Coronavirus pseudovirus packaging system, packaging method therefor, and application of coronavirus pseudovirus in evaluating disinfection efficacy

12600988 ยท 2026-04-14

Assignee

Inventors

Cpc classification

International classification

Abstract

A packaging system for a coronavirus pseudovirus, including a vesicular stomatitis virus (VSV) vector in which Fluc and EGFP dual-reporter genes replace a GP gene, and packaging cell that expresses a coronavirus spike protein. The packaging system may quickly package pseudoviruses by using a one-step packaging method, and may be used in the research of coronaviruses such as COVID-19 (SARS-CoV-2), SARS (SARS-CoV) and MERS, and other viruses. The packaging system and thereby pseudovirus method may also be used to evaluate the efficacy of disinfectants by means of virus contamination distribution models, setting up scenarios, and sampling and testing steps.

Claims

1. A coronavirus pseudovirus packaging system, comprising a modified vesicular stomatitis virus (VSV) and a packaging cell that expresses a coronavirus spike protein; wherein the coronavirus is SARS, MERS, or COVID-19 virus, and the amino acid sequence of the spike protein is set forth in SEQ ID NO: 4 or SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7; the modified vesicular stomatitis virus VSV is defined as a replication-defective virus with structural gene replaced by Fluc and EGFP dual-reporter genes, the modified vesicular stomatitis virus VSV is named as dVSVG-Fluc-EGFP, a gene coding GP in the genetic material of the VSV is replaced by Fluc reporter gene, the EGFP reporter gene is integrated between Fluc and VSV polymerase L gene, and the gene sequence of the dVSVG-Fluc-EGFP is set forth in SEQ ID NO: 3.

2. The coronavirus pseudovirus packaging system according to claim 1, wherein the packaging cell is selected from 293, 293T, 293sus, HEK293, HEK293T, HEK293FT, BHK, or Vero, and the packaging cell transiently or stably or inductively expresses the coronavirus spike protein, the transient expression is realized by transfecting the cell with an eukaryotic expression vector, the stable expression is realized by transducing the cell with a lentiviral vector system, and the induced expression is realized by transducing the cell with a tetracycline-regulated tet-on/off vector system.

3. A one-step packaging method for a pseudovirus packaging system, wherein the pseudovirus packaging system comprises the coronavirus pseudovirus packaging system according to claim 1, expression of the coronavirus spike protein is mediated by a transient expression plasmid or a stable expression plasmid or a stable and inducible expression lentivirus vector, dVSVG-Fluc-EGFP and the packaging cell that expresses the coronavirus spike protein are mixed in one step, and supernatant is collected after a certain time to obtain the coronavirus pseudovirus.

4. The one-step packaging method for the pseudovirus packaging system according to claim 3, comprising the following steps: (1) adding dVSVG-Fluc-EGFP to 293T cell that transiently or stably or inductively expresses VSV envelope protein GP, collecting supernatant after 24 h to obtain the amplified VSV replication-defective virus, and measuring its titer; and (2) passaging the packaging cell 293T that transiently or stably or inductively expresses the coronavirus spike protein into a 60 mm dish, adding dVSVG-Fluc-EGFP, wherein multiplicity of infection MOI is 0.1 to 5, culturing in an incubator at 32 C. to 37 C., harvesting pseudovirus supernatant after 24 h, then treating with anti-VSV neutralizing antibody for 2 h, and filtering with 0.22 m filter membrane to obtain coronavirus pseudovirus.

5. A coronavirus pseudovirus packaged by the coronavirus pseudovirus packaging system according to claim 1 as a biological indicator to replace a wild-type coronavirus for detection and evaluation of efficacy of a biological and chemical substance and a physical treatment method for inhibiting and disinfecting coronavirus, wherein the substance and the method for inhibiting and disinfecting coronavirus comprise an anti-coronavirus neutralizing antibodies, macromolecule and small-molecule drugs, physical virucidal disinfection methods, and chemical virucidal disinfectants.

6. A method of evaluating efficacy of a virucidal disinfectant using a coronavirus pseudovirus, comprising the following steps: (1) construction of virus-contaminated environment simulating distribution of a target virus under a virucidal disinfectant evaluation scene, including the existence of medium, temperature, humidity and gas disturbance, through analysis of virus contamination distribution models; diluting the packaged coronavirus pseudovirus, uniformly smearing the diluted coronavirus pseudovirus on a medium, and setting environmental parameters of evaluation scenarios; (2) determination of concentration of coronavirus pseudovirus before virucidal disinfection treatment based on the evaluation requirements, performing standard virus characteristic detection before treatment with sampling the coronavirus pseudovirus at different positions and different points; and (3) sampling and determination during and after virucidal disinfection treatment uniformly spraying or smearing the virucidal disinfectant on the medium; based on the evaluation requirements, selecting the positions and points selected in the step (2), sampling the coronavirus pseudovirus at different times, and detecting titer activity of the coronavirus pseudovirus.

7. The method according to claim 6, wherein the virus-contaminated environment in the step (1) comprises a logistics environment, a home environment, a public place environment, and a school environment.

8. The method according to claim 6, wherein multiple experimental groups are constructed in the step (1) to avoid excessive errors, and the step (3) comprises observing expression of fluorescent protein and luciferase after 293T-hACE2 is infected by the pseudovirus for measurement and calculation of infection capacity and bioactivity titer (TCID50 method, unit: PFU/ml) of the pseudovirus as well as detection of copy number of the pseudovirus nucleic acid (PCR method).

9. The method according to claim 6, wherein the virucidal disinfectant (peroxides, quaternary ammonium salts, chlorine-containing compounds, and alcohols) and the physical treatment method in the step (3) comprises combinations of one or more of ozone, peroxyacetic acid, hydrogen peroxide, chlorine dioxide, oxydol, sodium dichloroisocyanurate, ultraviolet light, negative ions, irradiation, or the like.

10. The method according to claim 6, wherein the medium in the step (1) and step (3) comprises one or more of a plastic, a foam, a bookbinding paperboard, a boxboard, a textile, and a metal foil.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a construction schematic diagram of dVSVG-Fluc-EGFP-based pseudovirus.

(2) FIG. 2 shows construction of COVID-19/SARS/MERS-S expression plasmid.

(3) FIG. 3 shows comparison of infection efficiency of COVID-19 pseudoviruses packaged with different S-truncates in different cells.

(4) FIG. 4 shows titer determination of different COVID-19 pseudoviruses in 293T-hACE2 detection cells.

(5) FIG. 5 shows effect of different sample collection time on titer of different types of pseudoviruses (different truncates at 3 end of S gene).

(6) FIG. 6 shows effect of pre-transfection with different amounts of envelope plasmid (pCA-C19-NA) on pseudovirus titer.

(7) FIG. 7 shows effect of transfection amount of spike protein in different packaging cells on titer of packaging COVID-19 pseudovirus.

(8) FIG. 8 shows expression of fluorescent reporter gene in 293T cells infected with dVSVG-Fluc-EGFP with different MOIs.

(9) FIG. 9 shows effect of adding VSV replication-defective virus with different MOIs to 293T cells on efficiency of assembling COVID-19 pseudovirus.

(10) FIG. 10 shows effect of different transfection time of COVID-19 envelope plasmid (pCA-COVID-19-C19 HA) on packaging efficiency.

(11) FIG. 11 shows effect of plasmid transient expression and inducible expression system and pseudovirus packaging sample collection time on titer of packaged pseudovirus.

(12) FIG. 12 shows effect of different DOX concentrations in the inducible packaging system on titer of packaged pseudovirus.

(13) FIG. 13 shows determination of package titer of different types of coronavirus at different temperatures.

(14) FIG. 14 shows stability test of different coronavirus pseudoviruses mediated by VSV vector, and effect of different temperatures on stability of coronavirus pseudoviruses.

(15) FIG. 15 shows stability test of different coronavirus pseudoviruses mediated by VSV vector, and effect of repeated freezing-thawing on stability of coronavirus pseudoviruses.

(16) FIG. 16 shows effect of storage time at 4 C. of COVID-19 pseudovirus system mediated by dVSVG-Fluc-EGFP dual-reporter genes vs. COVID-19 pseudovirus system mediated by pRV-Fluc (retroviral vector) on stability of pseudovirus.

(17) FIG. 17 shows neutralizing antibody titer detection (IC90) against COVID-19 pseudovirus, and 293T-hACE2 cell infection-pseudovirus neutralizing antibody detection.

(18) FIG. 18 shows neutralizing antibody titer detection (IC90) against COVID-19 pseudovirus, and pseudovirus neutralizing antibodyFluc enzyme activity detection.

(19) FIG. 19 shows detection of neutralizing antibody against SARS virus vector vaccine.

(20) FIG. 20 is a graph showing activity change of COVID-19 killed by ozone at room temperature.

(21) FIG. 21 is a graph showing activity change of COVID-19 killed by ozone at 20 C.

(22) COVID19 in the figures represents COVID-19.

DETAILED DESCRIPTION

(23) In the following, this disclosure will be further described in detail with reference to specific examples, which are intended for explanation but not limitation of this disclosure. This disclosure mainly relates to integrating the genes of COVID-19-S, SARS-CoV-S, and MERS-S or truncated sequences thereof into an expression system, and further integrating VSV pseudovirus of the envelope antigen through the constructed dVSVG-EGFP-FLuc dual-reporter packaging system, and is used for detecting production of neutralizing antibodies in immune serum obtained after the relevant antigen protein is immunized in mice.

(24) The reagents and consumables used in this disclosure are as follows: Lipofectamine LTX (Invitrogen 15338100), PBS (Hyclone SH30256.01), DMEM high glucose medium (Gibco C11995500), Penicillin-Streptomycin (Gibco 15140-122), fetal bovine serum (Gibco 10091-148), Opti-MEM I Reduced Serum Medium (Gibco 31985-070), 96-well cell culture plate (Corning 3599), 6-well cell culture plate (Corning 3516), 6-cm cell culture plate (Corning 430166), COVID-19 RBD protein (Genescript Biotechnology Ltd Z03485), COVID-19 S1 protein (Genescript Biotechnology Ltd Z03485), SARS-CoV S RBD protein (Sino Biological 40150-V08B2), and MERS-CoV S1 protein (Sino Biological 40069-V08B1).

(25) Cell Line:

(26) Vero-E6 (ATCC, CRL-1586), 293T (ATCC-derived) cells were maintained in a high glucose DMEM (SIGMA-ALDRICH) and supplemented with 10% LBS (Gibco), penicillin (100 IU/mL), and streptomycin (100 g/mL), passaged every 2 days in 5% carbon dioxide atmosphere at 37 C., infected with lentivirus expressing hACE2 for 72 hours, and screened for purinomycin resistance to obtain 293T-hACE2 cells.

(27) Antibody Preparation:

(28) Balb/C mice were immunized with COVID-19 spike protein (RBD/S1), SARS-CoV S RBD, and MERS-CoV S1 at 50 g/mouse every other week. Complete adjuvant was added to the primary immunization, and incomplete adjuvant was added to the subsequent booster immunization to prepare specific polyclonal antibody against spike proteins of COVID-19, SARS-CoV and MERS-CoV, and activity of neutralizing antibody was identified.

(29) Construction of Different Modified Envelope Expression Vectors:

(30) Molecular construction: After codon optimization focusing on Spike protein (S protein) clone of COVID-19, full-length sequence of S (1-3822 bp), a sequence of S with 19 amino acids deleted from C-terminal (1-3765 bp), a sequence of S with 19 amino acids deleted from C-terminal plus HA tag (1-3792 bp), a sequence of S with 27 amino acids deleted from C-terminal (1-3735 bp), and a sequence of S with 53 amino acids deleted from C-terminal (1-3663 bp) were cloned into pCAGGS vector, respectively. For SARS-CoV and MERS-CoV, sequences of S with 19 amino acids deleted from C-terminal were selected as the first choice.

Example 1 Construction of Different Type of Envelope Plasmids

(31) The S gene sequence published according to NCBI was codon optimized to facilitate the expression in cells. The sequence was respectively synthesized on a pCDNA3.1 vector by GenScript Biotech Corporation. After the target gene was amplified by PCR, the target band was recovered and purified by a fragment purification kit. The fragment and pCAGGS vector were digested with restriction endonucleases MCS1 (Xhol) and MCS2 (Nhel) at 37 C. for 3 h. The vector and the target fragment were recovered from gel, subjected to ligation reaction, and then transformed into competent cells. The positive clones were screened by colony PCR, the plasmid construction was verified by enzyme digestion and sequencing. The specific steps were as follows: 1. Primer synthesis and primer information: the primers were synthesized by GENEWIZ, Inc., and the PCR primers selected for construction and amplification of COVID-19-S gene are shown in Table 1.

(32) TABLE-US-00001 TABLE1 PrimersforamplificationanddetectionofCOVID-19-Sgene ProductNo. Productsize PrimerNo. Primersequence(5-3) Description COVID19-S 3822bp COVID19-S- CCGCTCGAGATGTTCGTG Upstreamprimerfor Xhol-F1 TTTCTGGTG(SEQIDNO: cloningfull-lengthS 8) gene COVID19-S- CTAGCTAGCTTAGGTGTA Downstreamprimer Nhel-R1 GTGCAGCTTCAC(SEQID forcloningfull-length NO:9) Sgene Note: The underline represents the digestion site.

(33) 1.1 The selected PCR primers and Colony PCR primers for amplification of COVID-19-S-C19 gene are shown in Table. 2:

(34) TABLE-US-00002 [0057]Table2COVID-19-S-C19geneamplification ProductNo. Productsize PrimerNo. Primersequence(5-3) Description COVID19- 3765bp COVID19-S- CCGCTCGAGATGTTCGTGT Upstreamprimer S-C19 C19-Xhol-F1 TTCTGGTG(SEQIDNO:10) forcloning COVID19-S-C19 gene COVID19-S- CTAGCTAGCTTAACAGCA Downstream C19-Nhel-R1 GCTTCCACAAGAACA primerforcloning (SEQIDNO:11) COVID19-S-C19 gene Note: The underline represents the digestion site.

(35) 1) The selected PCR primers and Colony PCR primers for amplifying COVID-19-S-C27 gene are shown in Table 3.

(36) TABLE-US-00003 TABLE3 COVID-19-S-C27geneamplification Product Product No. size PrimerNo. Primersequence(5-3) Description COVID19- 3741bp COVID19-S- CCGCTCGAGATGTTCGTGTTTC Upstreamprimer S-C27 C27-Xhol- TGGTG(SEQIDNO:12) forcloning F1 COVID19-S-C27 gene COVID19-S- CTAGCTAGCTTAGCCCTTCAGG Downstream C27-Nhel- CAGGAACAGCAG(SEQIDNO: primerfor R1 13) cloningCOVID19- S-C27gene Note: The underline represents the digestion site.

(37) 2) The selected PCR primers and Colony PCR primers for amplifying COVID-19-S-C53 gene are shown in Table 4.

(38) TABLE-US-00004 TABLE4 COVID-19-S-CS3geneamplification Product Product No. size PrimerNo. Primersequence(5-3) Description COVID19- 3663bp COVID19-S- CCGCTCGAGATGTTCGTGTTTC Upstreamprimer S-C53 C53-Xhol-F1 TGGTG(SEQIDNO:14) forcloning COVID19-S-C53 gene COVID19-S- CTAGCTAGCTTAGAAGCCCAGC Downstream C53-Nhel-R1 CAGATGTACC(SEQIDNO:15) primerforcloning COVID19-S-C53 gene Note: The underline represents the digestion site.

(39) 3) The selected PCR primers and Colony PCR primers for amplifying COVID-19-S-C19HA gene are shown in Table 5.

(40) TABLE-US-00005 TABLE5 COVID-19-S-C19HAgeneamplification Product Product No. size PrimerNo. Primersequence(5-3) Description COVID19- 3792bp COVID19-S- CCGCTCGAGATGTTCGTGTTTCT Upstreamprimer S-C19HA C19HA-Xhol- GGTG(SEQIDNO:16) forcloning F1 COVID19-S-C19H Agene COVID19-S- CTAGCTAGCTTAGGCATAATCTG Downstream C19HA-Nhel- GCACATCATAAGGGTAACAGCA primerforcloning R1 GCTTCCACAAGAACAGCA(SEQ COVID19-S-C19H IDNO:17) Agene Note: The underline represents the digestion site.

(41) 4) The selected PCR primers and Colony PCR primers for amplifying SARS-COV-S-C19 gene are shown in Table 6.

(42) TABLE-US-00006 TABLE6 SARS-COV-S-C19geneamplification Product Product No. size PrimerNo. Primersequence(5-3) Description SARS-COV- 3711bp SARS-COV- CCGCTCGAGATGTTCATCTTTCT Upstreamprimer S-C19 S-C19-Xhol- GCTGTTC(SEQIDNO:18) forcloning F1 SARS-COV-S-C19 gene SARS-COV- CTAGCTAGCTTAACAGCAAGAT Downstream S-C19-Nhel- CCACAGGAGCA(SEQIDNO:19) primerforcloning R1 SARS-COV-S-C19 gene Note: The underline represents the digestion site.

(43) 5) The selected PCR primers and Colony PCR primers for amplifying MERS-CoV-S-C19 gene are shown in Table 7.

(44) TABLE-US-00007 TABLE7 [MERS-COV-S-C19geneamplification Product Product No. size PrimerNo. Primersequence(5-3) Description MERS-CoV- 3711bp MERS-COV- CCGCTCGAGATGATACACTCAG Upstreamprimer S-C19 S-C19-Xhol- TGTTTC(SEQIDNO:20) forcloning F1 MERS-CoV-S-C19 gene MERS-COV- CTAGCTAGCTTAATTACACTTAA Downstream S-C19-Nhel- GTTTTCCC(SEQIDNO:21) primerforcloning R1 MERS-CoV-S-C19 gene Note: The underline represents the digestion site.

(45) 6) Target gene acquisition: PCR amplification was performed by using pCDNA3.1 plasmid with the target gene sequence as a template and using primers in Table 4.

(46) 7) The digested product was purified according to the protocol of AxyPrep PCR Cleanup kit, and the concentration of the product was measured with Nano-300.

(47) 8) The purified product and vector were subject to double digestion (at 37 C. for 3 h).

(48) 9) Electrophoresis was performed with 1% Agarose gel; the corresponding DNA maker was used as a control to verify the PCR product; band on the gel was cut; the remaining PCR product was recovered; and the concentration of the product was measured with Nano-300.

(49) 10) The purified product was ligated into the vector (overnight at 16 C., ligation ratio: 1:5).

(50) 11) The ligation product was transformed according to the protocol of E. coli DB3.1 Competent Cells (TaKaRa).

(51) 12) The monoclonal clone on LB (Kana) plate was picked and added into a sterile 1.5 mL tube containing 200 L LB (Kana) medium in advance, and incubated at 37 C. and 250 rpm for 3 h, and then Colony PCR was performed to screen positive clones.

(52) 13) After being identified by agarose gel electrophoresis, positive clones were selected and transferred to a 15 mL shake flask at a ratio of 1:500, and cultured at 37 C. and 250 rpm for 14-16 h.

(53) 14) The plasmid was extracted according to the protocol of the TIANGEN EndoFree Mini Plasmid Kit II.

(54) 15) The screened positive plasmid was identified by double digestion (XhoI and NheI, digested at 37 C. for 3 h).

(55) 16) After enzyme digestion and identification, the correct plasmid was selected for plasmid sequencing.

(56) The constructed PCR products of different types of pseudoviruses are shown in FIG. 2. According to the experimental results, specific bands appeared at the corresponding of the six genes after PCR amplification, and molecular size of the bands was correct, indicating that the target bands were successfully amplified, and the sequencing results also indicated that the plasmid construction was successful.

Example 2 Infection of VSV-COVID-19-S-C19-HA on 293T-hACE2 Cells Showed Higher Efficiency

(57) To obtain VSV pseudoviruses of different truncated spike proteins (S) of COVID-19, plasmids pCAGGS-COVID-19-S, pCAGGS-COVID-19-S-C19, pCAGGS-COVID-19-S-C19-HA, pCAGGS-COVID-19-S-C27, and pCAGGS-COVID-19-S-C53 were transfected into 293T cells for packaging by liposomes (lipo2000), respectively. After 12 hours of transfection, dVSVG-Fluc-EGFP (prepared and stored in the laboratory), i.e., VSV replication-defective virus strain, was inoculated into culture medium corresponding to cells expressing COVID-19 intact spike protein or COVID-19-S-C19/C27/C53/C19-HA truncated protein, respectively (eukaryotic expression plasmids were transiently transferred 12 h in advance). Supernatant was collected, and anti-VSV-G neutralizing serum was added to block the infectivity of dVSVG-Fluc-EGFP remained in the supernatant. The progeny viruses were harvested to obtain pseudoviruses carrying the spike protein with different modifications of COVID-19 on the virus surface. Supernatants were collected 24 h, 48 h, and 72 h after dVSVG-FLuc-EGFP-GP infection, followed by centrifugation and filtration (0.45 m pore size, Millipore) to remove cell debris, and long-term storage at 80 C. The number of EGFP-positive cells infected with 293T-hACE2 pseudovirus was counted by gradient dilution, and the titer of pseudovirus (unit: TU/ml) was measured and calculated.

(58) As shown in FIGS. 3 to 5, by comparing infection efficiency of VSV-mediated COVID-19 pseudoviruses, it is found that the pseudovirus packaged with full-length S had very low infection efficiency (EGFP and Fluc dual-reporter gene detection), indicating that the full-length S of COVID-19 is not suitable for packaging of COVID-19 pseudovirus. The truncated S-C19-HA pseudovirus had an infection efficiency about twice as high as that of S-C19. Although S-C19 could also package pseudovirus with higher titer, fusing a non-functional tag protein (other short peptides are also applicable) at 3 end of S-C19 can further improve the titer of the packaged COVID-19 pseudovirus, suggesting that the fused short peptide plays a role in stabilizing the spatial structure of coronavirus S. Further experiments showed that the packaging titer of MERS or SARS-S-C19HA was significantly higher than that of the control group (19 amino acids were deleted at C-terminal of S gene).

(59) The sensitivity of 293T-hACE2 (stably and highly expressing hACE2) cells to COVID-19 pseudoviruses was further tested. First, 293 cells and BHK21 cells could hardly be infected by COVID-19 pseudoviruses (FIG. 3), and almost all of the cell lines stably expressing hACE2 receptor protein were infected by COVID-19 pseudovirus (each cell expressed green fluorescence under fluorescence microscope). Furthermore, in the above-mentioned one-step packaging system, the packaging titer of the obtained VSV-COVID-19-S-C19-HA (abbreviated as S-C19-HA) pseudovirus was about 4000 times of that of VSV-COVID-19-S full-length group. Similarly, the packaging titer of S-C19-HA was 15 times higher than that of VSV-COVID-19-S-C27 (abbreviated as S-C27) group. At the same time, the titer of COVID-19 pseudovirus decreased with the increase of collection times (at 24 h, 48 h, and 72 h, respectively). Particularly, the titer of the COVID-19 pseudovirus in the third collected supernatant (72 h) was low, which was mainly caused by poor cell status and change of pH value in the medium after long-term incubation (FIG. 4 and FIG. 5). The above problems could be solved by continuous perfusion culture technology.

Example 3 dVSVG-COVID-19-S-C19-HA Pseudovirus Packaged in 293T Cells had the Highest Titer

(60) The packaging efficiency of COVID-19 pseudoviruses is one of the major limiting factors for high-throughput detection of neutralizing antibody assay in vitro. In order to select the most suitable cell line for producing COVID-19 pseudoviruses, different cell lines were pre-plated in a 6-well cell culture plate, and common cells such as Vero-E6, BHK21, 293T-hACE2, and 293 were compared in this technology. Preferably, plasmids with different concentrations were transfected in the above different cell lines, and then dVSVG-COVID-19-S-C19-HA COVID-19 pseudovirus was packaged by referring to the following one-step packaging method. The specific steps are as follows: 1) plating Vero/BHK21/293T/293T-hACE2 cells in a 6-well plate, to have a suitable cell density of about 70% after 24 h; 2) diluting and uniformly mixing 0 g, 0.25 g, 0.5 g, 1 g, and 2 g pCAGSGGGS-S/pCGGGS-S-C19/pCAGGS-S-C19-HA/pCAGGS-S-C27/pCAGGS-S-C53/pCAG GS-VSVG (positive envelope plasmid) in 100 l opti-MEM, respectively, and diluting and uniformly mixing Lipofectamine LTX in 100 l opti-MEM (plasmid:transfection reagent=1:3); 3) slowly mixing the plasmid diluent with the Lipofectamine LTX diluent, and then standing at room temperature for 20 min; 4) replacing the complete medium with opti-MEM, adding the mixed solution into the culture medium, gently mixing, culturing at 37 C. with 5% CO.sub.2 for 6 h, and then replacing the opti-MEM with complete medium; 5) adding dVSVG-Fluc-EGFP virus to infect the cells with MOI=1 after cell culture for 12 h; 6) collecting virus supernatant 24 h, 48 h and 72 h after virus infection, respectively, adding 1 l anti-VSVG serum per 1 mL virus suspension, and incubating in a cell incubator for 2 h; 7) infecting 293T-hACE2 cells after gradient dilution, calculating the number of EGFP positive cells after pseudovirus infection, and measuring and calculating the titer of the pseudovirus (unit: TU/ml); 8) observing EGFP fluorescence expression 48 h after virus infection; and 9) determining the optimal cell type for packaging according to the packaging titer of the pseudovirus.

(61) The statistical results showed that 293T-hACE2 produced strong cell fusion during the packaging process (FIG. 6), while it was relatively rare for other cells. The virus titer gradually increased with increase of the amount of plasmid for transfection, and the highest titer of packaged pseudovirus was obtained when 2 g plasmid was transfected. However, the high concentration of plasmid also affected the state of cells (excessive S protein aggregation caused certain toxicity to cells). The standard TCID50 (Karber method) statistics showed that the dVSVG-COVID-19-S-C19-HA pseudovirus had the highest titer (FIG. 7). It was also found that the supernatant of the package collected at 24 h contained about 5E5 effective virus particles per milliliter.

Example 4 Effect of Initial Inoculation Amount (MOI) of VSV Replication-Defective Virus on COVID-19 Pseudovirus Yield in One-Step Pseudovirus Packaging Method

(62) In order to further improve the packaging system to obtain higher packaging titer of pseudovirus, the initial inoculation amount of VSV replication-defective virus (dVSVG-Fluc-EGFP) was further tested. First, 293T packaging cells (stably expressing COVID-S-C19-HA protein) were infected according to different MOIs. The virus solution was collected 24 h after infection, and the virus titer was determined. The specific steps are as follows: 1) plating 293T cells in a 6-well plate, to have an optimal cell density of about 70% after 24 h; 2) diluting and uniformly mixing 1 g pCAGGS-S-C19-HA plasmid in 100 l opti-MEM, and diluting and uniformly mixing Lipofectamine LTX in 100 l opti-MEM (plasmid:transfection reagent:=1:3); 3) slowly mixing the plasmid diluent with the Lipofectamine LTX diluent, and then standing at room temperature for 20 min; 4) replacing the complete medium with opti-MEM, adding the mixed solution into the culture medium, gently mixing, culturing at 37 C. with 5% CO.sub.2 for 6 h, and then replacing the opti-MEM with complete medium; 5) adding dVSVG-Fluc-EGFP virus to infect the cells with MOI=0, 0.01, 0.1, 0.5, 1, 2, 5 after cell culture for 12 h; 6) collecting virus supernatant 24 h after virus infection, adding 1 L anti-VSVG serum per 1 mL virus solution, and incubating in a cell incubator for 2 h; 7) infecting 293T-hACE2 cells after gradient dilution, calculating the number of EGFP-positive cells after pseudovirus infection, and measuring and calculating the titer (unit: TU/mL) of the pseudovirus; 8) observing EGFP fluorescence expression 48 h after virus infection; and 9) determining the optimal cell type for packaging according to the packaging titer of the pseudovirus.

(63) The results showed that with increase of the MOI value of the added dVSVG-Fluc-EGFP replication-defective virus, the cell infection was gradually enhanced (FIG. 8), and the titer of the harvested COVID-19 pseudovirus was gradually increased. When the initial MOI=1, the titer of the packaged COVID-19 pseudovirus gradually entered a plateau (FIG. 9). Therefore, the initial multiplicity of infection (MOI) can be controlled in the range of 0.1 to 5, and the optimal MOI is MOI=1.

Example 5 Effect of Pre-Transfection Time of Coronavirus Envelope Expression Plasmid on Titer of Packaged Pseudovirus

(64) In the coronavirus pseudovirus packaging system, pre-transfection time of coronavirus envelope plasmid is another factor affecting pseudovirus titer. The effect of pre-transfection time of envelope eukaryotic expression plasmid on pseudovirus titer was further tested. First, dVSVG-Fluc-EGFP replication-defective virus was infected with MOI=1, 12 h and 24 h after plasmid transfection, the virus suspension was collected 24 h later, and the titer of the packaged pseudovirus was measured. The specific steps are as follows: 1) plating 293T cells in a 6-well plate, to have an optimal cell density of about 70% after 24 h; 2) diluting and uniformly mixing 1 g pCAGGS-S-C19-HA plasmid in 100 l opti-MEM, and diluting and uniformly mixing Lipofectamine LTX in 100 l opti-MEM (plasmid:transfection reagent=1:3); 3) slowly mixing the plasmid diluent with the Lipofectamine LTX diluent, and then standing at room temperature for 20 min; 4) replacing the complete medium with opti-MEM, adding the mixed solution into the culture medium, gently mixing, culturing at 37 C. with 5% CO.sub.2 for 6 h, and then replacing the opti-MEM with complete medium; 5) adding dVSVG-Fluc-EGFP virus to infect the cells with the optimal MOI=1 after cell culture for 12 h and 24 h, respectively; 6) collecting virus supernatant 24 h after virus infection, adding 1 L anti-VSVG serum per 1 mL virus solution, and incubating in a cell incubator for 2 h; 7) infecting 293T-hACE2 cells after gradient dilution, calculating the number of EGFP-positive cells after pseudovirus infection, and measuring and calculating the titer of COVID-19 pseudovirus (unit: TU/mL); and 8) observing EGFP fluorescence expression 48 h after virus infection.

(65) The results showed that when the envelope plasmid was pre-transfected for 12 h, the pseudovirus titer was slightly higher than that when the plasmid was transfected for 24 h (FIG. 10). With the increase of pre-transfection time, it was found that the state of cells was poor at the time of virus collection, and the pH change of the culture medium affected virus production of the cells. Therefore, the optimal pre-transfection time was 12 h. Meanwhile, the optimal pre-transfection time of the transient expression system was around 12 h. When TetOn was used to induce expression of coronavirus S protein, an inducer should be added 12 h in advance to induce stable expression of envelope protein in cells, and then VSV replication-defective virus was added for packaging of coronavirus pseudovirus.

Example 6 Comparison of Inducible System and Plasmid Transient Transfection Packaging, and Exploration of Different Concentrations of Dox in Inducible System Packaging

(66) In the coronavirus pseudovirus packaging system, packaging cells transiently or stably or inductively expressed the coronavirus spike protein, wherein the transient expression was realized by transfecting the cells with eukaryotic expression vector; the stable expression was realized by transducing cells with a lentiviral vector system; and the inducible expression was achieved by transducing cells with a tetracycline-regulated tet-on/off vector system.

(67) The pseudovirus packaging process of the inducible system is as follows: 1) plating 293T-19HA cells 40 h in advance (the plate can be a 6-well plate, T75 bottle, T175 bottle, cell factory, or the like, which can be selected according to actual needs); 2) replacing culture medium for the plated cells with complete medium containing 500 ng/ml DOX 24 h in advance, and culturing at 37 C. with 5% CO.sub.2; 3) adding VSV envelope pseudoviruis with MOI=0.5-5; and 4) harvesting the first, second, and third supernatants at 24 h, 48 h, and 72 h, respectively centrifuging the supernatants at 2000 g after each harvesting, taking the supernatants after 10 min, and storing them at 4 C.

(68) When TetOn was used to induce expression of coronavirus S protein, an inducer should be added 12 h in advance to induce stable expression of envelope protein in cells, and then VSV replication-defective virus was added for packaging of coronavirus pseudovirus. In this example, the results of the inducible system and the plasmid transient transfection packaging were compared.

(69) The packaging process of plasmid transient transfection is as follows: 1) plating 293T cells 24 h in advance (the plate can be a 6-well plate, T75 bottle, T175 bottle, cell factory or the like, which can be selected according to actual needs); 2) replacing culture medium for the plated cells with serum-free medium 8 h in advance, then performing plasmid transfection by mixing the transfection reagent PEI with plasmid pcDNA-19HA to be transfected in 3:1, incubating them at room temperature for 15 min, and then adding them to the cell culture medium that has been replaced with serum-free medium; 3) adding VSV envelope pseudovirus with MOI=0.5-5; and 4) harvesting the first, second, and third supernatants at 24 h, 48 h, and 72 b, respectively centrifuging the supernatants at 2000 g after each harvesting, taking the supernatants after 10 min, and storing them at 4 C.

(70) It can be seen from the results shown in FIG. 11 that the titers of the supernatants harvested at 24 h, 48 h, and 72 h in the inducible system packaging were better than those in the plasmid transient transfection packaging. In the figure, the X-axis shows the supernatant samples collected at 24 h, 48 h, and 72 h after the inducible system and the plasmid transient transfection packaging, and the Y-axis shows the virus titer (pfu/ml) after the TCID50 detection of the supernatants. Meanwhile, the supernatants harvested at 24 h, 48 h, and 72 h were stored at 4 C. after harvesting, and the titer was detected at the same time.

(71) By applying the above steps, this example also studied the effect of different DOX concentrations in the inducible system on the titer of the packaged pseudovirus.

(72) The results are shown in FIG. 12. The X-axis shows the concentrations of DOX in the packaging with the inducible system, 0 ng/ml, 200 ng/ml, 500 ng/ml, 1000 ng/ml, and 2000 ng/ml, and the Y-axis shows the virus titer (pfu/ml) after TCID50 detection of the supernatants. The harvesting virus was performed at 48 h. It can be seen from FIG. 12 that the titer of COVID-19 pseudovirus packaged with DOX at 500 ng/ml was the highest.

Example 7 Effect of Culture Temperature on Virus Producing Titer of Pseudoviruses with Different Modified Envelopes

(73) The temperature during virus packaging can affect the state of cells as well as the pH change of culture medium, and further has a great impact on the stability of some viruses. Therefore, the key factor of pseudovirus packaging, that is, culture temperature of packaging cells, was further detected. The specific steps are as follows: 1) plating 293T cells in a 6-well plate, to have an optimal cell density of about 70% after 24 h; 2) diluting and uniformly mixing 1 g plasmids pCAGGS-COVID-19-C19-HA, pCAGGS-SARS-CoV-C19, pCAGGS-MERS-CoV-C19, and VSVG in 100 l opti-MEM, and diluting and uniformly mixing Lipofectamine LTX in 100 l opti-MEM (plasmid:transfection reagent=1:3); 3) slowly mixing the plasmid diluent with the Lipofectamine LTX diluent, and then standing at room temperature for 20 min; 4) replacing the complete medium with opti-MEM, adding the mixed solution into the culture medium, gently mixing, culturing at 37 C. with 5% CO.sub.2 for 6 h, and then replacing the opti-MEM with complete medium; 5) adding dVSVG-Fluc-EGFP virus to infect the cells with MOI=0.5 after cell culture for 12 h; 6) culturing the infected cells in incubators at 37 C., 35 C., and 32 C., respectively, for 24 h, collecting virus supernatants, adding 1 L anti-VSVG serum per 1 mL virus solution, and incubating in a cell incubator for 2 h; 7) infecting 293T-hACE2 cells after gradient dilution, calculating the number of EGFP-positive cells after pseudovirus infection, and measuring and calculating the titer (unit: TU/ML) of the pseudovirus; and 8) observing EGFP fluorescence expression 48 hr after virus infection.

(74) The results showed that the temperature could greatly affect virus titer for COVID-19 pseudoviruses, and the virus titer gradually increased with decrease of temperature. When packaging COVID-19 pseudoviruses, the optimal temperature for culturing packaging cells was 32 C., while for SARS, MERS, and VSV replication-defective pseudoviruses, ideal viral load could be obtained at 35 C.; (FIG. 13).

Example 8 Stability Test of COVID-19 Pseudoviruses with Different Envelope Modifications

(75) It is known that the titer and stability of a stock solution of packaged pseudovirus are important factors affecting the long-term storage and viral load of the virus. The titer and storage stability of COVID-19 pseudovirus packaged based on VSV replication-defective vector and COVID-19 pseudovirus packaged based on RV (retroviral vector system) system were compared in parallel. The specific steps are as follows: 1) plating 293T cells in a 6-well plate, to have an optimal cell density of about 70% after 24 h; 2) diluting and uniformly mixing 1 g pCAGGS-COVID-19-C19-HA plasmid in 100 l opti-MEM, and diluting and uniformly mixing Lipofectamine LTX in 100 l opti-MEM (plasmid:transfection reagent=1:3); diluting and uniformly mixing 1 g pCAGGS-COVID-19-C9-HA, 1.5 g pcgp, 2 g pRV in 100 l Opti-MEM, and diluting and uniformly mixing Lipofectamine LTX in 100 l Opti-MEM (plasmid:transfection reagent=1:3); 3) slowly mixing the plasmid diluent with the Lipofectamine LTX diluent, and then standing at room temperature for 20 min; 4) replacing the complete medium with opti-MEM, adding the mixed solution into the culture medium, gently mixing, culturing at 37 C. with 5% CO.sub.2 for 6 h, and then replacing the opti-MEM with complete medium; 5) for VSV pseudovirus, adding dVSVG-Fluc-EGFP virus to infect the cells with MOI=0.5 after cell culture for 12 h; 6) for VSV pseudovirus, culturing the infected cells in an incubator at 37 C. for 24 h, collecting virus supernatant, adding 1 anti-VSV VG serum per 1 mL virus solution, and incubating in the cell incubator for 2 h; and 7) subjecting VSV-packaged COVID-19 pseudovirus to repeated freezing-thawing for 0, 1, 2, and 3 cycles, storing the virus stock solution at 4 C., 20 C., and 80 C. for 3 d and 7 d, infecting 293T-hACE2 cells after gradient dilution, and calculating the number of EGFP-positive cells after pseudovirus infection (VSV pseudovirus system); for COVID-19 pseudovirus packaged with pRV, collecting samples 36 h after infection, and storing them at 4 C. and 80 C. for different times, and then calculating the virus titer according to TCID50 (Karber method).

(76) The results showed that, as shown in FIG. 14 to FIG. 16, the virus titers of the two pseudoviruses changed little after three freezing-thawing cycles, the titers of COVID-19 stored at 4 C., 20 C., and 80 C. had little effect on the titers on the 7th day, and COVID-19 mediated by the pRV system had low titer and short storage time, so it was not suitable for large-scale detection. In addition, low initial virus titer will affect stability of the virus in long-term storage. The initial titer of dVSVG-COVID-19-S-C19-HA pseudovirus packaged by one-step method based on VSV system was 6E5 pfu/ml, which was nearly 100 times higher than that of pRV system, and the titer remained stable at 4 C. for 7 days.

Example 9 Pseudovirus-Based Neutralizing Antibody Detection

(77) 293T-hACE2 cells were inoculated in a 96-well plate in advance. Mouse serum was collected by orbital vein blood sampling, diluted with DMEM complete medium, and then diluted according to a 2-fold gradient, mixed with dVSV-COVID-19-S-C19-HA virus (6000TU), dVSV-SARS-CoV-S-C19 (500TU), and dVSS-MERS-CoV-S-C19 (500TU) respectively, and incubated at 37 C. for 2 h. The mixture of virus and antibody was resuspended in 10% FBS-DMEM, and the mixture was added to 293T-hACE2 cell suspension to be detected. After 48 h of culture, a green fluorescence image was taken with fluorescent photography equipment (Nikon microscope). For quantitative detection, cold fluorescence readout of Fluc reporter gene was determined, and neutralization titer of the antibody was calculated.

(78) In order to verify whether the pseudoviruses prepared by packaging can be used to detect antibody neutralization activity through neutralization assay, the prepared antisera of COVID-19, SARS-CoV, and MERS-CoV were used for pseudovirus neutralization assay. The specific steps are as follows: 1) plating 293T-hACE2 cells on a 96-well plate, to have a cell density of about 70% after 24 h; 2) diluting serum in gradient, mixing it with pseudovirus of the same volume, setting a duplicate well, and setting a pseudovirus control which was not mixed with the serum and a blank cell control which was only added with a culture medium; 3) placing in an incubator at 37 C. with 5% CO.sub.2 for 2 h; 4) inoculating the serum-pseudovirus mixture in the previous step into a 96-well plate, and culturing at 37 C. with 5% CO.sub.2 for 48 h; and 5) photographing, calculating and detecting the activity of firefly luciferase (FLuc).

(79) It can be seen from the results (as shown in FIG. 17 to FIG. 19) that the pseudovirus packaging SARS involved in this disclosure was used to detect antibodies with virus neutralizing efficacy produced by different types of vaccines. It can be seen from FIG. 18 that the serum IC50 of S1 protein vaccine was 56.9; and the IC50 of RBD protein vaccine was 68.35 (defined as a serum sample diluted 68.35 times that can effectively organize the infection of E3 virions). The COVID-19 pseudovirus system used COVID-19-S-C19-HA. The background value of the control group was very low, and the stability of different dilutions was high. In this example, the design route refers to the method shown in FIG. 1, dVSVG-Fluc-EGFP one-step method for packaging pseudovirus was used to continuously develop SARS-CoV pseudovirus. As shown in FIG. 19, the activity of neutralizing antibody produced by the candidate vaccine was detected by using the SARS pseudovirus packaged by the above operation technology, and the IC50 in the serum of mice immunized with SARS virus vector vaccine was about 864.3 (FIG. 19). In this technical solution, dVSVG-Fluc-EGFP-SARS-C19 was used for SARS pseudovirus, and 293T-hACE2 cells were used to detect the activity of neutralizing antibody, which was consistent with the method for detecting neutralizing antibody of COVID-19. Meanwhile, further analysis showed that the serum immunized with SARS vaccine had no obvious cross reaction with COVID-19 pseudovirus, the SARS pseudovirus in this example showed an excellent confidence interval, and the background Fluc value obtained from the control serum detection tended to be a parallel line, indicating that the stability and repeatability of the pseudovirus in neutralizing antibody activity detection is consistent with the conclusion of VSV mediated COVID-19 pseudovirus. The pseudovirus developed based on the dVSVG-Fluc-EGFP packaging system maintained a high biological titer (the titer of SARS pseudovirus was 8E6 pfu/ml), which was significantly higher than that of COVID-19 pseudovirus, and its stability was consistent with that of other coronavirus pseudoviruses. It is further concluded that the dVSVG-Fluc-EGFP packaging system can be adapted for the development of other known coronavirus pseudoviruses.

(80) In the following two examples, coronavirus pseudovirus was used as a biological indicator to evaluate the efficacy of a virucidal disinfectant:

Example 10 Use of Pseudoviruses of COVID-19 and its Variants to Examine and Evaluate Disinfecting Ability of Ozone

(81) (1) Preparation of biological indicator of COVID-19 pseudovirus reporting system a. adding dVSVG-Fluc-EGFP to 293T cells stably expressing VSV envelope protein GP, collecting the supernatant 24 h later to obtain the amplified VSV replication-defective virus, and determining the titer thereof; b. passaging the packaging cells 293T expressing COVID-19 Spike protein (S protein) into 60 mm dish, transfecting with eukaryotic expression plasmid by LipoLTX liposome, adding dVSVG-Fluc-EGFP after 12 h of transfection (the multiplicity of infection (MOI) was 0.1 to 5), culturing in an incubator at 32 C. to 37 C., harvesting the pseudovirus supernatant after 24 h, then treating with anti-VSV neutralizing antibody for 2 h, and filtering with a 0.22 um filter membrane to obtain the COVID-19 pseudovirus.

(82) (2) Construction of virus-contaminated environment

(83) A refrigerator was adopted to simulate an environmental temperature of low-temperature cold chain transportation of 40 C. to 20 C., 50 l COVID-19 pseudovirus with an initial titer of 2*10.sup.6 TU/ml obtained by packaging was diluted and evenly smeared on six 6 cm plastic culture dishes, 50 l COVID-19 pseudovirus was added to each dish with an initial titer of 2*10.sup.6 TU/ml.

(84) (3) Ozone was introduced into the experimental refrigerator at 40 C. to 20 C. for 30 min. When the detected ozone concentration was stable at 1-50 ppm, three 6 cm culture dishes were put in as the experimental group, and the other three 6 cm culture dishes were put into the control refrigerator at the same temperature without ozone.

(85) (4) At three different times, 10 min, 30 min, and 60 min, a 6 cm culture dish was taken from the experimental refrigerator and the control refrigerator respectively for titer test: 1) diluting the virus in dish with a dilution gradient of 10.sup.1 to 10.sup.6 into a 96-well plate; 2) plating 293T-ACE2 cells in the 96-well plate with 20000 cells, 100 l, per well and mixing with the diluted virus; 3) culturing at 37 C. with 5% CO.sub.2 for 24 h, photographing with fluorescent photography equipment, calculating and detecting the activity of firefly luciferase (FLuc), and calculating the titer.

(86) According to the results (as shown in FIG. 20-21), when the ozone concentration is maintained at 1-200 ppm and the temperature is set at low temperature (40 C. to 20 C.) and room temperature, ozone has a good ability to disinfect COVID-19 pseudoviruses. As the ozone inactivation time increases, the disinfection will continue to work, and the virus titer will be significantly reduced. According to the analysis of the influence of temperature, the higher the ambient temperature during disinfection, the stronger the ability of ozone to disinfect COVID-19, and COVID-19 pseudovirus can be almost completely inactivated after 10 min of disinfection at room temperature. For the simulated low-temperature cold chain environment at a temperature of 20 C., the experimental results show that the instantaneous disinfecting rate of ozone on COVID-19 pseudovirus in this environment is considerably high. The longer the time, the better the disinfecting effect, and the titers are all in a lower state. After a certain period of time, ozone can also achieve complete inactivation of the virus, showing better disinfecting ability.