Maize gene KRN2 and uses thereof

12600976 ยท 2026-04-14

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein are KRN2 gene controlling kernel row number in plant, molecular markers closely linked to KRN2 and their application in molecular breeding.

Claims

1. A construct comprising a sequence encoding a guide RNA designed to target the KRN2 gene, wherein the expression of the construct in a maize plant together with the expression of a Cas-associated gene results in a loss-of-function in the KRN2 gene.

2. A transgenic maize plant, maize plant part or maize plant cell thereof comprising the construct of claim 1.

3. A seed produced by growing the transgenic maize plant according to claim 2, wherein the seed comprises the loss-of-function in the KRN2 gene.

4. A maize plant, maize plant cell, or maize plant parts thereof, grown from the seed of claim 3.

5. A commodity product made from the maize plant, maize plant cell, or maize plant parts thereof, of claim 4, wherein the commodity product comprises a construct comprising a sequence encoding a guide RNA designed to target the KRN2 gene, wherein the expression of the construct in a maize plant together with the expression of a Cas-associated gene results in a loss-of-function in the KRN2 gene.

6. The commodity product of claim 5, wherein the commodity product is protein concentrate, protein isolate, cereal, meal, flour or biomass.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: Comparison of KRN between B73 and MT-6. a and b. Ear performance of B73 and MT-6; c. KRN of B73 and MT-6.

(2) FIG. 2: Genetic map of the B73/MT-6 F.sub.2 population, wherein the three boxes in light grey, dark grey and black represent the mapped QTL positions using data from three environments, Hainan, Beijing and Henan, respectively.

(3) FIG. 3: LOD profile of the qKRN2.

(4) FIG. 4: a. primary fine mapping of qKRN2 using BC.sub.4F.sub.2 and BC.sub.5F.sub.1 recombinant plants, wherein qKRN2 was narrowed down to a region between markers M8 and IDP1612; b. further fine mapping of qKRN2 using BC.sub.4F.sub.3, BC.sub.5F.sub.2, BC.sub.5F.sub.1 and BC.sub.6F.sub.1 recombinant plants, wherein qKRN2 was narrowed down to a region between markers M31 and MIL. In FIGS. 4a and 4b, the genotype of different recombinant plants was shown in the left panel, wherein homozygous B73/B73 was shown in white box, heterozygous MT-6/B73 was shown in black box; the phenotype of homozygous progeny from selfed heterozygous recombinant plants was shown in the light panel, wherein homozygous B73/B73 was shown in light grey (A), homozygous MT-6/MT-6 was shown in dark grey (B). N.sub.A/N.sub.B denotes the number of phenotype A/B. P-value represents the significance of difference between phenotype A and B in progeny of the same recombinant plant. ** denotes very significant difference statistically.

(5) FIG. 5: a. Representative ears of near isogenic lines NIL.sup.B73 and NIL.sup.MT-6; b. statistical results of KRN of NIL.sup.B73 and NIL.sup.MT-6; c. expression levels of KRN2 in immature ear of NIL.sup.B73 and NIL.sup.MT-6. NIL.sup.B73 is a near isogenic line in which the target segment is B73 allele; NIL.sup.MT-6 is a near isogenic line in which the target segment is MT-6 allele. * denotes significant difference statistically; ** denotes very significant difference statistically.

(6) FIG. 6: a. gene structure of KRN2 and the insertion site of Mu transposon in mutant krn2-1; b. genotype of wild-type (WT) and mutant krn2-1, wherein M1 represents the PCR amplification result using specific upstream and downstream primers of the KRN2 gene, M2 represents the PCR amplification result using specific downstream primer of the KRN2 gene and primer TIR8-1 specific to the transposon; c. Representative ears of WT and krn2-1; d. statistical results of KRN of WT and krn2-1. ** denotes very significant difference statistically.

(7) FIG. 7: Scheme of the vector pBCXUN-Myc used for overexpression.

(8) FIG. 8: Relative expression level of the KRN2 gene (a) and the statistical results of KRN (b) in KRN2-overexpressed maize lines (OE) and WT. ** denotes very significant difference statistically.

(9) FIG. 9: Two target sites designed for the CRISPR/Cas9-mediated gene editing; b. sequencing results of new lines CR-krn2-1 and CR-krn2-2 produced by CRISPR/Cas9-mediated gene editing; c. the statistical results of KRN of CR-krn2-1 and CR-krn2-2. ** denotes very significant difference statistically. FIG. 9 discloses SEQ ID NOs. 26-31, respectively, from left to right.

(10) FIG. 10: Representative panicles of positive progeny plants of overexpressing transgenic lines (OE) in rice and Nipponbare (WT); b. relative expression levels of the OsKRN2 gene in the overexpressing transgenic lines (OE) in rice and Nipponbare (WT); c-e. the statistical results of primary branches (c), secondary branches (d) and grain number per panicle (e) in the overexpressing transgenic lines (OE) in rice and Nippon bare (WT). ** denotes very significant difference statistically.

(11) FIG. 11: a. A single target site designed for the CRISPR/Cas9-mediated gene editing; b. sequencing results of new lines CR-oskrn2-1, CR-oskrn2-2 and CR-oskrn2-3 produced by CRISPR/Cas9-mediated gene editing; c. representative rice panicles of three gene-edited lines and the corresponding WT; d-f. the statistical results of primary branches (d), secondary branches (e) and grain number per panicle (f) in the three gene-edited new lines and the corresponding WT. ** denotes very significant difference statistically. FIG. 11 discloses SEQ ID NOs. 32-35, respectively, in order of appearance.

(12) FIG. 12: the statistical results of multiple agricultural traits in near isogenic lines NIL.sup.B73 and NIL.sup.MT-6: KRN (a), kernel number per ear (b), kernel weight per ear (c), 100-kernel weight (d), grain yield (e), ear weight (f), ear diameter (g), cob diameter (h), cob weight (i), ear length (j), kernel number per row (k), plant height (1), ear height (m), days to anthesis (n), days to silking (o), leaf angle (p), leaf length (q), leaf width (r), tassel length(s) and tassel branch number (t). * denotes significant difference statistically; ** denotes very significant difference statistically.

EXAMPLES

(13) The invention will be described in detail below with reference to the figures and the examples. It should be understood that the figures and examples of the present invention are intended to be illustrative only and do not limit the scope of the present invention in any way. The examples of the present application and the features in the examples may be combined with each other without contradiction.

Example 1: QTL Mapping for KRN in Maize

(14) 1. Development of a Maize Inbred Line MT-6

(15) The maize inbred line Mo17 (187-2C103, America), as the female parent, was crossed with the male parent teosinte X26-4 (Accession No. PI566686; Zea mays ssp. mexicana) to obtain F.sub.1 generation, and progeny plants with fewer KRN was selected and selfed continuously, resulting in a material having a KRN of 6 which can be stably inherited. Said material is designated MT-6. FIG. 1 shows the comparison of KRN between B73 (BSSS, America) and MT-6.

(16) 2. Construction of the F.sub.2 and F.sub.2:3 Populations

(17) The maize inbred line B73 was crossed with MT-6 to obtain F.sub.1, one plant was selected and selfed to obtain 266 F.sub.2 progeny plants, which forms the F.sub.2 population. Meanwhile, each F.sub.2 plant was selfed, resulting in 266 families which constitute the F.sub.2:3 population.

(18) 3. Investigation of KRN in the F.sub.2 and F.sub.2:3 Populations

(19) 266 F.sub.2 plants were grown in Hainan in 2010. Further, 266 F.sub.2:3 families were grown in Beijing and Henan in 2011 using a randomized complete block design. Each F.sub.2:3 family was grown in a single row (each row is 3 m, with 0.67 m distance between rows) at a density of 45,000 plants/hectare. Then, the KRN of each plant in the F.sub.2 population and of 8 plants in each F.sub.2:3 family (shown as an average value) was measured. The kernel row number per ear means the row number of grains in the ear. Results are shown in the following Table 1.

(20) TABLE-US-00001 TABLE 1 KRN in the F.sub.2 and F.sub.2:3 populations Population/Condition Average SD Variation range F.sub.2/Hainan 11.0 1.5 8.0-16.0 F.sub.2:3/Beijing 10.6 1.3 8.0-14.7 F.sub.2:3/Henan 10.1 1.4 8.0-14.0
4. Screening of Polymorphic Markers

(21) Polymorphic markers were selected in the whole genome from a public maize database (http://www.maziegdb.org). Primers were designed against each polymorphic marker, and were used for PCR amplification with the genomic DNA of B73 and MT-6 as template. The system and procedure for PCR amplification are shown in the following Table 2 and 3, respectively:

(22) TABLE-US-00002 TABLE 2 PCR amplification system DNA (10 ng/L) 3 L 10 buffer 1.0 L dNTP (2.5 mM) 0.8 L Forward primer (10 M) 0.3 L Reverse primer (10 M) 0.3 L Tag enzyme (2.5 U/L) 0.1 L ddH.sub.2O 4.5 L Total 10 L

(23) TABLE-US-00003 TABLE 3 PCR amplification procedure Temperature Time Cycles Step 1 95 C. 5 min 1 Step 2 95 C. 30 sec 36 56-62 C. 30 sec 72 C. 60 sec Step 3 72 C. 10 min 1 Step 4 15 C. keep

(24) The molecular markers polymorphic between B73 and MT-6 were selected to map QTL for KRN in the example. Finally, 192 polymorphic markers distributed on 10 chromosomes were obtained, as shown in FIG. 2.

(25) 5. Construction of a Linkage Map and Primary QTL Mapping for KRN

(26) As shown in FIG. 2, the length of the genetic map of the B73/MT-6 F.sub.2 population, constructed by 192 polymorphic markers is 1230.5 cM, and the average distance between markers is 6.4 cM. Together with the phenotypes (i.e., the observed KRN), QTL mapping was carried out for KRN using composite interval mapping (CIM) presented in Windows QTL Cartographer 2.5 software. The QTL controlling KRN was detected on chromosome 2, designated as qKRN2. As shown in FIG. 3, the LOD value of qKRN2 is always significantly greater than the threshold value of 3.4 in different generations or environments, indicating the presence of a QTL in this region (i.e., the detected result is true positive). Further as supported by the following Table 4, qKRN2 is located at around 55.0 cM in the genome, and the confidence interval is 18.2 cM (i.e., the genetic distance between the marker umc2193 and umc1259). This qKRN2 explains 9.4%-16.1% of the phenotypic variance, and is a major QTL controlling KRN in maize.

(27) TABLE-US-00004 TABLE 4 Effects of qKRN2 in different generations or environments Peak position of the Addi- Dom- Flanked max generation/ tive inant LOD contri- QTL markers LOD condition effect effect value bution qKRN2 umc2193- 55.0 cM F.sub.2/Hainan 0.76 0.02 8.1 9.4% umc1259 51.0 cM F.sub.2:3/Beijing 0.82 0.1 16.9 16.1% 55.0 cM F.sub.2:3/Henan 0.74 0.12 14.2 14.0%

Example 2. Primary Fine Mapping of qKRN2

(28) B73 was crossed with MT-6 to obtain F.sub.1, which was back-crossed with B73 to obtain BC.sub.1F.sub.1. Plants with heterozygous alleles in the interval of QTL-qKRN2 were selected from the BC.sub.1F.sub.1 population using 8 markers between umc2193 and umc1259 (among them 7 markers are known: TIDP3276, IDP8454, IDP1612, IDP4525, IDP7742, IDP7551 and IDP1415; 1 marker is newly developed by the inventors: M8 between IDP8454 and IDP1612, the primer sequences of which are shown as SEQ ID NOs: 4 and 5), and continuously back-crossed with B73 until BC.sub.4F.sub.1 was obtained. The BC.sub.4F.sub.1 population was selfed, resulting in two homozygous lines with QTL-qKRN2 being B73 and MT-6 alleles, respectively (i.e., NIL.sup.B73 and NIL.sup.MT-6), which are designated as near isogenic lines.

(29) Meanwhile, BC.sub.4F.sub.1 was selfed to obtain a BC.sub.4F.sub.2 population, and BC.sub.4F.sub.1 was back-crossed with B73 to obtain a BC.sub.5F.sub.1 population. Recombinant plants were screened using the above 8 molecular markers from around 10,000 BC.sub.4F.sub.2 and BC.sub.5F.sub.1 plants, in which the QTL region comprises multiple markers and one or more of markers are heterozygous. Recombinant plants in which the recombination site is between two different adjacent markers were selfed to produce new near isogenic lines.

(30) The kernel row number of 30 NIL.sup.B73 and NIL.sup.MT-6 plants were investigated respectively, and Student's t tests were carried out the significant test. If the P value is greater than 0.05, there is no significant difference between KRN of near isogenic lines, and thus the different region of the near isogenic lines does not comprise the target qKRN2; if the P value is less than 0.05, there is significant difference between KRN of near isogenic lines, and thus the target qKRN2 falls within the different region of the near isogenic lines. The results of t test are shown in FIG. 4a. Accordingly, the target region was further narrowed down to around 2.4-Mb genomic interval between the markers M8 and IDP1612.

Example 3. Further Fine Mapping of gKRN2

(31) 1. Design of New Polymorphic Markers

(32) Primers were designed against the genomic sequence between markers M8 and IDP1612 in B73 using the Primer5.0 software. PCR amplification was performed on the genomic DNA of B73 and MT-6 plants using the designed primers, and the amplified products were isolated using gel electrophoresis. Markers (InDel markers) resulting in amplified products polymorphic between B73 and MT-6 are used for further fine mapping of qKRN2 in the example. The InDel markers and the corresponding primer sequences used for further fine mapping in the example are shown in Table 5.

(33) TABLE-US-00005 TABLE5 InDelmarkersandprimersequencesbetweenM8and IDP1612 Amplified Name position Upstreamprimer Downstreamprimer product(B73) M8 16.37Mb CACAAGACTACAAGGACGAGA GGCAGGAAGGAGGAAGAAGA 1260bp (SEQIDNO:4) (SEQIDNO:5) M13 16.58Mb CCGCAAATCTCCGCACAC TGATCCACCGCCAAAATACAG 1326bp (SEQIDNO:6) (SEQIDNO:7) M20 16.85Mb TAAGGGTGCGAATGGAAAG GGGGGACACGTCGTAGGT 845bp (SEQIDNO:8) (SEQIDNO:9) M27 17.09Mb GCTCGTTCCGTAGTGTAGTCTG CAGAACCACGACTATTTATCCG 736bp (SEQIDNO:10) (SEQIDNO:11) M31 17.276Mb ATGTCTCCCACTGCTGCTAC CCTCCGTGACCTCATCGTC 397bp (SEQIDNO:12) (SEQIDNO:13) MIL 17.30Mb AGTTGATCGCTCGTCCTG TGTCAGGTGACCCATCCC 903bp (SEQIDNO:14) (SEQIDNO:15) M36 17.56Mb ACGGGCGACGAGAAGAAC CAGCATCAGACCCTCACTACC 973bp (SEQIDNO:16) (SEQIDNO:17)

(34) New recombinant plants were screened from around 18,000 plants in the BC.sub.4F.sub.3, BC.sub.5F.sub.2, BC.sub.5F.sub.1 and BC.sub.6F.sub.1 populations using the above InDel markers. Specifically, the lines heterozygous in the target QTL region and with a significant KRN difference between near isogenic lines were selected from the BC.sub.4F.sub.2 and BC.sub.5F.sub.1 populations used for primary fine mapping. Said lines were selfied, resulted in BC.sub.4F.sub.3 and BC.sub.5F.sub.2 populations, and the selected BC.sub.5F.sub.1 lines were back-crossed with B73 to obtain BC.sub.6F.sub.1 population. The genotypes of the target QTL region were detected by the InDel markers as shown in Table 5. If the InDel markers exhibit a combination of B73 band and heterozygous band, it is defined as a recombinant plant. If said combination never appears in the BC.sub.4F.sub.2 and BC.sub.5F.sub.1 populations used for primary fine mapping, it is defined as a new recombinant plant.

(35) The screened new recombinant plants were selfied, and t tests were performed for KRN of the progeny plants. If the P value is greater than 0.05, there is no significant difference between KRN of near isogenic lines, and thus the different region of the near isogenic lines does not comprise the target qKRN2; if the P value is less than 0.05, there is significant difference between KRN of near isogenic lines, and thus the target qKRN2 falls within the different region of the near isogenic lines. The results of t test are shown in FIG. 4b. Accordingly, the target region was further narrowed down to an around 20.82-Kb interval between the markers M31 and MIL.

(36) Based on maize genome reference sequences, there is only one gene encoding a WD40 repeat protein between the markers M31 and MIL, and the inventors designated it as KRN2 gene in the present application. It is known that the WD40 repeat protein family plays multiple roles in the development of plants, including signaling, chromatin assembly, RNA processing and the like. However, its correlation with the kernel row number trait has not been reported yet.

(37) The amino acid sequence of the protein encoded by KRN2 gene is shown in SEQ ID NO: 1. This protein consists of 696 amino acids, and comprises a protein domain, WD40 repeat sequence with unknown function.

(38) The genomic sequence (including introns) of KRN2 gene is shown in SEQ ID NO: 2. This sequence consists of 7421 nucleotides, wherein nucleotides 368-3367 represent a promoter sequence.

(39) The cDNA sequence of KRN2 gene is shown in SEQ ID NO: 3, which consists of 2853 nucleotides, and wherein nucleotides 310-2400 is the protein encoding sequence.

(40) This KRN2 gene has not been cloned in maize yet, and there is no report regarding its homologous genes in other model plants such as Arabidopsis and rice. Thus, it is of significant importance to carry out a deep analysis on this gene.

Example 4. Analysis of KRN2 Effects

(41) The kernel row number of 27 NIL.sup.B73 plants and 25 NIL.sup.MT-6 plants were investigated. It was observed that KRN of NIL.sup.MT-6 is 1.3 rows fewer than that of NIL.sup.B73 (P value<0.01, see FIG. 5 and Table 6). In terms of genotype, NIL.sup.B73 and NIL.sup.MT-6 have the same genetic background, with only difference lying in the region adjacent to the marker M31 (i.e., location of the KRN2 gene). In other words, the KRN difference between NIL.sup.B73 and NIL.sup.MT-6 is due to the KRN2 gene located in this region, a major QTL controlling the kernel row number trait.

(42) TABLE-US-00006 TABLE 6 Analysis of KRN2 effects IDP Average P Markers M8 M27 M31 MIL 1612 KRN SE N value effects NIL.sup.B73 A A A A A 16.71 27 6.1 1.3 0.24 10.sup.4 NIL.sup.MT-6 A A B A A 15.43 25 0.27

(43) Notes: A denotes markers being the same as the parent B73, B denotes markers being the same as the parent MT-6.

(44) The above statistical analysis results indicate that, the QTL identified in the present application, qKRN2, is a major QTL controlling the kernel row number trait.

(45) The inventors also measured the expression level of KRN2 in immature car of NIL.sup.B73 and NIL.sup.MT-6, and found that the KRN2 gene has a significant higher expression level in the immature ear of NIL.sup.MT-6 than that in the immature ear of NIL.sup.B73 (see FIG. 5c), indicating that the kernel row number trait is negatively regulated by the KRN2 gene. That is, the higher the expression level of KRN2 gene, the fewer the kernel row number.

Example 5: Verification of the Effects of KRN2 Gene Controlling Kernel Row Number in Maize

(46) A Mu transposon mutant of the KRN2 gene, krn2-1, was ordered from Maize Stock Center. The krn2-1 mutant has a Mu transposon inserted in the first exon of the KRN2 gene, specifically between the positions 682 and 683 of SEQ ID NO: 3, as shown in FIG. 6a. Wild type plants were identified using gene specific primers (upstream primer sequence: TAGGCTGTAGGATGGAGATG (SEQ ID NO: 18), and downstream primer sequence GACCTTGACCCTTTCATACC (SEQ ID NO: 19), and homozygous krn2-1 mutant plants were identified using the downstream primer sequence as shown in SEQ ID NO: 19 and a transposon specific primer TIR8-1: CGCCTCCATTTCGTCGAATCCCCTS (SEQ ID NO: 20). The results are shown in FIG. 6b. The transposon insertion in the KRN2 gene was confirmed in the krn2-1 mutant plants.

(47) The phenotype of wild-type plants and krn2-1 mutants were investigated. As shown in FIGS. 6c and 6d, the wild type has an average KRN of 14.38, while the homozygous krn2-1 mutant has an average KRN of 16.76. Thus, the krn2-1 mutant has a significantly increased KRN compared to the wild-type, and the increased KRN is about 2.38.

(48) Thus, it was confirmed that the KRN2 gene is capable of controlling the kernel row number trait in maize.

Example 6. Effects of KRN2 Gene Controlling KRN in Maize Verified by Overexpression Systems

(49) 1. Construction of a recombinant expression vector comprising a nucleic acid molecule encoding the KRN2 protein: a fragment of nucleotides 310-2400 of the cDNA as shown in SEQ ID NO: 3 was cloned into the overexpression vector pBCXUN-Myc (see FIG. 7) between two XcmI sites by enzyme digestion and ligation, and the promoter is Ubiquitin promoter. The recombinant expression vector was verified by sequencing. 2. The recombinant expression vector was transformed in the EHA105 Agrobacteria to obtain recombinant Agrobacteria comprising the recombinant expression vector, which was further used for transfection of embryo cells of maize lines, such that the nucleic acid molecule was integrated into the maize genome to obtain a recombinant cell. Methods for transformation of the expression vector and transfection of the Agrobacteria involved in this process as well as the used reagents are known to one skilled in the art. 3. The recombinant cell was cultured to obtain a transgenic maize seedling, from which at least one seed comprising the above nucleic acid molecule in its genome was collected.

(50) Said seed was planted, the expression level of the KRN2 gene as well as the KRN phenotype were observed for the grown plants. FIG. 8 shows the expression level of the KRN2 gene (see FIG. 8a) as well as the KRN phenotype (see FIG. 8b) in three representative lines KRN2-OE1, KRN2-OE3 and KRN2-OE4. It was found that KRN of the three transgenic lines with overexpressed KRN2 gene have 2 rows fewer than the wild-type (P<0.01).

Example 7. Preparation of Maize Lines With Increased KRN by Gene Editing of the KRN2 Gene

(51) 1. Construction of CRISPR/Cas9 vectors each comprising a specific gRNA target in the KRN2 gene: two specific gRNA target sites in the KRN2 gene were selected (see FIG. 9a, gRNA-KRN2-1 sequence: GGCCCTGCATTGCCGTGGT (SEQ ID NO: 23), target site: nucleotides 3470-3488 of SEQ ID NO: 2; gRNA-KRN2-2 sequence: AGAGTGCTGCCCGGCTCCC (SEQ ID NO: 24), target site: nucleotides 3547-3565 of SEQ ID NO: 2), and two pairs of primers were designed accordingly. PCR amplification was performed using vector pCBC-MT1T2 as a template. PCR product was recovered and ligated into the pBUE411 vector using a digestion-ligation system comprising BsaI endonuclease and T4 ligase. A recombinant Cas9 vector was obtained and verified by PCR and sequencing. 2. The recombinant Cas9 vector was transformed in the EHA 105 Agrobacteria to obtain recombinant Agrobacteria comprising the recombinant Cas9 vector, which was further used for transfection of embryo cells of maize lines, so as to obtain a recombinant cell. 3. The recombinant cell was cultured to obtain a transgenic maize seedling. The T.sub.0 generation was sequenced and identified for the target sites. Maize new lines CR-krn2-1 and CR-krn2-2 having 64bp and 73bp deletion in the KRN2 gene were obtained respectively (see FIG. 9b). These two new lines have loss-of-function in the KRN2 gene.

(52) Seeds of the new lines were planted, and the KRN phenotype was observed for the grown plants. Compared to the wild-type control, the KRN of the two new lines produced by gene editing increased around 1.8, which difference is statistically significant (see FIG. 9c).

Example 8. Application of InDel Markers of the Invention in Screening of the Breeding Material

(53) InDel markers of the invention as shown in Table 5 were used to detect the genotypes of the materials to be screened. Materials with the same bands as B73 were selected as excellent materials having increased KRN.

(54) Specifically, the genotypes of various samples were detected by PCR using InDel markers of the invention as shown in Table 5, and statistical analysis was performed. Meanwhile, KRN of each sample was counted. Results are shown in Table 7.

(55) TABLE-US-00007 TABLE 7 Analysis of KRN in different samples B73 genotype MT-6 genotype Number Number of Average of Average KRN Marker plants KRN plants KRN difference P value M8 33 17.03 54 15.3 1.73 6.06 10.sup.6 M13 33 16.73 39 14.77 1.96 1.30 10.sup.7 M20 31 18 27 16.52 1.48 8.91 10.sup.4 M27 38 17.32 37 16 1.32 6.87 10.sup.5 M31 26 16.77 33 15.09 1.68 7.89 10.sup.7 MIL 34 16.76 23 15.13 1.63 9.93 10.sup.5 M36 29 17.1 37 15.83 1.27 4.21 10.sup.4

(56) As shown in the above table, for marker M8, 33 plants having the B73 genotype exhibited an average KRN of 17.03, while 54 plants having the MT-6 genotype exhibited an average KRN of 15.3. That is, the KRN of maize materials having a low KRN2 expression level in the major QTL region is 1.73 more than that having a high KRN2 expression level, which difference is statistically significant. Thus, marker M8 can be used to effectively screen maize materials with more KRN, i.e., maize materials with low KRN2 expression level. Same results were observed for other markers M13, M20, M27, M31, MIL and M36.

(57) Accordingly, the newly developed markers M8, M13, M20, M27, M31, MIL and M36 can be used to effectively screen maize with more KRN during the seedling stage, which saves the cost, improves the screening efficiency to select plants with more KRN in a faster manner, thus accelerating the breeding of high-yield maize.

(58) Thus, the present invention developed new molecular markers within the major QTL qKRN2 region responsible for the kernel row number trait, increased the abundance of the molecular markers in the target region, and obtained linkage map of the molecular markers in the target region. Further, M8, M13, M20, M27, M31, MIL and M36 closely linked to the target QTL were obtained by further mapping analysis of the QTL, which molecular markers can be applied to screen the KRN trait of the maize material such that maize varieties or lines with more KRN can be selected effectively. The present application also provides marker information for studies related to the yield QTL in maize.

Example 9. Effects of KRN2 Homologous Gene in Arabidopsis

(59) The inventors searched the Arabidopsis TIGR database using the amino acid sequence of maize KRN2 gene, and a protein sequence with Gene ID No. AT5G53500 was found to have the highest similarity with the KRN2 protein (a sequence identity of 40%). This homologous gene of KRN2 in Arabidopsis was designated as AtKRN2. CDS region of this AtKRN2 was ligated into the pCAMBIA 130 vector by digestion and ligation, so as to obtain an overexpression vector of AtKRN2 having a CaMV35S promoter. The recombinant expression vector was verified by sequencing.

(60) Meanwhile, the AtKRN2 gene was edited by CRISPR/Cas9. Specifically, two specific gRNA target sites in the AtKRN2 gene were selected, and two pairs of primers were designed accordingly. PCR amplification was performed using vector pCBC-MTIT2 as a template. PCR product was recovered and ligated into the pHEE401e vector using a digestion-ligation system comprising BsaI endonuclease and T4 ligase. A recombinant Cas9 vector was obtained and verified by PCR and sequencing.

(61) The above recombinant expression vector and recombinant Cas9 vector were transformed in the EHA105 Agrobacteria to obtain recombinant Agrobacteria comprising recombinant expression vector and and the recombinant Cas9 vector respectively, which recombinant Agrobacteria was further used for transfection of Arabidopsis (ecotype Columbia, T.sub.0 generation) inflorescence, so as to obtain a recombinant cell. The T.sub.0 generation was selfied to obtain T.sub.1 seeds, and positive seedlings were identified subsequently.

(62) The T.sub.1 seeds were planted, and the AtKRN2 gene expression level as well as inflorescence phenotype in Arabidopsis are observed.

Example 10. Effects of KRN2 Homologous Gene in Rice

(63) The inventors searched the NCBI database using the amino acid sequence of maize KRN2 gene, and a rice protein sequence with Gene ID No. OS04G0568400 (LOC_OS04G48010) was found to have the highest similarity with the KRN2 protein (a sequence identity of 74%). This homologous gene of KRN2 in rice was designated as OsKRN2 (SEQ ID NO: 21). CDS region of this OsKRN2 (SEQ ID NO: 22) was ligated into the pCUbi1390 vector by digestion and ligation, so as to obtain an overexpression vector of OsKRN2 in rice (Nipponbare background) deriven by a Ubiquitin promoter. The recombinant expression vector was verified by sequencing.

(64) Meanwhile, the LOC_OS04G48010 gene was edited by CRISPR/Cas9. Specifically, a single specific gRNA target site in the OsKRN2 gene was selected (see FIG. 11a, gRNA-OsKRN2-1 sequence: aggttcactcgtaccggaag (SEQ ID NO: 25), target site: nucleotides 620-640 of SEQ ID NO: 21), and one pair of primers were designed accordingly. The primers were annealed to form a primer dimer, which was ligated to a CRISPR/Cas9 comprising the Cas9 gene using a digestion-ligation system comprising AarI endonuclease and T4 ligase. A recombinant Cas9 vector was obtained and verified by PCR and sequencing.

(65) The above recombinant expression vector and recombinant Cas9 vector were transformed in the EHA 105 Agrobacteria to obtain recombinant Agrobacteria comprising recombinant expression vector and the recombinant Cas9 vector respectively, which recombinant Agrobacteria was further used for transfection of Nipponbare callus, so as to obtain a recombinant cell. The positive seedlings were identified in the T.sub.0 generation and T.sub.1 seeds were harvested subsequently.

(66) The T.sub.1 seeds were planted, and the OsKRN2 gene expression level as well as grain number per panicle in rice were observed. Results show that all three overexpression lines had significantly increased OsKRN2 gene expression level (see FIG. 10b) and decreased grain number per panicle, primary and secondary branches (see FIG. 10c-e) compared to the wild-type control. Moreover, significantly increased grain number per panicle, primary and secondary branches were observed in three gene-edited lines CR-oskrn2-1, CR-oskrn2-2 and CR-oskrn2-3 (see FIG. 11).

Example 11. Potential Value of KRN2 Gene for Improving Maize Yield

(67) Near isogenic lines NIL.sup.B73 and NIL.sup.MT-6 were grown in the same field environment (Tieling city, Liaoning Provence, 2017), and mulitiple agricultural traits were investigated for each plant, including days to anthesis, days to silking, ear height, plant height, leaf length, leaf width, leaf angle, tassel length, tassel branch number and the like. When the ears were matured and harvested, multiple traits of ears and kernels were investigated for well-grown ears, including ear weight, ear length, kernel number per row, kernel row number, ear diameter, kernel number per ear, kernel weight per ear, cob weight, cob diameter, 100-kernel weight, as well as grain yield. The experiment was repeated twice (i.e., 17TLR1 and 17TLR2).

(68) The Student's t test were performed for multiple traits of near isogenic lines NIL.sup.B73 and NIL.sup.MT-6. The results show that in NIL.sup.B73, KRN is significantly more than NIL.sup.MT-6, while 100-kernel weight, ear length, and kernel number per row remains unchanged, resulting in significant higher kernel number per ear, kernel weight per ear, gain yield and ear weight than NIL.sup.MT-6 (see FIG. 12a-c and e-f). Besides, compared to NIL.sup.MT-6, NIL.sup.B73 also showed improved ear diameter, cob diameter and cob weight (see FIG. 12g-i). However, there was no significant difference in measured agricultural traits of plants (see FIG. 12l-t).

(69) These results indicate that the KRN2 gene is able to increase kernel number per ear, kernel weight per ear and ear weight by increasing KRN, thus to improve maize yield, while not significantly affects other agricultural traits. This has important application value for the genetic improvement of high-yield new maize varieties.