEQ ID NO: 160 PDI-B Wash-D193G DNA FIG. 16AZ SEQ ID NO: 161 PDI-B Wash-D193G AA FIG. 16BA SEQ ID NO: 162 PDI-B Wash-L201A DNA FIG. 16BB SEQ ID NO: 163 PDI-B Wash-L201A AA FIG. 16BC SEQ ID NO: 164 PDI-B Wash-L201W DNA FIG. 16BD SEQ ID NO: 165 PDI-B Wash-L201W AA FIG. 16BE SEQ ID NO: 180 PDI-B Vic DNA FIG. 16BF SEQ ID NO: 181 PDI-B Vic AA FIG. 16BG SEQ ID NO: 182 PDI-B Vic-G138A DNA FIG. 16BH SEQ ID NO: 183 PDI-B Vic-G138A AA FIG. 16BI SEQ ID NO: 184 PDI-B Vic-S140A DNA FIG. 16BJ SEQ ID NO: 185 PDI-B Vic-S140A AA FIG. 16BK SEQ ID NO: 186 PDI-B Vic-S142A DNA FIG. 16BL SEQ ID NO: 187 PDI-B Vic-S142A AA FIG. 16BM SEQ ID NO: 188 PDI-B Vic-D193G DNA FIG. 16BN SEQ ID NO: 189 PDI-B Vic-D193G AA FIG. 16BO SEQ ID NO: 190 PDI-B Vic-L201A DNA FIG. 16BP SEQ ID NO: 191 PDI-B Vic-L201A AA FIG. 16BQ SEQ ID NO: 192 PDI-B Vic-L201W DNA FIG. 16BR SEQ ID NO: 193 PDI-B Vic-L201W AA FIG. 16BS SEQ ID NO: 194 PDI-H1 Bris DNA FIG. 13I SEQ ID NO: 195 PDI-H1 Bris AA FIG. 13J SEQ ID NO: 196 PDI-H1 Bris-Y98F DNA FIG. 13K SEQ ID NO: 197 PDI-H1 Bris-Y98F AA FIG. 13L SEQ ID NO: 198 PDI-H5 Indo DNA FIG. 15E SEQ ID NO: 199 PDI-H5 Indo AA FIG. 15F SEQ ID NO: 200 IF-H5ITMCT.s1-4r FIG. 15G SEQ ID NO: 201 PDI-H5 Indo-Y91F DNA FIG. 15H SEQ ID NO: 202 PDI-H5 Indo-Y91F AA FIG. 15I SEQ ID NO: 203 Reference sequence H1 (H1 A/California/07/2009) FIG. 16BT SEQ ID NO: 204 Reference sequence H3 (H3 A/Kansas/14/2017) FIG. 16BU SEQ ID NO: 205 Reference sequence H5 (A/Indonesia/05/2005) FIG. 16BV SEQ ID NO: 206 Reference sequence H7 (H7 A/Shanghai/2/2013) FIG. 16BW SEQ ID NO: 207 Reference sequence B (B/Phuket/3073/2013) FIG. 16BX SEQ ID NO: 208 Reference sequence B (B/Maryland/15/2016) FIG. 16BY SEQ ID NO: 209 Reference sequence B (B/Victoria/705/2018) FIG. 16BZ
[0222] The present invention will be further illustrated in the following examples.
Example 1: Constructs
[0223] The influenza HA constructs were produced using techniques well known within the art. For example H1 A-California-07-09 HA, H1 A-California-7-09 (Y91F) HA, H3 A-Kansas-14-2017 HA, B-Phuket-3073-2013 HA and B-Phuket-3073-2013(S140A) HA were cloned as described below. Other modified HA were obtained using similar techniques and the HA sequences primers, templates and products are described below. A summary of the wildtype and mutated HA proteins, primers, templates, accepting vectors and products is provided in Tables 4 and 5 below.
Example 1.1: 2X35S/CPMV 160/PDISP-HA0 H1 A-California-7-09/NOS (Construct Number 1314)
[0224] A sequence encoding mature HA0 from influenza HA from A/California/7/09 fused to alfalfa PDI secretion signal peptide (PDISP) was cloned into 2X35S/CPMV 160/NOS expression system using the following PCR-based method. A fragment containing the PDISP-A/California/7/09 coding sequence was amplified using primers IF-CPMV(fl5′UTR)_SpPDI.c (SEQ ID NO:3) and IF-H1cTMCT.S1-4r (SEQ ID NO:4), using PDISP-H1 A/California/7/09 nucleotide sequence (SEQ ID NO:1) as template. The PCR product was cloned in 2X35S/CPMV 160/NOS expression system using In-Fusion cloning system (Clontech, Mountain View, Calif.). Construct number 1190 (
Example 1.2: 2X35S/CPMV 160/PDISP-HA0 H1 A-California-7-09 (Y91F)/NOS (Construct Number 6100)
[0225] A sequence encoding mature HA0 from influenza HA from A/California/7/09 (Y91F) fused to alfalfa PDI secretion signal peptide (PDISP) was cloned into 2X35S/CPMV 160/NOS expression system using the following PCR-based method. In a first round of PCR, a fragment containing the PDISP-H1 A/California/7/09 with the mutated Y91F amino acid was amplified using primers IF-CPMV(fl5′UTR)_SpPDI.c (SEQ ID NO:3) and H1_Cal(Y91F).r (SEQ ID NO:7), using PDISP-H1 A/California/7/09 gene sequence (SEQ ID NO: 1) as template. A second fragment containing the Y91F mutation with the remaining of the H1 A/California/7/09 was amplified using H1_Cal(Y91F).c (SEQ ID NO:8) and IF-H1cTMCT.S1-4r (SEQ ID NO:4), using PDISP-H1 A/California/07/09 nucleotide sequence (SEQ ID NO:1) as template. The PCR products from both amplifications were then mixed and used as template for a second round of amplification using IF-CPMV(fl5′UTR)_SpPDI.c (SEQ ID NO:3) and IF-H1cTMCT.S1-4r (SEQ ID NO:4) as primers. The final PCR product was cloned in 2X35S/CPMV 160/NOS expression system using In-Fusion cloning system (Clontech, Mountain View, Calif.). Construct number 3637 (
Example 1.3: 2X35S/CPMV 160/PDISP-HA0 H3 A-Kansas-14-2017/NOS (Construct Number 7281)
[0226] A sequence encoding mature HA0 from influenza HA from H3 A/Kansas/14/2017 (N382A+L384V, Cys™) fused to alfalfa PDI secretion signal peptide (PDISP) was cloned into 2X35S/CPMV 160/NOS expression system using the following PCR-based method. A fragment containing the H3 A-Kansas-14-2017 with the mutated amino acids N382A and L384V was amplified using primers IF-H3NewJer.c (SEQ ID NO: 62) and IF-H3_Swi_13.r (SEQ ID NO: 63), using PDISP-H3 A/Kansas/14/2017 (N382A+L384V, Cys™) gene sequence (SEQ ID NO: 60) as template. The final PCR product was cloned in 2X35S/CPMV 160/NOS expression system using In-Fusion cloning system (Clontech, Mountain View, Calif.). Construct number 4499 (
Example 1.4: 2X35S/CPMV 160/PDISP-HA0 H3 A-Kansas-14-2017/NOS (Construct Number 8179)
[0227] A sequence encoding mature HA0 from influenza HA from H3 A/Kansas/14/2017 (Y98F+N382A+L384V, Cys™) fused to alfalfa PDI secretion signal peptide (PDISP) was cloned into 2X35S/CPMV 160/NOS expression system using the following PCR-based method. In a first round of PCR, a fragment containing the H3 A-Kansas-14-2017 with the mutated amino acid Y98F was amplified using primers IF-H3NewJer.c (SEQ ID NO: 62) and H3_Kansas(Y98F).r (SEQ ID NO: 67), using PDISP-H3 A/Kansas/14/2017 (N382A+L384V, Cys™) gene sequence (SEQ ID NO: 60) as template. A second fragment containing the remaining of the H3 A/Kansas/14/2017 (N382A+L384V, Cys™) was amplified using H3_Kansas(Y98F).c (SEQ ID NO: 66) and IF-H3_Swi_13.r (SEQ ID NO: 63), using PDISP-H3 A/Kansas/14/2017 (N382A+L384V, Cys™) gene sequence (SEQ ID NO: 60) as template. The PCR products from both amplifications were then mixed and used as template for a second round of amplification using IF-H3NewJer.c (SEQ ID NO: 62) and IF-H3_Swi_13.r (SEQ ID NO: 63) as primers. The final PCR product was cloned in 2X35S/CPMV 160/NOS expression system using In-Fusion cloning system (Clontech, Mountain View, Calif.). Construct number 4499 (
Example 1.5: 2X35S/CPMV 160/PDISP-HA0 B-Phuket-3073-2013 NOS (Construct Number 2835)
[0228] A sequence encoding mature HA0 from influenza HA from B/Phuket/3073/2013 with proteolytic loop removed was fused to the alfalfa PDI secretion signal peptide (PDISP) and cloned into 2X35S/CPMV 160/NOS expression system using the following PCR-based method. A fragment containing the B/Phuket/3073/2013(PrL-) coding sequence was amplified using primers IF.HBPhu3073.c (SEQ ID NO:29) and IF-H1cTMCT.S1-4r (SEQ ID NO:4), using PDISP-B/Phuket/3073/2013(PrL-) nucleotide sequence (SEQ ID NO:27) as template. The PCR product was cloned in 2X35S/CPMV 160/NOS expression system using In-Fusion cloning system (Clontech, Mountain View, Calif.). Construct number 2530 (
Example 1.6: 2X35S/CPMV 160/PDISP-HA0 B-Phuket-3073-2013(S140A)/NOS (Construct Number 8352)
[0229] A sequence encoding mature HA0 from influenza HA from B/Phuket/3073/2013 (PrL-, S140A) fused to alfalfa PDI secretion signal peptide (PDISP) was cloned into 2X35S/CPMV 160/NOS expression system using the following PCR-based method. In a first round of PCR, a fragment containing the PDISP-B/Phuket/3073/2013(PrL-) with the mutated S140A amino acid was amplified using primers IF.HBPhu3073.c (SEQ ID NO:29) and B Phuket(S140A).r (SEQ ID NO:31), using PDISP-B/Phuket/3073/2013(PrL-) gene sequence (SEQ ID NO:27) as template. A second fragment containing the S140A mutation with the remaining of the B/Phuket/3073/2013(PrL-) was amplified using B_Phuket(S140A).c (SEQ ID NO:30) and IF-H1cTMCT.S1-4r (SEQ ID NO:4), using PDISP-B/Phuket/3073/2013(PrL-) gene sequence (SEQ ID NO:27) as template. The PCR products from both amplifications were then mixed and used as template for a second round of amplification using IF.HBPhu3073.c (SEQ ID NO:29) and IF-H1cTMCT.S1-4r (SEQ ID NO:4) as primers. The final PCR product was cloned in 2X35S/CPMV 160/NOS expression system using In-Fusion cloning system (Clontech, Mountain View, Calif.). Construct number 4499 (
[0230] A summary of the wildtype and mutated HA proteins, primers, templates, accepting vectors and products is provided in Tables 4 and 5 below.
TABLE-US-00005 TABLE 4 Primers used to prepare constructs as disclosed herein SEQ ID NO: Identifier Sequence 3 IF-CPMV(fl5′UTR)_SpPDI.c TCGTGCTTCGGCACCAGTACAATGGCGAAAAACGTTGCGATTTTCGGCT 4 IF-H1cTMCT.S1-4r ACTAAAGAAAATAGGCCTTTAAATACATATTCTACACTGTAGAGAC 7 H1_Cal(Y91F).r AAATCTCCTGGGAAACACGTTCCATTGTCTGAACTAGGTGTTTCCACAA 8 H1_Cal(Y91F).c AGACAATGGAACGTGTTTCCCAGGAGATTTCATCGATTATGAGGAGCTA 15 IF-H5ITMCT.s1-4r ACTAAAGAAAATAGGCCTTTAAATGCAAATTCTGCATTGTAACGATCCAT 16 H5Indo(Y91F).c AACCAATGACCTCTGTTTCCCAGGGAGTTTCAACGACTATGAAGAACTGAA 17 H5Indo(Y91F).r GAAACTCCCTGGGAAACAGAGGTCATTGGTTGGATTGGCCTTCTCCACTATGTAAGA 22 IF-H7Shang.r ACTAAAGAAAATAGGCCTTTATATACAAATAGTGCACCGCATGTTTCCAT 23 H7Shang(Y88F).c AGGAAGTGATGTCTGTTTCCCTGGGAAATTCGTGAATGAAGAAGCTCTGA 24 H7Shang(Y88F).r ACGAATTTCCCAGGGAAACAGACATCACTTCCTTCTCGCCTCTCAATAAT 29 IF.HBPhu3073.c TCTCAGATCTTCGCGGATCGAATCTGCACTGGGATAACATCTTCAAACTCAC 30 B_Phuket(S140A).c GACCCTACAGACTTGGAACCGCCGGATCTTGCCCTAACGCTACCAGTAAAATCGGATTT 31 B_Phuket(S140A).r CGTTAGGGCAAGATCCGGCGGTTCCAAGTCTGTAGGGTCCTCCTGGTGCTTTTTCTG 34 B_Phuket(S142A).c TGGAACCTCAGGAGCCTGCCCTAACGCTACCAGTAAAATCGGATTTTTTGCAACAATG 35 B_Phuket(S142A).r TGGTAGCGTTAGGGCAGGCTCCTGAGGTTCCAAGTCTGTAGGGTCCTC 38 B_Phuket(G138A).c GACCCTACAGACTTGCCACCTCAGGATCTTGCCCTAACGCTACCAGTAA 39 B_Phuket(G138A).r GGCAAGATCCTGAGGTGGCAAGTCTGTAGGGTCCTCCTGGTGCTTTTTCTG 42 B_Phuket(L203A).c CCCAAATGAAGAGCGCCTATGGAGACTCAAATCCTCAAAAGTTCACCTC 43 B_Phuket(L203A).r GATTTGAGTCTCCATAGGCGCTCTTCATTTGGGTTTTGTTATCCGAAT 46 B_Phuket(D195G).c GGGGGTTCCATTCGGGCAACAAAACCCAAATGAAGAGCCTCTATGGAGA 47 B_Phuket(D195G).r TCATTTGGGTTTTGTTGCCCGAATGGAACCCCCAAACAGTAATTTGGT 50 B_Phuket(L203W).c CCCAAATGAAGAGCTGGTATGGAGACTCAAATCCTCAAAAGTTCACCTC 51 B_Phuket(L203W).r GATTTGAGTCTCCATACCAGCTCTTCATTTGGGTTTTGTTATCCGAAT 62 IF-H3NewJer.c TCTCAGATCTTCGCGCAAAAAATCCCTGGAAATGACAATAGCACGGCAACGCTGTGC 63 IF-H3_Swi_13.r ACTAAAGAAAATAGGCCTTCAAATGCAAATGTTGCACCTAATGTTGCCCTT 66 H3_Kansas(Y98F).c CCTACAGCAACTGTTTCCCTTATGATGTGCCGGATTATGCCTCCCTTA 67 H3_Kansas(Y98F).r CCGGCACATCATAAGGGAAACAGTTGCTGTAGGCTTTGTTTCGTTCAACA 70 H3Kansas(S136D).c AAACGGAACAGACTCTTCTTGCATAAGGGGATCTAAGAGTAGTTTCTT 71 H3Kansas(S136D).r CAAGAAGAGTCTGTTCCGTTTTGAGTGACTCCAGCCCAATTGAAGCTTTC 74 H3Kansas(S136N).c AAACGGAACAAACTCTTCTTGCATAAGGGGATCTAAGAGTAGTTTCTT 75 H3Kansas(S136N).r CAAGAAGAGTTTGTTCCGTTTTGAGTGACTCCAGCCCAATTGAAGCTTTC 78 H3Kansas(S137N).c CGGAACAAGTAACTCTTGCATAAGGGGATCTAAGAGTAGTTTCTTTAGTAG 79 H3Kansas(S137N).r ATGCAAGAGTTACTTGTTCCGTTTTGAGTGACTCCAGCCCAATTGAAGCTTTCAT 82 H3Kansas(D190G).c TACGGACAAGGGCCAAATCAGCCTGTATGCACAATCATCAGGAAGAATC 83 H3Kansas(D190G).r CTGATTTGGCCCTTGTCCGTACCCGGGTGGTGAACCCCCCAAATGTAC 86 H3Kansas(D190K).c TACGGACAAGAAGCAAATCAGCCTGTATGCACAATCATCAGGAAGAATC 87 H3Kansas(D190K).r CTGATTTGCTTCTTGTCCGTACCCGGGTGGTGAACCCCCCAAATGTAC 90 H3Kansas(R222W).c ATCTAGACCCTGGATAAGGGATATCCCTAGCAGAATAAGCATCTATTGGA 91 H3Kansas(R222W).r TCCCTTATCCAGGGTCTAGATCCGATATTCGGGATTACAGCTTGTTGGC 94 H3Kansas(S228N).c GGATATCCCTAACAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGA 95 H3Kansas(S228N).r CTTATTCTGTTAGGGATATCCCTTATTCTGGGTCTAGATCCGATATTCGGG 98 H3Kansas(S228Q).c GGATATCCCTCAGAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATA 99 H3Kansas(S228Q).r CTTATTCTCTGAGGGATATCCCTTATTCTGGGTCTAGATCCGATATTCGGG 102 IF-H1_Cal-7-09.c TCTCAGATCTTCGCGGACACATTATGTATAGGTTATCATGCGAACAAT 103 IF-H1cTMCT.s1-4r ACTAAAGAAAATAGGCCTTTAAATACATATTCTACACTGTAGAGAC 106 H1_Idaho(Y91F).c ACAATGGAACGTGTTTCCCAGGAGATTTCATCAATTATGAGGAGCTAA 107 H1_Idaho(Y91F).r TGATGAAATCTCCTGGGAAACACGTTCCATTGTCTGAATTAGATGTTT 139 IF-B-Bris(nat).c tctcagatcttcgcggatcgaatctgcactgggataacatcgtcaaactc 200 IF-H5ITMCT.s1-4r actaaagaaaataggcctttaaatgcaaattctgcattgtaacgatccat
TABLE-US-00006 TABLE 5 Primers, templates, acceptor plasmids used to prepare constructs as disclosed herein P1* P2** P3*** P4**** PCR1# NA## Protein~ Nucleic acid of interest Const. # SEQ ID NO: Acceptor plasmid H1 A/California/7/2009 1314 3 4 — — 1 1 2 1190 (SacII-StuI) H1 A/California/7/2009 (Y91F) 6100 3 7 8 4 1 11 12 3637 (SacII-StuI) H5 A/Indonesia/5/2005 2295 3 15 — — 13 13 14 1190 (SacII-StuI) H1 A/Idaho/07/2018 4795 3 103 — — 100 100 101 3637 (SacII-StuI) H1 A/Idaho/07/2018 (Y91F) 8177 3 107 106 103 100 104 105 3637 (SacII-StuI) H3 A/Kansas/14/2017 7281 62 63 — — 60 60 61 4499 (AatII-StuI) (N382A + L384V) H3 A/Kansas/14/2017 8179 62 67 66 63 60 64 65 4499 (AatII-StuI) (Y98F + N382A + L384V) H3 A/Kansas/14/2017 8384 62 70 71 63 64 68 69 4499 (AatII-StuI) (Y98F + S136D + N382A + L384V) H3 A/Kansas/14/2017 8385 62 75 74 63 64 72 73 4499 (AatII-StuI) (Y98F + S136N + N382A + L384V) H3 A/Kansas/14/2017 8387 62 79 78 63 64 76 77 4499 (AatII-StuI) (Y98F + S137N + N382A + L384V) H3 A/Kansas/14/2017 8388 62 83 82 63 64 80 81 4499 (AatII-StuI) (Y98F + D190G + N382A + L384V) H3 A/Kansas/14/2017 8389 62 87 86 63 64 84 85 4499 (AatII-StuI) (Y98F + D190K + N382A + L384V) H3 A/Kansas/14/2017 8391 62 91 90 63 64 88 89 4499 (AatII-StuI) (Y98F + R222W + N382A + L384V) H3 A/Kansas/14/2017 8392 62 95 94 63 64 92 93 4499 (AatII-StuI) (Y98F + S228N + N382A + L384V) H3 A/Kansas/14/2017 8393 62 99 98 63 64 96 97 4499 (AatII-StuI) (Y98F + S228Q + N382A + L384V) H5 A/Indonesia/5/2005 (Y91F) 6101 3 17 16 15 13 18 19 3637 (SacII-StuI) H7 A/Shanghai/2/2013 6102 3 22 — — 20 20 21 3637 (SacII-StuI) H7 A/Shanghai/2/2013 (Y88F) 6103 3 24 23 22 20 25 26 3637 (SacII-StuI) B/Phuket/3073/2013 2835 29 4 — — 27 27 28 2530 (AatII) B/Phuket/3073/2013 (S140A, PrL−) 8352 29 31 30 4 27 32 33 4499 (AatII-StuI) B/Phuket/3073/2013 (S142A, PrL−) 8354 29 35 34 4 27 36 37 4499 (AatII-StuI) B/Phuket/3073/2013 (G138A, PrL−) 8358 29 39 38 4 27 40 41 4499 (AatII-StuI) B/Phuket/3073/2013 (L203A, PrL−) 8363 29 43 42 4 27 44 45 4499 (AatII-StuI) B/Phuket/3073/2013 (D195G, PrL−) 8376 29 47 46 4 27 48 49 4499 (AatII-StuI) B/Phuket/3073/2013 (L203W, PrL−) 8382 29 51 50 4 27 52 53 4499 (AatII-StuI) H3 A/Kansas/14/2017 (S136D) 8477 62 71 70 63 60 111 112 4499 (AatII-StuI) H3 A/Kansas/14/2017 (S136N) 8478 62 75 74 63 60 113 114 4499 (AatII-StuI) H3 A/Kansas/14/2017 (D190K) 8481 62 87 86 63 60 115 116 4499 (AatII-StuI) H3 A/Kansas/14/2017 (R222W) 8482 62 91 90 63 60 117 118 4499 (AatII-StuI) H3 A/Kansas/14/2017 (S228N) 8483 62 95 94 63 60 119 120 4499 (AatII-StuI) H3 A/Kansas/14/2017 (S228Q) 8484 62 99 98 63 60 121 122 4499 (AatII-StuI) B/Singapore/INFKK-16-0569/2016 2879 29 103 — — 123 123 124 4499 (AatII-StuI) B/Singapore/INFKK-16-0569/2016 8485 29 103 — — 125 125 126 4499 (AatII-StuI) (G138A) B/Singapore/INFKK-16-0569/2016 8486 29 103 — — 127 127 128 4499 (AatII-StuI) (S140A) B/Singapore/INFKK-16-0569/2016 8487 29 103 — — 129 129 130 4499 (AatII-StuI) (S142A) B/Singapore/INFKK-16-0569/2016 8488 29 103 — — 131 131 132 4499 (AatII-StuI) (D195G) B/Singapore/INFKK-16-0569/2016 8489 29 103 — — 133 133 134 4499 (AatII-StuI) (L203A) B/Singapore/INFKK-16-0569/2016 8490 29 103 — — 135 135 136 4499 (AatII-StuI) (L203W) B/Maryland/15/2016 6791 139 103 — — 137 137 138 4499 (AatII-StuI) B/Maryland/15/2016 (G138A) 8434 139 103 — — 140 140 141 4499 (AatII-StuI) B/Maryland/15/2016 (S140A) 8435 139 103 — — 142 142 143 4499 (AatII-StuI) B/Maryland/15/2016 (S142A) 8436 139 103 — — 144 144 145 4499 (AatII-StuI) B/Maryland/15/2016 (D194G) 8437 139 103 — — 146 146 147 4499 (AatII-StuI) B/Maryland/15/2016 (L202A) 8438 139 103 — — 148 148 149 4499 (AatII-StuI) B/Maryland/15/2016 (L202W) 8439 139 103 — — 150 150 151 4499 (AatII-StuI) B/Washington/02/2019 7679 139 103 — — 152 152 153 4499 (AatII-StuI) B/Washington/02/2019 (G138A) 8440 139 103 — — 154 154 155 4499 (AatII-StuI) B/Washington/02/2019 (S140A) 8441 139 103 — — 156 156 157 4499 (AatII-StuI) B/Washington/02/2019 (S142A) 8442 139 103 — — 158 158 159 4499 (AatII-StuI) B/Washington/02/2019 (D193G) 8443 139 103 — — 160 160 161 4499 (AatII-StuI) B/Washington/02/2019 (L201A) 8444 139 103 — — 162 162 163 4499 (AatII-StuI) B/Washington/02/2019 (L201W) 8445 139 103 — — 164 164 165 4499 (AatII-StuI) B/Darwin/20/2019 8333 139 103 — — 166 166 167 4499 (AatII-StuI) B/Darwin/20/2019 (G138A) 8458 139 103 — — 168 168 169 4499 (AatII-StuI) B/Darwin/20/2019 (S140A) 8459 139 103 — — 170 170 171 4499 (AatII-StuI) B/Darwin/20/2019 (S142A) 8460 139 103 — — 172 172 173 4499 (AatII-StuI) B/Darwin/20/2019 (D193G) 8461 139 103 — — 174 174 175 4499 (AatII-StuI) B/Darwin/20/2019 (L201A) 8462 139 103 — — 176 176 177 4499 (AatII-StuI) B/Darwin/20/2019 (L201W) 8463 139 103 — — 178 178 179 4499 (AatII-StuI) B/Victoria/705/2018 8150 139 103 — — 180 180 181 4499 (AatII-StuI) B/Victoria/705/2018 (G138A) 8446 139 103 — — 182 182 183 4499 (AatII-StuI) B/Victoria/705/2018 (S140A) 8447 139 103 — — 184 184 185 4499 (AatII-StuI) B/Victoria/705/2018 (S142A) 8448 139 103 — — 186 186 187 4499 (AatII-StuI) B/Victoria/705/2018 (D193G) 8449 139 103 — — 188 188 189 4499 (AatII-StuI) B/Victoria/705/2018 (L201A) 8450 139 103 — — 190 190 191 4499 (AatII-StuI) B/Victoria/705/2018 (L201W) 8451 139 103 — — 192 192 193 4499 (AatII-StuI) H1 A/Brisbane/02/2018 6722 3 103 — — 194 194 195 3637 (SacII-StuI) H1 A/Brisbane/02/2018 (Y91F) 8433 3 103 — — 196 196 197 3637 (SacII-StuI) H5 A/Indonesia/5/05 2295 3 200 — — 198 198 199 1190 (SacII-StuI) H5 A/Indonesia/5/05 (Y91F) 6101 3 200 — — 201 201 202 3637 (SacII-StuI) *Primer 1 (forward primer of fragment 1), **Primer 2 (reverse primer of fragment 1), ***Primer 3 (forward primer of fragment 2 if needed), ****Primer 4 (reverse primer of fragment 2 if needed) #Templates for first PCR ##Resulting nucleic acid ~Resulting protein
Example 2: Plant-Derived VLPs Comprising Parent HA and Modified HA
[0231] Virus-like particles bearing parent or modified HA were produced and purified as previously described (WO2020/000099, which is incorporated herein by reference). Briefly, N. benthamiana plants (41-44 days old) were vacuum infiltrated in batches with an Agrobacterium inoculum carrying either parent HA or modified HA expression cassettes. Six days after infiltration, the aerial parts of the plants were harvested and stored at −80° C. until purification. Frozen plant leaves were homogenized in one volume of buffer [50 mM Tris, 150 mM NaCl: 0.04% (w/v) Na.sub.2S.sub.2O.sub.5, pH 8.0]/kg biomass. The homogenate was pressed through a 400 μm nylon filter and the fluid was retained. Filtrates were clarified by centrifugation 5000×g and filtration (1.2 μm glass fiber, 3M Zeta Plus, 0.45-0.42m filter) and then concentrated by centrifugation (75000×g, 20 min). VLPs were further concentrated and purified by ultracentrifugation over an iodixanol density gradient (120000×g, 2h). VLP-rich fractions were pooled and dialyzed against 50 mM NaPO.sub.4, 65 mM NaCl, 0.01% Tween 80 (pH 6.0). This clarified extract was captured on a Poros HS column (Thermo Scientific) equilibrated in 50 mM NaPO.sub.4, 1M NaCl, 0.005% Tween 80. After washing with 25 mM Tris, 0.005% Tween 80 (pH 8.0), the VLPs were eluted with 50 mM NaPO.sub.4, 700 mM NaCl, 0.005% Tween 80 (pH 6.0). Purified VLPs were dialyzed against formulation buffer (100 mM NaKPO.sub.4, 150 mM NaCl, 0.01% Tween 80 (pH 7.4)) and passed through a 0.22 μm filter for sterilization.
[0232] The composition of the VLP preparations was determined by gel electrophoresis followed by Coomassie staining and western blotting. Both VLP preparations are primarily composed of the uncleaved form of HA (HA0). Purity was determined by densitometry analysis of stained gels and was used to calculate the total HA content [total protein (BCA) x % purity]. The purity of preparations was approx. 95%.
[0233] VLPs comprising non-modified or modified HA were visualized for particle formation and morphology by electron microscopy. Exemplary electron micrograph images for VLPs comprising either non-modified or modified HA from H1/Brisbane, H3/Kansas, B/Phuket
[0234] and B/Maryland are shown in
H1 HA
[0235] The yield of VLP comprising modified HAs produced in a plant was similar or greater than the yield of the corresponding parent or non-modified HA for VLPs comprising modified H1 A/Idaho/07/2018 (H1 Idaho Y91F;
[0236] Yield and hemagglutination activity were further assessed in VLPs comprising H1 A/Brisbane/02/2018 or H1 A/Brisbane/02/2018 Y91F (
H3 HA
[0237] The yield of VLP comprising modified HAs produced in a plant was similar or greater than the yield of the corresponding parent or non-modified HA for VLPs comprising modified comprising a series of modified H3 Kansas/14/2017 HAs (H3 Kansas Y98F; H3 Kansas Y98F, S136D; H3 Kansas Y98F, S136N; H3 Kansas Y98F, S137N; H3 Kansas Y98F, D190G; H3 Kansas Y98F, D190K, H3 Kansas Y98F, R222W; H3 Kansas Y98F, S228N; H3 Kansas Y98F, S228Q;
[0238] Yield and hemagglutination activity were further assessed in a series of VLPs comprising modified H3 Kansas/14/2017 with single non-binding candidate mutations S136D, S136N, D190K, R222W, S228N, and S228Q (
B HA
[0239] The yield of VLP comprising modified HAs produced in a plant was similar or greater than the yield of the corresponding parent or non-modified HA for VLPs comprising modified B Phuket/3073/2013 HAs (B Phu S140A; B Phu S142A; B Phu G138A; B Phu L203A; B Phu D195G; B Phu L203W;
[0240] Yield and hemagglutination activity were further assessed in a series of VLPs comprising non-modified or modified single mutation HA B Singapore-INFKK-16-0569-2016 (G138A, S140A, S142A, D195G, L203A, or L203W;
H5 HA
[0241] Hemagglutination activity was assessed for VLPs comprising either H5 A/Indonesia/5/05 or modified Y91F H5 A/Indonesia/5/05. The VLPs comprising modified Y91F H5 A/Indonesia/5/05 exhibited a significant reduction in hemagglutination activity (expressed as HA titer) as shown in
H7 HA
[0242] Hemagglutination activity was assessed for VLPs comprising either H7 A/Shanghai/2/2013 or modified Y88F H7 A/Shanghai/2/2013. The VLP comprising modified Y88F H7 A/Shanghai/2/2013 exhibited a significant reduction in hemagglutination activity (expressed as HA titer) as shown in
Example 3: Materials & Methods
Example 3.1: Human subjects and PBMC Isolation
[0243] Healthy adults aged 18-64 were recruited by the McGill Vaccine Study Centre and participants provided written consent prior to blood collection. This protocol was approved by the Research Ethics Board of the McGill University Health Centre.
[0244] Human PBMC were isolated from peripheral blood by differential-density gradient centrifugation within one hour of blood collection. Briefly, blood was diluted 1:1 in phosphate-buffered saline (PBS) (Wisent) at room temperature prior to layering over Lymphocyte Separation Medium (Ficoll) (Wisent). PBMC were collected from the Ficoll-PBS interface following centrifugation (650×g, 45 min, 22° C.) and washed 3 times in PBS (320×g, 10 min, 22° C.). Cells were resuspended in RPMI-1640 complete medium (Wisent) supplemented with 10% heat inactivated fetal bovine serum (Wisent), 10 mM HEPES (Wisent), and 1 mM penicillin/streptomycin (Wisent).
Example 3.2. Hemagglutination Assay
[0245] Hemagglutination assay was based on a method described by Nayak and Reichl (2004, J. Viorl. Methods 122:9-15). Briefly, serial two-fold dilutions of the test samples (100 μL) were made in V-bottomed 96-well microtiter plates containing 100 μL PBS, leaving 100 μL of diluted sample per well. One hundred microliters of a 0.25% turkey (for H1) red blood cells suspension (Bio Link Inc., Syracuse, N.Y., or Lampire Biological Laboratories) were added to each well, and plates were incubated for 2-20h at room temperature. The reciprocal of the highest dilution showing complete hemagglutination was recorded as HA activity. In parallel, a recombinant HA standard was diluted in PBS and run as a control on each plate. Hemagglutination was indicated by the absence of a cell pellet after this period.
[0246] Where indicated, 1×10.sup.6 human PBMC were incubated for 30 min with 1-5 μg parent HA VLP (e.g. H1 HA) or modified HA VLP (e.g. Y91F H1 HA) and cell clustering was evaluated by light microscopy.
Example 3.3: Surface Plasmon Resonance (SPR) Analysis
[0247] SPR is a label-free technology used to detect biomolecular interactions based on a collective electron oscillation happening at a metal/dielectric interface. Changes on the refractive index are measured on the surface of a sensor chip (mass change) which can deliver kinetics, equilibrium and concentration data. The SPR-based potency assay is an antibody independent receptor-binding SPR-based assay. The assay uses the Biacore™ T200 and 8K SPR instruments from GE Healthcare Life Sciences and quantifies the total amount of functionally active trimeric or oligomeric HA protein in the vaccine samples through binding to a biotinylated synthetic α-2,3 (avian) and α-2,6 (human) sialic acid glycan immobilized to a Streptavidin Sensor Chip as described in Khurana et. al. (Khurana S., et. al., 2014, Vaccine 32:2188-2197).
Example 3.4: Mice and Vaccination
[0248] Female Balb/c mice were immunized by injection into the gastrocnemius muscle with 0.5-3 μg parent HA-VLP or modified HA VLP (50 μL total in PBS). Mice were vaccinated on day 0 and boosted on day 21 (when indicated). Blood was collected from the left lateral saphenous vein before vaccination and at D21 post-vaccination. Sera were obtained by centrifugation of blood in microtainer serum separator tubes (Beckton Dickinson) (8000×g, 10 min) and stored at −20° C. until further analysis.
[0249] To evaluate humoral and cell-mediated immune responses mice were euthanized on day 28 (one-dose) or day 49 (28d post-boost) by CO.sub.2 asphyxiation. Blood was collected by cardiac puncture and cleared serum samples were obtained as described above. Spleens and bilateral femurs were harvested and splenocytes and bone marrow immune cells were isolated (Yam, K. K., et al., Front Immunol, 2015. 6: p. 207; Yam, K. K., et al., Hum Vaccin Immunother, 2017. 13(3): p. 561-571).
[0250] To evaluate vaccine efficacy, mice were challenged with 1.58×10.sup.3 times the median tissue culture infectious dose (TCID.sub.50) of H1N1 A/California/07/09 (National Microbiology Laboratory, Public Health Agency of Canada). Mice were anesthetized using isoflurane and infected by intranasal instillation (25 μL/nare). Mice were monitored for weight loss for 12 days post-infection and were euthanized if they lost 20% of their pre-infection weight. On days 3 and 5 post-infection a subset of mice was sacrificed, and lungs were harvested for evaluation of viral load and inflammation. Lung homogenates were prepared as previously described (Hodgins, B., et al., Clin Vaccine Immunol, 2017. 24(12)) and stored at −80° C. until further analysis.
Example 3.5: Antibody Titer Measurement
[0251] Neutralizing antibodies were evaluated by hemagglutination inhibition (HAI) assay (Zacour, M., et al., Clin Vaccine Immunol, 2016. 23(3): p. 236-42; WHO Global Influenza Surveillance Network. 2011. World Health Organization. ISBN 978 9241548090:43-62) and microneutralization (MN) assay (Yam, K. K., et al., Clin Vaccine Immunol, 2013. 20(4): p. 459-67). Titers are reported as the reciprocal of the highest dilution to inhibit hemagglutination (HAI) or cytopathic effects (MN). Samples below the limit of detection (<10) were assigned a value of 5 for statistical analysis.
[0252] HA-specific IgG was quantified by enzyme-linked immunosorbent assay (ELISA) as previously described (Hodgins, B., et al., Clin Vaccine Immunol, 2017. 24(12)) with the following modifications: plates were coated with 2 μg/mL recombinant HA (Immune Technologies) or HA-VLP (Medicago Inc.) and HA-specific IgG was detected using horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Southern Biotech) diluted 1:20000 in blocking buffer. To evaluate the avidity of HA-specific IgG, wells containing bound antibody were incubated with urea (0M-8M) for 15 min and re-blocked for 1 h prior to detection. Avidity index (AI)=[IgG titer 2-8M urea/IgG titer 0M urea].
Example 3.6: Antibody Secreting Cells (ASC)
[0253] HA-specific IgG ASC were quantified by ELISpot (Mouse IgG ELISpot.sup.BASIC, Mabtech). Sterile PVDF membrane plates (Millipore) were coated with Anti-IgG capture antibody and blocked according to the manufacturer's guidelines. To quantify in vivo activated ASCs, wells were seeded with 250,000 (bone marrow) or 500,000 (splenocyte) freshly-isolated cells and incubated at 37° C., 5% CO.sub.2 for 16-24h. HA-specific ASCs were detected according to the manufacturer's guidelines using 1 μg/mL biotinylated HA (immune tech, biotinylated using Sulfo-NHS-LC-Biotin). To evaluate memory ASCs, freshly isolated cells were polyclonally activated with 0.5 μg/mL R848 and 2.5 ng/mL recombinant mouse IL-2 (1.5×10.sup.6 cells/mL in 24-well plates) for 72h (37° C., 5% CO.sub.2). Activated cells were re-counted and the assay was carried out as described above.
Example 3.7: Splenocyte Proliferation
[0254] Splenocyte proliferation was measured by chemiluminescent bromodeoxyuridine (BrdU) incorporation ELISA (Sigma). Freshly isolated splenocytes were seeded in 96-well flat-bottom black plates (2.5×10.sup.5 cells/well). Cells were stimulated for 72h (37° C., 5% CO.sub.2) with parent H1-VLP or peptide pools (BEI Resources) consisting of 15mer peptides overlapping by 11 amino acids spanning the complete HA sequences of parent H1/California/07/2009 (2.5 μg/mL). BrdU labelling reagent (10 μM) was added for the last 20h of incubation. BrdU was detected as described by the manufacturers. Proliferation is represented as a stimulation index compared to unstimulated samples.
Example 3.8: Intracellular Cytokine Staining and Flow Cytometry
[0255] Freshly isolated splenocytes or bone marrow immune cells (1×10.sup.6/200 μL in a 96-well U-bottom plate) were stimulated with parent H1-VLP (2.5 μg/mL) or left unstimulated for 18h (37° C., 5% CO.sub.2). After 12h, Golgi Stop and Golgi Plug (BD Biosciences) were added according to the manufacturer's instructions. Cells were washed 2× with PBS (320×g, 8 min, 4° C.) and labeled with Fixable Viability Dye eFluor 780 (eBioscience) (20 min, 4° C.). Cells were washed 3× followed by incubation with Fc Block (BD Biosciences) for 15 min at 4° C. Samples were incubated for an additional 30 min upon addition of the surface cocktail containing the following antibodies: anti-CD3 FITC (145-2C11, eBioscience), anti-CD4 V500 (RM4-5, BD Biosciences) anti-CD8 PerCP-Cy5.5 (53-6.7, BD Biosciences), anti-CD44 BUV395 (IM7, BD Biosciences) and anti-CD62L BUV373 (MEL-14, BD Biosciences). Cells were washed 3× and fixed (Fix/Perm solution, BD Biosciences) overnight. For detection of intracellular cytokines, fixed cells were washed 3× in perm/wash buffer (BD Biosciences) followed by intracellular staining with the following antibodies (30 min, 4° C.): anti-IL-2 APC (JES6-5H4, Biolegend), anti-IFNγ PE (XMG1.2, BD Biosciences) and anti-TNFα eFluor450 (MP6-XT22, Invitrogen). Cells were washed 3× in perm/wash buffer and then resuspended in PBS for acquisition using a BD LSRFortessa or BD LSRFortessa X20 cell analyzer. Data was analyzed using FlowJo software (Treestar, Ashland).
Example 3.9: Lung Viral Load and Inflammation
[0256] Viral load was measured by TCID.sub.50 in lung homogenates obtained at 3- and 5-days post infection (dpi). The assay was carried out and TCID.sub.50 was calculated exactly as previously described (Hodgins, B., et al., Clin Vaccine Immunol, 2017, 24(12)). Lung homogenates were also evaluated in duplicate by multiplex ELISA (Quansys) according to the manufacturer's instructions.
Example 4: Characterizing Modified, Non-Binding HA
[0257] VLPs Comprising Parent H1-HA or Modified H1-HA
[0258] Virus like particles comprising HA interact with human immune cells through binding to cell-surface SA (Hendin, H. E. et. al., 2017, Vaccine 35:2592-2599). Activation of human B cells following co-incubation with H1-VLP and VLPs bearing other mammalian HA proteins was also observed. However, VLPs targeting avian influenza strains such as H5N1 do not bind to or activate human B cells. Without wishing to be bound by theory, this lack of activation of B cells by H5N1 may be due to B cells not expressing terminal α(2,3)-linked SA.
[0259] A Y98F HA that does not bind to α(2,6)-linked SA (Whittle et al. (2014, J Virol, 88(8): p. 4047-57) was tested with the expectation that a VLP comprising Y98F HA would exhibit reduced humoral immune responses, since VLPs comprising Y98F HA would not be able to bind to or activate B cells through HA-SA interactions. However, as described below, modified H1 VLP (Y91F H1-VLP) elicited superior humoral responses and improved viral clearance compared to the native H1-VL.
[0260] Absence of Cell Clustering:
[0261] Incubation of human PBMC with the parent H1-VLP results in rapid cell clustering as a result of HA-SA interactions (Hendin, H. E., et al., Vaccine, 2017. 35(19): p. 2592-2599). However, PBMC incubated with the Y91F H1-VLP do not form clusters, even when the concentration of VLP is increased 5-fold. As shown in
[0262] Undetectable Hemagglutination:
[0263] The hemagglutination assay is a rapid method to estimate the amount of VLP or influenza virus in any given sample. The parent H1-VLP readily hemagglutinates tRBC and results in an HA titer of 48000. However, when this assay was conducted with an equivalent protein concentration of Y91F H1-VLP, the HA titer was <10 (
[0264] SPR Results:
[0265] The results shown in
[0266] VLPs Comprising Parent H3-HA or Modified H3-HA
[0267] In contrast with the results observed noted above for Y91F H1 HA, VLPs comprising Y98F H3 A/Kansas HA were observed to hemagglutinate tRBCs (
[0268] Additional modifications to H3 HA resulted in a significant reduction of HA titer (
[0269] The SA binding or non-binding properties for modified H3 HA comprising the following single mutations S136D, S136N, D190K, R222W, S228N, and S228Q were also evaluated (
Example 4.1: Activation of Human Immune Cells In Vitro
[0270] Human PBMC were stimulated with 1 μg parent H1-VLP or Y91F H1-VLP for 6h in vitro and cell activation was evaluated on the basis of CD69 expression.
[0271] Reduced B Cell Activation:
[0272] VLPs comprising wild type H1 resulted in activation of 15.6±2.9% of B cells compared to only 3.6±1.8% with VLPs comprising the modified HA (Y91F H1-VLP;
[0273] Increased T Cell Activation:
[0274] VLPs comprising modified HA (Y91F H1-VLP) resulted in increased activation of CD4.sup.+ and CD8.sup.+ T cells compared to VLPs comprising parent (wild type) HA (H1-VLP). The Y91F H1-VLP elicited activation of 0.2±0.06% of CD4.sup.+ T cells (
Example 4.2: Animal Study Results
[0275] Improved Humoral Immune Responses:
[0276] To establish whether HA-SA interactions influence the humoral immune response to vaccination in mice, neutralizing antibodies against H1N1 (A/California/07/2009) were measured in the serum 21 days post-vaccination with 3 μg parent H1-VLP or Y91F H1-VLP. Neutralizing antibodies were measured using hemagglutination inhibition (HAI) assay to measure antibodies that block the binding of live virus to turkey erythrocytes (Cooper, C., et al., HIV Clin Trials, 2012. 13(1): p. 23-32) and the microneutralization (MN) assay to measure antibodies that prevent infection of Madin-Darby Canine Kidney (MDCK) cells (Zacour, M., et al., Clin Vaccine Immunol, 2016. 23(3): p. 236-42; Yam, K. K., et al., Clin Vaccine Immunol, 2013. 20(4): p. 459-67).
[0277] Vaccination with the Y91F H1-VLP resulted in a statistically significant increase in HAI and MN titers compared to parent H1-VLP-vaccinated mice (
[0278] Similar titers were achieved by week 12, however, the Y91F H1-VLP treatment resulted in a more rapid increase over weeks 2-4, compared with vaccination using the corresponding wild type (parent) H1-VLP. High HAI titers at early time points may be associated with maintenance of titers at 28-weeks post vaccination. At week 28, only 3 out of 8 parent H1-VLP vaccinated mice had an HAI titer ≥40 compared to 6 out of 7 vaccinated mice in the Y91F H1-VLP group.
[0279] Hemagglutination inhibition (HI) titers were also increased following vaccination with VLP comprising Y91F H1-A/Idaho/07/2018 but narrowly failed to achieve statistical significance (
[0280] Vaccination with VLP comprising non-binding H1 A/Brisbane/02/2018 resulted in higher H1-specific IgG titers at day 21 and day 21 post-boost (day 42) and higher avidity (
[0281] Vaccination with Y88F H7-VLP resulted in a statistically significant increase in HAI titers compared to parent H7-VLP-vaccinated mice, up to two months post vaccination (
[0282] In contrast to VLPs comprising non-binding H1 and H7, there was no change in hemagglutination inhibition (HI) titers following vaccination with VLP comprising non-binding (NB) D195G B/Phuket/3073/2013 (
[0283] To further characterize the B cell response, memory B cells and in vivo activated antibody secreting cells (ASCs) were quantified in the spleen and bone marrow by enzyme-linked immune absorbent spot (ELISpot) assay. Mice were vaccinated twice (3 weeks apart) with 3 μg or 0.5 μg VLP and ASCs were evaluated 4 weeks post-boost. Similar levels of memory B cells were observed in the spleen regardless of vaccine or dose, but there was a trend towards an increase in the bone marrow of Y91F H1-VLP-vaccinated mice (
[0284] Strong Cell-Mediated Immune Responses:
[0285] The enhanced cell-mediated immunity (CMI) elicited by plant-derived HA-VLPs is one of the key features that distinguishes these vaccines from other formulations. Therefore, maintenance of cellular responses in mice vaccinated with Y91F H1-VLP was examined. CMI was evaluated on the basis of proliferative responses and cytokine profiles of memory T cells.
[0286] Proliferation was quantified by measuring incorporation of the synthetic thymidine analog bromodeoxyuridine (BrdU) in splenocytes upon re-stimulation with H1 antigens. Re-stimulation with parent H1-VLP (2 μg/mL) resulted in similar stimulation indices in mice vaccinated with parent H1-VLP or Y91F H1-VLP (
[0287] Cytokine production by splenocytes was measured using flow cytometry. Antigen-specific T cells were identified on the basis of IL-2, TNFα, or IFNγ production, following re-stimulation with parent H1-VLP or Y91F H1-VLP (both at 2.5 μg/mL) for 18h. Both the parent H1-VLP and Y91F H1-VLP resulted in an increase in H1-specific CD4.sup.+ T cells 28 days post-vaccination, however, this increase was only statistically significant in the Y91F H1-VLP group (
[0288] Splenocytes and bone marrow immune cells were further analyzed for the frequency of CD4.sup.+ T cells expressing CD44 (antigen specific) and at least one of IL-2, TNFα or IFNγ (
[0289] It was further observed that the frequency of IL-2.sup.+TNFα.sup.+IFNγ.sup.− CD4.sup.+ T cells in the bone marrow correlate with HI titer (
[0290] Total splenic CD4 T cell responses were similarly maintained following vaccination with VLP comprising non-binding (Y91F) H1-A/Idaho/07/2018 (1 week post-boost). Mice (n=8/group) were vaccinated with 1 μg VLP comprising binding H1 A/Idaho/07/2018 or non-binding (Y91F) H1 A/Idaho/07/2018 and boosted with 1 μg at day 21. Mice were euthanized 1 week post-boost and spleens were harvested to measure antigen-specific (CD44+) CD4 T cells by flow cytometry. Both vaccines resulted in similar frequencies of responding cells (
[0291] Since CMI responses in naïve animals are generally weak after the first dose and previous studies evaluating CMI in response to HA-VLPs were conducted following a two-dose vaccine schedule, CMI was also evaluated in mice vaccinated with 2 doses of VLP. By 28d post-boost only the TNFα single-positive population (IFNγ+) was increased compared to the PBS (control) group and there was no difference between the two vaccines (
[0292] Reduced Viral Load:
[0293] Mice were challenged with 1.58×10.sup.3 times the median tissue culture infectious dose (TCID.sub.50) of parent (wild type) H1N1 (A/California/07/09) 28 days post-vaccination with 3 μg VLP. This resulted in substantial weight loss and 69% mortality in the control group (PBS), however, all mice vaccinated with parent H1-VLP or Y91F H1-VLP survived (
[0294] A subset of the infected mice were sacrificed 3 dpi (days post-infection) and 5 dpi to quantify viral titers in the lung as previously described (Hodgins, B., et al., Clin Vaccine Immunol, 2017. 24(12)). Consistent with survival and weight loss trends, a decrease in viral titer in mice vaccinated with either parent H1-VLP or Y91F H1-VLP was observed, compared to the PBS control group at 3 dpi. However, this difference is only statistically significant in the Y91F H1-VLP group (P<0.002). By 5 dpi, mice vaccinated with the Y91F H1-VLP had a 2-log reduction in viral titers compared to the PBS group (P<0.001), and significantly lower titers than the parent H1-VLP group (P<0.033;
[0295] Lung homogenates from 3 dpi and 5 dpi were also evaluated by multiplex ELISA (
[0296] Immune Response Following Vaccination with VLP Comprising Modified H5:
[0297] Total splenic CD4 T cell responses were maintained upon introduction of the Y91F mutation (
[0298] Notably, non-binding H5-VLP results in increased H5-specific bone marrow plasma cells (BMPC) (
[0299] Among evaluated VLPs comprising modified HA, non-binding H1, H5 and H7 VLP resulted in a significant increase in responding CD4 T cells when compared to the placebo group (see
[0300] Immune Response Following Vaccination with VLP Comprising Modified H7:
[0301] Non-binding H7-VLP results in significantly higher hemagglutination inhibition (HI) titers up to 14 weeks post-vaccination as compared to VLP with parent H7 (
[0302] Splenic CD4 T cell responses were maintained upon introduction of the non-binding H7 mutation. Mice were euthanized 5 weeks post-boost and spleens were harvested to measure antigen-specific (CD44+) CD4 T cells by flow cytometry. Both vaccines resulted in similar frequencies of responding cells (
[0303] Immune Response Following Vaccination with VLP Comprising Modified B HA:
[0304] Fewer CD4 T cells expressing IFNγ were observed upon vaccination with non-binding B-VLP (3 weeks post-boost). Mice (n=8/group) were vaccinated with 1 μg binding or non-binding (NB) B-VLP (D195G B/Phuket/3073/2013) and boosted with 1 μg at day 21. Mice were euthanized 3 weeks post-boost and spleens were harvested to measure antigen-specific (CD44+) CD4 T cells by flow cytometry. The frequency of total responding CD4 T cells was similar between vaccine groups (
[0305] All citations are hereby incorporated by reference.
[0306] The present invention has been described with regard to one or more embodiments. However, it will be apparent to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as defined in the claims.