COMPOUNDS AND USES THEREOF
20260097022 ยท 2026-04-09
Inventors
Cpc classification
A61K9/006
HUMAN NECESSITIES
International classification
A61K9/00
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
Abstract
The accumulation of senescent cells is associated with aging, inflammation, and cellular dysfunction. Senolytic drugs can alleviate age-related comorbidities by selectively killing senescent cells. Described herein is a screen of 2,352 compounds for senolytic activity in a model of senescence and trained neural networks to predict the senolytic activities of >800,000 molecules. Methods, systems, and algorithms of the disclosure can enrich for structurally diverse compounds with senolytic activity. Compounds of the disclosure can comprise drug-like compounds which selectively target senescent cells across different senescence models, with more favorable medicinal chemistry properties than, and selectivity comparable to, those of a documented senolytics. Molecular docking simulations of compound binding to several senolytic protein targets, combined with time-resolved fluorescence energy transfer experiments, indicate that these compounds act in part by inhibiting Bcl-2, a regulator of cellular apoptosis. Compounds of the present disclosure can decrease senescent cell burden and mRNA expression of senescence-associated genes.
Claims
1-25. (canceled)
26. A method of treating a senescence-associated disease or disorder or an age-related disease or disorder in a subject comprising, administering to the subject a compound of Formula (I): ##STR00197## or a pharmaceutically acceptable salt thereof, wherein; R.sup.1 and R.sup.4 are each independently selected from hydrogen and C.sub.1-6 alkyl; each R.sup.2 and R.sup.3 is independently selected from halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, S(O).sub.2R.sup.6, S(O).sub.2N(R.sup.5).sub.2, NO.sub.2, CN, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl; wherein each C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl is optionally substituted with one or more substituents independently selected from halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, NO.sub.2, O, and CN; each R.sup.5 is independently selected from: hydrogen; and C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2NO.sub.2, O, and CN; each R.sup.6 is independently selected from: C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2NO.sub.2, O, and CN; m is 0, 1, 2, 3, 4, or 5; and n is 0, 1, 2, 3, 4, or 5.
27. The method of claim 26, comprising decreasing senescent cell burden and/or mRNA expression of senescence-associated genes in the subject.
28. The method of claim 27, wherein: each R.sup.2 and R.sup.3 is independently selected from the group consisting of halogen, OR.sup.5, N(R.sup.5).sub.2, and C.sub.1-6 alkyl; wherein each C.sub.1-6 alkyl, is optionally substituted with one or more substituents independently selected from halogen, OR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, O, and CN; each R.sup.5 is independently selected from: hydrogen; and C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2O, and CN; and each R.sup.6 is independently selected from: C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2O, and CN.
29. The method of claim 28, wherein: R.sup.5 is hydrogen or C.sub.1-6 alkyl; and R.sup.6 is C.sub.1-6 alkyl.
30. The method of claim 27, wherein: R.sup.1 and R.sup.4 are each hydrogen; and each R.sup.2 and R.sup.3 is independently halogen, OC.sub.1-6 alkyl, C.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, or C.sub.1-6 haloalkyl; m is selected from 1 or 2; and n is 0, 1, 2, or 3.
31. The method of claim 30, wherein: R.sup.1 and R.sup.4 are each hydrogen; and each R.sup.2 is independently halogen, OC.sub.1-3 alkyl, C.sub.1-3 alkyl, OC.sub.1-3 haloalkyl, or C.sub.1-3 haloalkyl; each R.sup.3 is independently halogen, C.sub.1-3 alkyl, and C.sub.1-3 haloalkyl; m is selected from 1 or 2; and n is 0, 1, or 3.
32. The method of claim 30, wherein each R.sup.2 and R.sup.3 is independently selected from F, Cl, OCH.sub.3, OCH.sub.2CH.sub.3, CH.sub.3, and CH.sub.2CH.sub.3.
33. The method of claim 27, wherein the compound or the pharmaceutically acceptable salt therefor further comprises a pharmaceutically acceptable excipient.
34. The method of claim 27, where the compound of Formula (I) is represented by one of the following structures: ##STR00198## ##STR00199## ##STR00200## ##STR00201## ##STR00202## ##STR00203## ##STR00204## ##STR00205## ##STR00206## ##STR00207## ##STR00208## ##STR00209## ##STR00210## ##STR00211## ##STR00212## ##STR00213## ##STR00214## ##STR00215## ##STR00216## ##STR00217## ##STR00218## ##STR00219## ##STR00220## ##STR00221## ##STR00222## ##STR00223## or a pharmaceutically acceptable salt of any one thereof.
35. The method of claim 27, where the compound of Formula (I) is represented by one of the following structures: ##STR00224## or a pharmaceutically acceptable salt of any one thereof.
36. A method of treating a senescence-associated disease or disorder or an age-related disease or disorder in a subject comprising, administering to the subject a compound selected from: ##STR00225## ##STR00226## ##STR00227## ##STR00228## ##STR00229## ##STR00230## ##STR00231## ##STR00232## ##STR00233## ##STR00234## ##STR00235## ##STR00236## ##STR00237## ##STR00238## ##STR00239## ##STR00240## ##STR00241## ##STR00242## ##STR00243## ##STR00244## ##STR00245## ##STR00246## ##STR00247## ##STR00248## ##STR00249## ##STR00250## ##STR00251## ##STR00252## ##STR00253## ##STR00254## ##STR00255## ##STR00256## ##STR00257## ##STR00258## or a pharmaceutically acceptable salt of any one thereof.
37. A compound of Formula (II): ##STR00259## or a pharmaceutically acceptable salt thereof, wherein: R.sup.1 and R.sup.4 are each independently selected from hydrogen and C.sub.1-6 alkyl; R.sup.10 is selected from ##STR00260## each R.sup.2 and R.sup.3 is independently selected from halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, C(O)OR.sup.5, OC(O)R.sup.6, S(O).sub.2R.sup.6, S(O).sub.2N(R.sup.5).sub.2, NO.sub.2, CN, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl; wherein each C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl is optionally substituted with one or more substituents independently selected from halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6C(O)OR.sup.5, OC(O)R.sup.6, NO.sub.2, O, and CN; each R.sup.5 is independently selected from hydrogen; and C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2NO.sub.2, O, and CN; each R.sup.6 is independently selected from C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2NO.sub.2, O, and CN; m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, 4, or 5.
38. The compound or salt of claim 37, wherein R.sup.1 and R.sup.4 are each hydrogen; m is selected from 0 and 1; R.sup.10 is selected from ##STR00261## n is selected from 0 and 1; and each R.sup.3 is independently halogen, and S(O).sub.2N(R.sup.5).sub.2.
39. The compound or salt of claim 37, wherein each m is selected from 0 and 1, each R.sup.2 is independently selected from the group consisting of halogen; n is selected from 0 and 1; and each R.sup.3 is independently halogen, and S(O).sub.2NH.sub.2.
40. The compound or salt of claim 37, wherein R.sup.10 is selected from ##STR00262##
41. The compound or salt of claim 37, wherein the compound is selected from ##STR00263##
42. A pharmaceutical composition comprising a compound of claim 37 and a pharmaceutically acceptable excipient.
43. A method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject a compound of claim 37.
44. The method of claim 43, wherein the disease or disorder is a senescence-associated disease or disorder.
45. A method of decreasing senescent cell burden and/or mRNA expression of senescence-associated genes in a subject comprising contacting the senescent cell with the compound or salt of claim 37.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings (also Figure or FIG. herein), of which:
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
DETAILED DESCRIPTION
[0047] While various embodiments of the invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed.
[0048] Cellular senescence is a permanent state of cell cycle arrest that is associated with cellular stress and aging. Although senescence primarily protects against cancer, senescent cells (Sncs) exhibit altered phenotypes and secrete senescence-associated secretory phenotype (SASP) factors, which include cytokines, chemokines, growth factors, and proteases that cause inflammation and tumorigenesis. These factors, in turn, contribute to aging and the deleterious consequences of late-life diseases, including cancer, atherosclerosis and osteoarthritis. Recent studies have shown that the selective clearance of Sncs can ameliorate pathophysiological consequences associated with senescence. In particular, senolytics, an emerging class of drugs that selectively kill Sncs, have been shown to extend healthspan and enhance the efficacy of chemotherapy in mice. Yet, the removal of senescent cells in mice has also been shown to slow wound healing and induce liver and perivascular tissue fibrosis, highlighting the need to discover senolytic therapies that do not induce severe side effects.
[0049] Given the potential of senolytics with few side effects to mediate healthy aging, there has been considerable interest in discovering novel senolytics. The first senolytics-dasatinib, quercetin, fisetin, and ABT-263-emerged in the mid-2010s from targeted bioinformatics approaches that focused on pathways protecting Sncs from apoptosis. Subsequently, senolytics including heat shock protein (HSP)-90 inhibitors, cardiac glycosides, and bromodomain and extra-terminal domain (BET) family protein inhibitors have been discovered through high-throughput screens and detailed mechanistic studies. Many of these documented senolytics have side effects or limitations to clinical application. For instance, senolytics including fisetin and ABT-737 have limited bioavailability, and the evaluation of ABT-263 in Phase II studies for the treatment of lung carcinoma revealed that thrombocytopenia and neutropenia were common side effects in patients. Thus, the identification of novel senolytic compounds is needed to advance the development of senolytics as a class of therapeutics.
[0050] Parallel to the discovery and development of senolytics, machine learning has proven versatile for facilitating drug discovery efforts. Various machine learning models have combined training data generated from biological screens or available from public databases with architectures including neural networks to predict the activities and pharmacological properties of chemical compounds, discover molecular binding targets and aging biomarkers, and design molecules that satisfy predetermined criteria for biological activity and physicochemical properties. While machine learning approaches have successfully enabled the discovery of chemical compounds targeting diverse indications, including bacterial infection and fibrosis, they remain to be developed, tested, and applied in different therapeutic areas, including senolytics. In such applications, the design of appropriate conceptual frameworks, the generation of well-controlled training data, the choice of suitable model architectures, and the experimental validation of model predictions are important for determining a model's predictive accuracy and demonstrating the utility of machine learning for chemical compound discovery.
[0051] Aspects of the present disclosure provides for in silico prediction of senolytic activity by machine learning models on the basis of chemical structure alone (Panel 1a of
[0052] In some embodiments, compounds as disclosed herein are effective senolytics (e.g., IC.sub.50<20 M) and exhibit selectivity comparable to that of ABT-737 in different senescence models.
[0053] Methods, systems, and algorithms of the disclosure may comprise molecular docking simulations involving documented senolytic protein targets and/or time-resolved fluorescence energy transfer (TR-FRET) experiments. In some embodiments, compounds of the present disclosure bind Bcl-2. Furthermore, compounds of the present disclosure can have encouraging safety profiles. Compounds of the present disclosure (e.g., BRD-K56819078) can reduce senescent cell burden and senescence-associated mRNA expression in the kidneys of mouse models.
[0054] As used in the specification and appended claims, unless specified to the contrary, the following terms have the meaning indicated below.
[0055] As used herein. C.sub.1-C.sub.x includes C.sub.1-C.sub.2, C.sub.1-C.sub.3 . . . . C.sub.1-C.sub.x, C.sub.1-C.sub.x refers to the number of carbon atoms that make up the moiety to which it designates (excluding optional substituents).
[0056] Alkyl or alkylene refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, containing no unsaturation, having from one to eighteen carbon atoms (e.g., C.sub.1-C.sub.18 alkyl). In certain embodiments, an alkyl comprises three to eighteen carbon atoms (e.g., C.sub.3-C.sub.18 alkyl). In certain embodiments, an alkyl comprises one to fifteen carbon atoms (e.g., C.sub.1-C.sub.15 alkyl). In certain embodiments, an alkyl comprises one to twelve carbon atoms (e.g., C.sub.1-C.sub.12 alkyl). In certain embodiments, an alkyl comprises one to eight carbon atoms (e.g., C.sub.1-C.sub.8 alkyl). In other embodiments, an alkyl comprises one to six carbon atoms (e.g., C.sub.1-C.sub.6 alkyl). In other embodiments, an alkyl comprises one to five carbon atoms (e.g., C.sub.1-C.sub.8alkyl). In other embodiments, an alkyl comprises one to four carbon atoms (e.g., C.sub.1-C.sub.4 alkyl). In other embodiments, an alkyl comprises one to three carbon atoms (e.g., C.sub.1-C.sub.3 alkyl). In other embodiments, an alkyl comprises one to two carbon atoms (e.g., C.sub.1-C.sub.2 alkyl). In other embodiments, an alkyl comprises one carbon atom (e.g., C.sub.1 alkyl). In other embodiments, an alkyl comprises five to fifteen carbon atoms (e.g., C.sub.5-C.sub.15 alkyl). In other embodiments, an alkyl comprises five to eight carbon atoms (e.g., C.sub.5-C.sub.8 alkyl). In other embodiments, an alkyl comprises two to five carbon atoms (e.g., C.sub.2-C.sub.5 alkyl). In other embodiments, an alkyl comprises three to five carbon atoms (e.g., C.sub.3-C.sub.5 alkyl). In other embodiments, the alkyl group is selected from methyl, ethyl, 1-propyl (n-propyl), 1-methylethyl (iso-propyl), 1-butyl (n-butyl), 1-methylpropyl (sec-butyl), 2-methylpropyl (iso-butyl). 1.1-dimethylethyl (tert-butyl), and 1-pentyl (n-pentyl). The alkyl is attached to the rest of the molecule by a single bond. Unless stated otherwise specifically in the specification, an alkyl group is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilanyl, OR.sup.a, SR.sup.a, OC(O)R.sup.f, N(R.sup.a).sub.2, C(O)R.sup.a, C(O)OR.sup.a, C(O)N(R.sup.a).sub.2, N(R.sup.a)C(O)OR.sup.f, OC(O)NR.sup.aR.sup.f, N(R.sup.a)C(O)R.sup.f, N(R.sup.a)S(O).sub.tR.sup.f (where t is 1 or 2), S(O).sub.tOR.sup.a (where t is 1 or 2), S(O).sub.tR.sup.f (where t is 1 or 2) and S(O).sub.tN(R.sup.a).sub.2(where t is 1 or 2) where each R.sup.a is independently hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, and each R.sup.f is independently alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.
[0057] Alkoxy refers to a radical bonded through an oxygen atom of the formula-O-alkyl, where alkyl is an alkyl chain as defined above.
[0058] Alkenyl refers to a straight or branched hydrocarbon chain radical group consisting solely of carbon and hydrogen atoms, containing at least one carbon-carbon double bond, and having from two to eighteen carbon atoms. In certain embodiments, an alkenyl comprises three to eighteen carbon atoms. In certain embodiments, an alkenyl comprises three to twelve carbon atoms. In certain embodiments, an alkenyl comprises six to twelve carbon atoms. In certain embodiments, an alkenyl comprises six to ten carbon atoms. In certain embodiments, an alkenyl comprises eight to ten carbon atoms. In certain embodiments, an alkenyl comprises two to eight carbon atoms. In other embodiments, an alkenyl comprises two to four carbon atoms. The alkenyl is attached to the rest of the molecule by a single bond, for example, ethenyl (i.e., vinyl), prop-1-enyl (i.e., allyl), but-1-enyl, pent-1-enyl, penta-1.4-dienyl, and the like. Unless stated otherwise specifically in the specification, an alkenyl group is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilanyl. OR.sup.a, SR.sup.a, OC(O)R.sup.f, N(R.sup.a).sub.2, C(O)R.sup.aC(O)OR.sup.a, C(O)N(R.sup.a).sub.2, N(R.sup.a)C(O)OR.sup.fOC(O)NR.sup.aR.sup.fN(R.sup.a)C(O)R.sup.fN(R.sup.a)S(O).sub.tR.sup.f (where t is 1 or 2) S(O).sub.tOR.sup.a (where t is 1 or 2), S(O).sub.tR.sup.f (where t is 1 or 2) and S(O).sub.tN(R.sup.a) 2 (where t is 1 or 2) where each R.sup.a is independently hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, and each R.sup.f is independently alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.
[0059] Alkynyl refers to a straight or branched hydrocarbon chain radical group consisting solely of carbon and hydrogen atoms, containing at least one carbon-carbon triple bond, having from two to eighteen carbon atoms. In certain embodiments, an alkynyl comprises three to eighteen carbon atoms. In certain embodiments, an alkynyl comprises three to twelve carbon atoms. In certain embodiments, an alkynyl comprises six to twelve carbon atoms. In certain embodiments, an alkynyl comprises six to ten carbon atoms. In certain embodiments, an alkynyl comprises eight to ten carbon atoms. In certain embodiments, an alkynyl comprises two to eight carbon atoms. In other embodiments, an alkynyl has two to four carbon atoms. The alkynyl is attached to the rest of the molecule by a single bond, for example, ethynyl, propynyl, butynyl, pentynyl, hexynyl, and the like. Unless stated otherwise specifically in the specification, an alkynyl group is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilanyl, OR.sup.a, SR.sup.a, OC(O).sub.tR.sup.f, N(R.sup.a).sub.2, C(O)R.sup.a, C(O)OR.sup.a, C(O)N(R.sup.a).sub.2, N(R.sup.a)C(O)OR.sup.f, OC(O)NR.sup.aR.sup.f, N(R.sup.a)C(O)R.sup.f, N(R.sup.a)S(O).sub.tR.sup.f (where t is 1 or 2), S(O).sub.tOR.sup.a (where t is 1 or 2), S(O).sub.tR.sup.f (where t is 1 or 2) and S(O).sub.tN(R.sup.a).sub.2 (where t is 1 or 2) where each R.sup.a is independently hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, and each R.sup.f is independently alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.
[0060] Halo or halogen refers to bromo, chloro, fluoro or iodo substituents.
[0061] Haloalkyl refers to an alkyl radical, as defined above, that is substituted by one or more halo radicals, as defined above.
[0062] Optional or optionally means that a subsequently described event or circumstance may or may not occur and that the description includes instances when the event or circumstance occurs and instances in which it does not. For example. optionally substituted aryl means that the aryl radical are or are not substituted and that the description includes both substituted aryl radicals and aryl radicals having no substitution.
[0063] Pharmaceutically acceptable. as used herein, refers a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively nontoxic at the concentration or amount used, e.g., the material is administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.
[0064] The term pharmaceutically acceptable salt refers to a form of a therapeutically active agent that consists of a cationic form of the therapeutically active agent in combination with a suitable anion, or in alternative embodiments, an anionic form of the therapeutically active agent in combination with a suitable cation. Handbook of Pharmaceutical Salts: Properties. Selection and Use. International Union of Pure and Applied Chemistry. Wiley-VCH 2002. S. M. Berge. L. D. Bighley. D. C. Monkhouse. J. Pharm. Sci. 1977, 66, 1-19. P. H. Stahl and C. G. Wermuth, editors. Handbook of Pharmaceutical Salts: Properties. Selection and Use, Weinheim/Zrich: Wiley-VCH/VHCA. 2002. Pharmaceutical salts typically are more soluble and more rapidly soluble in stomach and intestinal juices than non-ionic species and so are useful in solid dosage forms. Furthermore, because their solubility often is a function of pH, selective dissolution in one or another part of the digestive tract is possible and this capability can be manipulated as one aspect of delayed and sustained release behaviors. Also, because the salt-forming molecule can be in equilibrium with a neutral form, passage through biological membranes can be adjusted.
[0065] The term acceptable with respect to a formulation, composition or ingredient, as used herein, means having no persistent detrimental effect on the general health of the subject being treated.
[0066] The terms administer, administering, administration, and the like, as used herein, refer to the methods that may be used to enable delivery of compounds or compositions to the desired site of biological action. These methods include, but not limited to, oral routes, intraduodenal routes, parenteral injection (including intravenous, subcutaneous, intraperitoneal, intramuscular, intravascular or infusion), topical and rectal administration. Those of skill in the art are familiar with administration techniques that can be employed with the compounds and methods described herein. In some embodiments, the compounds and compositions described herein are administered orally.
[0067] The terms effective amount or therapeutically effective amount, as used herein, refer to a sufficient amount of an agent or a compound being administered, which will relieve to some extent one or more of the symptoms of the disease or condition being treated. The result includes reduction or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. For example, an effective amount for therapeutic used is the amount of the composition comprising a compound as disclosed herein required to provide a clinically significant decrease in disease symptoms. An appropriate effective amount in any individual case is optionally determined using techniques, such as a dose escalation study.
[0068] The term subject or patient encompasses mammals. Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species: farm animals such as cattle, horses, sheep, goats, swine: domestic animals such as rabbits, dogs, and cats: laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. In one aspect, the mammal is a human. In some instances, the subject is a tissue or a cell.
[0069] As used herein, treatment or treating or palliating or ameliorating are used interchangeably herein. These terms refer to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and/or a prophylactic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient is still afflicted with the underlying disorder. For prophylactic benefit, the compositions are administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease has not been made.
Pharmaceutical Compositions
[0070] In some embodiments, the compound described herein is combined with a pharmaceutically suitable or acceptable carrier (also referred to herein as a pharmaceutically suitable (or acceptable) excipient, physiologically suitable (or acceptable) excipient, or physiologically suitable (or acceptable) carrier) selected on the basis of a chosen route of administration and standard pharmaceutical practice as described, for example, in Remington: The Science and Practice of Pharmacy (Gennaro, 21.sup.st Ed. Mack Pub. Co., Easton, PA (2005)).
[0071] Accordingly, provided herein is a pharmaceutical composition comprising at least one compound of Formula (I), or a pharmaceutically acceptable salt thereof, together with one or more pharmaceutically acceptable carriers. In certain embodiments, provided herein are compounds for use in pharmaceutical compositions. In some embodiments, compounds of Formula (I) or pharmaceutically acceptable salts thereof are formulated as formulations with one or more pharmaceutically acceptable excipients.
[0072] In certain embodiments, a compound of Formula (I) is represented by:
##STR00006##
or a pharmaceutically acceptable salt thereof, wherein: [0073] R.sup.1 and R.sup.4 are each independently hydrogen or C.sub.1-6 alkyl; [0074] each R.sup.2 and R.sup.3 is independently selected from the group consisting of halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, NO.sub.2, CN, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl: wherein each C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl is optionally substituted with one or more substituents independently selected from halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, NO.sub.2, O, and CN; [0075] each R.sup.5 is independently selected from: hydrogen; and C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, NO.sub.2, O, and CN; [0076] each R.sup.6 is independently selected from: C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, NO.sub.2, O, and CN; [0077] m is 0, 1, 2, 3, 4, or 5; and [0078] n is 0, 1, 2, 3, 4, or 5.
[0079] In certain embodiments, a compound of a pharmaceutical formulation described herein is selected from Formula (I):
##STR00007##
or a pharmaceutically acceptable salt thereof, wherein: [0080] R.sup.1 and R.sup.4 are each independently hydrogen or C.sub.1-6 alkyl; [0081] each R.sup.2 and R.sup.3 is independently selected from the group consisting of halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, S(O).sub.2R.sup.6, S(O).sub.2N(R.sup.5).sub.2, NO.sub.2, CN, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl: wherein each C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl is optionally substituted with one or more substituents independently selected from halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6C(O)OR.sup.5, OC(O)R.sup.6, NO.sub.2, O, and CN; [0082] each R.sup.5 is independently selected from: hydrogen; and C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, NO.sub.2, O, and CN; [0083] each R.sup.6 is independently selected from: C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, NO.sub.2, O, and CN; [0084] m is 0, 1, 2, 3, 4, or 5; and [0085] n is 0, 1, 2, 3, 4, or 5.
[0086] In certain embodiments, for a compound or a pharmaceutical formulation described herein as Formula (I):
[0087] R.sup.1 and R.sup.4 are each independently hydrogen or C.sub.1-6 alkyl: [0088] each R.sup.2 and R.sup.3 is independently selected from the group consisting of halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, NO.sub.2, CN, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl: wherein each C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl is optionally substituted with one or more substituents independently selected from halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, NO.sub.2, O, and CN; [0089] each R.sup.5 is independently selected from: hydrogen; and C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, NO.sub.2, O, and CN; [0090] each R.sup.6 is independently selected from: C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, NO.sub.2, O, and CN; [0091] m is 0, 1, 2, 3, 4, or 5; and [0092] n is 0, 1, 2, 3, 4, or 5.
[0093] In some embodiments, provided herein is a compound, according to Formula (I), wherein each R.sup.2 and R.sup.3 is independently selected from the group consisting of halogen, OR.sup.5, N(R.sup.5).sub.2, and C.sub.1-6 alkyl: wherein each C.sub.1-6 alkyl, is optionally substituted with one or more substituents independently selected from halogen, OR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, O, and CN: each R.sup.5 is independently selected from: hydrogen; and C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2. O, and CN; and each R.sup.6 is independently selected from: C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, O, and CN.
[0094] In some embodiments, provided herein is a compound, or a pharmaceutically acceptable salt thereof, according to Formula (I), wherein R.sup.5 is hydrogen or C.sub.1-6 alkyl; and R.sup.6 is C.sub.1-6 alkyl. In some embodiments, provided herein is a compound, or a pharmaceutically acceptable salt thereof, according to Formula (I), wherein R.sup.1 and R.sup.4 are each hydrogen; and each R.sup.2 and R.sup.3 is independently hydrogen, halogen, OC.sub.1-6 alkyl, or C.sub.1-6 alkyl.
[0095] In some embodiments, provided herein is a compound, or a pharmaceutically acceptable salt thereof, according to Formula (I), wherein each R.sup.2 and R.sup.3 is independently-H, F, Cl, OCH.sub.3, OCH.sub.2CH.sub.3, CH.sub.3, or CH.sub.2CH.sub.3. In some embodiments, provided herein is a compound, or a pharmaceutically acceptable salt thereof, according to Formula (I), wherein each R.sup.2 is independently Cl, OCH.sub.3, or CH.sub.3. In some embodiments, provided herein is a compound, or a pharmaceutically acceptable salt thereof, according to Formula (I), wherein and n is 1, and each R.sup.3 is independently F or CH.sub.3. In some embodiments, n is 0. In some embodiments, n is 2, and each R.sup.3 is CH.sub.3. In some embodiments, m is 1 and R.sup.2 is C.sub.1 or CH.sub.3. In some embodiments, m is 2 and R.sup.2 is OCH.sub.3.
[0096] In some embodiments, provided herein is a compound, or a pharmaceutically acceptable salt thereof, according to Formula (I), wherein R.sup.2 is OCH.sub.3. In some embodiments, provided herein is a compound, or a pharmaceutically acceptable salt thereof, according to Formula (I), wherein R.sup.2 is C.sub.1 or CH.sub.3. In some embodiments, provided herein is a compound, or a pharmaceutically acceptable salt thereof, according to Formula (I), wherein R.sup.3 is F or CH.sub.3.
[0097] In some embodiments, provided herein is a pharmaceutical composition comprising a compound of Formula (I) represented by one of the following structures:
##STR00008##
[0098] In some embodiments, provided herein is a pharmaceutical composition comprising the compound:
##STR00009##
or a pharmaceutically acceptable salt thereof.
[0099] In some embodiments, provided herein is a pharmaceutical composition comprising the compound:
##STR00010##
or a pharmaceutically acceptable salt thereof.
[0100] In some embodiments, provided herein is a pharmaceutical composition comprising the compound:
##STR00011##
or a pharmaceutically acceptable salt thereof.
[0101] In another aspect, the present disclosure provides a compound of Formula (II):
##STR00012##
or a pharmaceutically acceptable salt thereof, wherein: [0102] R.sup.1 and R.sup.4 are each independently hydrogen or C.sub.1-6 alkyl; [0103] R.sup.10 is selected from
##STR00013## [0104] each R.sup.2 and R.sup.3 is independently selected from the group consisting of halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, C(O)OR.sup.5, OC(O)R.sup.6, S(O).sub.2R.sup.6, S(O).sub.2N(R.sup.5).sub.2, NO.sub.2, CN, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl; wherein each C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl is optionally substituted with one or more substituents independently selected from halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, NO.sub.2, O, and CN; [0105] each R.sup.5 is independently selected from: hydrogen; and C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, NO.sub.2, O, and CN; [0106] each R.sup.6 is independently selected from: C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, NO.sub.2, O, and CN; [0107] m is 0, 1, 2, 3, or 4; and [0108] n is 0, 1, 2, 3, 4, or 5.
[0109] In some embodiments of a compound of Formula (II), [0110] R.sup.1 and R.sup.4 are each hydrogen; [0111] m is selected from 0 and 1; [0112] R.sup.10 is selected from
##STR00014## [0113] n is selected from 0 and 1; and [0114] each R.sup.3 is independently halogen, and S(O).sub.2N(R.sup.5).sub.2.
[0115] In some embodiments of a compound or salt of Formula (II), each m is selected from 0 and 1, each R.sup.2 is independently selected from the group consisting of halogen, n is selected from 0 and 1; and each R.sup.3 is independently halogen, and S(O).sub.2NH.sub.2. In some cases, m is 0. In some cases, m is 1. In some cases, R.sup.2 is fluorine. In some cases, n is 0. In some cases, n is 1. In some cases, R.sup.3 is S(O).sub.2NH.sub.2. In some cases, R.sup.3 is halogen. In some cases, R.sup.3 is selected from chlorine and fluorine. In some cases, R.sup.3 is Cl. In some cases, R.sup.3 is F.
[0116] In some embodiments of a compound or salt of Formula (II), each R.sup.5 is independently selected from: hydrogen; and C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, and CN. In some cases, each R.sup.5 is independently selected from: hydrogen; and C.sub.1-6 alkyl. In some cases, each R.sup.5 is independently selected from: hydrogen; and methyl. In some cases, R.sup.5 is methyl. In some cases, R.sup.5 is hydrogen.
[0117] In some embodiments of a compound or salt of Formula (II), R.sup.10 is selected from
##STR00015##
In some cases, R.sup.10 is selected from
##STR00016##
In some cases, R.sup.10 is
##STR00017##
In some cases, R.sup.10 is
##STR00018##
In some cases, R.sup.10 is
##STR00019##
[0118] In another aspect, the present disclosure provides a pharmaceutical composition comprising a compound of Formula (II) and a pharmaceutically acceptable excipient.
[0119] The carrier(s) (or excipient(s)) is acceptable or suitable if the carrier is compatible with the other ingredients of the composition and not deleterious to the recipient (i.e., the subject) of the composition.
[0120] Exemplary pharmaceutical compositions are used in the form of a pharmaceutical preparation, for example, in solid, semisolid or liquid form, which includes one or more of a disclosed compound, as an active ingredient, in a mixture with an organic or inorganic carrier or excipient suitable for external, enteral or parenteral applications. In some embodiments, the active ingredient is compounded, for example, with the usual non-toxic, pharmaceutically acceptable carriers for tablets, pellets, capsules, suppositories, solutions, emulsions, suspensions, and any other form suitable for use. The active object compound is included in the pharmaceutical composition in an amount sufficient to produce the desired effect upon the process or condition of the disease.
[0121] In some embodiments for preparing solid compositions such as tablets, the principal active ingredient is mixed with a pharmaceutical carrier, e.g., conventional tableting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate, or gums, and other pharmaceutical diluents, e.g., water, to form a solid preformulation composition containing a homogeneous mixture of a disclosed compound or a non-toxic pharmaceutically acceptable salt thereof. When referring to these preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition is readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.
[0122] In solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules and the like), the subject composition is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, cellulose, microcrystalline cellulose, silicified microcrystalline cellulose, lactose, sucrose, glucose, mannitol, and/or silicic acid: (2) binders, such as, for example, carboxymethylcellulose, hypromellose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia: (3) humectants, such as glycerol: (4) disintegrating agents, such as crospovidone, croscarmellose sodium, sodium starch glycolate, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate: (5) solution retarding agents, such as paraffin: (6) absorption accelerators, such as quaternary ammonium compounds: (7) wetting agents, such as, for example, docusate sodium, cetyl alcohol and glycerol monostearate: (8) absorbents, such as kaolin and bentonite clay: (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, in some embodiments, the compositions comprise buffering agents. In some embodiments, solid compositions of a similar type are also employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
[0123] In some embodiments, a tablet is made by compression or molding, optionally with one or more accessory ingredients. In some embodiments, compressed tablets are prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. In some embodiments, molded tablets are made by molding in a suitable machine a mixture of the subject composition moistened with an inert liquid diluent. In some embodiments, tablets, and other solid dosage forms, such as dragees, capsules, pills, and granules, are scored or prepared with coatings and shells, such as enteric coatings and other coatings.
Methods of Treatment
[0124] In some embodiments, compounds of Formula (I) or (II) may be used in a method of treating a disease or disorder, for example, a disease or disorder associated with aging. Accordingly, provided herein is a method of treating a disease or disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of a compound according to Formula (I), or a pharmaceutically acceptable salt thereof. Also provided herein is a method of treating a disease or disorder in a subject, the method comprising administering to the subject a pharmaceutical composition comprising a compound of Formula (I) or (II),
##STR00020##
or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, wherein: [0125] R.sup.1 and R.sup.4 are each independently hydrogen or C.sub.1-6 alkyl; [0126] each R.sup.2 and R.sup.3 is independently selected from the group consisting of halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, NO.sub.2, CN, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl; wherein each C.sub.1-6 alkyl, C.sub.2-6 alkenyl, and C.sub.2-6 alkynyl is optionally substituted with one or more substituents independently selected from halogen, OR.sup.5, SR.sup.5, N(R.sup.5).sub.2, C(O)R.sup.6, C(O)N(R.sup.5).sub.2, N(R.sup.5)C(O)R.sup.6, C(O)OR.sup.5, OC(O)R.sup.6, NO.sub.2, O, and CN; [0127] each R.sup.5 is independently selected from: hydrogen; and C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, NO.sub.2, O, and CN; [0128] each R.sup.6 is independently selected from: C.sub.1-6 alkyl optionally substituted with one more substituents independently selected from halogen, OC.sub.1-6 alkyl, OC.sub.1-6 haloalkyl, NH.sub.2, NO.sub.2, O, and CN; [0129] m is 0, 1, 2, 3, 4, or 5; and [0130] n is 0, 1, 2, 3, 4, or 5.
[0131] In some embodiments, provided herein is a method of treating a disease or disorder in a subject, the method comprising administering to the subject a pharmaceutical composition comprising a compound represented by one of the following structures:
##STR00021##
or a pharmaceutically acceptable salt of any one thereof, and a pharmaceutically acceptable excipient.
[0132] In some embodiments, provided herein is a method of treating a disease or disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of the compound:
##STR00022##
or a pharmaceutically acceptable salt thereof.
[0133] In some embodiments, the compound is formulated in a pharmaceutical composition further comprising one or more pharmaceutically acceptable excipients prior to the administering to the subject.
[0134] In some embodiments, the disease or disorder is a senescence-associated disease or disorder. In some embodiments, the senescence-associated disease or disorder is an age-related disease or disorder. In some embodiments, the disease or disorder is a senescence-associated disease or disorder, or an age-related disease or disorder described herein.
[0135] In some embodiments, provided herein is a method of decreasing senescent cell burden and/or mRNA expression of senescence-associated genes in a subject (e.g., a tissue or a cell) comprising contacting the senescent cell with a senolytic agent described herein. Also provided herein are methods for selectively killing a senescent cell comprising contacting the senescent cell with a senolytic agent described herein (i.e., facilitating interaction or in some manner allowing the senescent cell and senolytic agent to interact) under conditions and for a time sufficient to kill the senescent cell. In such embodiments, the agent selectively kills senescent cells over non-senescent cells (i.e., the agent selectively kills senescent cells compared with killing of non-senescent cells). In certain embodiments, the senescent cell to be killed is present in a subject (e.g., a human or non-human animal). The senolytic agent(s) may be administered to the subject according to the treatment cycles, treatment courses, and non-treatment intervals described above and herein.
[0136] In some embodiments, the compounds of Formula (I) or (II) may be applicable for diverse indications where senescent cell accumulation is a driver of disease pathology. In some embodiments, the compounds of Formula (I) or (II) are senescent cell-targeting, have favorable medicinal chemistry properties, and lack appreciable toxicity. In some embodiments, the compounds of Formula (I) or (II) may be relevant to medical aesthetics comprising decreasing biological age of skin, fibrosis and scarring, inflammation and inflammaging, sunburn and skin damage, and/or treatment of DNA-damanged skin.
[0137] In some embodiments, the compounds of Formula (I) or (II) may decrease the mRNA expression of p16, a key age-associated biomarker, as well as Col1a1 and MMP9 in aged or wounded ex vivo human skin models suggests that the compounds may improve tissue function and wound healing by eliminating senescent cells and reducing scarring. In some embodiments, the compounds of Formula (I) or (II) may decrease the mRNA expression of Col1a1. In some embodiments, the compounds provided herein may decrease the mRNA expression of MMP9.
Pharmaceutical Formulation
[0138] In some embodiments, a compound of Formula (I), a compound of Formula (II), or a pharmaceutical composition of any one thereof, is formulated into a pharmaceutical formulation In some cases, the pharmaceutical formulation is a 5% topical ointment in 10% DMSO, 45% PEG300, and 45% water. In some cases, the formulation contains at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% DMSO. In some cases, the formulation contains at most 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, or 5% DMSO. In some cases, the formulation contains at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50% PEG300. In some cases, the formulation contains at most 50%, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, or 40% PEG300. In some cases, the formulation contains at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50% water. In some cases, the formulation contains at most 50%, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, or 40% water.
Senescence-Associated Diseases and Disorders
[0139] Methods are provided herein for treating conditions, diseases, or disorders related to, associated with, or caused by cellular senescence, including age-related diseases and disorders in a subject in need thereof. Methods are provided herein for treating conditions, diseases, or disorders related to, associated with, or caused by cellular senescence, including age-related diseases and disorders in a subject in need thereof by administering to the subject in need thereof a compound of Formula (I).
[0140] A senescence-associated disease or disorder may also be called herein a senescent cell-associated disease or disorder. Senescence-associated diseases and disorders include, for example, cardiovascular diseases and disorders, inflammatory diseases and disorders, autoimmune diseases and disorders, pulmonary diseases and disorders, eve diseases and disorders, metabolic diseases and disorders, neurological diseases and disorders (e g., neurodegenerative diseases and disorders); age-related diseases and disorders induced by senescence: skin conditions; age-related diseases; dermatological diseases and disorders; and transplant related diseases and disorders. A prominent feature of aging is a gradual loss of function, or degeneration that occurs at the molecular, cellular, tissue, and organismal levels. Age-related degeneration gives rise to well-recognized pathologies, such as sarcopenia, atherosclerosis and heart failure, osteoporosis, pulmonary insufficiency, renal failure, neurodegeneration (including macular degeneration, Alzheimer's disease, and Parkinson's disease), and many others. Although different mammalian species vary in their susceptibilities to specific age-related pathologies, collectively, age-related pathologies generally rise with approximately exponential kinetics beginning at about the mid-point of the species-specific life span (e.g., 50-60) years of age for humans).
[0141] Examples of senescence-associated conditions, disorders, or diseases that may be treated by administering any one of the senolytic agents (e.g., compounds of Formula (I)) described herein according to the methods described herein include, cognitive diseases (e g., mild cognitive impairment (MCI). Alzheimer's disease and other dementias: Huntington's disease); cardiovascular disease (e.g., atherosclerosis, cardiac diastolic dysfunction, aortic aneurysm, angina, arrhythmia, cardiomyopathy, congestive heart failure, coronary artery disease, myocardial infarction, endocarditis, hypertension, carotid artery disease, peripheral vascular diseases, cardiac stress resistance, cardiac fibrosis): metabolic diseases and disorders (e.g., obesity, diabetes, metabolic syndrome): motor function diseases and disorders (e.g., Parkinson's disease, motor neuron dysfunction (MND), Huntington's disease): cerebrovascular disease: emphysema; osteoarthritis: benign prostatic hypertrophy: pulmonary diseases (e.g., idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), emphysema obstructive bronchiolitis, asthma): inflammatory/autoimmune diseases and disorders (e.g., osteoarthritis, eczema, psoriasis, osteoporosis, mucositis, transplantation related diseases and disorders), ophthalmic diseases or disorders (e.g., age-related macular degeneration, cataracts, glaucoma, vision loss, presbyopia); diabetic ulcer; metastasis: a chemotherapeutic side effect, a radiotherapy side effect; aging-related diseases and disorders (e.g., kyphosis, renal dysfunction, frailty, hair loss, hearing loss, muscle fatigue, skin conditions, sarcopenia, and herniated intervertebral disc) and other age-related diseases that are induced by senescence (e.g., diseases/disorders resulting from irradiation, chemotherapy, smoking tobacco, eating a high fat/high sugar diet, and environmental factors), wound healing: skin nevi: fibrotic diseases and disorders (e g. , cystic fibrosis, renal fibrosis, liver fibrosis, pulmonary fibrosis, oral submucous fibrosis, cardiac fibrosis, and pancreatic fibrosis). In certain embodiments, any one or more of the diseases or disorders described above or herein may be excluded.
[0142] In a more specific embodiment, methods are provided for treating a senescence-associated disease or disorder by killing senescent cells (i.e., established senescent cells) associated with the disease or disorder in a subject who has the disease or disorder by administering a senolytic agent, where m the disease or disorder is osteoarthritis: idiopathic pulmonary fibrosis: chronic obstructive pulmonary disease (COPD); or atherosclerosis.
[0143] Subjects (i.e., patients, individuals (human or non-human animals)) who may benefit from use of the methods described herein that comprise administering a senolytic agent (e.g., a compound of Formula (I)) include those who may also have a cancer. The subject treated by these methods may be considered to be in partial or complete remission (also called cancer remission) As discussed in detail herein, the senolytic agents for use in methods for selective killing of senescent cells are not intended to be used as a treatment for cancer, that is, in a manner that kills or destroys the cancer cells in a statistically significant manner. Therefore, the methods disclosed herein do not encompass use of the senolytic agents m a manner that would be considered a primary therapy for the treatment of a cancer. Even though a senolytic agent, alone or with other chemotherapeutic or radiotherapy agents, are not used in a manner that is sufficient to be considered as a primary cancer therapy, the methods and senolytic agents described herein may be used in a manner (e.g, a short term course of therapy) that is useful for inhibiting metastases. In other certain embodiments, the subject to be treated with the senolytic agent does not have a cancer (i.e., the subject has not been diagnosed as having a cancer by a person skilled in the medical art).
Age-Related Diseases and Disorders
[0144] A senolytic agent may also be useful for treating or preventing (I.e., reducing the likelihood of occurrence) of an age-related disease or disorder that occurs as part of the natural aging process or that occurs when the subject is exposed to a senescence inducing agent or factor (e.g., irradiation, chemotherapy, smoking tobacco, high-fat/high sugar diet, other environmental factors). An age-related disorder or disease or an age-sensitive trait may be associated with a senescence-inducing stimulus. The efficacy of a method of treatment described herein may be manifested by reducing the number of symptoms of an age-related disorder or age-sensitive trait associated with a senescence-inducing stimulus, decreasing the severity of one or more symptoms, or delaying the progression of an age-related disorder or age-sensitive trait associated with a senescence-inducing stimulus. In other particular embodiments, preventing an age-related disorder or age-sensitive trait associated with a senescence-inducing stimulus refers to preventing (i.e., reducing the likelihood of occurrence) or delaying onset of an age-related disorder or age-sensitive trait associated with a senescence-inducing stimulus, or reoccurrence of one or more age-related disorder or age-sensitive trait associated with a senescence-inducing stimulus. Age related diseases or conditions include, for example, renal dysfunction, kyphosis, herniated intervertebral disc, frailty, hair loss, hearing loss, vision loss (blindness or impaired vision), muscle fatigue, skin conditions, skin nevi, diabetes, metabolic syndrome, and sarcopenia. Vision loss refers to the absence of vision when a subject previously had vision Various scales have been developed to describe the extent of vision and vision loss based on visual acuity. Age-related diseases and conditions also include dermatological conditions, for example without limitation, treating one or more of the following conditions: wrinkles, including superficial fine wrinkles; hyperpigmentation; scars; keloid; dermatitis; psoriasis; eczema (including seborrheic eczema); rosacea; vitiligo; ichthyosis vulgaris: dermatomyositis; and actinic keratosis.
[0145] Frailty has been defined as a clinically recognizable state of increased vulnerability resulting from aging-associated decline in reserve and function across multiple physiologic systems that compromise a subject's ability to cope with every day or acute stressors. Frailty has been may be characterized by compromised energetics characteristics such as low grip strength, low energy, slowed waking speed, low physical activity, and/or unintentional weight loss. Studies have suggested that a patient may be diagnosed with frailty when three of five of the foregoing characteristics are observed. In certain embodiments, aging and diseases and disorders related to aging may be treated or prevented (i.e., the likelihood of occurrence of is reduced) by administering a senolytic agent. The senolytic agent may inhibit senescence of adult stem cells or inhibit accumulation, kill, or facilitate removal of adult stem cells that have become senescent.
[0146] The effectiveness of a senolytic agent with respect to treating a senescence-associated disease or disorder described herein can readily be determined by a person skilled in the medical and clinical arts. One or any combination of diagnostic methods appropriate for the particular disease or disorder, which methods are well known to a person skilled in the art, including physical examination, patient self-assessment, assessment and monitoring of clinical symptoms, performance of analytical tests and methods, including clinical laboratory tests, physical tests, and exploratory surgery, for example, may be used for monitoring the health status of the subject and the effectiveness of the senolytic agent. The effects of the methods of treatment described herein can be analyzed using techniques known in the art, such as comparing symptoms of patients suffering from or at risk of a particular disease or disorder that have received the pharmaceutical composition comprising a senolytic agent with those of patients who were not treated with the senolytic agent or who received a placebo treatment.
[0147] As understood by a person skilled in the medical art, the terms. treat and treatment. refer to medical management of a disease, disorder, or condition of a subject (i.e., patient). In general, an appropriate dose and treatment regimen provide the senolytic agent in an amount sufficient to provide therapeutic and/or prophylactic benefit Therapeutic benefit for subjects to whom the senolytic agents described herein are administered, includes, for example, an improved clinical outcome, wherein the object is to prevent or slow or retard (lessen) an undesired physiological change associated with the disease, or to prevent or slow or retard (lessen) the expansion or severity of such disease. As discussed herein, effectiveness of the one or more senolytic agents may include beneficial or desired clinical results that comprise, but are not limited to, abatement, lessening, or alleviation of symptoms that result from or are associated with the disease to be treated; decreased occurrence of symptoms: improved quality of life; longer disease-free status (i.e., decreasing the likelihood or the propensity that a subject will present symptoms on the basis of which a diagnosis of a disease is made): diminishment of extent of disease, stabilized (i.e., not worsening) state of disease; delay or slowing of disease progression; amelioration or palliation of the disease state; and remission (whether partial or total), whether detectable or undetectable; and/or overall survival. The effectiveness of the senolytic agents described herein may also mean prolonging survival when compared to expected survival if a subject were not receiving the senolytic agent that selectively kills senescent cells.
[0148] Administration of a senolytic agent described herein can prolong prolonging survival when compared to expected survival if a subject were not receiving treatment. Subjects in need of treatment include those who already have the disease or disorder as well as subjects prone to have or at risk of developing the disease or disorder, and those in which the disease, condition, or disorder is to be treated prophylactically. A subject may have a genetic predisposition for developing a disease or disorder that would benefit from clearance of senescent cells or may be of a certain age wherein receiving a senolytic agent would provide clinical benefit to delay development or reduce severity of a disease, including an age-related disease or disorder.
[0149] In another embodiment, a method is provided for treating a senescence-associated disease or disorder that further comprises identifying a subject who would benefit from treatment with a senolytic agent described herein (i.e., phenotyping: individualized treatment). This method comprises first detecting the level of senescent cells in the subject, such as in a particular organ or tissue of the subject A biological sample may be obtained from the subject, for example, a blood sample, serum or plasma sample, biopsy specimen, body fluids (e.g., lung lavage, ascites, mucosal washings, synovial fluid, vitreous fluid, spinal fluid), bone marrow, lymph nodes, tissue explant, organ culture, or any other tissue or cell preparation from a subject. The level of senescent cells may be determined according to any of the in vitro assays or techniques described herein. For example, senescence cells may be detected by morphology (as viewed by microscopy, for example), production of senescence associated markers such as, senescence-associated -galactosidase (SA--gal), p16INK4a, p21. PAI-1, or any one or more SASP factors (e.g., IL-6. MMP3). The senescent cells and non-senescent cells of the biological sample may also be used in an in vitro cell assay in which the cells are exposed to any one of the senolytic agents described herein to determine the capability of the senolytic agent to kill the subject's senescent cells without undesired toxicity to non-senescent cells. As positive controls in these assays, the assay may incorporate any one of the senolytic agents described herein. The subject then may be treated with an appropriate senolytic agent, which may be a MDM2 mhibitor; an inhibitor of one or more Bel-2 anti-apoptotic protein family members wherein the inhibitor inhibits at least Bel-XL (e.g., a Bcl-xL selective inhibitor, Bel-2/Bel-xL/Bel-w inhibitor, a Bcl-2/Bel-xL or a Bel-xL/Bcl-w inhibitor); or an Akt specific inhibitor. In addition, these methods may be used to monitor the level of senescent cells in the subject before, during, and after treatment with a senolytic agent. In certain embodiments, the presence of senescence cells, may be detected (e.g., by determining the level of a senescent cell marker expression of mRNA, for example), and the treatment course and/or non-treatment interval can be adjusted accordingly.
[0150] A subject, patient, or individual in need of treatment with a senolytic agent as described herein may be a human or may be a non-human primate or other animal (i.e., veterinary use) who has developed symptoms of a senescence cell-associated disease or disorder or who is at risk for developing a senescence cell-associated disease or disorder. Non-human animals that may be treated include mammals, for example, non-human primates (e.g., monkey, chimpanzee, gorilla, and the like), rodents (e.g., rats, mice, gerbils, hamsters, ferrets, rabbits), lagomorphs, swine (e.g., pig, miniature pig), equine, canine, feline, bovine, elephants, bears and other domestic, farm, and zoo animals.
EXAMPLES
Example 1Identification of Senolytics with Deep Neural Networks
[0151] Cell culture. Human lung fibroblast (IMR-90) cells were obtained from ATCC (CCL-186) and passaged less than 10 times (less than 30 population doublings) for all experiments described in this example, with the exception of high-passage cells used in the model of replicative senescence (see the section on Replicative senescence below). Cells were cultured in growth media comprising Eagle's Minimum Essential Medium (EMEM: ATCC 30-2003) supplemented with 10% fetal bovine serum (FBS: Thermo Fisher 16140071) and 1% penicillin-streptomycin (Thermo Fisher 15070063). Cells were incubated in a humidity-controlled incubator at 37 C., with 5% CO.sub.2. Cells were detached using trypsin-EDTA (0.05%; Gibco 25300120).
[0152] Etoposide-induced senescence. IMR-90 cells were cultured as described above. At between 30 to 50% confluence, the media was replaced with complete growth media containing vehicle (0.5% dimethyl sulfoxide: DMSO, MilliporeSigma D5879) or complete growth media containing 50 M etoposide (prepared as a 1:200 dilution of a 10 mM stock solution in DMSO; etoposide, MilliporeSigma E1383). Cells were treated for 2 days, after which the media was replaced with fresh growth media and cells were allowed to recover for 4 days. Cells were then plated as described below.
[0153] Doxorubicin-induced senescence. IMR-90 cells were cultured as described above. At between 30 to 50% confluence, the media was replaced with complete growth media containing vehicle (0.5% DMSO) or complete growth media containing 0.5 M doxorubicin (prepared as a 1:200 dilution of a 0.1 mM stock solution in DMSO: doxorubicin, Cayman Chemical 15007). Cells were treated for 2 days, after which the media was replaced with fresh growth media and cells were allowed to recover for 4 days. Cells were then plated as described below.
[0154] Replicative senescence. Early-passage IMR-90 cells (passage number <3, corresponding to less than 9 population doublings from supplier's stock) were used. High-passage IMR-90 cells were cultured as described above and passaged until cells became non-dividing (passage number >10, corresponding to at least 30 population doublings from supplier's stock). Senescence was confirmed with SA--gal staining and mRNA quantification, as described elsewhere herein. Cells were then plated as described below.
[0155] Senescence-associated -galactosidase staining. On each of two days before or on the day of compound additioncorresponding to days 0 and 1 shown in
[0156] mRNA quantification using quantitative PCR. Total RNA was extracted using an RNeasy& mini kit from Qiagen (Qiagen 74104) following the manufacturer's instructions. For qPCR analysis, cDNAs were synthesized using a QuantiTect Reverse Transcription Kit from Qiagen following the manufacturer's instructions (Qiagen 205311). Real-time PCR amplifications were performed in 96-well optical reaction plates using a Power SYBR Green PCR Master Mix from Thermo-Fisher (Thermo-Fisher 4368577). The following primers were used, and the relative expression of each gene was determined by normalization to GAPDH expression for each sample:
TABLE-US-00001 p16Forwardprimer: CCCAACGCACCGAATAGTTA p16Reverseprimer: ACCAGCGTGTCCAGGAAG p21Forwardprimer: TGTCCGTCAGAACCCATGC p21Reverseprimer: AAAGTCGAAGTTCCATCGCTC KI67Forwardprimer: GAGGTGTGCAGAAAATCCAAA KI67Reverseprimer: CTGTCCCTATGACTTCTGGTTGT GAPDHForwardprimer: GGAGCGAGATCCCTCCAAAAT GAPDHReverseprimer: GGCTGTTGTCATACTTCTCATGG
[0157] Relative expression values for each of p16, p21, and KI67 were then normalized to those of control (DMSO-treated or early passage) cells for comparison, as shown in Panel 1c of
[0158] Chemical compounds for screens. A screening library was obtained from MicroSource Discovery Systems comprising FDA-approved drugs, drugs currently in clinical trials, and natural products (2.560) compounds total). The screening library was supplemented with 20 compounds, most of which have documented senolytic activity, and all of which were procured from commercial suppliers. After deduplication of 228 compounds, the 2.352 unique compounds were screened for senolytic activity as described below.
[0159] Chemical screening. For all screening experiments. 99 L of cells were plated into each well of a 96-well clear flat-bottom, black polystyrene tissue-culture-treated plate (Corning 3904) at a density of 10+ cells/well. Plates were incubated overnight for adhesion. The day after plating. 1 L of each compound, prepared as either a 1 mM stock solution in DMSO (10 M final concentration screen) or 0.1 mM stock solution in DMSO (1 M final concentration screen), was added to each well using an Agilent Bravo liquid handler. A built-in slow mixing step involving aspirating and dispensing was used to enhance distribution of the added compounds in solution. Cells were incubated for 3 days, after which resazurin (MilliporeSigma R.sup.7017) was added to each well to a final concentration of 0.15 mM. After an additional 1 day of incubation, the fluorescence excitation/emission at 550/590 nm was read using a SpectraMaxR M3 plate reader and manufacturer software (SoftMax Pro R 6). Experiments were performed in biological duplicate.
[0160] Validation dose-response measurements are shown in
[0161] Calculation of cellular viability values in dose-response curves. To determine relative cell viability values for the dose-response curves shown in
[0162] Calculation of baseline cellular viability values. As shown in Panel 3f of
[0163] Curve-fitting and estimation of IC.sub.50 values. To estimate IC.sub.50 values in dose-response curves, nonlinear least-squares fitting (the Isqcurvefit function in MATLAB, ver. R2019b) was used to fit relative growth values to Hill functions of the form
while enforcing H0) for all x. IC.sub.50 values were determined by numerically solving the best-fit Hill function for x given H(x)=0.5.
[0164] Deep learning model. The deep learning model used builds on that applied in Stokes. J. M, et al. Cell 2020, 180 (4). 688-702, which is incorporated herein by reference in its entirety, and uses Chemprop (github.com/chemprop/chemprop), a software package for molecular property prediction that implements the graph neural networks described below and in the main text. For each compound, a graph-based molecular representation was generated from the compound's simplified molecular-input line-entry system (SMILES) string using RDKit (ver. 2021.09.01). A feature vector for each atom and bond in the compound was generated based on the following computable features: [0165] 1. atom features including the atomic number, number of bonds for each atom, formal charge, chirality, number of bonded hydrogen atoms, hybridization, aromaticity, and atomic mass; [0166] 2. bond features including the bond type (single, double, tripe, or aromatic), conjugation, ring membership, and stereochemistry.
[0167] The model implements the bond-based message-passing convolutional neural network. Here, each message (a real number) associated with a bond was updated by summing the messages from neighboring bonds, concatenating the current bond's message with the sum, and applying a single neural network layer with a non-linear activation function. After a fixed number of message-passing steps, the messages across the molecule were summed to produce a final message representing the molecule. This message was inputted into a feed-forward neural network, which output a final prediction of the compound's senolytic activity. The final output was a real number between 0 (is not senolytic) and 1 (is senolytic), describing the probability that the compound was predicted to be senolytic.
[0168] Model optimization. Three model optimizations were used to improve model performance. First. 200 molecule-level features computed with RDKit were added to the graph-based representation of each compound. This step was performed in order to provide additional information about predicted global properties of each compound, augmenting the local message-passing approach. Second. Bayesian hyperparameter optimization was used in order to select hyperparameters for the model. Doing so using Chemprop's hyperopt function, the following hyperparameters were found and used for all Chemprop models: depth. 2: dropout. 0 number of feedforward layers. 3: hidden size. 600. Finally, ensembling was used to increase the robustness of Chemprop model predictions, as detailed separately for Model evaluation and Model predictions and filtering below.
[0169] Model evaluation. Each compound in the initial training dataset of 2.352 compounds was assigned a binary activity value of 0 (no senolytic activity) or 1 (possesses senolytic activity), as shown in Panel 1d of
[0170] Random forest classifiers were independently trained using scikit-learn. The same training and withheld test sets as above were used, and an exhaustive hyperparameter grid search was performed. 360 random forest models were trained for hyperparameters in the following combinatorial space: max depth between 5 to 40, in intervals of 5: number of estimators between 20) and 100, in intervals of 20; max features between 20 and 180, in intervals of 20. Precision-recall curves were generated using scikit-learn as above. For both Chemprop and random forest models, bootstrapping with 100 subsamples, each subsample with size equal to the test set, was used to calculate 95% confidence intervals for the auPRC and bootstrapped variations of precision-recall curves (Panel 1e of
[0171] t-SNE and visualization, sklearn, manifold's TSNE function was used in conjunction with Morgan fingerprint representations of all compounds (radius=2 and number of bits=2048) to visualize compounds (Panel 1g of
[0172] Model predictions and filtering. For the final model. 20 Chemprop models were each trained for 30 epochs using random 80-10.sup.10 training-validation-testing splits. The models were then deployed to predict the senolytic activities of 804.959 compounds comprising the Broad Institute's Drug Repurposing Hub (with 5819 unique compounds scored) and an extended Broad Institute library of 799.140 compounds. For each compound, the prediction scores of all models were averaged to determine the final prediction score for the compound. Following prediction of senolytic activity, compounds with high prediction scores (>0.4) possessing PAINS and Brenk substructures were filtered out using rdkit. Chem's FilterCatalog package. The remaining compounds with high prediction scores were filtered based on the Tanimoto similarity, and all calculations of Tanimoto similarity were performed as described above.
[0173] Chemical curation. ABT-737 was from Cayman Chemical (Cayman Chemical 11501). Other compounds were procured from the Broad Institute Center for the Development of Therapeutics. ChemBridge, and May bridge.
[0174] Calculation of physicochemical properties. For each compound, the physicochemical properties shown in Table 1 herein below were calculated from the corresponding SMILES string using SwissADME.
[0175] Measuring cytotoxicity against HepG2 and HEK293 cells. Cytotoxicity in human embryonic kidney (HEK293) and liver carcinoma (HepG2) cells was assayed as above using a resazurin assay. Cells were obtained from ATCC (ATCC CRL-1573 and HB-8065), passaged <10 times, and grown in Dulbecco's modification of Eagle's Medium (DMEM: Corning 10.sup.013-CV) supplemented with 10% FBS and 1% penicillin-streptomycin. 99 L of cells were plated into each well of a 96-well clear flat-bottom, black polystyrene tissue-culture-treated plate at a density of 10+ cells/well, and plates were incubated overnight for adhesion. The day after plating. 1 L of each compound, prepared as two-fold serial dilutions of 5 mM stock solutions in DMSO, was added to each well. Cells were incubated for 3 days, after which resazurin was added to each well to a final concentration of 0.15 mM. After an additional 1 day of incubation, the fluorescence excitation/emission at 550/590 nm was read using a SpectraMax M3 plate reader. Experiments were performed in biological duplicate. IC.sub.50 values were determined by normalizing with respect to the fluorescence intensity values of untreated control cells on day 3, as described in Calculation of cellular viability values in dose-response curves above.
[0176] Molecular docking simulations. Molecular docking simulations were performed using AutoDock Vina 1.2.0. Compounds were provided as SMILES strings and represented in three dimensions using OpenBabel. Protein structures were curated from the PDB using the accession codes tabulated in Panel 5a of
[0177] BCL-2 TR-FRET. Inhibition of Bcl-2 binding to a peptide ligand was measured using the BCL-2 TR-FRET Assay Kit from BPS Bioscience (BPS Bioscience 50222). Briefly, the provided BCL TR-FRET assay buffer was diluted 1:3 with ultrapure Milli-Q water. The anti-His terbium-labeled donor and dye-labeled acceptor were each diluted 1:100 with diluted assay buffer. The BCL-2 peptide ligand was thawed on ice and diluted 1:40 with diluted assay buffer, and BCL-2 protein was diluted with diluted assay buffer to a working concentration of 1 ng/L. Test compounds at the indicated final concentrations were prepared as stock 10% DMSO solutions in ultrapure Milli-Q water. The reaction was performed by combining 5 L diluted donor. 5 L diluted acceptor. 2 L test compound. 5 L diluted ligand, and 3 L diluted protein in each well of the provided white, flat-bottom 384-well plate. Positive control reactions had 2 L 10% DMSO in water in lieu of test compound. Negative control reactions had 2 L 10% DMSO in water and 5 L diluted assay buffer in lieu of test compound and diluted ligand. Reactions were incubated at room temperature for 3 hours, and fluorescent intensities were measured using a SpectraMax M5 plate reader and manufacturer software (SoftMax Pro 6) with the following TR-FRET settings; for terbium-labeled donor emission, ex/em. 340/620 nm: lag time. 100 s: integration time. 500 s: for dye-acceptor emission, ex/em. 340/665 nm: lag time. 100 s; integration time. 500 s. The TR-FRET ratio. 665 nm emission/620 nm emission, was calculated for all reactions, and percentage activity was calculated by linearly interpolating the positive and negative control TR-FRET ratio values between relative activity values of 0) and 1. Experiments were performed in biological duplicate and repeated on independent occasions.
[0178] Hemolysis assay. Whole human blood containing EDTA (Innovative Resarch IWB1K2E) was centrifuged at 120g at 4 C., for 5 min and resuspended in Dulbecco's PBS (DPBS: VWR 02-0119-0500). These washing steps were repeated until the supernatant was clear. Red blood cells were then resuspended in DPBS to 510.sup.8 cells/mL, and 100 L of cells was plated into each well of a 96-well clear round-bottom plate. Compounds were added to the indicated concentrations, and DMSO was used as a vehicle. Samples were incubated for 1 h at 37 C., without shaking, after which plates were centrifuged at 1500g at room temperature for 5 min to pellet cells. 60 L of the supernatant from each sample was then transferred to a 96-well clear flat-bottom plate, and the absorbance was read at 405 nm using a SpectraMax M3 plate reader to quantify the amount of soluble hemoglobin. Fractional hemolysis was determined by linearly interpolating absorbance values with respect to a positive control (saturation with 10% Triton X-100) and a negative control (1% DMSO vehicle). Results are depicted in
[0179] Genotoxicity assay. An Ames 384-ISO test (6041-1S) from Environmental Bio-Detection Products, Inc, was used following the manufacturer's instructions. Briefly. Salmonella typhimurium TA100 was grown overnight (16-18 h) at 37 C., with shaking at 300 rpm and treated with the provided exposure media and compound samples at the final concentrations indicated. Treatment with the provided 4-nitroquinoline 1-oxide (4NQO), a mutagen, was used as a positive control. Cells were then added to the provided reversion solution, and each sample was split into 48 wells of 384-well plates. Plates were incubated at 37 C., for 2 days, after which the number of revertant (yellow-colored) wells corresponding to each sample was counted. Additionally, we verified that each test compound did not inhibit the growth of S, typhimurium TA100. An overnight bacterial culture was diluted 1:10.000 in LB medium (Becton Dickinson 244620) and plated using 99 L working volumes into the wells of a clear flat-bottom 96-well plate. One L of two-fold dilutions of each test compound in DMSO, starting from a final concentration of 500 M, was added across wells, and plates were sealed and incubated overnight at 37 C., to determine bacterial growth. Results are shown in
[0180] Aged mouse model experiments. For the baseline experiment, the results of which are shown in Panels 6a-6e of
[0181] For compound administration. BRD-K56819078 (ChemBridge 7507010) was prepared fresh in 10% DMSO: 45% PEG300:45% water for injection w/w, and for each mouse a total of six intraperitoneal injections over a 14-day period were performed at 25 mg/kg per injection, as determined by weighing each mouse immediately prior to injection. All mice were euthanized by CO.sub.2 asphyxiation and dissected, and one kidney was harvested per mouse. Each kidney was divided for SA--gal staining and mRNA measurements. Samples that were designated for SA--gal staining were embedded in OCT medium and flash-frozen in liquid nitrogen. Samples that were designated for mRNA measurements were placed in RNAlater Stabilization Solution (Thermo Fisher AM7021) and flash-frozen with dry ice.
[0182] For SA--gal staining, kidney samples were oriented and cut into 10 m-thin sections using a Leica CM1950 cryostat. SA--gal staining was then performed similarly to the above, but with modifications. Frozen sections were fixed for 15 minutes using 2% formaldehyde and 0.2% glutaraldehyde in PBS (pH 7.4). Sections were then washed in PBS and incubated overnight at 37 C., in a dry incubator with -gal staining solution, an aqueous solution containing 40 mM citric acid/sodium phosphate (MilliporeSigma C0759 and S9763). 5 mM potassium ferrocyanide (MilliporeSigma P9387). 5 mM potassium ferricyanide (MilliporeSigma P8131). 2 mM magnesium chloride (MilliporeSigma M8266). 150 mM sodium chloride (Fisher Scientific S271), and 1 mg/mL X-gal (MilliporeSigma 9660), titrated to pH 6.0. Sections were washed in PBS, counterstained with Nuclear Fast Red (VWR AAJ61010-AP) for 5 min at room temperature, then washed again in PBS before imaging. Imaging was performed on an EVOS XL Core or a Leica DMil equipped with a Flexacam CI camera. Two fields of view were captured for each kidney section, the images were thresholded by color using ImageJ ver. 2.0.0-rc-69/1.52p (National Institutes of Health), and the ratios of blue area (SA--gal-positive area) to total red and blue area (all cells) were calculated for each field of view. One kidney sample from each of the vehicle- and BRD-K56819078-treated aged mice groups failed to stain for SA--gal, which may arise if the sections did not contain any kidney cortical region: data from these samples were discarded.
[0183] For mRNA measurements, kidney samples were homogenized using an SP Bel-Art ProCulture cordless homogenizer, and mRNA was extracted and quantified as described above in mRNA quantification using quantitative PCR, using a PureLink RNA Mini Kit (Thermo Fisher 12183020) for extraction. The following primers were used, and the relative expression of each gene was determined by normalization to -actin expression for each sample:
TABLE-US-00002 p16Forwardprimer: AGGGCCGTGTGCATGACGTG p16Reverseprimer: GCACCGGGCGGGAGAAGGTA p21Forwardprimer: AACATCTCAGGGCCGAAA p21Reverseprimer: TGCGCTTGGAGTGATAGAAA -actinForwardprimer: GGCTGTATTCCCCTCCATCG -actinReverseprimer: CCAGTTGGTAACAATGCCATGT
[0184] Two-sided, two-sample unpaired 1-tests or one-way ANOVA tests were performed using MATLAB, as shown in Panel 1c of
TABLE-US-00003 TABLE 1 Physicochemical properties and cytotoxicity of identified compounds. Compound BRD-K20733377 BRD-K56819078 BRD-K44839765 ABT-737 Canonical C1CCC(CC1) COC1C(CC(CC1) CC1CCCCC1C CN(C)CCC(CSC1CCCCC1) simplified C2CCC(CC2) C(O)NC2CC3C(CC2) (O)NC2CC3C NC2C(CC(CC2)S(O) molecular-input C(O)NC3CCC NC(S3)SCC(O) (CC2)NC(S3)SCC (O)NC(O)C3CCC line-entry system (CC3)S(O)(O) NC4CCCCC4F)OC (O)NC4CCCCC4 (CC3)N4CCN(CC4) (SMILES) string NC4NCCCN4 CC5CCCCC5C6CCC (CC6)Cl)[N+](O)[O] Molecular weight 430.48 Da 497.56 Da 433.55 Da 813.43 Da Number of heavy 31 34 30 56 atoms Number of 7 10 8 17 rotatable bonds Topological polar 109.43 .sup.2 143.09 .sup.2 124.63 .sup.2 164.49 .sup.2 surface area (TPSA) Lipinski- Yes Yes Yes No; conforming MW > 500 g/mol, TPSA > 140 .sup.2 Veber-conforming Yes No; Yes No; number of TPSA > 140 .sup.2 rotatable bonds > 10, TPSA > 140 .sup.2 Pan-assay None None None None interference compounds (PAINS) Brenk None None None Yes; nitro group substructures and oxygen- nitrogen single bond HEK293 IC.sub.50 51.1 M 21.4 M 159.5 M 28.8 M HepG2 IC.sub.50 70.3 M 420.7 M 382.6 M 131.9 M
[0185] For comparison, values for ABT-737 are shown. Lipinski-conforming indicates that a compound violates no more than one of Lipinski's rule of five: (a)5 hydrogen bond donors, (b) 10 hydrogen-bond acceptors, (c) molecular weight <500 Da, and (d) log P partition coefficient <5. Veber-conforming indicates that a compound violates none of Veber's rules for oral bioavailability: (a)10 rotatable bonds and (b) TPSA140 2. IC.sub.50 values for human embryonic kidney (HEK293) and human liver carcinoma (HepG2) cells represent values inferred from curve-fitting with data from two biological replicates, as detailed elsewhere herein.
Chemical Screens of 2,352 Compounds Identify Senolytics.
[0186] To identify compounds with senolytic activity used to train the model. 2.352 compounds, largely from a library of FDA-approved drugs and drugs undergoing clinical trials, were screened for senolytic activity in a model of therapy-induced senescence as described above. Human lung (IMR-90) fibroblasts were treated with etoposide to induce senescence via the formation of double-stranded DNA breaks, and cells were allowed to recover in etoposide-free medium. Senescence was confirmed by staining for senescence-associated -galactosidase (SA--gal) at timepoints corresponding to one day before compound treatment and the day of compound treatment, which indicated substantively increased straining in etoposide-treated Sncs relative to vehicle (0.5% dimethyl sulfoxide)-treated controls (Panel 1b of
[0187] As a starting point for senolytic activity, active compounds were defined as those for which relative Snc viability was <0.5, relative viability of control cells was >0.5, and the ratio of relative Snc/control viability was <0.7 (Panel 1d of
[0188] Based on the foregoing criteria for active compounds, a screen at 10 M revealed more active compounds, including documented senolytics, than the screen at 1 M. The screening results at 10 M were thus used to train subsequent models, including a binary classifier.
Design and Validation of Graph Neural Network Models
[0189] The screening data was then used to train deep learning models that predict senolytic activity based on chemical structure. Message-passing graph neural network (MPNN) models were trained and deployed to predict senolytic activity based on chemical structure as described herein above. MPNNs are a type of supervised model that takes as input a chemical structure of a molecule, integrates local information contained at each atom and bond, and produces as output a prediction score representing the probability that the molecule possesses a property of interest. The ability of these models to predict senolytic activity was assessed by training and testing on 80-20 splits of the screening data. Precision-recall curves, which plot the true positive rate against the positive predictive value (Panel 1e of
[0190] The model was then retrained using the entire screening dataset, and it was applied to predict the senolytic activities of 804.959 compounds comprising the Broad Institute's Drug Repurposing Hub (with 5819 unique compounds scored) and an extended Broad Institute library of 799.140 compounds. The compounds exhibited a range of prediction scores, from 2.110.sup.6 to 0.70 (Panel 1f of
[0191] The search space was narrowed by applying filters selective for favorable medicinal chemistry properties and structural novelty (
[0192] Measuring senolytic activity as before, the preliminary screens revealed that 25 of the 216 curated high-ranking compounds were active, in contrast to none of the 50 curated low-ranking compounds (Panels 2a and 2b of
Validation of Compounds in Models of Therapy-Induced Senescence
[0193] The dose-response of several compounds that were particularly selective at 10 M was examined in detail: of these, three compounds. BRD-K20733377. BRD-K56819078, and BRD-K44839765, exhibited encouraging therapeutic indices of 8.3, 12.0, and 4.7, respectively, which were at least comparable to the therapeutic index of ABT-737 (7.5: Panels 3a-3e of
[0194] Given that the identified compounds may exhibit more promising selectivity than ABT-737, their structural and physicochemical properties were investigated in greater detail. All three compounds are drug-like compounds from the extended Broad Institute library with no current clinical use. BRD-K56819078 and BRD-K44839765 share a benzothiazole-containing substructure, and all three compounds occupy a chemical space distinct from that of the training dataset, with the closest compounds being sulfadiazine. 3.4-dimethyoxybenzoic acid, and salicylanilide, as measured by Tanimoto similarity (
[0195] To further investigate the senolytic activities of BRD-K20733377. BRD-K56819078, and BRD-K44839765, the selectivity of these compounds against Sncs was verified in in an IMR-90 model of therapy-induced senescence using doxorubicin (
Validation of Compounds in a Model of Replicative Senescence
[0196] Orthogonal to models of therapy-induced senescence, the efficacy of BRD-K20733377. BRD-K56819078, and BRD-K44839765 in a model of replicative senescence was measured. Early- and late-passage IMR-90 cells were cultured, and late-passage cells were passaged until they became non-dividing. To confirm senescence of late-passage cells. SA--gal staining (Panel 4a of
Molecular Docking and TR-FRET Study of Identified Compounds
[0197] Given that BRD-K20733377. BRD-K56819078, and BRD-K44839765 are selective against Sncs in different models of senescence, it was hypothesized that they may act on targets conserved in senescence pathways. As a starting point for determining their potential mechanisms of action, attention was to focused on documented senolytic protein targets, including Bcl-2 and Bcl-2 family proteins, heat shock proteins such as Hsp90, and proteins involved in cell cycle regulation such as MDM2 and PI3K (Panel 5a of
[0198] Molecular docking simulations were performed to predict likely protein targets of BRD-K20733377. BRD-K56819078, and BRD-K44839765 (Panel 5b of
[0199] The molecular docking simulations suggested that BRD-K20733377. BRD-K56819078, and BRD-K44839765 most likely bind Bcl-2, and that this binding might involve similar residues or binding pockets as those of ABT-737. This hypothesis was directly tested using a time-resolved fluorescence resonance energy transfer (TR-FRET) assay, in which Bcl-2 binding activity to a peptide ligand specific to its active site was measured. It was found that all three compounds indeed inhibited Bcl-2, and this inhibition occurred at micromolar concentrations comparable to the corresponding Snc IC.sub.50 values in the therapy-induced and replicative senescence models (Panel e of
Initial Toxicity Profiling of Identified Compounds
[0200] As BRD-K20733377. BRD-K56819078, and BRD-K44839765 exhibit promising senolytic activities and physicochemical properties, their toxicity profiles were further assessed. Mechanistic toxicity, as surveyed by hemolysis, and genotoxicity, as assessed by mutagenic potential, was investigated for the three compounds. Hemolysis is can be a severe toxic liability of systemically-administered compounds that kill cells, and hemolytic activity may preclude the use of compounds for injection. Measuring the release of hemoglobin from human red blood cells extracted from whole blood, it was found that treatment with all three compounds, in addition to ABT-737, did not induce significant hemolysis up to a final concentration of 100 Mapproximately 10 the corresponding therapeutic concentrations in the therapy-induced and replicative senescence models (
In Vivo Efficacy of BRD-K56819078 in an Aged Mouse Model
[0201] Given the favorable selectivity and toxicity profiles of BRD-K20733377. BRD-K56819078, and BRD-K44839765. BRD-K56819078, one of the more selective of the three compounds across all senescence models was selected for in vivo testing. Documented measurements of Sncs in animal models have focused on Snc accumulation in the kidneys, which has been suggested to exhibit more salient increases in senescence-associated biomarkers than in other tissues in humans. As a baseline experiment, the kidneys of nave young and aged C.sub.57BL/6J mice were harvested, and SA--gal staining and p16 and p21 mRNA expression were measure (Panel 6a of
[0202] BAGedC57BL/6J mice were then treated with vehicle (10% DMSO: 45% PEG300:45% water for injection w/w) or BRD-K56819078 (intraperitoneally at 25 mg/kg per injection) on days 0, 2. 4, 7. 9, and 11 of a 14-day experiment (Panel 6d of
Bcl-XL Targeting of Compounds
[0203] In addition to Bcl-2. IBX-100, and analogs thereof are selective inhibitors of the protein Bcl-XL (IC.sub.50 1 M for all three compounds), without substantively inhibiting the proteins Bcl-w. Bcl2-Al, and Mcl-1 (IC.sub.50>100 M for all three compounds), as demonstrated using TR-FRET experiments (
[0204] Although the compounds may share a similar mechanism of action with ABT-737 and ABT-263, it is notable that IBX-100 and analogs are not cytotoxic to T-cells and other immune cells (see Toxicological Properties below). This suggests that the compounds can kill senescent cells without resulting in thrombocytopenia or neutropenia, which has been a challenge in the clinical use of ABT-737 and ABT-263. This may be due to weaker Bcl-XL inhibition than ABT-737 and ABT-263, or the presence of potentially promiscuous and/or potentially toxic chemical moieties in ABT-737 and ABT-263.
In Vitro Senescent Human Fibroblast Cells
[0205] DNA Damage-Induced Senescence
[0206] In a model of etoposide-induced senescence in IMR-90 human lung fibroblasts, the compounds disclosed herein including IBX-100 exhibited comparable, if not higher, selectivity against senescent cells than ABT-737. As shown in
[0207] Reactive Oxygen Species-Induced Senescence and Replicative Senescence
[0208] Similar results as for DNA damage-induced senescence were found for IMR-90) fibroblasts where senescence was induced by (1) H.sub.2O.sub.2 treatment and (2) continued passaging until cells became non-dividing. In both cases, selectivities were comparable to those in the DNA damage-induced senescence model.
In Vitro Senescent Human Endothelial Cells and Human Primary Muscle Cells
[0209] Similar results as for IMR-90 human lung fibroblasts were found in vitro for two diverse cell types, human umbilical vein endothelial cells (HUV-EC-C) and human primary skeletal muscle cells (ATCC PCS-950-010) (
Ex Vivo Aged Human Skin Models
[0210] As baseline, mRNA expression of p16 was found to be increased in an older subject (e.g., 70-year-old Caucasian female. Fitzpatrick type 2), by 3 compared to a younger subject (e.g., 29-year-old Caucasian female, Fitzpatrick type 3), as shown in
[0211] IBX-100 was first tested in ex vivo skin for safety. IBX-100 was formulated as a 5% topical ointment in 10% DMSO: 45% PEG300:45% water for injection (w/w) and applied directly on an older subject (e.g., 70-year-old Caucasian female, Fitzpatrick type 2) and a younger subject (e.g., 29-year-old Caucasian female, Fitzpatrick type 3) skin. No adverse effects were observed after application.
[0212] IBX-100 was further tested in ex vivo skin for efficacy, p16 mRNA expression was measured after 5 days of topical application of IBX-100 on an older subject (e.g., 70-year-old Caucasian female, Fitzpatrick type 2) skin, and compared to vehicle values. We found that p16 mRNA expression decreased, on average, by approximately 40% with administration of IBX-100 for the three samples tested (
Ex Vivo Wounded Skin Models
[0213] Senescent cells can accumulate at skin wounds and contribute to scarring after wound recovery. Compounds that selectively eliminate senescent cells in wounded skin may facilitate scarless recovery at the cost of longer healing times.
[0214] As baseline, skin biopsies were wounded with a 2 mm diameter hole punch, and mRNA expression of p16 was found to be increased in the wound region. This result was comparable for two different sets of skin biopsy samples, including middle-aged skin (e.g., 46-year-old Hispanic female, Fitzpatrick type 3) and younger skin (e.g., 36-year-old Caucasian female, Fitzpatrick type 2-3). For the younger skin sample, RNA expression levels of collagen (Col1a1) and matrix metallopeptidase 9 (MMP9) were additionally measured. Higher levels of Col1a1 may be associated with senescence and scarring. Higher levels of MMP9 may be associated with scarring, arthritis, and inflammation, p16, Col1a1, and MMP9 expression levels were found to be increased, by 2, 1.5, and 2, respectively, inside the wound area as compared to outside the wound area (
[0215] IBX-100 was tested again for safety in a combination dosing regimen. IBX-100 was formulated as a 10% solution in 100% DMSO and applied directly by pipetting 5 L on wounded younger skin (e.g., 36-year-old Caucasian female, Fitzpatrick type 2-3). Additionally, IBX-100 was administered to the culture medium at a final concentration of about 100 g/mL, by adding 1 L of a 100 mg/mL solution in DMSO to 1 mL of culture media, as a model of systemic administration. For both administration routes, no adverse effects were observed after application.
[0216] To test efficacy. IBX-100 was applied both topically and systemically as described above every 24 h for 5 days. On day 6, the skin biopsies were excised, and p16. Col1a1, and MMP9 RNA expression was measured inside each wound. Compared to vehicle (e.g., DMSO) values, p16. Col1a1, and MMP9 expression was decreased, on average, by 30%. 60%, and 60%, respectively, with administration of IBX-100 (
Additional Medicinal Chemistry and Toxicological Properties
[0217] Favorable medicinal chemistry properties: IBX-100 and analogs possess more favorable medicinal chemistry properties compared to ABT-737 and ABT-263, with no Lipinski or Veber rule violations. Brenk substructures, and PAINS. The molecular weights of IBX-100 and all analogs are less than 550 Da, suggesting favorable skin permeability.
[0218] Non-cytotoxicity to T-cells in vitro: IBX-100 appears to be not cytotoxic to primary human T-cells (e.g., IC.sub.50)>100 M for all compounds). In contrast. ABT-737. ABT-263, and ABT-199 may be cytotoxic (e.g., IC.sub.501 M for all three compounds), and induce substantial cell death at about 0.1 M, as shown in
Therapeutic Indices
[0219] The N-|2-(2-anilino-2-oxoethyl) sulfanyl-1.3-benzothiazol-6-yl|benzamide core scaffold includes 130 additional compounds (out of 170) tested) for which we have discovered putative selective senolytic activity in vitro in the etoposide-induced senescence model, with therapeutic indices (ratio of IC.sub.50) values between etoposide- and DMSO-treated IMR9 ( ) fibroblasts) summarized for each compound (Table 2). Etoposide treatment induces DNA damage, which can result in senescence. DMSO is a vehicle and does not induce DNA damage, which does not result in senescence. Here, selective senolytic activity means inferred therapeutic index greater than 1. Of note, the compounds identified as Specs AN-648/15102282 and Specs AN-648/15102283 are two highly selective senolytic compounds (therapeutic indices >5 to 10). AN-648/15102282 can be described by the IUPAC name N-|2-[2-(4-ethoxyanilino)-2-oxoethyl|sulfanyl-1.3-benzothiazol-6-yl|-3-methylbenzamide. AN-648/15102283 can be described by the IUPAC name N-[2-[2-(4-ethoxyanilino)-2-oxoethyl|sulfanyl-1.3-benzothiazol-6-yl]-2-methylbenzamide. Compounds in Table 2:
[0220] BRD-K56819078. BRD-K20733377, and Specs AN-648/15102283 are inhibitors of the protein Bcl-XL (IC.sub.501 micromolar for all three compounds), without substantively inhibiting the proteins Bcl-w. Bcl2-Al, and Mcl-1 (IC.sub.50 at least approximately 100 M for all three compounds), as demonstrated using TR-FRET experiments. BRD-K20733377 is additionally an inhibitor of BRD4 (IC.sub.5010 micromolar).
[0221] AN-648/15102283, hereafter referred to as IBX-100, decreases p16 mRNA expression when applied topically to old human skin, as well as p16, Col1a1, and MMP9 mRNA expression when applied topically and systemically to wounded human skin. Human skin results are presented for IBX-100. Compounds with a TI of <1 were labelled as +, compounds with a TI of 1 to 5 were labelled as ++, and compounds with a TI of >5 were labeled as +++. In some cases, variation in TIs may occur due biological variation and since the TI is a ratio of two curve-fitted parameters. In some cases, depending on biological variability the TI may vary but will be in the same direction of >1 or <1 (i.e, compounds with +++ or ++ will always be+++ or ++ while compounds with + will always be+).
TABLE-US-00004 TABLE 2 Compounds and bioactivity cpd Therapeutic no Structure Compound ID Index (TI) 1