Replication-competent recombinant herpes simplex virus type 1 (HSV-1) comprising deletions in the ICP6 and IR regions
12600955 ยท 2026-04-14
Assignee
Inventors
Cpc classification
C12N2710/16643
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N2710/16651
CHEMISTRY; METALLURGY
C12N2710/16622
CHEMISTRY; METALLURGY
C12N2710/16633
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61P35/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
Abstract
A recombinant herpes simplex virus type 1 (HSV-1), a recombinant HSV-1 vector, and a method of preparing the recombinant HSV-1, may enable easy genetic modification, as a relatively large foreign gene may be inserted or various foreign genes may be inserted simultaneously, as ICP6 and IR regions are simultaneously deleted. These may be used in cancer treatment as an oncolytic virus that is safe, while having an excellent effect in killing cancer cells.
Claims
1. A recombinant herpes simplex virus type 1 (HSV-1) strain KOS, comprising: an HSV-1 genome, in which an infected-cell protein 6 (ICP6) region among genomic regions of HSV-1 is deleted, and the nucleotide sequence of SEQ ID NO:2 among nucleotide sequences of the internal repeat (IR) region between a unique long (UL) region and a unique short (US) region is deleted, wherein the recombinant HSV-1 is replication-competent and is an oncolytic virus that activates immune cells by exposing antigens of cancer cells by specifically killing cancer cells, wherein the simultaneous deletion of ICP6 and a nucleotide sequence of SEQ ID NO:2 enhances the ability to selectively kill cancer cells, and wherein the cancer is lung cancer or glioma.
2. The recombinant HSV-1 of claim 1, comprising: a terminal repeat of a long (TRL) region; a UL region comprising a nucleotide sequence of at least one gene selected from the group consisting of UL1 to UL38 and UL40 to UL56; a US region comprising a nucleotide sequence of at least one gene selected from the group consisting of US1 to US12; a terminal repeat of a short (TRS) region, or a combination thereof, as a genomic region.
3. The recombinant HSV-1 of claim 1, wherein the ICP6 region is a UL39 gene.
4. The recombinant HSV-1 of claim 1, having a genome in which the nucleotide sequence of SEQ ID NO: 1 among nucleotide sequences of HSV-1 and ICP6 genes is deleted.
5. The recombinant HSV-1 of claim 1, wherein the IR region comprises an internal repeat of a long (IRL) region and an internal repeat of a short (IRS) region.
6. The recombinant HSV-1 of claim 1, wherein a part of a nucleotide sequence of a UL56 gene is additionally deleted, as a deleted part of the nucleotide sequence of the UL56 gene.
7. The recombinant HSV-1 of claim 6, wherein the deleted part of the nucleotide sequence of the UL56 gene is the nucleotide sequence of SEQ ID NO: 3.
8. The recombinant HSV-1 of claim 1, comprising: the nucleotide sequence of SEQ ID NO: 4.
9. The recombinant HSV-1 of claim 1, exhibiting cancer cell or tumor cell specificity.
10. A recombinant HSV-1 vector, comprising: a genome nucleotide sequence of the recombinant HSV-1 of claim 1.
11. The 1 vector of claim 10, further comprising: a nucleotide sequence of a foreign gene.
12. A method of preparing a recombinant HSV-1 strain KOS, wherein the recombinant HSV-1 is replication-competent and is an oncolytic virus that activates immune cells by exposing antigens of cancer cells by specifically killing cancer cell, the method comprising: preparing a recombinant HSV-1 vector comprising a genome nucleotide sequence of HSV-1 strain KOS, in which an ICP6 region and the nucleotide sequence of SEQ ID NO:2 among nucleotide sequences of the IR region are deleted; and transfecting cells with the vector to obtain a recombinant HSV-1, wherein the simultaneous deletion of ICP6 and a nucleotide sequence of SEQ ID NO:2 enhances the ability to selectively kill cancer cells, and wherein the cancer is lung cancer or glioma.
13. The method of claim 12, wherein the recombinant HSV-1 vector comprises: a TRL region; a UL region comprising a nucleotide sequence of at least one gene selected from the group consisting of UL1 to UL38 and UL40 to UL56; a US region comprising a nucleotide sequence of at least one gene selected from the group consisting of US1 to US12; a TRS region, or a combination thereof.
14. A method of treating lung cancer or glioma, the method comprising: administering an effective amount of the recombinant HSV-1 of claim 1 to a subject in need thereof, thereby treating the lung cancer or glioma.
15. A method of treating lung cancer or glioma, the method comprising: administering an effective amount of the vector of claim 10 to a subject in need thereof, thereby treating the lung cancer or glioma.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13) wherein
MODE OF DISCLOSURE
(14) Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.
Example 1: Construction of Recombinant HSV-1 (ICP6IR HSV-1) in which ICP6 and IR Regions are Deleted
(15)
(16) First, ICP6 HSV-1 in which a part of the ICP6 region is deleted is prepared from a genomic sequence of the HSV-1 WT. The nucleotides 86,364 to 89,777 in the wild-type HSV-1 genome sequence constitute a sequence encoding the ICP6 gene. The nucleotides 86,901 to 89,578, which are a part of the ICP6 gene, were deleted using a method known in the art, and this was names as ICP6 HSV-1 virus.
(17)
(18) Next, ICP6IR virus from which the ICP6 and IR regions are deleted was constructed using the ICP6 HSV-1 virus as a template. In the wild-type HSV-1 genome sequence, the nucleotides 116,141 to 116,846 constituted a UL56 sequence, and the IR region was broadly composed of b(117,080 to 125,845), a(125,846 to 126,240), and c(126,241 to 132,463). In this region, the nucleotides 116,200 to 131,261 corresponding to a partial region of UL56 gene to a partial region of IR region were deleted using a method known in the art. This was named ICP6IR HSV-1 virus.
Example 2: Construction of ICP6-IR-rpsL-Neo to which Foreign Gene rpsL-Neo is Inserted
(19) A foreign gene, 1319 bp, which is an rpsL-neo gene, was inserted to the ICP6IR HSV-1 of Example 1, from which the ICP6 gene and the IR gene were simultaneously deleted, to construct a virus, and the insertion of the foreign gene of the virus was evaluated.
(20) In particular, as shown in Table 1, a UL56-rpsL-neo primer having a sequence complementary to UL56 and rpsL-neo and a UsIR-rpsL-neo primer having a sequence complementary to UsIR and rpsL-neo were prepared. After adding a 2 green master mix (thermo scientific) reaction enzyme to 10 pmol of the UL56-rpsL-neo primer and the UsIR-rpsL-neo primer, PCR was performed with 200 ng of the rpsL-neo gene as a template. The PCR product was transformed into DH10b Escherichia coli together with the ICP6 total vector of Example 1 to induce homologous recombination to prepare ICP6-IR-rpsL-neo expressing rpsL-neo.
(21)
(22)
(23) TABLE-US-00001 TABLE1 SEQ Primer ID name NO. Sequence UL56- 5 5- rpsL- acaggaataccagaataatgaccaccacaatcgc neo gaccaccccaaatacaGGCCTGGTGATGATGGGG GATCG-3 (underline:sequencecomplementary toUL56,bold:sequence complementarytorpsL-neo) UsIR- 6 5- rpsL- cccgaggacgccccgatcgtccacacggagcgcg neo gctgccgacacggatcTCAGAAGAACTCGTCAAG AAGGCG-3 (bold:sequencecomplementaryto rpsL-neo,underline:sequence complementarytoUsIR)
(24) PCRs were performed using the PCR primers in Table 2 to evaluate production of the homologous recombination. Conditions of each of the PCRs were as follows. After adding a 2 green master mix (thermo scientific) reaction enzyme to 10 pmol of the UL55 S primer and the UsIR-rpsL-neo AS primer, each of the PCRs was performed with 200 ng of the rpsL-neo gene as a template; and denaturing the resultant at 95 C. for 30 seconds, annealing at 58 C. for 30 seconds, and extending at 72 C. for 2 minutes in the PCR machine (Bio-rad). To confirm rpsL-neo and glycoprotein C, PCR was performed under conditions denaturing the resultant at 95 C. for 30 seconds, annealing at 58 C. for 30 seconds, and extending at 72 C. for 30 seconds at the same mixture ratio.
(25) TABLE-US-00002 TABLE2 SEQID Primername NO. Sequence(5.fwdarw.3) UL55S 7 ACGCGTCGACtaaaaacaaaacatttcaa acaaatcgcccca UsIR-rpsL 8 cccgaggacgccccgatcgtccacacgga neoAS gcgcggctgccgacacggatcTCAGAAGA ACTCGTCAAGAAGGCG rpsLneoS 9 CGGCATCGCCCTAAAATTCGGCGTCCTC rpsLneoAS 10 AAGAACCGGGCGCCCCTGCGCTGACAGC gCS 11 CAGATCCGATGCCGGTTTCGGAATTCCAC CCG gCAS 12 CGGGTTAAACACCTGGCGGTCGTCCTCGA AC ICP6R-rpsL- 13 GTTCCTGTCGCGACACACGGCGCCGCTCT neoS GCGGTATTCGGGGGGGAGGGGGGCCTGGT GATGATGGCGGGATCG ICP6R-rpsL- 14 AGGGTCCCGTCCGCCTTCTCCGTGACATA neoAS CAGGGTCATGGATTGGCTATGTCAGAAGA ACTCGTCAAGAAGGCG
(26)
(27)
(28) Therefore, it was confirmed that the rpsL-neo gene, a foreign gene, was successfully inserted to the ICP6IR virus.
Example 3: Construction of ICP6IR Virus
(29) The rpsL-neo gene, a foreign gene, was deleted from the ICP6-IR-rpsL-neo prepared in Example 2 to prepare ICP6IR virus.
(30) In particular, after preparing the primers in Table 3, a primer annealing method was performed to prepare a two-stranded oligomer having a complementary sequence bound thereto. The prepared oligomer was transformed into DH10b E. coli together with the ICP6-IR-rpsL-neo total vector of Example 2 to induce homologous recombination to prepare dICP6-dIR.
(31) TABLE-US-00003 TABLE3 Primer SEQID name NO. Sequence(5->3) IRS 15 ACAGGAATACCAGAATAATGACCACCACAATCGCG ACCACCCCAAATACAGATCCGTGTCGGCAGCCGCG CTCCGTGTGGACGATCGGGGCGTCCTCG IRAS 16 CGAGGACGCCCCGATCGTCCACACGGAGCGCGGCT GCCGACACGGATCTGTATTTGGGGTGGTCGCGATT GTGGTGGTCATTATTCTGGTATTCCTGT
(32) To confirm whether the ICP6IR virus from which the foreign gene was deleted was successfully constructed or not, PCR was performed using the PCR primers above. After adding a 2 green master mix (thermo scientific) reaction enzyme to 10 pmol of a UL55 S primer and an AIR AS primer, PCR was performed with 200 ng of ICP6IR as a template in the PCR machine (Bio-rad) under the conditions of denaturing the resultant at 95 C. for 30 seconds, annealing at 58 C. for 30 seconds, and extending at 72 C. for 1 minute. To confirm rpsL-neo, PCR was performed under conditions denaturing the resultant at 95 C. for 30 seconds, annealing at 58 C. for 30 seconds, and extending at 72 C. for 30 seconds at the same mixture ratio.
(33) As a result, it was confirmed that IR was successfully removed since a band of a size of 1 kb of the prepared ICP6IR virus was confirmed the same with that of the positive control.
(34)
(35)
(36) Thus, it confirms that the ICP6IR virus with the foreign gene removed therefrom was successfully prepared.
(37) Experimental Example 1: Confirmation of anticancer effects and safety of ICP6IR virus of Example 3
(38) A549 (human lung cancer, ATCC CRM-CCL-185TM), U251N (human glioma, ATCC), and VERO (monkey normal kidney, ATCC CCL-81) cells were divided into a 6-well plate at a density of 3.510.sup.5 cells/well, and HswC (iXcells, 10HU-188) cells were divided at a density of 310.sup.5 cells/well. After 24 hours, each of a wild-type HSV-1, a ICP6 virus from which only ICP6 is deleted, a AIR virus from which only IR is deleted, and a ICP6IR virus from which both ICP6 and IR are deleted was infected with 0.1 MOI.
(39) After 24 hours, 48 hours, 72 hours, and 120 hours, the cells and the supernatants were all collected and centrifuged at 4 C. for 10 minutes at 3000 rpm. Thus obtained pellets and the supernatants were separated, and the supernatants were remained at 4 C., and after freezing/thawing the pellets three times, the supernatants were added with the pellets, and the resultants were centrifuged once again at 4 C. for 10 minutes at 3000 rpm. Thereafter, only the supernatants were separated and a plaque assay was performed as follows.
(40) VERO cells divided into a 12-well plate at a density of 1.510.sup.5 were infected with the supernatants obtained as described above. After 8 hours, 1 ml of 1% methylcellulose was added to the cells. 3 days after the infection, the cells were dyed with 1% crystal violet staining solution to count the number of plaques.
(41) As a result, it was confirmed that ICP6IR showed cancer cell killing ability similar to that of wild-type virus HSV-1 and cancer cell killing ability higher than that of ICP6 or AIR. Also, progeny virus of low titer was produced in HswC cells, showing the characteristics of a vector that is safe for humans.