METHOD FOR PREPARING RICE PHOTOSENSITIVE MALE STERILE MATERIAL AND RELATED GENES THEREOF

20230151383 · 2023-05-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention discloses a method for preparing a rice photosensitive male sterile material and related genes thereof. The method for preparing photosensitive male sterile rice of the present invention includes: reducing the abundance of protein RMS1 in the target rice, reducing the activity of the protein RMS1 in the target rice or reducing the content of the protein RMS1 in the target rice to obtain the photosensitive male sterile rice. The protein RMS1 is the following A1) or A2): A1), the amino acid sequence of which is as shown in SEQ ID No. 1 in the sequence listing; A2), a homologous protein having more than 98% identity with A1) and is derived from rice. The present invention obtains a rice photosensitive male sterile material by controlling the RMS1 gene of rice and its encoded protein, and achieves the fertility of rice under different light conditions.

    Claims

    1-13. (canceled)

    14. A method for preparing photosensitive male sterile rice, comprising the following step of: reducing the abundance of protein RMS1 in target rice, reducing the activity of protein RMS1 in target rice or reducing the content of protein RMS1 in target rice, to obtain the photosensitive male sterile rice; wherein the protein RMS1 is the following A1) or A2): A1), the amino acid sequence of which is as shown in SEQ ID NO. 1 in the sequence listing; A2), a homologous protein having more than 98% identity with A1) and is derived from rice.

    15. The method according to claim 14, wherein the step of reducing the abundance of protein RMS1 in the target rice, reducing the activity of the protein RMS1 in the target rice or reducing the content of the protein RMS1 in the target rice is implemented by inhibiting the expression of the encoding gene of the protein RMS1 in the target rice or knocking out the encoding gene of the protein RMS1 in the target rice.

    16. The method according to claim 15, wherein the step of inhibiting the expression of the encoding gene of the protein RMS1 in the target rice or knocking out the encoding gene of the protein RMS1 in the target rice is implemented by using a CRISPR/Cas9 system.

    17. The method according to claim 16, wherein the CRISPR/Cas9 system comprises a vector expressing sgRNA, and the target sequence of the sgRNA is as shown in SEQ ID NO. 15 in the sequence listing.

    18. The method according to claim 14, wherein the encoding gene of the protein RMS1 is any one of the following b1)-b4): b1) a DNA molecule as shown in SEQ ID NO. 2 in the sequence listing; b2) a DNA molecule as shown in SEQ ID NO. 3 in the sequence listing; b3) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b1) or b2) and encoding the protein RMS1 of claim 14; b4) a DNA molecule hybridizing under strict conditions to the nucleotide sequence defined in b1) or b2) and encoding the protein RMS1 of claim 14.

    19. Any of the following substances: (1) an sgRNA or a recombinant plasmid expressing the sgRNA; wherein the target sequence of the sgRNA is as shown in SEQ ID NO. 15 in the sequence listing; (2) P1, protein RMS1, which is the following A11) or A12): A11), the amino acid sequence of which is as shown in SEQ ID NO. 1 in the sequence listing; A12), a homologous protein having more than 98% identity with A11) and is derived from rice; (3) P2, protein RMS1-4, which is the following A21) or A22): A21), the amino acid sequence of which is as shown in SEQ ID NO. 6 in the sequence listing; A22), a homologous protein having more than 98% identity with A21) and is derived from rice; (4) P3, protein RMS1-5, which is the following A31) or A32): A31), the amino acid sequence of which is as shown in SEQ ID NO. 9 in the sequence listing; A32), a homologous protein having more than 98% identity with A31) and is derived from rice; (5) P4, protein RMS1-11, which is the following A41) or A42): A41), the amino acid sequence of which is as shown in SEQ ID NO. 12 in the sequence listing; A42), a homologous protein having more than 98% identity with A41) and is derived from rice; (6) Q1, a nucleic acid molecule encoding the protein RMS1 of P1; (7) Q2, a nucleic acid molecule encoding the protein RMS1-4 of P2; (8) Q3, a nucleic acid molecule encoding the protein RMS1-5 of P3; (9) Q4, A nucleic acid molecule encoding the protein RMS1-11 of P4.

    20. The substances according to claim 19, wherein: the nucleic acid molecule encoding the protein RMS1 of P1 is any one of the following b11)-b14): b11), a DNA molecule shown in SEQ ID NO. 2 in the sequence listing; b12), a DNA molecule shown in SEQ ID NO. 3 in the sequence listing; b13), a DNA molecule having 75% or more identity with the nucleotide sequence defined in b11) or b12) and encoding the protein RMS1 of P1; b14), a DNA molecule that hybridizes to the nucleotide sequence defined in b11) or b12) under strict conditions and encodes the protein RMS1 of P1; the nucleic acid molecule encoding the protein RMS1-4 of P2 is any one of the following b21)-b24): b21), a DNA molecule shown in SEQ ID NO. 7 in the sequence listing; b22), a DNA molecule shown in SEQ ID NO. 8 in the sequence listing; b23), a DNA molecule having 75% or more identity with the nucleotide sequence defined in b21) or b22) and encoding the protein RMS1-4 of P2; b24), a DNA molecule that hybridizes to the nucleotide sequence defined in b21) or b22) under strict conditions and encodes the protein RMS1-4 of P2; the nucleic acid molecule encoding the protein RMS1-5 of P3 is any one of the following b31)-b34): b31), a DNA molecule shown in SEQ ID NO. 10 in the sequence listing; b32), a DNA molecule shown in SEQ ID NO. 11 in the sequence listing; b33), a DNA molecule having 75% or more identity with the nucleotide sequence defined in b31) or b32) and encoding the protein RMS1-5 of P3; b34), a DNA molecule that hybridizes to the nucleotide sequence defined in b31) or b32) under strict conditions and encodes the protein RMS1-5 of P3; the nucleic acid molecule encoding the protein RMS1-11 of P4 is any one of the following b41)-b44): b41), a DNA molecule shown in SEQ ID NO. 13 in the sequence listing; b42), a DNA molecule shown in SEQ ID NO. 14 in the sequence listing; b43), a DNA molecule having 75% or more identity with the nucleotide sequence defined in b41) or b42) and encoding the protein RMS1-11 of P4; b44), a DNA molecule that hybridizes to the nucleotide sequence defined in b41) or b42) under strict conditions and encodes the protein RMS1-11 of P4.

    21. Any of the following methods: (1) a method for rice breeding by using the sgRNA or the recombinant plasmid of claim 19; (2) a method for preparing transgenic rice, comprising introducing the encoding gene of the sgRNA according to claim 19 and the encoding gene of a Cas9 protein into recipient rice to obtain photosensitive male sterile rice; (3) a method for regulating rice photoperiod-sensitive fertility by using the protein of claim 19; (4) a method for cultivating photosensitive male sterile rice by using the protein of claim 19; (5) a method for cultivating photosensitive male sterile rice by using the protein of claim 19 as a target; (6) a method for regulating rice photoperiod-sensitive fertility by using the nucleic acid molecule of claim 19; (7) a method for cultivating photosensitive male sterile rice by using the nucleic acid molecule of claim 19; (8) a method for cultivating photosensitive male sterile rice by using the nucleic acid molecule of claim 19 as a target.

    22. Any of the following methods: (1) a method for regulating rice photoperiod-sensitive fertility by using the nucleic acid molecule of claim 20; (2) a method for cultivating photosensitive male sterile rice by using the nucleic acid molecule of claim 20; or (3) a method for cultivating photosensitive male sterile rice by using the nucleic acid molecule of claim 20 as a target.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0095] FIG. 1 is a map of the intermediate vector pYLgRNA-U3.

    [0096] FIG. 2 is the electrophoresis detection graph of the expression cassette amplification of intermediate vector pYLgRNA-U3-RMS1.

    [0097] FIG. 3 is a map of the genome editing vector pYLCRISPR/Cas9-MTmono vector.

    [0098] FIG. 4 is an electrophoresis diagram of the PCR detection results of the monoclonal colonies of Escherichia coli transformed with the recombinant vector pYLCRISPR/Cas9-MT-RMS1.

    [0099] FIG. 5 is a sequence alignment diagram of the recombinant vector pYLCRISPR/Cas9-MT-RMS1.

    [0100] FIG. 6 shows the type of RMS1 gene mutation and the type of amino acid encoded after mutation; wherein, 9522.sup.38740-target is wild-type rice 9522; the black part of the encoded protein is the RMS1 core domain, and the gray part is the newly encoded protein region after RMS1 mutation.

    [0101] FIG. 7 is the population phenotypic analysis of the F.sub.2 hybrid between the wild-type rice variety 9522 and the RMS1 homozygous mutant 9522.sup.38740-5.

    [0102] FIG. 8 is the phenotype comparison between the RMS1 homozygous mutant 9522.sup.38740-5 and the wild-type rice variety 9522 under different light durations; A is the long light treatment, and B is the short light treatment.

    [0103] FIGS. 9A-9D show the comparison of the 12-KI staining effect of pollen grains between RMS1 homozygous mutant 9522.sup.38740-5 and wild-type rice variety 9522 under short-day light and different temperature treatments; wherein, FIG. 9A is the staining microscopic examination of pollen grains of wild-type rice variety 9522 after short-day high temperature treatment, FIG. 9B is the staining microscopic examination of pollen grains of homozygous mutant 9522.sup.38740-5 after short-day high temperature treatment, FIG. 9C is the staining microscopic examination of pollen grains of wild-type rice variety 9522 after short-day low temperature treatment, and FIG. 9D is the staining microscopic examination of pollen grains of homozygous mutant 9522.sup.38740-5 after short-day low temperature treatment.

    [0104] FIG. 10 shows the pollen fertility changes of RMS1 homozygous mutant 9522.sup.38740-5 and wild-type rice variety 9522 grown in different natural ecological regions.

    DETAILED DESCRIPTION

    [0105] The experimental methods used in the following examples are conventional methods unless otherwise specified.

    [0106] The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

    [0107] The expression vector pYLgRNA-U3 is described in the literature “Shi Jiangwei, Li Yixing, Song Shufeng, Qiu Peony, Deng Yao, Li Li, Targeted Editing of Rice Panicle Development Gene Osal Mediated by CRISPR/Cas9 System. HYBRID RICE, 2017, 32(3): 74-78,” which can be obtained by the public from the Hunan Hybrid Rice Research Center, and this biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

    [0108] The expression vector pYLCRISPR/Cas9-MTmono is described in the literature “Shi Jiangwei, Li Yixing, Song Shufeng, Qiu Peony, Deng Yao, Li Li, Targeted Editing of Rice Panicle Development Gene Osal Mediated by CRISPR/Cas9 System. HYBRID RICE, 2017, 32(3): 74-78,” which can be obtained by the public from the Hunan Hybrid Rice Research Center, and the biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

    [0109] The rice variety Wuyunjing 7 (original code 9522) has been disclosed in the document “CRISPR/Cas9-directed editing of the Osal gene of rice panicle development. Hybrid Rice (HYBRID RICE), 2017, 32(3): 74-78,” which can be obtained by the public from the Hunan Hybrid Rice Research Center, and the biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

    Example 1 Selection of Target Site of Rice RMS1 Gene and Construction of Knockout Vector

    [0110] The inventors of the present invention discovered a gene related to photosensitive male sterility, the RMS1 (Reverse Male Sterility) gene from rice Wuyunjing 7. The encoding sequence of the RMS1 gene was shown in SEQ ID NO. 2 in the sequence listing, which encoded a protein RMS1 consisting of 345 amino acid residues, and its amino acid sequence was shown in SEQ ID NO. 1 in the sequence listing. The full-length gDNA of the RMS1 gene was 2623 bp, containing 3 exons and 4 introns, and its nucleotide sequence was shown in SEQ ID NO. 3 in the sequence listing.

    [0111] In this example, the rice RMS1 gene was knocked out by CRISPR/Cas9 gene editing technology to obtain mutants 9522.sup.38740-4, 9522.sup.38740-5 and 9522.sup.38740-11 with photosensitive male sterile phenotype, and mutant 9522.sup.38740-4, 9522.sup.38740-5 and 9522.sup.38740-11 were all RMS1 knockout rice. The specific operation method was as follows:

    [0112] 1. Design of a Target Sequence

    [0113] The target sequence used was 5′-CCAAGGCCGGTAAGCGCCGC-3′ (SEQ ID NO. 15), which was located at the junction of the first exon and the second intron sequence, that is, positions 384 to 403 of the sequence 3.

    [0114] 2. Construction of Intermediate Vector pYLgRNA-U3-RMS1

    [0115] (1) Design and Synthesis of RMS1 Target Site Linker Primer

    [0116] After the target site sequence was determined, GGCA was added before the 5′ of the sense strand of the target sequence, and AAAC was added before the 5′ of the antisense strand to obtain the target site linker primer. The target site linker primer sequences were as follows:

    TABLE-US-00001 RMS1-Cas9-F: (SEQ ID NO. 16) 5′-GGCACCAAGGCCGGTAAGCGCCGC ′; RMS1-Cas9-R: (SEQ ID NO. 17) 5′-AAACGCGGCGCTTACCGGCCTTGG-3′.

    [0117] (2) Preparation of RMS1 Target Site Linkers

    [0118] The RMS1 target site linker primers RMS1-Cas9-F and RMS1-Cas9-R were diluted with ddH.sub.2O to stock solutions with a concentration of 10 μM. 10 μL to 80 μL deionized water was taken for each solution to a final volume of 100 μL. The solution was fully mixed and then heat-shocked at 90° C. for 30s, and then moved to room temperature to complete the annealing and the RMS1 target site linker was obtained, which was labeled as RMS1-Cas9.

    [0119] (3) Construction of RMS1 Intermediate Vector

    [0120] 1 μL pYLgRNA-U3 vector plasmid (as shown in FIG. 1), 1 μL 10×T4 DNA Ligase Buffer, 1 μL target site linker RMS1-Cas9, 1 μL BsaI restriction endonuclease and 0.5 μL 10×T4 DNA Ligase were mixed evenly. The PCR instrument was used for the reaction, and the reaction conditions were 37° C. for 5 min, 20° C. for 5 min, 5 cycles, thereby obtaining an intermediate vector containing the target sequence of the rice RMS1 gene, which was named pYLgRNA-U3-RMS1.

    [0121] 3. Construction and Transformation of RMS1 Site-Directed Editing Final Vector

    [0122] (1) Amplification of RMS1 Intermediate Vector Expression Cassette

    [0123] The intermediate vector pYLgRNA-U3-RMS1 was used as the template, Uctcg-B1: TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG (SEQ ID NO. 18) and gRcggt-BL: AGCGTGGGTCTCGACCGGGTCCATCCACTCCAAGCTC (SEQ ID NO. 19) were used as primers for PCR amplification, and the amplified products were obtained. The amplified products were detected by gel electrophoresis, and it was determined as a DNA molecule with a size of about 550 bp (as shown in FIG. 2). The amplification result was consistent with the expectation. The amplified products were recovered and purified and named as the RMS1 intermediate vector expression cassette. The expression cassette contained a sgRNA encoding gene and a U3 promoter, wherein the sgRNA target sequence was 5′-CCAAGGCCGGTAAGCGCCGC-3′ (SEQ ID NO. 15), and the sgRNA encoding gene was shown in SEQ ID NO. 4 in the sequence listing.

    [0124] (2) Construction and Transformation of RMS1 Site-Directed Editing Final Vector

    [0125] Using BsaI restriction endonuclease and T4 DNA Ligase, the gene editing vector pYLCRISPR/Cas9-MTmono (as shown in FIG. 3) and the RMS1 intermediate vector expression cassette were digested and ligated to obtain the RMS1 gene site-directed editing final vector pYLCRISPR/Cas9-MT-RMS1. E. coli was transformed, spread on a plate containing kanamycin, and cultured at 37° C. overnight.

    [0126] (3) Detection of Recombinant Vector pYLCRISPR/Cas9-MT-RMS1

    [0127] Three monoclonal colonies cultivated overnight in step (2) were randomly selected and named as RMS1-cas9-1, RMS1-cas9-2, and RMS1-cas9-3, respectively. Three monoclonal colonies were detected by PCR using the pYLCRISPR/Cas9-MTmono vector: SP1: CCCGACATAGATGCAATAACTTC (SEQ ID NO. 20) and SP2: GCGCGGTGTCATCTATGTTACT (SEQ ID NO. 21). The PCR amplification products were subjected to gel electrophoresis, and the electrophoresis results (as shown in FIG. 4) showed that the RMS1-cas9-2 monoclonal colony could amplify a band with a size of about 550 bp, which was consistent with the expectation.

    [0128] Plasmid DNA of RMS1-cas9-2 monoclonal was extracted and sequenced. The sequencing results (as shown in FIG. 5) showed that the DNA fragment shown in SEQ ID NO. 5 in the sequence listing successfully replaced the DNA fragment between the two BsaI restriction sites on the gene editing vector pYLCRISPR/Cas9-MTmono. This indicated that the expression cassette containing the U3 promoter and the sgRNA encoding gene was successfully constructed into the gene editing vector pYLCRISPR/Cas9-MTmono, that is, the genome site-directed editing vector of RMS1 was successfully constructed, and the recombinant vector pYLCRISPR/Cas9-MT-RMS1 was obtained.

    Example 2 Acquisition and Phenotypic Analysis of RMS1 Mutant Rice Material

    [0129] 1. Acquisition of RMS1 Mutant Rice Material

    [0130] Using the method of Agrobacterium-mediated transformation of rice callus, the RMS1 gene site-directed editing vector pYLCRISPR/Cas9-MT-RMS1 was used to transform the callus of rice variety Wuyunjing 7 (original code 9522, hereinafter referred to as 9522), and positive mutants were screened and identified.

    [0131] 2. The Detection of Fixed-Point Editing

    [0132] Three homozygous mutants with knockout of RMS1 gene were obtained by PCR detection, which were named as homozygous mutant 9522.sup.38740-4, homozygous mutant 9522.sup.38740-5, and homozygous mutant 9522.sup.38740-11 The sequencing results showed (as shown in FIG. 6):

    [0133] The RMS1 gene (wild-type) was mutated in the homozygous mutant 9522.sup.38740-4, and 2 bases were deleted from the 128th-129th position of the CDS of the RMS1 gene. This mutation caused the ORF of the RMS1 gene to shift after the 126th position, and a new stop codon was formed in the RMS1 3′UTR sequence. The gene after the frame shift mutation was named RMS1-4 gene, the nucleotide sequence of RMS1-4 gene was shown in SEQ ID NO. 8 in the sequence listing, and the encoding sequence of RMS1-4 gene was shown in SEQ ID NO. 7 in the sequence listing, which encoded a protein RMS1-4 composed of 359 amino acid residues, and its amino acid sequence was shown in SEQ ID NO. 6 in the sequence listing.

    [0134] The RMS1 gene (wild-type) was also mutated in the homozygous mutant 9522.sup.38740-5, and 1 base was deleted from the 127th position of the CDS of the RMS1 gene. This mutation caused the ORF of the RMS1 gene to shift after the 126th position, and a new stop codon was formed in advance at 334-336 bp of the CDS of the RMS1 gene to terminate translation. The gene after the frame shift mutation was named RMS1-5 gene. The nucleotide sequence of RMS1-5 gene was shown in SEQ ID NO. 11 in the sequence listing, the encoding sequence of RMS1-5 gene was shown in SEQ ID NO. 10 in the sequence listing, which encoded a protein RMS1-5 consisting of 111 amino acid residues, and its amino acid sequence was shown in SEQ ID NO. 9 in the sequence listing.

    [0135] The RMS1 gene (wild-type) was mutated in the homozygous mutant 9522.sup.38740-11, and 1 base was inserted into the 127th position of the CDS of the RMS1 gene. This mutation caused the ORF of the RMS1 gene to shift after the 126th position, and a new stop codon was formed in the RMS1 3′ UTR sequence. The gene after the frame shift mutation was named RMS1-11 gene. The nucleotide sequence of RMS1-11 gene was shown in SEQ ID NO. 14 in the sequence listing, the encoding sequence of the RMS1-11 gene was shown in SEQ ID NO. 13 in the sequence listing, which encoded a protein RMS1-11 composed of 360 amino acid residues, and its amino acid sequence was shown in SEQ ID NO. 12 in the sequence listing.

    [0136] The two core domains SANT of the wild-type RMS1 protein were located at positions 14-61 and 67-112 of the amino acid sequence, respectively. It can be seen that the mutations at the above sites led to the deletion of the core domain SANT, which in turn affected the function of the RMS1 gene.

    [0137] 3. Construction and Phenotypic Analysis of RMS1 Mutant F.sub.2 Co-Segregation Population

    [0138] The homozygous mutants 9522.sup.38740-4, 9522.sup.38740-5, 9522.sup.38740-11 had the same mutant phenotype and agronomic traits. Therefore, in the subsequent examples of the present invention, the homozygous mutant 9522.sup.38740-5, was used as an example for detailed phenotypic analysis.

    [0139] (1) F.sub.2 Group Construction

    [0140] The wild-type 9522 was used as the female parent, the T.sub.1 generation single plant obtained from the homozygous mutant 9522.sup.38740-5 was used as the male parent for hybridization (planting time: 201806-201810), and the F.sub.1 hybrid seeds were harvested. The F.sub.1 generation population was planted in Lingshui, Hainan (planting time: 201812-201904). F.sub.1 generation population was self-crossed to obtain F.sub.2 generation population, and the F.sub.2 generation population was planted in Changsha, Hunan (planting time: 201906-201910).

    [0141] (2) Phenotypic Analysis

    [0142] There were a total of 42 individual plants in the F.sub.2 generation isolated population in step 1. After genotype identification and analysis of all the individual plants in the F.sub.2 isolated population, a total of 3 genotypes were isolated, which were the wild-type genotype (the corresponding positions of the two chromatids were both from the RMS1 gene of wild-type rice) and the RMS1 mutant material homozygous mutant 9522.sup.38740-5 homozygous genotype (the corresponding positions of the two chromosomes were the RMS1-5 gene from the homozygous mutant 9522.sup.38740-5, hereinafter referred to as the 9522.sup.38740-5 genotype), and the heterozygous genotype obtained by crossing the wild-type and RMS1 mutant material homozygous mutant 9522.sup.38740-5 genotype (that is, the corresponding position of one chromosome was the RMS1 gene from wild-type rice, and the corresponding position of the other chromosome was the RMS1-5 gene from the homozygous mutant 9522.sup.38740-5, hereinafter referred to as the heterozygous genotype). Wherein, there were 7 strains in the wild-type genotype group, 26 strains in the heterozygous genotype group, and 9 strains in the 9522.sup.38740-5 genotype group. The separation ratio of wild-type genotype:heterozygous genotype:9522.sup.38740-5 genotype was 7:26:9, generally in line with the separation ratio of 1:2:1.

    [0143] Planting observation found that the leaf morphology of each individual plant in the F.sub.2 generation segregated population was consistent. Through microscopic observation, it was found that the anther morphology of different genotypes was different. In the segregating population of F.sub.2 generation, the wild-type population had bright yellow anthers, full anther shape, normal number of pollen grains and anther microscopically fertile. The heterozygous genotype population was consistent with the wild-type population. However, in the 9522.sup.38740-5 genotype population, the anthers were abnormally whitened, the morphology of anthers were shriveled, the number of pollen grains suddenly decreased, and the microscopic examination of anthers showed that there were a lot of sterile pollen grains (as shown in FIG. 7). Corresponding to the segregation ratio of F.sub.2 population, it indicated that the mutation of RMS1 gene led to abnormal anther development and thus affected the pollen fertility of recipient plants.

    Example 3 Analysis of Photosensitive Characteristics of RMS1 Mutant Rice Materials

    [0144] 1. Analysis of Photosensitive Characteristics of RA/S1 Mutant Rice Materials

    [0145] The homozygous mutant 9522.sup.38740-4T.sub.2 generation, the homozygous mutant 9522.sup.38740-5T.sub.2 generation and the wild-type rice 9522 of RMS1 mutant material were planted under natural conditions in Lingshui, Hainan (18° 51′23″N, 110° 5′6″E). The results showed that the homozygous mutant 9522.sup.38740-4T.sub.2 generation and the homozygous mutant 9522.sup.38740-5T.sub.2 generation plants had low seed setting rate, which were 4.56% and 3.13%, respectively, while the seed setting rate of wild-type rice 9522 was 95.6% (201812-201904); the homozygous mutant 9522.sup.38740-4T.sub.3 generation, the homozygous mutant 9522.sup.38740-5T.sub.3 generation and the wild-type rice 9522 were planted under natural conditions in Changsha, Hunan (28° 13′07″N, 113° 15′10″E). The results showed that the homozygous mutant 9522.sup.38740-4T.sub.3 generation and the homozygous mutant 9522.sup.38740-5T.sub.3 generation mutant were 35.29% and 16.02%, respectively, while the seed setting rate of wild-type rice 9522 was 96.75% (201906-201910). The same RMS1 mutant rice line had obvious differences in the seed setting rate in different regions. It was believed that the length of light in different regions would affect the fertility of pollen, which will lead to changes in the seed setting rate.

    [0146] In order to further explore the effect of light on the pollen fertility of RMS1 mutant plants, 7 homozygous mutant 9522.sup.38740-5 T.sub.3 generation plants were subjected to exploratory short light treatment (light duration 10.5 hours, light intensity 30000 Lx; the temperature in the light period was 30° C., and the temperature in the dark period was 24° C.) and long light treatment (light duration 13.5 hours, light intensity 30,000 Lx; the temperature in the light duration was 30° C., and the temperature in the dark period was 24° C.) experiments. A11 experiments were carried out in a greenhouse with controlled temperature and light. Wild-type rice 9522 was used as the control.

    [0147] Mature anthers of wild-type rice 9522 and mutant 9522.sup.38740-5 T.sub.3 generation plants were collected for microscopy and iodine staining. During iodine staining, the anthers of 3 florets of a single rice plant were taken and placed on a glass slide, the anthers were smashed with tweezers to release the pollen grains, and 1-2 drops of I.sub.2-KI solution were added and covered with a cover glass for observation under a microscope. Those that were dyed blue were the pollen grains with strong vitality, and those that were yellow-brown were stunted pollen grains. Three fields of view were taken from each film, and the pollen staining rate was counted to represent the pollen fertility.

    [0148] The results showed that, under short light conditions, the anthers of wild-type rice 9522 were bright yellow, plump in shape and normal in number of pollen grains. Pollen iodine staining showed a staining rate of 95.64%, indicating that the pollen fertility of wild-type rice 9522 was normal. Under the same conditions, the anthers of the homozygous mutant 9522.sup.38740-5 T.sub.3 generation plants were white and shriveled, and the number of pollen grains decreased significantly. The pollen iodine staining rate was only 28.17%, indicating that the pollen fertility of the mutant 9522.sup.38740-5 T.sub.3 generation plants decreased significantly (as shown in Table 1 and FIG. 8B).

    [0149] Under long light conditions, the anthers of wild-type rice 9522 were bright yellow, plump in shape, and normal in number of pollen grains. The pollen was stained with iodine, and the staining rate was 96.18%, indicating that the pollen fertility of wild-type rice 9522 was normal. Under the same conditions, the anthers of the homozygous mutant 9522.sup.38740-5 T.sub.3 generation plants were bright yellow, plump in shape, and the number of pollen grains was normal. The pollen was stained with iodine, and the staining rate was 86.40% (as shown in Table 1 and FIG. 8A).

    [0150] Compared with short light conditions, the number and staining rate of pollen grains of the homozygous mutant 9522.sup.38740-5 T.sub.3 generation plants were significantly restored under long light conditions, indicating that the pollen fertility of the homozygous mutant 9522.sup.38740-5 T.sub.3 generation plants was restored.

    TABLE-US-00002 TABLE 1 Statistics of I.sub.2-KI staining results of pollen grains of RMS1 homozygous mutant 9522.sup.38740-5T.sub.3 and wild-type rice variety 9522 under different light conditions Total Number of number of non-stained pollen pollen Staining Treatment Treatment grains grains rate conditions materials (grain) (grain) (%) Short light 9522 1838 80 95.64  conditions Homozygous 323 232 28.17** mutant 9522.sup.38740-5 Long light 9522 1859 71 96.18  conditions Homozygous 1920 261 86.40  mutant 9522.sup.38740-5 Note: **P < 0.01.

    [0151] It can be seen that under different light conditions, the anther color, morphology and pollen fertility of the control material 9522 were consistent, indicating that the light duration did not affect the pollen fertility of the recipient material 9522. However, the pollen of the RMS1 homozygous mutant 9522.sup.38740-5 T.sub.3 generation plants showed significant differences in anther color, morphology and number of pollen grains under different light duration treatments. Under short light conditions, the anthers of the homozygous mutant 9522.sup.38740-5T.sub.3 generation plants were white in color and shriveled in shape. The results of iodine staining showed that the number of pollen grains was greatly reduced, and there were a large number of sterile pollen grains, which was significantly different from the control under the same conditions. Under long light conditions, the number of pollen grains and fertility of the homozygous mutant 9522.sup.38740-5 T.sub.3 generation plants were significantly restored, and the anther color, shape and number of pollen grains of the homozygous mutant 9522.sup.38740-5 T.sub.3 generation plants were consistent with the control material under the same conditions. The results indicated that the pollen fertility of RMS1 mutant materials was sensitive to the light duration, and the pollen fertility of RMS1 mutants decreased sharply under short light conditions, while the pollen fertility of RMS1 mutants could be restored under long light conditions.

    [0152] 2. The Effect of Temperature on the Pollen Fertility of RMS1 Mutant Rice

    [0153] (1) Effects of Temperature on the Fertility of RMS1 Mutant Rice Under Greenhouse Conditions

    [0154] In order to further explore the relationship between pollen fertility and temperature of RMS1 mutant materials, different temperatures were set on the basis of 12-hour short light conditions.

    [0155] The 6 9522.sup.38740-5 T.sub.3 generation plants and 6 wild-type 9522 plants grown in the field were transferred respectively to the culture pot during the jointing period to ease the growth of the plants. In the early booting stage, the plants were moved into an incubator for short light, high-low temperature treatment. Wherein, the treatment conditions of short light and low temperature (hereinafter referred to as short-day low temperature) were 12 hours of light duration, light intensity of 30000 Lx, and temperature of 23° C.; the conditions of short light high temperature (hereinafter referred to as short-day high temperature) treatment were 12 hours of light duration, 30,000 Lx of light intensity, and 33° C. of temperature. After heading, the pollen microscopic examination was carried out on the plants under different temperature treatments. 3 florets were taken from each individual plant and mixed for microscopic examination. The microscopic examination method of pollen fertility was the same as above. Three fields of view were taken from each film, and the pollen staining rate was counted to express the pollen fertility.

    [0156] The results showed that under short-day high temperature conditions, the pollen iodine staining rate of wild-type rice 9522 was 94.41%, and the pollen iodine staining rate of 9522.sup.38740-5 T.sub.3 generation plants under the same conditions was 23.86%. The pollen iodine staining rate of wild-type rice 9522 was 89.75%, and the pollen iodine staining rate of homozygous mutant 9522.sup.38740-5 T.sub.3 generation plants under the same conditions was 0 (as shown in Table 2 and FIGS. 9A-9D). This indicated that the pollen fertility of the RMS1 mutant material homozygous mutant 9522.sup.38740-5 was significantly lower than that of wild-type rice under short light conditions, regardless of the temperature, which further confirmed that the short light conditions were decisive for pollen fertility in RMS1 mutants. At the same time, low temperature also promoted the decrease of pollen fertility in RMS1 mutants under short light conditions.

    TABLE-US-00003 TABLE 2 Statistics of I.sub.2-KI staining results of pollen grains of RMS1 homozygous mutant 9522.sup.38740-5T.sub.3 and wild-type rice variety 9522 under different light conditions Total Number of number of non-stained pollen pollen Staining Treatment Treatment grains grains rate conditions materials (grain) (grain) (%) Short-day high 9522 2202 123 94.41  temperature Homozygous 570 434 23.86** treatment mutant 9522.sup.38740-5 Short-day low 9522 2079 213 89.75  temperature Homozygous 59 59 0**   treatment mutant 9522.sup.38740-5 Note: **P < 0.01.

    [0157] (2) The Effect of Temperature on the Pollen Fertility of RMS1 Mutant Rice Under Natural Environment

    [0158] Under natural conditions in Lingshui, Hainan (18° 51′23″N, 110° 5′6″E, 201912-202004), the RMS1 mutant materials homozygous mutant 9522.sup.38740-5 T.sub.4 generation plants and wild-type rice 9522 were planted in two batches. The first batch of materials was sown on Dec. 3, 2019, and its booting period was from Feb. 10, 2020 to Mar. 5, 2020. During this period, the average daily temperature in Lingshui was 22.2° C. The second batch of materials was sown on Dec. 13, 2019, and its booting period was from Feb. 20, 2020 to Mar. 15, 2020. During this period, the daily average temperature in Lingshui was 23.78° C. The difference of average daily temperature between the two batches at booting stage was 1.58° C. After heading, the mature anthers of the homozygous mutant 9522.sup.38740-5 T.sub.4 generation plants and the wild-type rice 9522 plants sown in different batches were collected for pollen iodine staining. Three individual plants were randomly selected from each group, and one field of view was taken from each individual plant for statistics.

    [0159] The results showed that the pollen microscopic staining rate of the first batch of homozygous mutant 9522.sup.38740-5 T.sub.4 generation plants was 0%, and the pollen microscopic staining rate of the same batch of wild-type 9522 was 94.87%. while the pollen microscopic staining rate of the homozygous mutant 9522.sup.38740-5 T.sub.4 generation plants was 10.97%, and the pollen microscopic staining rate of the same batch of wild-type 9522 was 92.19% (as shown in Table 3). The results indicated that the pollen iodine staining rate of the mutant materials of the same line and sown in batches at the same site was changed, indicating that the temperature difference between different sowing periods could lead to the change of pollen fertility.

    TABLE-US-00004 TABLE 3 Statistics of pollen grain I.sub.2-KI staining results of RMS1 homozygous mutant 9522.sup.38740-5 T.sub.4 plants and wild-type rice variety 9522 sown in different sowing batches Total Number of number of non-stained Sowing Treatment pollen grains pollen grains Staining batches materials (grain) (grain) rate (%) First 9522 78 4 94.87 batch Homozygous 38 38 0 mutant 9522.sup.38740-5 Second 9522 141 11 92.19 batch Homozygous 82 73 10.97 mutant 9522.sup.38740-5

    [0160] In conclusion, the pollen of the RMS1 mutant material was sensitive to the length of light, specifically, the pollen of the RMS1 mutant material was fertile under long-day (long light) conditions, The pollen fertility of the short-day (short light) RMS1 mutant material was significantly reduced, and low temperature can promote the complete abortion of mutant RMS1 pollen, which enhanced the pollen sterility of mutant RMS1. Therefore, RMS1 was considered to have the characteristics of anti-photosensitivity and was a photosensitive fertility-related gene, and photosensitive male sterile rice can be obtained by knocking out this gene.

    [0161] 3. Changes in Pollen Fertility of RMS1 Mutant Rice Materials Planted in Different Natural Ecological Regions

    [0162] In order to further verify the photosensitivity of RMS1, planting experiments in different natural ecological regions were designed. The RMS1 mutant material homozygous mutant 9522.sup.38740-5 T.sub.4 generation plants and wild-type rice 9522 were grown under natural conditions in Lingshui of Hainan, Baoshan of Yunnan, Changsha of Hunan, Fuyang of Hangzhou, and Wuhan and Xiangyang of Hubei. After heading, the mature anthers of the homozygous mutant 9522.sup.38740-5 T.sub.4 generation plants and wild-type rice 9522 plants grown in different regions were collected for pollen iodine staining. Three individual plants were randomly selected from each group, and one field of view was taken from each individual plant for statistics.

    [0163] The results showed that (FIG. 10) the pollen fertility of the RMS1 mutant material showed an increasing trend from south to north. Under the natural conditions of Lingshui, Hainan, the pollen of the RMS1 mutant showed complete sterility (the dyeability rate was 0%). Under natural conditions in Xiangyang, Hubei, the pollen fertility of mutant RMS1 was restored (the contamination rate reached 82.35%). It was further indicated that the gene RMS1 was regulated by light to affect pollen fertility, and also showed that the RMS1 mutant material had the potential to be used as a two-line sterile line. Under the natural conditions of Lingshui, Hainan, it can be used as a sterile line to carry out hybrid seed production; under the natural conditions of Xiangyang, Hubei, it can be used as a reproductive line to produce the seeds of the sterile line.

    INDUSTRIAL APPLICATION

    [0164] The invention utilized CRISPR/Cas9 technology to edit the rice RMS1 gene at a fixed-point, knocked out the rice RMS1 gene through frame shift mutation, inactivated the protein RSM1, and obtained a new generation of rice varieties with photosensitive male sterility (RMS1 gene knockout rice). Compared with wild-type rice, the obtained RMS1 gene knockout rice showed no significant difference in the vegetative growth stage, but the pollen fertility changed with the duration of light. Under short light conditions (the light duration was 10.5 hours, the temperature in the light period was 30° C., the light intensity was 30000 Lx, and the temperature in the dark period was 24° C.), the anthers of the RMS1 gene knockout rice were white and shriveled, and the number of pollen grains decreased significantly. Compared with wild-type rice, pollen iodine staining showed that it contained a large number of sterile pollen grains, and the fertility was significantly reduced; the RMS1 gene knockout rice was exposed to long light conditions (the light duration was 13.5 hours, the temperature in the light period was 30° C., the light intensity was 30000 Lx, and the temperature in the dark period was 24° C.), the anthers of RMS1 knockout rice were bright yellow, plump in shape, and normal in the number of pollen grains, which was consistent with the fertility of wild-type rice, and the fertility was restored compared with mutants under short light conditions. In order to further explore the relationship between pollen fertility and temperature of RMS1 mutant materials, different temperatures were set on the basis of short light conditions. The results showed that the pollen fertility of the RMS1 mutant was significantly lower than that of the wild-type rice under short light conditions, regardless of the temperature, in terms of pollen quantity and dye rate, which further confirmed that the short light conditions had a decisive effect on the pollen fertility of the RMS1 mutant. At the same time, under short light conditions, low temperature also promoted the decrease of pollen fertility of RMS1 mutant and enhanced the pollen sterility of mutant RMS1. This indicated that the RMS1 gene knockout rice was photosensitive male sterile rice (photosensitive male nuclear sterile rice). The photosensitive male sterile rice can be used as a female parent to combine with a dominant variety to produce hybrid seeds. The photosensitive male sterile rice not only provides a new sterile line material for two-line hybrid rice breeding, but also lays a theoretical foundation for hybrid breeding of other gramineous crops.