Genetically modified microorganism for production of aspartic acid and downstream metabolites from aspartic acid as target substance, and method for producing target substance using same

12600991 ยท 2026-04-14

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure relates to a genetically modified microorganism satisfying some of predetermined conditions. The predetermined conditions include: (I) succinate dehydrogenase activity or fumarate reductase activity being reduced or inactivated relative to a wild-type microorganism; (II) lactate dehydrogenase activity being reduced or inactivated relative to the wild-type microorganism; (III) the genetically modified microorganism having modified phosphoenolpyruvate carboxylase activity showing resistance to feedback inhibition by aspartic acid in wild-type phosphoenolpyruvate carboxylase activity, or exogenous phosphoenolpyruvate carboxylase activity having higher resistance to feedback inhibition by aspartic acid than that of the wild-type phosphoenolpyruvate carboxylase activity shown by the wild-type microorganism; and (IV) pyruvate:quinone oxidoreductase being reduced or inactivated relative to the wild-type microorganism.

Claims

1. A reaction product comprising a target substance and a genetically modified microorganism, wherein the genetically modified microorganism belongs to the genus Escherichia or coryneform bacteria, and satisfying all of the following Conditions (I) to (III): Condition (I): have an inactivated or disrupted chromosomal gene, the gene encoding a fumarate reductase catalyzing a conversion reaction from fumarate to succinate in a counterclockwise TCA cycle under reducing conditions or anaerobic conditions, and so that succinate dehydrogenase activity or fumarate reductase activity is reduced or inactivated relative to a wild-type unmodified microorganism, wherein the wild-type unmodified microorganism is a wild-type of the genetically modified microorganism; Condition (II): have an inactivated or disrupted chromosomal lactate dehydrogenase gene so that lactate dehydrogenase activity is reduced or inactivated relative to the wild-type unmodified microorganism; and Condition (III): have an operable gene that encodes a mutant-type phosphoenolpyruvate carboxylase so that the genetically modified microorganism has modified phosphoenolpyruvate carboxylase activity showing resistance to feedback inhibition by aspartic acid in wild-type phosphoenolpyruvate carboxylase activity, or exogenous phosphoenolpyruvate carboxylase activity having higher resistance to feedback inhibition by aspartic acid than that of the wild-type phosphoenolpyruvate carboxylase activity shown by the wild-type unmodified microorganism, the mutant-type phosphoenolpyruvate carboxylase comprises SEQ ID NO: 2, with mutations including at least one amino acid substitution selected from the group consisting of: (a) an amino acid substitution at the position 299 with asparagine, (b) an amino acid substitution at the position 653 with glycine, (c) an amino acid substitution at the position 813 with serine or glycine, (d) an amino acid substitution at the position 869 with glycine, (e) an amino acid substitution at the position 873 with glycine or serine, and (f) an amino acid substitution at the position 917 with glycine, wherein the reaction product is obtained by: (p) culturing the genetically modified microorganism in a reaction medium (X) comprising a sugar serving as a substrate, to produce the target substance, and the genetically modified microorganism is cultured so as to produce aspartic acid or a downstream metabolite from aspartic acid as the target substance via the counterclockwise TCA cycle under reducing conditions or anaerobic conditions; wherein the reaction product is an intermediate product, whereby recovering of the target substance is achieved by harvesting the intermediate product containing the target substance, and wherein the genetically modified microorganism produces more aspartic acid or a downstream metabolite from aspartic acid as the target substance as compared to the wild-type unmodified microorganism.

2. The reaction product according to claim 1, wherein the genetically modified microorganism is further satisfying Condition (IV): pyruvate: quinone oxidoreductase is reduced or inactivated relative to the wild-type unmodified microorganism.

3. A method for producing a target substance, the method comprising: (p) culturing a genetically modified microorganism in a reaction medium (X) comprising a sugar serving as a substrate, to produce a target substance; and (q) recovering the target substance from the reaction medium (X), wherein the genetically modified microorganism belongs to the genus Escherichia or coryneform bacteria, and is genetically modified: (I) to have an inactivated or disrupted chromosomal gene, the gene encoding a fumarate reductase catalyzing a conversion reaction from fumarate to succinate in a counterclockwise TCA cycle under reducing conditions or anaerobic conditions; (II) to have an inactivated or disrupted chromosomal lactate dehydrogenase gene; and (III) to have an operable gene that encodes a mutant-type phosphoenolpyruvate carboxylase showing increased resistance to feedback inhibition by aspartic acid as compared to a wild-type phosphoenolpyruvate carboxylase, in step (p), the genetically modified microorganism is cultured so as to produce aspartic acid or a downstream metabolite from aspartic acid as the target substance via the counterclockwise TCA cycle under reducing conditions or anaerobic conditions, and the mutant-type phosphoenolpyruvate carboxylase comprises SEQ ID NO: 2, with mutations including at least one amino acid substitution selected from the group consisting of: (a) an amino acid substitution at the position 299 with asparagine, (b) an amino acid substitution at the position 653 with glycine, (c) an amino acid substitution at the position 813 with serine or glycine, (d) an amino acid substitution at the position 869 with glycine, (e) an amino acid substitution at the position 873 with glycine or serine, and (f) an amino acid substitution at the position 917 with glycine, and wherein the genetically modified microorganism produces more aspartic acid or a downstream metabolite from aspartic acid as the target substance as compared to a wild-type unmodified microorganism, wherein the wild-type unmodified microorganism is a wild type of the genetically modified microorganism.

4. The method according to claim 3, wherein, in Step (p), the genetically modified microorganism is cultured in the reaction medium (X under reducing conditions where the genetically modified microorganism does not substantially proliferate, to produce the target substance.

5. The method according to claim 3, wherein an oxidation-reduction potential of the reaction medium (X) is a predetermined value within the range of 200 mV to 500 mV.

6. The method according to claim 3, wherein the reaction medium (X) comprises glucose serving as the substrate.

7. The method according to claim 3, wherein the genetically modified microorganism is precultured to proliferate under aerobic conditions in a predetermined culture medium (Y prior to the step (p).

8. The method according to claim 3, wherein the aspartic acid or the downstream metabolite from aspartic acid serving as the target substance is oxaloacetic acid or malic acid, which is an intermediate metabolite in the counterclockwise TCA cycle under reducing conditions or anaerobic conditions.

9. The method according to claim 3, wherein the target substance is aspartic acid, beta alanine, or asparagine.

10. A mutant-type phosphoenolpyruvate carboxylase comprising an amino acid mutation with respect to an amino acid sequence of a wild-type phosphoenolpyruvate carboxylase of a microorganism belonging to coryneform bacteria, the amino acid mutation being capable of reducing feedback inhibition by aspartic acid in the wild-type phosphoenolpyruvate carboxylase activity, wherein the amino acid mutation at least comprises: based on the amino acid sequence set forth in SEQ ID NO: 2, (g) an amino acid substitution of an amino acid corresponding to the 299th aspartic acid with asparagine; (i) an amino acid substitution of an amino acid corresponding to the 813th lysine with a predetermined amino acid, wherein the substituted amino acid is not lysine; or (l) an amino acid substitution of an amino acid corresponding to the 917th asparagine with a predetermined amino acid, wherein the substituted amino acid is not asparagine, wherein the mutant-type phosphoenolpyruvate carboxylase has higher resistance to feedback inhibition by aspartic acid than that of a protein having only the amino acid substitution defined in (g), (i), or (1) above with respect to the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase.

11. The mutant-type phosphoenolpyruvate carboxylase according to claim 10, wherein the mutant-type phosphoenolpyruvate carboxylase has an amino acid sequence set forth in in any one of the following (J), (K), and (L): (J) an amino acid sequence obtained by introducing the amino acid substitution set forth in (g) above and the amino acid substitution set forth in (i) or (1) above into the amino acid sequence set forth in any one of SEQ ID NOs: 2 to 13; (K) an amino acid sequence having deletion, substitution, and/or addition of one or more amino acids in the amino acid sequence defined in (J) above, wherein each of the above amino acid substitutions has been maintained; and (L) an amino acid sequence having a sequence identity of at least 60% to the amino acid sequence defined in (J) above, wherein each of the above amino acid substitutions has been maintained.

12. The mutant-type phosphoenolpyruvate carboxylase according to claim 11, wherein the amino acid sequence defined in (J) above is an amino acid sequence obtained by introducing the above amino acid substitution into the amino acid sequence set forth in SEQ ID NO: 2.

13. The mutant-type phosphoenolpyruvate carboxylase according to claim 10, wherein the mutant-type phosphoenolpyruvate carboxylase has an amino acid sequence obtained by introducing the above amino acid substitution into the amino acid sequence set forth in any one of SEQ ID NOs: 2 to 13.

14. A nucleic acid coding for the mutant-type phosphoenolpyruvate carboxylase according to claim 12.

15. The nucleic acid according to claim 14, wherein the nucleic acid is a DNA fragment.

16. A genetically modified microorganism into which the nucleic acid according to claim 14 is introduced.

17. The genetically modified microorganism according to claim 16, satisfying all of the following Conditions (I) to (III): Condition (I): succinate dehydrogenase activity or fumarate reductase activity is reduced or inactivated relative to a wild-type microorganism corresponding to the genetically modified microorganism; Condition (II): lactate dehydrogenase activity is reduced or inactivated relative to the wild-type microorganism; and Condition (III): the genetically modified microorganism has modified phosphoenolpyruvate carboxylase activity showing resistance to feedback inhibition by aspartic acid in wild-type phosphoenolpyruvate carboxylase activity, or exogenous phosphoenolpyruvate carboxylase activity having higher resistance to feedback inhibition by aspartic acid than that of the wild-type phosphoenolpyruvate carboxylase activity shown by the wild-type microorganism.

18. The genetically modified microorganism according to claim 17, further satisfying Condition (IV): pyruvate: quinone oxidoreductase is reduced or inactivated relative to the wild-type microorganism.

19. The reaction product according to claim 1, wherein the genetically modified microorganism is a genetically modified microorganism belonging to Gram-positive bacteria.

20. The reaction product according to claim 19, wherein the genetically modified microorganism is a genetically modified microorganism belonging to coryneform bacteria.

21. The reaction product according to claim 1, wherein the genetically modified microorganism is a genetically modified microorganism belonging to Gram-negative bacteria.

22. The reaction product according to claim 21, wherein the genetically modified microorganism is a genetically modified microorganism belonging to the genus Escherichia.

23. The reaction product according to claim 21, wherein the genetically modified microorganism is further satisfying Condition V): pyruvate formate-lyase activity is reduced or inactivated relative to the wild-type unmodified microorganism.

24. The method according to claim 3, wherein the genetically modified microorganism in Step (p) belongs to the genus Escherichia, and is genetically modified to have an inactivated or disrupted chromosomal pyruvate formate-lyase gene.

25. The method according to claim 3, wherein the genetically modified microorganism is genetically modified to have an inactivated or disrupted chromosomal pyruvate: quinone oxidoreductase gene.

26. The method according to claim 3, wherein the mutant-type phosphoenolpyruvate carboxylase comprises the amino acid substitution of (a) above and at least one selected from among the amino acid substations of (c), (e) and (f) above.

27. The method according to claim 3, wherein the genetically modified microorganism belongs to the coryneform bacteria, and the disrupted inactivated or disrupted chromosomal gene encoding the fumarate reductase in (I) above is at least one selected from the group consisting of sdhC, sdhA, sdhB and sdhD.

28. The method according to claim 27, wherein the genetically modified microorganism belongs to the genus Corynebacterium.

29. The method according to claim 3, wherein the genetically modified microorganism belongs to the genus Escherichia, and the inactivated or disrupted chromosomal gene encoding the fumarate reductase in (I) above is at least one gene selected from the group consisting of frdD, frdC, frdB and frdA.

30. The method according to claim 3, wherein the genetically modified microorganism belongs to the genus Escherichia, and is genetically modified to have an inactivated or disrupted chromosomal pyruvate formate-lyase gene.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a diagram showing a metabolic pathway which can be adopted in some embodiments of the invention.

(2) FIG. 2A is a diagram schematically showing a positional relationship between PCR primers used in Examples and a gene.

(3) FIG. 2B is a diagram schematically showing a positional relationship between PCR primers used in Examples and genes.

(4) FIG. 2C is a diagram schematically showing a positional relationship between PCR primers used in Examples and a gene.

(5) FIG. 3A is a diagram showing a part of results obtained by subjecting various wild-type phosphoenolpyruvate carboxylase protein sequences to multiple alignment analysis.

(6) FIG. 3B is a diagram showing another part of results obtained by the multiple alignment analysis in FIG. 3A.

(7) FIG. 3C is a diagram showing still another part of results obtained by the multiple alignment analysis in FIG. 3A.

(8) FIG. 4 is a diagram showing results of Test Example 1 in Examples.

(9) FIG. 5 is a diagram showing results of Test Example 2 in Examples.

(10) FIG. 6 is a diagram showing results of Test Example 3 in Examples.

(11) FIG. 7 is a diagram showing results of Test Example 4 in Examples.

MODE(S) FOR CARRYING OUT THE INVENTION

(12) <Genetically Modified Microorganism>

(13) According to a first aspect of the invention, provided is the following genetically modified microorganism.

(14) A genetically modified microorganism satisfying at least one of the following Conditions (I), (II), and (IV) and satisfying the following Condition (III): Condition (I): succinate dehydrogenase activity or fumarate reductase activity is reduced or inactivated relative to a wild-type microorganism corresponding to the genetically modified microorganism; Condition (II): lactate dehydrogenase activity is reduced or inactivated relative to the wild-type microorganism; Condition (III): the genetically modified microorganism has modified phosphoenolpyruvate carboxylase activity showing resistance to feedback inhibition by aspartic acid in wild-type phosphoenolpyruvate carboxylase activity or exogenous phosphoenolpyruvate carboxylase activity having higher resistance to feedback inhibition by aspartic acid than that of the wild-type phosphoenolpyruvate carboxylase activity shown by the wild-type microorganism; and Condition (IV): pyruvate:quinone oxidoreductase activity is reduced or inactivated relative to the wild-type microorganism.

(15) Furthermore, according to a second aspect of the invention, provided is the following genetically modified microorganism.

(16) A genetically modified microorganism satisfying all of the following Conditions (I) to (III): Condition (I): succinate dehydrogenase activity or fumarate reductase activity is reduced or inactivated relative to a wild-type microorganism corresponding to the genetically modified microorganism; Condition (II): lactate dehydrogenase activity is reduced or inactivated relative to the wild-type microorganism; and Condition (III): the genetically modified microorganism has modified phosphoenolpyruvate carboxylase activity showing resistance to feedback inhibition by aspartic acid in wild-type phosphoenolpyruvate carboxylase activity or exogenous phosphoenolpyruvate carboxylase activity having higher resistance to feedback inhibition by aspartic acid than that of the wild-type phosphoenolpyruvate carboxylase activity shown by the wild-type microorganism.

(17) In addition, hereinafter, the genetically modified microorganism according to the first aspect of the invention and the genetically modified microorganism according to the second aspect of the invention may be collectively referred to as the genetically modified microorganism of the invention or the genetically modified microorganism according to the invention.

(18) In the invention, the genetically modified microorganism is sufficient to be literally understood, and thus, is sufficient to be understood that the genetically modified microorganism is a microorganism which has been subjected to any gene modifications. More specifically, such a genetic modifications may be those that realize a predetermined combination of Conditions (I) to (IV) above within the realm defined for each of the genetically modified microorganisms according to the first and second aspects of the invention.

(19) In the invention, the microorganism is sufficient to be literally understood. More specifically, the microorganism and genetically modified microorganism in the invention may be fungi, or prokaryotes such as archaea, cyanobacteria and bacteria. In the invention, the microorganism and the genetically modified microorganism are preferably fungi or bacteria, and more preferably bacteria.

(20) Examples of fungi include yeasts of the genus Saccharomyces (e.g., Saccharomyces cerevisiae), yeasts of the genus Schizosaccharomyces (e.g., Schizosaccharomyces pombe), yeasts of the genus Pichia (e.g., Pichia pastoris), yeasts of the genus Kluyveromyces (Kluyveromyces lactis), Hansenula polymorpha, yeasts of the genus Yarrowia (e.g., Yarrowia lipolytica), fungi of the genus Cryptococcus (e.g., Cryptococcus sp. S-2), fungi of the genus Aspergillus (e.g., Aspergillus oryzae), and fungi of the genus Pseudozyma (e.g., Pseudozyma antarctica). Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and the like can be conveniently used in the invention since gene manipulation techniques or heterologous protein expression systems therefor are established.

(21) Examples of the bacteria include the genus Escherichia (e.g., Escherichia coli), the genus Bacillus (e.g., Bacillus subtilis), the genus Lactobacillus (e.g., Lactobacillus acidophilus), the genus Clostridium (e.g., Clostridium thermocellum and Clostridium acetobutylicum), the genus Rhodopseudomonas (e.g., Rhodopseudomonas palustris), the genus Rhodobacter (Rhodobacter capsulatus), and bacteria belonging to coryneform bacteria specifically described below. The microorganism and genetically modified microorganism in the invention are preferably the genus Escherichia or coryneform bacteria, more preferably Escherichia coli or coryneform bacteria, most preferably the genus Corynebacterium, for which genetic manipulation techniques or protein expression systems have already been established and which enable substance production under reducing conditions where the bacterial cells do not substantially proliferate.

(22) Moreover, in some embodiments, the genetically modified microorganism according to the invention is a microorganism belonging to Gram-positive bacteria (e.g., actinomycetes). Furthermore, in other some embodiments, the genetically modified microorganism according to the invention may be a microorganism belonging to Gram-negative bacteria. The Gram-negative bacteria specifically are microorganisms belonging to the phylum Proteobacteria, and more particularly include microorganisms belonging to the class Alpha-, Beta-, Gamma-, Delta-, Epsilon-, or Zeta-proteobacteria, and microorganisms belonging to the class Oligoflexia. Examples of the Gram-negative bacteria which can be preferably used in the invention include microorganisms belonging to the family Enterobacteriaceae, the family Vibrionaceae, or the family Pseudomonadaceae.

(23) Herein, the coryneform bacteria refer to a group of microorganisms defined in Bargey's Manual of Determinative Bacteriology (8th Ed., p. 599, 1974).

(24) More particularly, examples of coryneform bacteria include the genus Corynebacterium, the genus Brevibacterium, the genus Arthrobacter, the genus Mycobacterium, the genus Micrococcus, and the genus Microbacterium.

(25) Examples of the genus Corynebacterium include species and strains as described below: Corynebacterium glutamicum (e.g., strains FERM P-18976, ATCC13032, ATCC31831 strain, ATCC13058, ATCC13059, ATCC13060, ATCC13232, ATCC13286, ATCC13287, ATCC13655, ATCC13745, ATCC13746, ATCC13761, and ATCC14020); Corynebacterium acetoglutamicum (e.g., strain ATCC15806); Corynebacterium acetoacidophilum (e.g., strain ATCC13870); Corynebacterium melassecola (e.g., strain ATCC17965); Corynebacterium efficiens (e.g., strain YS-314, strain YS-314.sup.T (strain NBRC100395.sup.T)); Corynebacterium alkanolyticum (e.g., strain ATCC21511); Corynebacterium callunae (e.g., strains ATCC15991, NBRC15359 strain, and DSM20147); Corynebacterium lilium (e.g., strain ATCC15990); Corynebacterium thermoaminogenes (Corynebacterium efficiens) (e.g., strains AJ12340 and FERM BP1539); Corynebacterium herculis (e.g., strain ATCC13868); Corynebacterium ammoniagenes (Brevibacterium ammoniagenes) (e.g., strains ATCC6871, ATCC6872, DSM20306, NBRC12071.sup.T, NBRC12072, and NBRC12612.sup.T); Corynebacterium pollutisoli; Corynebacterium marinum (e.g., strain DSM44953); Corynebacterium humireducens (e.g., strain NBRC106098); Corynebacterium halotolerans (e.g., strain YIM70093); Corynebacterium deserti (e.g., strain GIMN1.010); Corynebacterium doosanense (e.g., strains CAU212, and DSM45436); and Corynebacterium maris (e.g., strain DSM45190).

(26) Specific examples of the genus Brevibacterium include the following species and strains: Brevibacterium divaricatum (e.g., strain ATCC14020); Brevibacterium flavum [e.g., strains MJ-233 (FERM BP-1497), MJ-233AB-41 (FERM BP-1498), ATCC13826, ATCC14067, and ATCC13826]; Brevibacterium immariophilum (e.g., strain ATCC14068); Brevibacterium lactofermentum (Corynebacterium glutamicum) (e.g., strain ATCC13869); Brevibacterium roseum (e.g., strain ATCC13825); Brevibacterium saccharolyticum (e.g., strain ATCC14066); Brevibacterium thiogenitalis (e.g., strain ATCC19240); Brevibacterium album (e.g., strain ATCC15111); and Brevibacterium cerinum (e.g., strain ATCC15112).

(27) Specific examples of the genus Arthrobacter include species and strains as described below: Arthrobacter globiformis (e.g., strains ATCC8010, ATCC4336, ATCC21056, ATCC31250, ATCC31738, ATCC35698, NBRC3062, and NBRC12137T).

(28) Specific examples of the genus Micrococcus include Micrococcus freudenreichii [e.g., strain No. 239 (FERM P-13221)]; Micrococcus luteus [e.g., strain NCTC2665, No. 240 (FERM P-13222)]; Micrococcus ureae (e.g., strain IAM1010); and Micrococcus roseus (e.g., strain IFO3764).

(29) Specific examples of the genus Microbacterium include Microbacterium ammoniaphilum (e.g., strain ATCC15354).

(30) Additionally, for example, in the case of ATCC strains among the above-described strains of coryneform bacteria, the strains are available from American Type Culture Collection (P.O. Box 1549 Manassas, VA 20108 USA) that provides those strains. Other strains would also be available from respective microbial culture collections that provide those strains.

(31) The genetically modified microorganism according to the invention can be prepared by subjecting the microorganism exemplified above to a predetermined gene manipulation.

(32) [Conditions (I), (II), (IV), and (V)]

(33) At first, Conditions (I), (II), and (IV) will be described.

(34) The expression succinate dehydrogenase activity or fumarate reductase activity is reduced or inactivated relative to a wild-type microorganism corresponding to the genetically modified microorganism in Condition (I) means that a succinate dehydrogenase or fumarate reductase activity is significantly reduced or completely inactivated relative to a wild-type microorganism that is used as a starting material for preparation of the genetically modified microorganism according to the invention. Additionally, some of bacteria such as the genus Corynebacterium do not have fumarate reductase, and succinate dehydrogenase catalyzes this reaction. However, some of bacteria such as E. coli have both enzymes of succinate dehydrogenase and fumarate reductase, and the fumarate reductase mainly catalyzes the above reaction.

(35) Moreover, the expression lactate dehydrogenase activity is reduced or inactivated relative to the wild-type microorganism in Condition (II) means that lactate dehydrogenase activity is significantly reduced or completely inactivated relative to the wild-type microorganism that is used as a starting material for preparation of the genetically modified microorganism according to the invention.

(36) Furthermore, the expression pyruvate:quinone oxidoreductase activity is reduced or inactivated relative to the wild-type microorganism in Condition (IV) means that pyruvate:quinone oxidoreductase activity is significantly reduced or completely inactivated relative to the wild-type microorganism used as a starting material for preparation of the genetically modified microorganism according to the invention.

(37) More specifically, Conditions (I), (II), and (IV) mean that, in the metabolic pathway of the microorganism as shown in FIG. 1, the metabolization from succinic acid to fumaric acid or the reverse metabolization thereof (e.g., SdhCAB/FrdDCBA), the metabolization from pyruvic acid to lactic acid (Ldh), and the metabolization from pyruvic acid to acetic acid (PoxB; Pro), respectively, are significantly suppressed or inactivated.

(38) Meanwhile, in microorganisms capable of proliferating under aerobic conditions but incapable of proliferating under reducing conditions (anaerobic conditions), generally, metabolism in the TCA cycle (citric acid cycle) shown in FIG. 1 proceeds clockwise under aerobic conditions, while, on the other hand, metabolism in the TCA cycle proceeds counterclockwise under reducing conditions or anaerobic conditions.

(39) That is, in the case of adopting an embodiment satisfying Condition (I) in the invention, since conversion from succinic acid to fumaric acid is suppressed under aerobic conditions, a larger amount of citric acid, cis-aconitic acid, D-isocitric acid, -ketoglutaric acid, succinyl CoA, succinic acid, or additional metabolites derived therefrom can efficiently be produced, while, on the other hand, under reducing conditions or anaerobic conditions, a larger amount of oxaloacetic acid, L-malic acid, fumaric acid, or additional metabolites derived therefrom can efficiently be produced. In that case, in the genetically modified microorganism of the invention satisfying Condition (I), the above additional metabolites derived from the above metabolites of the TCA cycle may be biosynthesized via metabolic systems that the corresponding wild-type microorganism inherently possesses, or may even be biosynthesized via new metabolic systems constructed by introduction of a predetermined gene.

(40) Next, in the case of adopting an embodiment satisfying Condition (II) in the invention, since conversion from pyruvic acid to lactic acid is suppressed, the metabolic pathway from pyruvic acid to oxaloacetic acid efficiently proceeds. As a result, according to such an embodiment, the production of oxaloacetic acid, L-malic acid, fumaric acid, or additional metabolites derived therefrom can efficiently be performed.

(41) Furthermore, in the case of adopting an embodiment satisfying Condition (IV) in the invention, since conversion from pyruvic acid to acetic acid is suppressed, similarly to the embodiment satisfying Condition (II), the metabolic pathway from pyruvic acid to oxaloacetic acid efficiently proceeds. As a result, according to such an embodiment, the production of oxaloacetic acid, L-malic acid, fumaric acid, or additional metabolites derived therefrom can efficiently be performed. Therefore, an embodiment satisfying both Conditions (II) and (IV) can preferably be adopted in the invention since the production efficiency of oxaloacetic acid, L-malic acid, fumaric acid, or additional metabolites derived therefrom can be further improved in such an embodiment.

(42) In a specific embodiment, the genetically modified microorganism according to the invention satisfies at least two conditions of Conditions (I), (II), and (IV). In this case, the genetically modified microorganism according to the invention preferably satisfies both of Conditions (I) and (II), both of Conditions (I) and (IV), or Conditions (II) and (IV), and more preferably satisfies all of Conditions (I), (II), and (IV).

(43) The reason for this is explained as follows. In such embodiments, the metabolic pathway from pyruvic acid to the TCA cycle and the metabolism of the TCA cycle efficiently proceed, and therefore, efficient production of oxaloacetic acid, L-malic acid or fumaric acid in the TCA cycle, or a metabolite derived therefrom, or even a downstream metabolite (e.g., citric acid, cis-aconitic acid, D-isocitric acid, -ketoglutaric acid, succinyl CoA, succinic acid) can be realized. Thus, production of these metabolites or even substances derived therefrom through another metabolization can be efficiently achieved.

(44) More specifically, for example, in the embodiment shown in FIG. 1, a downstream metabolite such as succinic acid or a metabolite derived therefrom (e.g., glutamic acid or a metabolite derived from glutamic acid) can efficiently be produced under aerobic conditions, while, a downstream metabolite such as fumaric acid or a metabolite derived therefrom (for example, aspartic acid or a metabolite derived from aspartic acid) can efficiently be produced under a reducing condition.

(45) Next, Condition (V) will be described.

(46) The genetically modified microorganism according to the invention additionally satisfies the following Condition (V) in a specific embodiment, although it is not indispensable to satisfy Condition (V) in the invention.

(47) Condition (V): pyruvate formate-lyase activity is reduced or inactivated relative to the wild-type microorganism.

(48) Herein, the expression pyruvate formate-lyase activity is reduced or inactivated relative to the wild-type microorganism in Condition (V) means that pyruvate formate-lyase activity is significantly reduced or completely inactivated relative to the wild-type microorganism used as a starting material for preparation of the genetically modified microorganism according to the invention.

(49) In particular, in a case where the genetically modified microorganism according to the invention is a microorganism belonging to gram-negative bacteria, the genetically modified microorganism preferably satisfies Condition (V). The reason for this is as follows. A wild-type microorganism belonging to gram-negative bacteria expresses pyruvate formate-lyase activity that is not usually found in gram-positive bacteria. As described below, the pyruvate formate-lyase activity creates a secondary biosynthetic pathway for synthesis of organic acids such as formic acid and acetic acid from pyruvic acid. That is, when such pyruvate formate-lyase activity is reduced or inactivated, the secondary biosynthetic pathway can be blocked, and thus, the metabolic flux to a target substance is made to be stronger, thereby realizing more efficient production of a target substance.

(50) In the meantime, the succinate dehydrogenase activity or fumarate reductase activity in Condition (I), the lactate dehydrogenase activity in Condition (II), the pyruvate:quinone oxidoreductase activity in Condition (IV), and the pyruvate formate-lyase activity in Condition (V) are respective enzyme activities that can inherently be shown by a wild-type microorganism used as a starting material for preparation of the genetically modified microorganism according to the invention. More specifically, the enzyme activities can be described by the EC numbers, which have been recognized as the international enzyme classification based on systematic taxonomy and categories of reactions according to types of reactions between substrates and enzymes, and the enzyme activities in the respective conditions include the enzyme activities shown in Table 1 below.

(51) TABLE-US-00001 TABLE 1 Nomenclature EC Major possible reactions Conditions of enzymes numbers catalyzed by respective enzymes (I) Succinate dehydrogenase 1.3.5.1 Quinone + Succinate .Math. Fumarate reductase Hydroquinone + Fumarate 1.3.5.4 Same as above (reverse reaction) 1.3.1.6 Succinate + NAD.sup.+ .Math. Fumarate + NADH (II) Lactate dehydrogenase 1.1.5.12 (R)-lactate + Quinone .Math. Pyruvate + Quinol 1.1.1.27 (S)-lactate + NAD.sup.+ .Math. Pyruvate + NADH + H.sup.+ 1.1.1.28 (R)-lactate + NAD.sup.+ .Math. Pyruvate + NADH + H.sup.+ 1.1.2.4 (R)-lactate + 2[Fe(III)cytochrome c] .Math. 2[Fe(II)cytochrome c] + 2H.sup.+ + Pyruvate 1.1.2.3 (S)-lactate + 2[Fe(III) cytochrome c] .Math. [Fe(II)cytochrome c] + 2H.sup.+ + Pyruvate (IV) Pyruvate:quinone 1.2.5.1 Pyruvate + ubiquinone + H.sub.2O .Math. Acetate + oxidoreductase CO.sub.2 + ubiquinol (Pyruvate dehydrogenase (quinone)) (V) Pyruvate Formate- 2.3.1.54 Acetyl-CoA + Formate .Math. CoA + Pyruvate Lyase (Formate acetyltransferase)

(52) Herein, fulfillment of Conditions (I) and/or (II) and/or (IV) and/or (V) may be realized using various techniques for genetic engineering and molecular biology. For example, with respect to succinate dehydrogenase genes or fumarate reductase genes, lactate dehydrogenase genes, pyruvate:quinone oxidoreductase genes, and pyruvate formate-lyase genes (formate acetyltransferase genes), which are found in microorganisms exemplified in Tables 2 to 10 below, a technique based on gene disruption or mutation introduction that targets the genes on genome, a technique based on antisense inhibition (antisense RNA) on the mRNA expression level, and the like can be applied. Alternatively, a genetically modified microorganism subjected to genetic manipulation to express a peptide or protein inhibiting each of the enzyme activities is also encompassed by the invention. Furthermore, alternatively, in a case where an enzyme protein that can cause each enzyme activity requires an activation process by a predetermined endogenous activator to express the enzyme activity in the microorganism, fulfillment of each condition may be realized by way of inactivation of the endogenous activator to thereby suppress the expression of the enzyme activity.

(53) However, a technique for gene disruption or mutation introduction is preferably employed because such a technique make it possible to relatively simply and more reliably realize reduction or inactivation of the respective enzyme activities in the above conditions. More specifically, any of embodiments (I) to (IV) is preferably adopted: (I) an embodiment in which an enzyme gene coding region that can cause each enzyme activity has completely or partially been disrupted in the genome (chromosomal DNA) of the genetically modified microorganism to fulfill Conditions (I) and/or (II) and/or (IV) and/or (V); (II) an embodiment in which a gene expression regulation region (e.g., a promoter region) that exists upstream of an enzyme gene coding region causing each enzyme activity has been completely or partially disrupted in the genome of the genetically modified microorganism to fulfill Conditions (I) and/or (II) and/or (IV) and/or (V); (III) an embodiment in which a nucleotide mutation inducing one or more amino acid mutations has been introduced into an enzyme gene coding region that can cause each enzyme activity, in the genome of the genetically modified microorganism, to fulfill Conditions (I) and/or (II) and/or (IV) and/or (V), wherein the one or more amino acid mutations mean amino acid mutations causing reduction or inactivation of each enzyme activity; (IV) an embodiment in which an endogenous activator that activates enzyme activity of an enzyme protein causing each enzyme activity has been inactivated based on the methods mentioned in Embodiments (I) to (III) above, to fulfill Conditions (I) and/or (II) and/or (IV) and/or (V).

(54) Additionally, needless to say, Embodiments (I) to (IV) above may be each independently adopted to realize the reduction or inactivation of each enzyme activity defined in each condition. In addition, in order to satisfy one condition, at least two embodiments of Embodiments (I) to (IV) may be adopted particularly within the range that does not cause any inconsistency. For example, in order to satisfy Condition (I), both Embodiments (I) and (II) may be adopted, and, more specifically, both of the coding region and the gene expression regulation region for each gene may be disrupted in the genome of the microorganism. In addition, for example, both of Embodiments (I) and (II) may be adopted in order to satisfy Condition (I), and Embodiment (III) may be adopted in order to satisfy Condition (II).

(55) Herein, the disruption of the gene coding region or the gene expression regulation region (target region) in the genetically modified microorganism can be realized, for example, based on techniques such as a homologous recombination method, a genome-editing technique (CRISPR/CAS system), a transposon method, and a mutation introduction method. Among these techniques, from the viewpoint that the disruption of the target region can comparatively inexpensively and efficiently be achieved, it a homologous recombination method is conveniently employed. Hereinafter, an example of a gene disruption method based on homologous recombination will be described. However, it should be noted that the method for preparing the genetically modified microorganism according to the invention is not limited to the method described below, and any method can be adopted.

(56) [Gene Disruption Method Based on Homologous Recombination]

(57) (1) Determination of Target Region to be Disrupted and Cloning of Same Region

(58) Regarding a number of bacteria such as the genera Escherichia, Bacillus and Clostridium, and various fungi such as Saccharomyces cerevisiae and Yarrowia lipolytica, their whole genome sequences have been determined, and also, their nucleotide sequences, and amino acid sequences of proteins encoded by respective genes have already been known.

(59) For example, speaking of Corynebacterium glutamicum, which is one of microorganisms that can preferably be used in the invention, whole genome sequences of many strains such as strain ATCC13032, strain R, strain ATCC21831, and strain ATCC14067 have been determined, and also, their nucleotide sequences and the like have already been known. Moreover, whole genome sequences have already been determined for strains of the genus Corynebacterium such as Corynebacterium efficiens strain YS-314; Corynebacterium callunae strain DSM20147; Corynebacterium ammoniagenes strain DSM20306; Corynebacterium marinum strain DSM44953; Corynebacterium humireducens strain NBRC106098 (DSM45392); Corynebacterium halotolerans strain YIM70093 (DSM44683); Corynebacterium deserti strain GIMN1.010; Corynebacterium maris strain DSM45190; and Corynebacterium doosanense strain CAU212 (DSM45436), and thus, their nucleotide sequences and the like have already been known. Furthermore, there are also microorganisms of which nucleotide sequences of the respective enzyme genes causing the respective enzyme activities in Conditions (I), (II), (IV), and (V), and amino acid sequences of the enzymes have already been known, although their whole genome sequences have not yet been determined.

(60) Such known nucleotide sequences and amino acid sequences are easily available from various databases such as database (URL: https://www.nebi.nlm.nih.gov/) posted on the Internet by National Center for Biotechnology Information Support Center (NCBI) (8600 Bethesda Rockville Pike, Maryland, USA).

(61) With regard to microorganisms serving as starting materials for preparation of the genetically modified microorganisms according to the invention, Tables 2 to 10 below shows examples of information on genes that may be subjected to disruption or the like to reduce or inactivate the enzyme activities in Conditions (I) and/or (II) and/or (IV) and/or (V), etc. In addition, needless to say, information and the like on microorganisms that may be used in the invention, and the respective genes that may be targeted to reduce or inactivate the respective enzyme activities are not limited to those shown in the following tables.

(62) TABLE-US-00002 TABLE 2 Microorganism Gene symbols (Scientific names) (homologue gene) Gene ID GenBankID (NCBI) Information Corynebacterium sdhC 1021096 Coding region: 392705-393478 glutamicum ATCC13032 (Cgl0370) protein_id: NP_599618.1 (Genome sequence ID: sdhA 1021051 Coding region: 393495-395516 NC_003450.3) (Cgl0371) protein id: NP 599619.1 sdhB 1021416 Coding region: 395516-396265 (Cgl0372) protein id: NP 599620.1 ldh 1020853 Coding region: complement (Cg12911) (3112447-3113391) protein id: NP 602100.1 poxB 1020557 Coding region: complement (pqo) (2776766-2778505) (Cgl2610) protein id: NP 601811.1 Escherichia coli str. K-12 sdhC 945316 Coding region: 755177..755566 substr. MG1655 protein_id: NP_415249.1 (Genome sequence ID: sdhD 945322 Coding region: 755560..755907 NC_000913.3) protein_id: NP_415250.1 sdhA 945402 Coding region: 755907..757673 protein_id: NP_415251.1 sdhB 945300 Coding region: 757689..758405 protein_id: NP_415252.1 ldhA 946315 Coding region: complement (1441854..1442843) protein_id: NP_ 415898.1 EC number=1.1.1.28 dld 946653 Coding region: 2222185..2223900 protein_id: NP_416637.1 EC number=1.1.5.12 lldD 948121 Coding region: 3779827..3781017 protein id: NP 418062.1 poxB 946132 Coding region: complement (909331..911049) protein_id: NP_415392.1 frdD 948668 Coding region: complement (ECK4147) (4379007..4379366) product: fumarate reductase membrane protein FrdD protein_id: NP_418575.1 EC number:1.3.5.4 frdC 948680 Coding region: complement (ECK4148) (4379377..4379772) Product: fumarate reductase membrane protein FrdC protein_id: NP_418576.1 EC number=1.3.5.4 frdB 948666 Coding region: complement (ECK4149) (4379783..4380517) Product: fumarate reductase iron- sulfur protein protein_id:NP_418577.1 EC number:1.3.5.4 frdA 948667 Coding region: complement (ECK4150) (4380510..4382318) product: fumarate reductase flavoprotein subunit protein_id: NP_418578.1 EC number:1.3.5.4 pflB 945514 Coding region: complement (ECK0894; pfl) (951272..953554) product: pyruvate formate-lyase protein_id: NP_415423.1 EC number:2.3.1.54 ybiW 945444 Coding region: complement (ECK0813; pflF) (860174..862606) product: putative pyruvate formate lyase protein id: NP_415344.1 pflD 948454 Coding region: 4143995..4146292 (ECK3942; yijL) product: putative formate acetyltransferase 2 protein_id: NP_418386.1 tdcE 947623 Coding region: complement (ECK3103; yhaS) (3260124..3262418) product: 2-ketobutyrate formate- lyase/pyruvate formate-lyase 4 protein_id: YP_026205.1 EC number:2.3.1.54 pflA 945517 Coding region: complement (act; ECK0893) (950340..951080) product: pyruvate formate-lyase activating enzyme protein_id: NP_415422.1 EC number:1.97.1.4 pflC 948453 Coding region: 4146258..4147136 (ECK3943; yijM) product: putative pyruvate formate- lyase 2 activating enzyme PflC protein_id: NP_418387.3 Bacillus subtilis ATCC sdhC complement (2665158..2665766) 13952 protein_id: WP_003152571.1 (Genome sequence sdhA complement (2663364..2665124) ID:NZ_CP009748.1) protein_id: WP_013353100.1 sdhB complement (2662603..2663361) protein_id: WP_013353099.1 KS08_RS01490 282196..283149 protein_id: WP_014471413.1 L-lactate dehydrogenase

(63) TABLE-US-00003 TABLE 4 Microorganism Gene symbols (Scientific names) (homologue gene) Gene ID GenBankID (NCBI) Information Saccharomyces cerevisiae SDH1 853709 Chromosome XI S288C Genome sequence ID: NC_001136.10 complement (<169207..>171129) transcript_id: NM_001179714.1 protein_id: NP_012774.1 Flavoprotein subunit SDH2 850685 Chromosome XII Genome sequence ID: NC_001144.5 complement (<53131..>53931) transcript_id: NM_001181861.1 protein_id: NP_013059.1 Iron-sulfur protein subunit SDH3 853716 Chromosome XI Genome sequence ID: NC_001143.9 <179667..>180263 transcript_id:NM_001179707.1 protein_id: NP_012781.1 Cytochrome b subunit SDH4 851758 Chromosome IV Genome sequence ID: NC_001136.10 <817950..>818495 transcript_id: NM_001180485.1 protein_id: NP_010463.1 Membrane anchor subunit SDH5 854083 Chromosome XV Genome sequence ID: NC_001147.6 <196507..>196995 transcript_id: NM_001183326.1 protein_id: NP_014570.1 Protein required for flavinylation of Sdh1p (This protein binds to Sdh1p and promotes FAD cofactor attachment, which is necessary for assembly of succinate dehydrogenase (SDH) and expression of activity.) SDH6 851986 Chromosome IV Genome sequence ID: NC_001136.10 complement (1233278..1233517) transcript_id: NM_001184471.3 protein_id: NP_076888.3 Mitochondrial protein involved in assembly of SDH (involved in maturation of the Sdh2p subunit). SDH7 852123 Chromosome IV Genome sequence ID: NC_001136.10 <1470017..>1470418 transcript_id: NM_001180819.3 protein_id: NP_010799.3 Mitochondrial protein involved in assembly of SDH (involved in maturation of the Sdh2p subunit) SDH8 852572 Chromosome II Genome sequence ID: NC_001134.8 complement (<742160..>742576) transcript_id: NM_001178617.1 protein_id: NP_009828.2 Protein required for assembly of SDH DLD1 851380 Chromosome IV Genome sequence ID: NC_001136.10 complement (<145826..>147589) transcript_id: NM_001180234.1 protein_id: NP_010107.1 Major D-lactate dehydrogenase DLD2 851376 Chromosome IV Genome sequence ID: NC_001136.10 transcript_id: NM_001180238.1 protein_id: NP_010103.1 Minor d-lactate dehydrogenase DLD3 856638 Chromosome V Genome sequence ID: NC_001137.3 <16355..>17845 transcript_id: NM_001178886.1 protein_id: NP_010843.1 Minor D-lactate dehydrogenase

(64) TABLE-US-00004 TABLE 6 Microorganism Gene symbols (Scientific names) (homologue gene) GenBankID (NCBI) information Yarrowia lipolytica SDH1 Chromosome 1D CLIB89 (W29) Genome sequence ID: CP017556.1 complement (1423938..1426073) protein_id: AOW03921.1 Flavoprotein subunit 2 SDH2 Chromosome 1D Genome sequence ID: CP017556.1 3025537..3026343 protein_id: AOW04521.1 Iron-sulfur protein subunit SDH3 Chromosome lE Genome sequence ID: CP017557.1 3508208..3509167 mRNA:join(3508208..3508241,3508686..3509167) protein_id: AOW06147.1 SDH4 Chromosome lA Genome sequence ID: CP017553.1 complement (1471620..1472117) protein_id: AOW00655.1 SDH2P membrane anchor subunit SDH5 Chromosome 1F Genome sequence ID: CP017558.1 1579326..1579763 protein_id: AOW07023.1 Flavinator of SDH DLD1 Chromosome lE Genome sequence ID: CP017557.1 complement (385330..387066) protein id: AOW04885.1 YALI1_E25400g Chromosome lE Genome sequence ID: CP017557.1 2540045..2541166 protein_id: AOW05746.1 Putative lactate dehydrogenase cytochrome b

(65) Furthermore, with respect to a variety of the genus Corynebacterium of which whole genome sequences have been specified, information such as GenBlank ID accession numbers for homologous genes of sdhCABD gene, ldh gene, and poxB gene are shown in Tables 7 to 10.

(66) TABLE-US-00005 TABLE 7 Coryneform bacterial species Gene symbols (Scientific names) (homologue gene) GenBankID (NCBI) information Corynebacterium efficiens sdhC Genome sequence ID: NC_004369.1 YS-314 Coding region: 420459-421232 protein_id: WP_011074957.1 sdhA Genome sequence ID: NC_004369.1 Coding region: 421253-423265 protein_id: WP_006770371.1 sdhB Genome sequence ID: NC_004369.1 Coding region: 423265-424014 protein_id: WP_006770370.1 ldh Genome sequence ID: NC_004369.1 Coding region: complement (2936722- 2937675) protein_id: WP_035109376.1 poxB Unknown Corynebacterium callunae sdhC Genome sequence ID: CP004354.1 DSM20147 Coding region: 374848-375621 protein_id: AGG65781.1 sdhA Genome sequence ID: CP004354.1 Coding region: 375641-377653 protein_id: AGG65782.1 sdhB Genome sequence ID: CP004354.1 Coding region: 377653-378402 protein_id: AGG65783.1 ldh Genome sequence ID: CP004354.1 Coding region: 2672590-2673537 protein_id: AGG67879.1 poxB Genome sequence ID: CP004354.1 Coding region: complement (2370666- 2372405) protein_id: AGG67621.1 Corynebacterium ammoniagenes sdhC Genome sequence ID: CP009244.1 DSM20306 Coding region: 370172-370927 protein_id: APT81721.1 sdhA Genome sequence ID: CP009244.1 Coding region: 370962-37297 protein_id: APT81722.1 sdhB Genome sequence ID: CP009244.1 Coding region: 372977-373726 protein_id: APT81723.1 ldh Genome sequence ID: CP009244.1 Coding region: complement (2614468- 2615415) protein_id: APT83593.1 poxB Genome sequence ID: CP009244.1 Coding region: complement (2383050- 2384801) protein_id: APT83404.1

(67) TABLE-US-00006 TABLE 8 Coryneform bacterial species Gene symbols (Scientific names) (homologue gene) GenBankID (NCBI) information Corynebacterium marinum DSM sdhC Genome sequence ID: NZ_CP007790.1 44953 Coding region: 279105-279860 protein_id: WP_042620633.1 sdhA Genome sequence ID: NZ_CP007790.1 Coding region: 279887-281896 protein_id: WP_042620634.1 sdhB Genome sequence ID: NZ_CP007790.1 Coding region: 281896-282645 protein id: WP_042620635.1 ldh Genome sequence ID: NZ_CP007790.1 Coding region: complement (2470158- 2471123) WP_042622762.1 poxB Genome sequence ID: NZ_CP007790.1 Coding region: complement (2227741- 2229486) protein_id: WP_042622095.1 Corynebacterium humireducens sdhC Genome sequence ID: CP005286.1 NBRC 106098 (DSM 45392) Coding region: 269560-270315 protein_id: AJE32111.1 sdhA Genome sequence ID: CP005286.1 Coding region: 270342-272351 protein_id: AJE32112.1 sdhB Genome sequence ID: CP005286.1 Coding region: 272351-273100 protein_id: AJE32113.1 ldh Genome sequence ID: CP005286.1 Coding region: complement (2555308- 2556261) protein_id: AJE34285.1 poxB Genome sequence ID: CP005286.1 Coding region: complement (2270826- 2272571) protein_id: AJE34046.1 Corynebacterium halotolerans sdhC Genome sequence ID: NC_020302.1 YIM 70093 (DSM 44683) Coding region: 413293-414048 protein_id: WP_015399818.1 sdhA Genome sequence ID: NC_020302.1 Coding region: 414079-416088 protein_id: WP_015399819.1 sdhB Genome sequence ID: NC_020302.1 Coding region: 416088-416837 protein_id: WP_015399820.1 ldh Genome sequence ID: NC_020302.1 Coding region: complement (2953144- 2954118) protein_id: WP_015402062.1 poxB Genome sequence ID: NC_020302.1 Coding region: complement (2649819- 2651555) protein_id: WP_015401811.1

(68) TABLE-US-00007 TABLE 9 Coryneform bacterial species Gene symbols (Scientific names) (homologue gene) GenBankID (NCBI) information Corynebacterium deserti sdhC Genome sequence ID: NZ_CP009220.1 GIMN1.010 Coding region: 422535-423308 protein_id: WP_053544030.1 sdhA Genome sequence ID: NZ_CP009220.1 Coding region: 423330-425354 protein_id: WP 053544031.1 sdhB Genome sequence ID: NZ_CP009220.1 Coding region: 425354-426103 protein_id: WP_053544032.1 ldh Genome sequence ID: NZ_CP009220.1 Coding region: complement (2773439- 2774383) protein_id: WP_053545854.1 poxB Genome sequence ID: NZ_CP009220.1 Coding region: complement (2464577- 2466316) protein_id: WP_053545632.1 Corynebacterium doosanense CAU sdhC Genome sequence ID: NZ_CP006764.1 212 Coding region: 406322-407077 (DSM 45436) protein_id: WP_026159285.1 sdhA Genome sequence ID: NZ_CP006764.1 Coding region: 407089-409191 protein_id: WP_018021407.1 sdhB Genome sequence ID: NZ_CP006764.1 Coding region: 409191-409940 protein_id: WP_018021406.1 ldh Genome sequence ID: NZ_CP006764.1 Coding region: 1783629-1784582 protein_id: WP_018020959.1 poxB Genome sequence ID: NZ_CP006764.1 Coding region: complement (2289478- 2291241) protein_id: WP_018022699.1 Arthrobacter sp. PGP41 sdhB Genome sequence ID: NZ_CP026514.1 (Iron-sulfur subunit) Coding region: complement (1210020- 1210802) protein_id: WP_104997174.1 sdhA Genome sequence ID: NZ_CP026514.1 (Flavoprotein Coding region: complement (1210805- subunit) 1212604) protein_id: WP_104997175.1 sdhD Genome sequence ID: NZ_CP026514.1 (Subunit D) Coding region: complement (1212713- 1213204) protein_id: WP_104997176.1 sdhC Genome sequence ID: NZ_CP026514.1 (Cytochrome b556 Coding region: complement (1213208- subunit) 1213588) protein_id: WP_104997177.1 ldh Genome sequence ID: NZ_CP026514.1 Coding region: 4105995-4106942 protein_id: WP_104999408.1 poxB Unknown

(69) TABLE-US-00008 TABLE 10 Coryneform bacterial species Gene symbols (Scientific names) (homologue gene) GenBankID (NCBI) information Micrococcus luteus sdhB Genome sequence ID: NC_012803.1 NCTC 2665 (Iron-sulfur subunit) Coding region: complement 4528020- 528811) protein_id: WP_010079347.1 sdhA Genome sequence ID: NC_012803.1 (Flavoprotein Coding region: complement (528811- subunit) 530598) protein_id: WP_010079346.1 sdhD Genome sequence ID: NC_012803.1 (Subunit D) Coding region: complement (530676- 531155) protein_id: WP_010079345.1 sdhC Genome sequence ID: NC_012803.1 (Cytochrome b556 Coding region: complement (531159- subunit) 531563) protein_id: WP_010079344.1 ldh Genome sequence ID: NC_012803.1 Coding region: 2304603-2305589 protein_id: WP_010079965.1 poxB Genome sequence ID: NC_012803.1 Coding region: complement (293132- 294847) protein_id: WP_010079539.1

(70) As for the respective enzyme genes possessed by bacteria, the succinate dehydrogenase activity, the fumarate reductase activity, the lactate dehydrogenase activity, the pyruvate:quinone oxidoreductase activity, and the pyruvate formate-lyase activity are enzyme activities shown by succinate dehydrogenase (Sdh), fumarate reductase (Frd), lactate dehydrogenase (Ldh), pyruvate:quinone oxidoreductase (Pox or Pqo), and pyruvate formate-lyase (Pfl) which are found in wild-type strains, respectively. The proteins of these enzymes can be encoded by genes or the like represented as sdhCAB (or sdhCABD depending on bacterial species); ldhA, dld, lldD, etc. (gene coding for an enzyme protein showing lactate dehydrogenase activity), poxfl (pqo), and pflABCD (see Tables 2 to 10).

(71) In addition, in bacteria, succinate dehydrogenase (Sdh), is a complex composed of three subunit proteins of a transmembrane protein (subunit C) encoded by sdhC gene, a flavoprotein subunit (subunit A) encoded by sdhA gene, and FeS protein (subunit B) encoded by sdhfl gene, and, in some cases, SdhD (subunit D). In cases of prokaryotes, the genes each encoding these subunits form an operon in the bacterial genomes (for example, see FIG. 2B). Additionally, the fumarate reductase (Frd) is a complex composed of subunits D, C, B, and A in bacteria such as Escherichia coli, and is encoded by frdDCBA gene (operon). Furthermore, the pyruvate formate-lyase (Pfl) is a complex composed of the subunits A, B, C, and D in bacteria such as Escherichia coli, and is encoded by pflABCD gene (operon).

(72) Microorganisms for which nucleotide sequences and protein sequences of coding regions of the respective enzyme genes in Conditions (I), (II), (IV), and (V) as described above, as well as peripheral regions thereof have already been known would conveniently be employed. This is because genome regions to be disrupted can easily be specified by reference to the known sequences. However, needless to say, microorganisms that can be used as starting materials for preparation of genetically modified microorganism according to the invention are not limited to the microorganisms for which genomic nucleotide sequences or the like have already been known as described above, and even any microorganisms for which the enzyme protein coding regions or peripheral regions thereto are unknown can also be employed.

(73) In such cases where microorganisms for which enzyme protein coding regions or peripheral regions thereof have not been known are employed, for example, the coding regions for enzyme genes are appropriately cloned by any types of genetic engineering techniques, and the nucleotide sequences thereof may be determined as needed, thus identifying and cloning regions to be disrupted. For example, when alignment analysis is carried out for known amino acid sequences of the homologue enzyme proteins (Tables 2 to 10), a plurality of certain amino acid conservative regions are found. Therefore, degenerate primers can be designed within the amino acid conservative regions each found at the N-terminal side and the C-terminal side of the enzyme proteins, the degenerate PCR method may be performed using as a template the genomic DNA of a cloning target of microorganism, and using a pair of the above degenerate primers, thus amplifying and cloning parts of the coding regions for the target enzyme genes. Then, nucleotide sequences of the partial coding regions may be appropriately determined, and the cloned partial coding regions may be targeted for gene disruption based on the method for preparing a gene-disrupted strain described below, or the like, thereby preparing a genetically modified microorganism according to the invention satisfying Conditions (I), (II), (IV), and (V). In the meantime, when it is required to prepare a genetically modified microorganism in which full-length coding regions for the target enzyme genes, or entire regions of gene expression regulation regions present peripheral to the enzyme genes have been disrupted, pairs of primers may appropriately be designed to the opposite direction within the partial internal coding regions of the enzyme genes, for which nucleotide sequences have been determined in the above way, and then, the full-length coding regions for the target enzyme genes, or the peripheral regions thereof may be cloned using technique such as the inverse PCR method, and also, nucleotide sequences of these regions may be determined. Such a cloning technique based on PCR is convenient since the genome regions to be disrupted can easily be cloned. However, as for alternative techniques, a gene library of a target microorganism may be prepared, suitable probes may be designed, and then, the enzyme genes and the peripheral regions thereof, serving as targets for disruption, may be cloned by various hybridization methods, and also, nucleotide sequences thereof may be determined. Furthermore, with regard to any microbial species for which any homologous gene sequences are unavailable, in accordance with conventional methods, the target enzymes may be identified based on combination of protein purification techniques and enzyme activity measurement techniques. Then, for example, peptide sequences thereof may be partially determined, and, subsequently, the target enzyme genes may be cloned by the various genetic engineering techniques.

(74) (2) Preparation of Plasmid Vector for Gene Disruption, and Disruption of Gene (Coding Region/Expression Regulation Region Etc.) by Homologous Recombination

(75) Next, with regard to disruption of the enzyme genes in Conditions (I), (II), (IV) and (V), a method for preparing a gene-disrupted strain based on a homologous recombination technique will be described.

(76) At first, it is required that a plasmid vector for gene disruption that causes homologous recombination with respect to a region to be disrupted in the genome is prepared.

(77) As an example of such a plasmid vector for gene disruption, a gene disrupting plasmid vector obtained by inserting a drug-resistant gene, e.g., a kanamycin-resistance gene, into the inside of the region to be disrupted in a plasmid vector that has been obtained by cloning the region to be disrupted in the microorganism genome, can be mentioned. In such a gene disrupting plasmid vector, regions to each homologous to the region to be disrupted in the microorganism genome exist at both sides of the drug-resistant gene. Therefore, since homologous recombination occurs between the microorganism genome and the gene disrupting plasmid in a manner that the drug-resistant gene is inserted into the region to be disrupted in the microorganism genome, this makes it possible to realize disruption of a target enzyme gene. In addition, by way of adding a drug relating to the drug-resistant gene to the culture media, a gene-disrupted strain can also be efficiently selected.

(78) As another example of the plasmid vector for gene disruption, a plasmid vector including a fragment in which regions located at both sides of the part to be disrupted in the microorganism genome (i.e., regions each located 5 upstream and 3 downstream of the part to be removed from the genome) are linked to one another in tandem, can also be employed. Such a plasmid for disruption can be obtained, for example, as follows: regions present 5 upstream and 3 downstream of the disruption-target enzyme gene are each amplified based on the PCR method, and the amplified fragments are then inserted into a predetermined site, such as a multiple cloning site, of a plasmid vector in a manner that the amplified fragments are linked to one another in tandem. Alternatively, the whole region from the 5 upstream region to the 3 downstream region around the enzyme gene to be disrupted may be amplified based on the PCR method; the amplified product may be cloned with a variety of plasmid vectors; primers may subsequently be designed to the opposite direction inside the cloned region; and a plasmid vector for gene disruption into which a deletion mutation of the enzyme gene is introduced may be prepared based on the inverse PCR method with the primers.

(79) In the plasmid for gene disruption, the sequence length of a region homologous to a microorganism genome sequence that is a target for gene disruption is not limited as long as it can cause the homologous recombination. However, the sequence length may generally be about 500 bp or more, and preferably be around 1000 bp. Moreover, for the plasmid for gene disruption, a plasmid having a replication origin of E. coli is convenient since such a plasmid makes it possible to plasmid construction using E. coli for cloning, thus simplifying the construction operations. Furthermore, the plasmid for gene disruption preferably have no replication origin causing its autonomous replication in a microorganism that is employed as a target for gene disruption. If any replication origins of the microorganism exist in the plasmid for gene disruption, it is recommended that the replication origins are removed therefrom based on restriction enzyme treatments or the like, followed by introduction thereof into a coryneform bacterium. Additionally, for the plasmid for gene disruption, a combination of a drug-resistant gene enabling drug-based selection, and a lethal gene enabling positive selection, e.g., SacB gene which can produce a toxin inhibiting the growth of Gram-negative bacteria in the presence of sucrose, may be used. When such a plasmid for gene disruption is employed, strains that have undergone the homologous recombination can be isolated based on the selection using a drug, and then, gene-disrupted strains from which the vector portion has been eliminated through second homologous recombination can be isolated by way of carrying out selection based on cultivation in a culture medium containing sucrose, thereby realizing efficient acquisition of gene-disrupted strains.

(80) For introduction of the plasmid vector for gene disruption into microorganisms, any transformation methods that have been established according to types of microorganisms may be employed, although there are no particular limitations. For example, as for coryneform bacteria, which are preferably adopted in the invention, the introduction would be performed conveniently using the electroporation method (e.g., the technique described in Van der Rest et al. Appl. Microbiol Biotechnol 52, pp 541-545, 1999). This is because the electroporation method enables efficient introduction of nucleic acids into cells of coryneform bacteria.

(81) In addition, confirmation of disruption of the target regions in the genome of the genetically modified microorganism can be carried out based on the PCR method, the Southern hybridization method, various enzyme activity measurement methods, and the like.

(82) By using the aforementioned gene disruption techniques, a genetically modified microorganism having reduced or inactivated enzyme activity in Conditions (I) and/or (II) and/or (IV) and/or (V) can be comparatively easily prepared.

(83) [Condition (III)]

(84) The genetically modified microorganism according to the invention may further satisfy Condition (III): the genetically modified microorganism has modified phosphoenolpyruvate carboxylase activity showing resistance to feedback inhibition by aspartic acid in wild-type phosphoenolpyruvate carboxylase activity, or exogenous phosphoenolpyruvate carboxylase activity having higher resistance to feedback inhibition by aspartic acid than that of the wild-type phosphoenolpyruvate carboxylase activity shown by the wild-type microorganism.

(85) The meaning of resistance to feedback inhibition by aspartic acid in wild-type phosphoenolpyruvate carboxylase activity in Condition (III) is described as follows.

(86) At first, in the invention, specifically, the phosphoenolpyruvate carboxylase activity refers to enzyme activity that catalyzes the reaction defined in EC4.1.1.31, and is enzyme activity exerted by phosphoenolpyruvate carboxylases (PEPCs), which are widely possessed by a number of different plants and microorganisms. The metabolic reaction catalyzed by PEPCs is shown below.

(87) ##STR00001##

(88) In the meantime, it has been known that a wild-type phosphoenolpyruvate carboxylase is allosterically affected by a metabolite such as aspartic acid, malic acid, or -ketoglutaric acid (2-oxoglutaric acid), and thus the enzyme activity is inhibited. Such a inhibition of the enzyme activity is called feedback inhibition (Non-Patent Documents 2 to 4). That is, the modified phosphoenolpyruvate carboxylase activity in the invention is defined by an enzymatic property in which the feedback inhibition by aspartic acid in the enzyme activity is significantly reduced relative to the corresponding wild-type microorganism and the wild-type phosphoenolpyruvate carboxylase possessed by the microorganism, while the genetically modified microorganism according to the invention exhibits phosphoenolpyruvate carboxylase activity.

(89) Next, the meaning of the term exogenous phosphoenolpyruvate carboxylase activity having higher resistance to feedback inhibition by aspartic acid than that of the wild-type phosphoenolpyruvate carboxylase activity shown by the wild-type microorganism is explained as follows.

(90) That is, the above-described term means exogenous phosphoenolpyruvate carboxylase activity having higher resistance to feedback inhibition by aspartic acid, relative to resistance to feedback inhibition by aspartic acid exhibited by a wild-type microorganism that corresponds to the spices to which the genetically modified microorganism according to the invention belongs, or a wild-type phosphoenolpyruvate carboxylase possessed by the wild-type microorganism used as a starting material for preparation of the genetically modified microorganism according to the invention. Specifically, such exogenous phosphoenolpyruvate carboxylase activity may be produced by a heterologous phosphoenolpyruvate carboxylase of a strain lineages or organism species different from the corresponding wild-type host microorganism. In this case, the organism species different from the wild-type host microorganism include microorganisms (e.g., fungi, prokaryotes such as archaea and bacteria), and various organism species of plants, animals such as mammals, and the like. Furthermore, realization of the exogenous phosphoenolpyruvate carboxylase activity in the genetically modified microorganism according to the invention can be realized more specifically by introduction of a nucleic acid coding for a PEPC gene isolated from the strain lineage or organism species different from the wild-type host microorganisms.

(91) Additionally, for example, based on the measurement methods described in Non-Patent Documents 2 to 4, the measurement method described in Yoshinaga, T. Izui, K and Katsuki, H J. Biochem, 68, 747-750 (1970), or the like, it can be formed that the modified phosphoenolpyruvate carboxylase (activity) shows resistance to feedback inhibition by aspartic acid in wild-type phosphoenolpyruvate carboxylase activity, and that the exogenous phosphoenolpyruvate carboxylase (activity) shows higher resistance to feedback inhibition by aspartic acid than that of the wild-type phosphoenolpyruvate carboxylase activity shown by the wild-type microorganism.

(92) In addition, phosphoenolpyruvate carboxylase would be represented as PEPC or ppc somewhere in the present specification.

(93) More particularly, fulfillment of Condition (III) can be realized in the manner described below in the genetically modified microorganism according to the invention, although there are no particular limitations. That is, by way of introducing amino acid mutations into protein sequences of wild-type phosphoenolpyruvate carboxylases of various species of microorganisms based on genetic engineering techniques, a gene coding for a mutant-type enzyme acquiring resistance to feedback inhibition by aspartic acid in the wild-type phosphoenolpyruvate carboxylase activity while retaining the phosphoenolpyruvate carboxylase activity may artificially be produced. For example, any base substitution techniques such as the random mutagenesis based on the error-prone PCR, and the site specific mutagenesis based on PCR using mutagenic primers may be employed therefor. Alternatively, a more advantageous mutant-type PEPC may be produced by applying a molecular evolution technique such as DNA shuffling to DNAs coding for multiple types of wild-type PEPCs.

(94) By way of introducing a nucleic acid coding for a mutant-type PEPC obtained in the above way into a species of microorganism, a genetically modified microorganism satisfying (III) can be prepared. More specifically, the nucleic acid coding for the mutant-type PEPC may be introduce into the species of microorganism in a form that makes it possible to express the mutant-type PEPC. In the related art, a large number of microbial species including coryneform bacteria, gene expression systems suitable for the respective microbial species have already been established. With respect to microorganisms for which any techniques according to the known gene expression systems have been available, such known techniques may be employed for introduction of the mutant-type PEPC into the microorganisms. However, needless to say, any gene manipulation techniques or gene expression systems may uniquely be developed, and such techniques may be employed for introduction of the mutant-type PEPC into microorganisms.

(95) In the genetically modified microorganism according to the invention, the mutant-type PEPC satisfying (III) is preferably a mutant-type enzyme obtained by introducing a predetermined mutation into a bacteria-derived wild-type PEPC, although it is not particularly limited. Furthermore, such a mutant-type PEPC is a mutant-type enzyme obtained by introducing a predetermined mutation into a wild-type PEPC derived preferably from a coryneform bacterium, more preferably from a bacterium of the genus Corynebacterium.

(96) In Table 11 below, examples of bacteria-derived PEPCs that may preferably be employed in the invention are mentioned.

(97) TABLE-US-00009 TABLE 11 Source SEQ ID Nos: (bacterial species) GenBankID (NCBI) information (Protein sequence) Corynebacterium GeneID: 101955 2 glutamicum Genome sequence ID: NC_003450.3 ATCC13032 Coding region: complement (1677384-1680143) Gene symbol: Cgl1585 protein_id: NP_600799.1 Corynebacterium efficiens Genome sequence ID: NC_004369.1 3 YS-314 Coding region: complement (1792342-1795101) locus_tag: CE_RS08485 protein_id: WP_006767704.1 Corynebacterium callunae Genome sequence ID: CP004354 4 DSM20147 Coding region: complement (11594895-1597654) protein_id: AGG66941.1 Corynebacterium Genome sequence ID: CP009244.1 5 ammoniagenes Coding region: complement (486124-488886) DSM 20306 protein_id: APT81814.1 Corynebacterium marinum Genome sequence ID: NZ_CP007790.1 6 DSM 44953 Coding region: complement (1359285-1362056) protein_id: WP_042621481.1 Corynebacterium Genome sequence ID: CP005286.1 7 humireducens NBRC Coding region: complement (1428883-1431654) 106098 = DSM 45392 protein_id: AJE33253.1 Corynebacterium Genome sequence ID: NC_020302.1 8 halotolerans YIM 70093 = Coding region: complement (1664275-1667040) DSM 44683 protein_id: WP_015400953.1 Corynebacterium deserti Genome sequence ID: NZ_CP009220.1 9 GIMN1.010 Coding region: complement (1613811-1616594) protein_id: WP_082353424.1 Corynebacterium Genome sequence ID: NZ_CP006764.1 10 doosanense CAU 212 = Coding region: complement (263722-266466) DSM 45436 protein_id: WP_018021559.1 Corynebacterium pollutisoli Genome sequence ID: FXAR01000006.1 11 VDS Coding region: complement (149213-151984) protein_id: SMG31000.1 Arthrobacter sp. PGP41 Genome sequence ID: NZ_CP026514.1 12 Coding region: 621955-624777 protein_id: WP_104996751.1 Escherichia coli str. K-12 Genome sequence ID: NC_010473.1 13 substr. DH10B Coding region: complement (4248167-4250818) protein_id: WP_001005586.1

(98) More specifically, as examples of specific structures of the mutant-type PEPC satisfying Condition (III), the following embodiments (i) and (ii) may be considered.

(99) (i) a mutant-type PEPC having deletion, substitution or addition of one or more amino acids in an amino acid sequence of a wild-type PEPC. In this case, the range of one or more may be, e.g., from 1 to 100, from 1 to 50, or from 1 to 30, preferably at least 2 or more, or from 2 to 20, more preferably from 2 to 10, still more preferably from 2 to 5, and particularly preferably from 2 to 4, or from 2 to 3, for example, 2.

(100) (ii) a chimeric PEPC including a combination of parts of amino acid sequences of two or more wild-type PEPCs.

(101) Into the genetically modified microorganisms according to some embodiments, nucleic acids coding for bacteria-derived mutant-type phosphoenolpyruvate carboxylases have been introduced in forms capable of expressing the mutant-type phosphoenolpyruvate carboxylases, and the mutant-type phosphoenolpyruvate carboxylases have at least one amino acid mutation causing the genetically modified microorganisms to satisfy Condition (III). In this case, the mutant-type phosphoenolpyruvate carboxylases are preferably mutant-type PEPCs derived from coryneform bacteria, the genus Corynebacterium, or the genus Escherichia, more preferably mutant-type PEPCs derived from the genus Corynebacterium, and particularly preferably mutant-type PEPCs derived from Corynebacterium glutamicum.

(102) Furthermore, in specific embodiments, the at least one amino acid mutation in the mutant-type phosphoenolpyruvate carboxylases includes at least one selected from the group consisting of amino acid substitutions shown in the following (a) to (f): based on the amino acid sequence set forth in SEQ ID NO: 2, (a) an amino acid substitution of an amino acid corresponding to the 299th aspartic acid with a predetermined amino acid, wherein the substituted amino acid is not aspartic acid, and the amino acid substitution is preferably an amino acid substitution with alanine, asparagine, glycine, or serine; (b) an amino acid substitution of an amino acid corresponding to the 653rd lysine with a predetermined amino acid, wherein the substituted amino acid is not lysine, and the amino acid substitution is preferably an amino acid substitution with alanine, asparagine, or serine; (c) an amino acid substitution of an amino acid corresponding to the 813th lysine with a predetermined amino acid, wherein the substituted amino acid is not lysine, and the amino acid substitution is preferably an amino acid substitution with alanine, asparagine, glycine, or serine; (d) an amino acid substitution of an amino acid corresponding to the 869th serine with a predetermined amino acid, wherein the substituted amino acid is not serine, and the amino acid substitution is preferably an amino acid substitution with alanine, asparagine, or glycine; (e) an amino acid substitution of an amino acid corresponding to the 873rd arginine with a predetermined amino acid, wherein the substituted amino acid is not arginine, and the amino acid substitution is preferably an amino acid substitution with alanine, asparagine, glycine, or serine; and (f) an amino acid substitution of an amino acid corresponding to the 917th asparagine with a predetermined amino acid, wherein the substituted amino acid is not asparagine, and the amino acid substitution is preferably an amino acid substitution with alanine, phenylalanine, glycine, or serine, wherein the amino acid before substitution and the substituted amino acid are different from each other in (a) to (f) above.

(103) That is to say, the purpose of the amino acids shown in (a) to (f) above is identification of amino acid substitution sites in the PEPC amino acid sequence that serves as a target for mutagenesis on the basis of amino acids included in the amino acid sequence set forth in SEQ ID NO: 2. In other words, more specifically, the amino acids corresponding to in (a) to (f) above refer to amino acids that are aligned one-to-one with the amino acids of SEQ ID NO: 2 shown in (a) to (g) above, when the one-to-one alignment (pairwise alignment) is performed on the basis of the identity of the PEPC amino acid sequence (i.e., a target for mutagenesis) to the amino acid sequence shown in SEQ ID NO: 2, using a technique such as ClustalW or ClustalX (Bioinformatics, Volume 23, Issue 21, 1 Nov. 2007, pp 2947-2948).

(104) FIGS. 3A and 3B shows an example of identification of amino acids to be substituted in (a) to (f) above with respect to wild-type PEPC protein sequences (SEQ ID NOs: 3 to 13), from other 11 species of the genus Corynebacterium shown in Table 11, by way of performing the multiple alignment analysis for the protein sequences, based on ClustalW, against the wild-type PEPC amino acid sequence (SEQ ID NO: 2) derived from Corynebacterium glutamicum strain ATCC13032.

(105) As shown in FIG. 3A, the amino acid corresponding to the 299th aspartic acid in (a) above is aspartic acid (d) in each of the nine types of wild-type PEPCs belonging to the genus Corynebacterium, is threonine (T) in the wild-type PEPC of Arthrobacter globiformis strain NBRC12137, which is a species of coryneform bacteria, and is glutamic acid (E) in the wild-type PEPC of Escherichia coli strain K-12. Moreover, as shown in FIG. 3B, with regard to the nine types of wild-type PEPCs belonging to the genus Corynebacterium, the amino acid corresponding to the 653rd lysine in (b) above is arginine (R) in C. ammoniagenes, and is histidine (H) in C. doosanense, while the amino acid is identical to lysine (K) of the base sequence, in each of the other bacterial species. Furthermore, as shown in FIG. 3C, the amino acid corresponding to the 813th lysine in (c) above is identical to lysine (K) of the base sequence, in each of all the bacterial species. Furthermore, as shown in FIG. 3C, the amino acid corresponding to the 869th serine in (d) above is identical to serine (S) of the base sequence, in each of all the bacterial species. Furthermore, as shown in FIG. 3C, the amino acid corresponding to the 873rd arginine in (e) above is identical to arginine (R) of the base sequence, in each of all the bacterial species. Furthermore, as shown in FIG. 3C, the amino acid corresponding to the 917th asparagine in (f) above is threonine in C. ammoniagenes, is valine (V) in C. doosanense, and is identical to asparagine (N) of the base sequence, in each of the other bacterial species.

(106) In addition, for example, the 299th aspartic acid may be described as D299 using a single character code for amino acids, and the amino acid substitution of the 299th aspartic acid with asparagine may be described as D299N. Other amino acids and amino acid substitutions may be described in the same manner.

(107) In a more preferred embodiment, the at least one amino acid mutation in the mutant-type phosphoenolpyruvate carboxylase includes at least one selected from the group consisting of amino acid substitutions shown in the following (g) to (l): based on the amino acid sequence set forth in SEQ ID NO: 2, (g) an amino acid substitution of an amino acid corresponding to the 299th aspartic acid with asparagine; (h) an amino acid substitution of an amino acid corresponding to the 653rd lysine with serine; (i) an amino acid substitution of an amino acid corresponding to the 813th lysine with a predetermined amino acid, wherein the substituted amino acid is not lysine, and the amino acid substitution is preferably an amino acid substitution with glycine or serine; (j) an amino acid substitution of an amino acid corresponding to the 869th serine with glycine; (k) an amino acid substitution of an amino acid corresponding to the 873rd arginine with glycine; and (l) an amino acid substitution of an amino acid corresponding to the 917th asparagine with a predetermined amino acid, wherein the substituted amino acid is not asparagine and the amino acid substitution is preferably an amino acid substitution with alanine, phenylalanine, glycine, or serine.

(108) In a still more preferred embodiment, the at least one amino acid mutation in the mutant-type phosphoenolpyruvate carboxylase includes the amino acid substitution shown in (g) above, and at least one of the amino acid substitutions shown in (h) to (l) above.

(109) Furthermore, in another preferred embodiment, the at least one amino acid mutation in the mutant-type phosphoenolpyruvate carboxylase includes the amino acid substitution shown in (g) above, and at least one of the amino acid substitutions shown in (i) to (l) above.

(110) In addition, in a particularly preferred embodiment, the at least one amino acid mutation in the mutant-type phosphoenolpyruvate carboxylase includes the amino acid substitution shown in (g) above, and the amino acid substitution shown in (i) or (l) above.

(111) Furthermore, in another embodiment, the mutant-type phosphoenolpyruvate carboxylase may be a mutant-type PEPC having an amino acid sequence set forth in any one of the following (A) to (C): (A) an amino acid sequence obtained by introducing at least one selected from the group consisting of the amino acid substitutions shown in the above (a) to (l) into the amino acid sequence shown in any one of SEQ ID NOs: 2 to 13 (preferably SEQ ID NOs: 2 to 12, more preferably SEQ ID NOs: 2 to 11), wherein the amino acid before substitution and the substituted amino acid are different from each other; (B) an amino acid sequence having deletion, substitution, and/or addition of one or more amino acids in the amino acid sequence defined in (A) above, wherein the at least one amino acid substitution has been maintained; and (C) an amino acid sequence having a sequence identity of at least 60% to the amino acid sequence defined in (A) above, wherein the at least one amino acid substitution has been maintained.

(112) Furthermore, in still another embodiment, the mutant-type phosphoenolpyruvate carboxylase may be a mutant-type PEPC having an amino acid sequence shown in any one of the following (D) to (F): (D) an amino acid sequence obtained by introducing the amino acid substitution shown in (g) above, and at least one of the amino acid substitutions shown in (h) to (l) above into the amino acid sequence set forth in any one of SEQ ID NOs: 2 to 13 (preferably SEQ ID NOs: 2 to 12, more preferably SEQ ID NOs: 2 to 11), wherein the amino acid before substitution and the substituted amino acid are different from each other; (E) an amino acid sequence having deletion, substitution, and/or addition of one or more amino acids in the amino acid sequence defined in (D) above, wherein the above amino acid substitutions have been maintained; and (F) an amino acid sequence having a sequence identity of at least 60% to the amino acid sequence defined in (D) above, wherein the above amino acid substitutions have been maintained.

(113) Furthermore, in still another embodiment, the mutant-type phosphoenolpyruvate carboxylase may be a mutant-type PEPC having an amino acid sequence shown in any one of the following (G) to (I): (G) an amino acid sequence obtained by introducing the amino acid substitution shown in (g) above, and at least one of the amino acid substitutions shown in (i) to (l) above into the amino acid sequence set forth in any one of SEQ ID NOs: 2 to 13 (preferably SEQ ID NOs: 2 to 12, more preferably SEQ ID NOs: 2 to 11), wherein the amino acid before substitution and the substituted amino acid are different from each other; (H) an amino acid sequence having deletion, substitution, and/or addition of one or more amino acids in the amino acid sequence defined in (G) above, wherein the above amino acid substitutions have been maintained; and (I) an amino acid sequence having a sequence identity of at least 60% to the amino acid sequence defined in (G) above, wherein the above amino acid substitutions have been maintained.

(114) Furthermore, in still another embodiment, the mutant-type phosphoenolpyruvate carboxylase may be a mutant-type PEPC having an amino acid sequence shown in any one of the following (J) to (L): (J) an amino acid sequence obtained by introducing the amino acid substitution shown in (g) above, and the amino acid substitution shown in the above (i) or (l) into the amino acid sequence set forth in any one of SEQ ID NOs: 2 to 13 (preferably SEQ ID NOs: 2 to 12, more preferably SEQ ID NOs: 2 to 11), wherein the amino acid before substitution and the substituted amino acid are different from each other; (K) an amino acid sequence having deletion, substitution, and/or addition of one or more amino acids in the amino acid sequence defined in (J) above, wherein the above amino acid substitutions have been maintained; and (L) an amino acid sequence having a sequence identity of at least 60% to the amino acid sequence defined in (J) above, wherein the above amino acid substitutions have been maintained.

(115) In the meantime, in (B), (E), (H) and (K) above, the range of one or more is, for example, from 1 to 100, from 1 to 50, or from 1 to 30, preferably from 1 to 20, from 1 to 15, or from 1 to 10, and more preferably from 1 to 9, from 1 to 8, from 1 to 7, from 1 to 6, from 1 to 5, from 1 to 4, from 1 to 3, or from 1 to 2.

(116) In addition, in (C), (F), (I) and (L) above, at least 60% may be replaced with preferably at least 70%, more preferably at least 80%, and still more preferably at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

(117) Moreover, an embodiment in which the amino acid sequence set forth in any one of SEQ ID NOs: 2 to 13 (preferably, SEQ ID NOs: 2 to 12, more preferably SEQ ID NOs: 2 to 11) is replaced with the amino acid sequence set forth in SEQ ID NO: 2 (that is, the wild-type PEPC amino acid sequence of Corynebacterium glutamicum strain ATCC13032) is particularly preferred.

(118) In addition, in the above-described embodiments, the meaning remains that the mutant-type PEPC having the amino acid sequence defined in any of (A) to (L) above retains phosphoenolpyruvate carboxylase activity, and satisfies Condition (III).

(119) Furthermore, in a specific embodiment, in the genetically modified microorganism according to the invention, for example, aspartate dehydrogenase (AspDH, EC 1.4.1.21), aspartate aminotransferase (AspC, EC2.6.1.1), and the aspartate ammonia-lyase (AspA, EC4.3.1.1,) (see FIG. 1) may be enhanced. More specifically, genes coding for these enzymes may additionally be introduced thereto for enhancement of these enzyme activities. As examples of the enzyme genes to be introduced into the recombinant coryneform bacteria of the invention, enzyme genes disclosed in Patent Documents 2, JP 2016-516435 A, and the like can be mentioned. The contents disclosed in these conventional art documents are also incorporated by reference into the present specification.

(120) According to genetically modified microorganisms appropriately adopting each embodiment mentioned above, a starting substrate such as a sugar can more efficiently be employed for production of a target substance, and thus, a significant improvement in production efficiency of a target substance such as aspartic acid or a metabolite derived therefrom can be expected.

(121) <Method for Producing Target Substance>

(122) According to a third aspect of the invention, there is provided the following method for producing a target substance.

(123) A method for producing a target substance, the method including: (p) producing a target substance using cells of the genetically modified microorganism according to the invention, or a treated cell product thereof; and (q) recovering the target substance.

(124) In some embodiments, in Step (p), the target substance may be produced by culturing the genetically modified microorganism according to the invention under aerobic conditions where the genetically modified microorganism can substantially proliferate. The metabolism in the TCA cycle shown in FIG. 1 proceeds clockwise in coryneform bacteria under aerobic conditions. Therefore, in cases where an embodiment for the substance production under aerobic conditions is considered suitable for a type of the target substance, which is desired to be produced as a target, in consideration of the above-mentioned metabolism, such an embodiment may be selected.

(125) On the other hand, in a culture medium or reaction solution under reducing conditions, microorganisms such as the genus Escherichia such as E. coli and coryneform bacteria do not substantially proliferate but cause unique metabolic systems under reducing conditions to function. Therefore, when coryneform bacteria according to the invention or a treated cell product thereof is reacted in a culture medium or a reaction solution under reducing conditions in the above way, it becomes possible to eliminate waste of nutrient sources due to proliferation and division of the bacterial cells, and thus, the conversion efficiency of the nutrient sources into the target substance can be improved. In addition, the genetically modified microorganism according to the invention is expected to remarkably significantly improve the conversion efficiency of nutrient sources into the target substance since the genetically modified microorganism has one or more reduced or inactivated enzyme activities in Conditions (I), (II), and (IV), and has phosphoenolpyruvate carboxylase activity showing resistance to feedback inhibition by a metabolite. Furthermore, according to such an embodiment in which reactions proceeds under reducing conditions where the microorganism does not substantially proliferate, as compared to the bioprocess under aerobic conditions involving division/proliferation of the cells, generation of fermentation heat can be prevented, and also, it is not required that sufficient aeration is secured during the course of the cultivation. Therefore, simplification of facilities required for the bioprocess, and energy reductions can be achieved, and thus, such an embodiment will be friendly to the global environment, and will result in cost reductions.

(126) Therefore, it is preferable that, in Step (p), the cells of the genetically modified microorganism or a treated cell product thereof are reacted in a reaction medium (X) under reducing conditions where the genetically modified microorganism does not substantially proliferate, to produce the target substance.

(127) Step (p)

(128) Furthermore, in a more preferred embodiment, the method according to the invention further includes, before Step (p), (p) preliminarily culturing and proliferating the genetically modified microorganism under aerobic conditions in a predetermined culture medium (Y), wherein cells of the genetically modified microorganism proliferated in Step (p) or a treated cell product thereof are subjected to Step (p).

(129) Although such an embodiment in which the method of the invention includes Step (p) would be involved also in the embodiment for the substance production under aerobic conditions, the embodiment is particularly preferably applied to a case where the substance production is performed in a reaction medium (X) under reducing conditions where the genetically modified microorganism does not substantially proliferate. The reason for this is explained as follows. In Step (p), in cases where the genetically modified microorganism is caused to proliferate to a certain degree in advance under aerobic conditions, and then, in Step (p), the substance production is caused to proceed with a sufficient amount of the proliferated genetically modified microorganism in a reaction medium (X) where the genetically modified microorganism does not substantially proliferate, it becomes possible to perform efficient substance production using the genetically modified microorganism as if using a chemical catalyst. Furthermore, in some cases, the genetically modified microorganism may be recovered from the reaction medium (X) after the substance production in the reaction medium (X), and then, can be reused in a reaction in Step (p) of second or any subsequent cycles.

(130) Hereinafter, specific configurations and elements which may be adopted in Step (p), Step (p) and Step (q) will be described in detail in this order.

(131) [Base Medium Constituting Culture Medium (Y)]

(132) The culture medium (Y) is not particularly limited, and a suitable culture medium may be selected and employed depending on a type of genetically modified microorganism to be used in the method. Specifically, as the culture medium (Y), a natural or synthetic culture medium containing a carbon source, a nitrogen source, inorganic salts, other nutritional substances, and the like can be used. For example, ingredients contained in the culture medium are explained as follows.

(133) For the carbon source, carbohydrate, more specifically, carbon-containing substances such as sugars including polysaccharides or monosaccharides, various materials including such substances, and the like can be mentioned, and the following ingredients can be mentioned as examples:

(134) monosaccharides such as glucose, fructose, mannose, xylose, arabinose, and galactose; disaccharides such as sucrose, maltose, lactose, cellobiose, xylobiose, and trehalose; polysaccharides such as cellulose, starch, glycogen, agarose, pectin, and alginic acid; molasses and the like; non-edible agricultural wastes or non-edible biomass (resources including non-edible herbaceous or woody plants as raw materials) such as rice straws, forest residual materials, bagasse, and corn stover; saccharified solutions containing a plurality of sugars such as glucose and xylose, obtained by saccharifying energy crops, e.g., switchgrass, napier grass, and Miscanthus, with a diastatic enzyme or the like; sugar alcohols such as mannitol, sorbitol, xylitol, and glycerin; organic acids such as acetic acid, citric acid, lactic acid, fumaric acid, maleic acid, and gluconic acid; alcohols such as ethanol, propanol, and butanol; and hydrocarbons such as normal paraffin.

(135) In addition, a single type of the carbon source can be used alone, or a mixture of two or more types thereof can be used.

(136) For the nitrogen source, inorganic or organic ammonium compounds such as ammonium carbonate ((NH.sub.4).sub.2CO.sub.3), ammonium chloride, ammonium sulfate, ammonium nitrate, and ammonium acetate; urea, aqueous ammonia, sodium nitrate, potassium nitrate, or the like can be used. Furthermore, corn steep liquor, meat extracts, protein hydrolysates (e.g., casamino acid, tryptone, peptone, NZ-amine), nitrogen-containing organic compounds such as amino acid, or the like can also be used.

(137) In addition, a single type of the nitrogen source can be used alone, or a combination of two or more types thereof can be used. The concentration of the nitrogen source in the culture medium may appropriately be adjusted depending on conditions such as a type or property of the genetically modified microorganism to be adopted, and the type of nitrogen compounds, and is not particularly limited. For example, the concentration may be set to about 0.1 to about 10 w/v %.

(138) As examples of the inorganic salts, monopotassium phosphate, dipotassium phosphate, magnesium sulfate (hydrate), sodium chloride, iron(II) sulfate heptahydrate, iron(II) nitrate, manganese sulfate, zinc sulfate, cobalt sulfate, and calcium carbonate can be mentioned.

(139) Additionally, a single type of inorganic salt may be used alone, or a mixture of two or more types thereof may be used. The concentration of the inorganic salt in the culture medium may be appropriately adjusted depending on conditions such as a type or property of the genetically modified microorganism to be adopted, and a type of inorganic salt, and is not particularly limited. For example, the concentration may be set to about 0.01 to about 1 (w/v %).

(140) Furthermore, examples of the other nutritional substances include meat extracts, peptone, polypeptone, yeast extracts, dry yeasts, corn steep liquor, skim milk powder, hydrochloric acid hydrolysates of defatted soybean, extracts from animals, plants or microorganism cells, and degradation products thereof. The concentration of the other nutritional substances in the culture medium may be appropriately adjusted depending on conditions such as a type or property of the genetically modified microorganism to be adopted, and a type of nutritional substance, and is not particularly limited. For example, the concentration may be set to about 0.1 to about 10 (w/v %).

(141) In addition, as needed, vitamins can also be added to the culture medium (Y). Examples of vitamins include biotin, thiamine, (vitamin B1), pyridoxine (vitamin B6), pantothenic acid, and inositol.

(142) Moreover, as needed, an antifoaming agent such as a silicone-based antifoaming agent or a polyether-based antifoaming agent may be added. Since various antifoaming agents for bacterial culture media are commercially available, such antifoaming agents may be employed.

(143) In addition, the pH of the culture medium (Y) is not particularly limited as long as it causes the genetically modified microorganism to be adopted to grow, and the pH thereof is preferably about 6 to about 8.

(144) Furthermore, when the genetically modified microorganism to be adopted is a microorganism belonging to coryneform bacteria, the A medium [Inui, M. et al., Metabolic analysis of Corynebacterium glutamicum during lactate and succinate productions under oxygen deprivation conditions. J. Mol. Microbiol. Biotechnol. 7:182-196 (2004)], the BT medium [Omumasaba, C. A. et al., Corynebacterium glutamicum glyceraldehyde-3-phosphate dehydrogenase isoforms with opposite, ATP-dependent regulation. J. Mol. Microbiol. Biotechnol. 8:91-103 (2004)], the NA medium described in Examples of the present specification, and the like can preferably be employed as the culture medium (Y).

(145) Microbial cells obtained by way of culturing and proliferating the genetically modified microorganism of the invention in the culture medium (Y) as described above or a treated cell product thereof may be subjected to Step (p).

(146) In that case, it is only sufficient to appropriately set conditions for culturing the genetically modified microorganism, such that the genetically modified microorganism sufficiently proliferates to obtain a sufficient amount of the microbial cells or the treated cell product thereof. Specifically, the culturing temperature can be set to about 25 C. to 38 C. under aerobic conditions, and the culturing time can be set to about 12 hours to about 48 hours. Moreover, with regard to microbial cell stocks based on lyophilization or freeze storage, the microbial cell stocks can be inoculated on a solid medium at first, and then, colonies or the like, which would be confirmed to have grown on the solid culture medium, can be further inoculated into the aforementioned culture medium (Y), thus preparing the genetically modified microorganism to be subjected to Step (p).

(147) Furthermore, a specific form of the cells or the treated cell product thereof is only sufficient to be in a state where the target substance can be produced, and is not particularly limited.

(148) In some embodiments, as described above, the genetically modified microorganism is cultured and proliferated in the culture medium (Y) in Step (p), and then, the culture medium (Y) containing the genetically modified microorganism may be subjected directly to Step (p) without recovering or separating the genetically modified microorganism from the culture medium (Y), to thus produce the target substance using cells of the genetically modified microorganism. Furthermore, as needed, prior to Step (p), a carbon source (sugars), a nitrogen source, inorganic salts, vitamins, a reducing agent, etc. that can be ingredients for the reaction medium (X) described later may be added to the culture medium (Y) containing the genetically modified microorganism obtained in the step (p), and then, the resulting culture medium (Y) may be subjected to a reaction for production of the target substance in Step (p).

(149) In another embodiment, cells obtained by separating and recovering from the culture medium (Y) the genetically modified microorganism, which has been cultured and proliferated in the culture medium (Y) in Step (p), or a treated cell product obtained by subjecting the above separated/recovered cells to a predetermined physical or chemical treatment may be subjected to Step (p). Examples of techniques for separating and recovering the genetically modified microorganism from the culture medium (Y) include centrifugal separation, separation based on various filters, and decantation. In addition, the treated cell product in the invention is not particularly limited as long as the reaction for production of a target substance in Step (p) can be realized. More particularly, examples thereof include products obtained by subjecting the recovered microbial cells to various chemical treatments, and microbial cells immobilized on a carrier such as acrylamide, carrageenan, or other suitable polymers.

(150) [Composition of Reaction Medium (X)]

(151) A composition of the reaction medium (X) in the invention is not particularly limited as long as it realizes the reaction medium (X) under reducing conditions that cause the genetically modified microorganism not to substantially proliferate, while causing the reaction for production of a target substance by the genetically modified microorganism to proceed. The reaction medium (X) may contain a carbon source, a nitrogen source, inorganic salts, etc., and may be a natural medium derived from organisms, or may be an artificially synthesized medium. Examples of ingredients contained in the reaction medium (X) are described below.

(152) For the carbon source, carbohydrate, more specifically, carbon-containing substances such as sugars including polysaccharides or monosaccharides, various materials including such substances, and the like can be mentioned, and the following ingredients can be mentioned as examples:

(153) monosaccharides such as glucose, fructose, mannose, xylose, arabinose, and galactose; disaccharides such as sucrose, maltose, lactose, cellobiose, xylobiose, and trehalose; polysaccharides such as cellulose, starch, glycogen, agarose, pectin, and alginic acid; molasses and the like; non-edible agricultural wastes or non-edible biomass (resources including non-edible herbaceous or woody plants as raw materials) such as rice straws, forest residual materials, bagasse, and corn stover; saccharified solutions containing a plurality of sugars such as glucose and xylose, obtained by saccharifying energy crops, e.g., switchgrass, napier grass, and Miscanthus, with a diastatic enzyme or the like; sugar alcohols such as mannitol, sorbitol, xylitol, and glycerin; organic acids such as acetic acid, citric acid, lactic acid, fumaric acid, maleic acid, and gluconic acid; alcohols such as ethanol, propanol, and butanol; and hydrocarbons such as normal paraffin.

(154) Among these, monosaccharides are preferable, and glucose is more preferable. Moreover, sugars including glucose (disaccharides, oligosaccharides, and polysaccharides) are also preferable. Furthermore, a single type of the carbon source can be used alone, or a combination of two or more types thereof can be used. In addition, the concentration of the carbon source in the reaction medium (X) is preferably about 1 to about 20 (w/v %), more preferably about 2 to about 10 (w/v %), and still more preferably about 2 to about 5 (w/v %). Additionally, the concentration of the sugar in the reaction medium (X) is, for example, about 1 to about 20 (w/v %), more preferably about 2 to 10 about (w/v %), and still more preferably about 2 to about 5 (w/v %).

(155) For the nitrogen source, inorganic or organic ammonium compounds such as ammonium carbonate ((NH.sub.4).sub.2CO.sub.3), ammonium chloride, ammonium sulfate, ammonium nitrate, and ammonium acetate; urea, aqueous ammonia, sodium nitrate, potassium nitrate, or the like can be used. Furthermore, corn steep liquor, meat extracts, peptone, NZ-amine, protein hydrolysates, nitrogen-containing organic compounds such as amino acid, or the like can also be used.

(156) In addition, a single type of the nitrogen source can be used alone, or a combination of two or more types thereof can be used. The concentration of the nitrogen source in the culture medium may appropriately be adjusted depending on conditions such as a type or property of the genetically modified microorganism to be adopted, and the type of nitrogen compounds, and is not particularly limited. For example, the concentration may be set to about 0.1 to about 10 w/v %.

(157) As examples of the inorganic salts, monopotassium phosphate, dipotassium phosphate, magnesium sulfate (hydrate), sodium chloride, iron(II) sulfate heptahydrate, iron(II) nitrate, manganese sulfate, zinc sulfate, cobalt sulfate, and calcium carbonate can be mentioned.

(158) Additionally, a single type of inorganic salt may be used alone, or a mixture of two or more types thereof may be used. The concentration of the inorganic salt in the culture medium may be appropriately adjusted depending on conditions such as a type or property of the genetically modified microorganism to be adopted, and a type of inorganic salt, and is not particularly limited. For example, the concentration may be set to about 0.01 to about 1 (w/v %).

(159) In addition, as needed, vitamins can also be added to the reaction medium (X). Examples of vitamins include biotin, thiamine, (vitamin B1), pyridoxine (vitamin B6), pantothenic acid, and inositol.

(160) In addition, the pH of the reaction medium (X) is not particularly limited as long as it is within the range that causes the reaction for production of a desired target substance to proceed. In general, the pH thereof is preferably about 6.0 to about 8.0, more preferably 6.5 to 8.0, and, for example, around 7.5.

(161) In addition, for a specific preferable basic composition of the reaction medium (X), the aforementioned BT culture medium or the like can be mentioned, and, by way of appropriately adjusting the concentration of the carbon source (sugars), the concentration (xn) of at least one of nicotinic acid and a derivative thereof, the concentration (xb) of biotin, etc. in the above-described manners, on the basis of the composition of these culture media, a reaction medium (X) may be prepared.

(162) [Reducing Conditions]

(163) The reducing conditions where the coryneform bacteria do not substantially proliferate means that the reaction medium is in a reducing state to the extent that the genetically modified microorganism does not substantially proliferate, as it is literally interpreted. More specifically, such reducing conditions can be defined based on an oxidation-reduction potential of the reaction medium. The oxidation-reduction potential of the reaction medium (X) is preferably from about 200 mV to about 500 mV, and more preferably from about 250 mV to about 500 mV.

(164) In addition, the oxidation-reduction potential of the reaction medium (X) can be measured using an oxidation-reduction potentiometer. Since there are also commercial products of oxidation-reduction potentiometers, such commercial products may be used for measurement of the oxidation-reduction potential of the reaction medium (X) in the invention.

(165) The reducing state of the reaction medium can simply be estimated using a resazurin indicator (decolorization from blue to colorlessness will occur in a reducing state). However, for more precise control, the reducing state may be measured using an oxidation-reduction potentiometer (e.g., ORP Electrodes manufactured by Broadley-James Corporation).

(166) For a method for preparing the reaction medium (X) in reducing conditions, various methods can be used without any particular limitations. For example, the following known methods for preparing an aqueous solution for the reaction can be used.

(167) That is, an aqueous solution for the reaction may be used instead of distilled water or the like as a solvent for the reaction medium, and, as references for the method for preparing an aqueous solution for the reaction, for example, a method for preparing a culture solution for obligatory anaerobic microorganisms such as sulfate-reducing microorganisms (Pfennig, N. et al., (1981): The dissimilatory sulfate-reducing bacteria, In The Prokaryotes, A Handbook on Habitats Isolation and Identification of Bacteria, Ed. by Starr, M. P. et al., p 926-940, Berlin, Springer Verlag.), Nogeikagaku Jikkensho (Agricultural Chemistry Experiments Book) Vol. 3, Ed. by Agricultural Chemistry Classroom in Kyoto University, 1990, Issue 26, published by Sangyo Tosho Publishing Co., Ltd. and the like may be used to thereby obtain an aqueous solution under desired reducing conditions.

(168) Specifically, by way of subjecting distilled water or the like to a heat treatment or depressurization to remove a dissolved gas, an aqueous solution for the reaction in reducing conditions can be obtained. In this case, by way of treating distilled water or the like under a reduced pressure of about 10 mmHg or less, preferably about 5 mmHg or less, more preferably about 3 mmHg or less, for about 1 to about 60 minutes, preferably about 5 to about 40 minutes, a dissolved gas, particularly dissolved oxygen, is removed therefrom, thereby preparing an aqueous solution for the reaction in reducing conditions (anaerobic conditions).

(169) Furthermore, also by way of adding a suitable reducing agent (e.g., thioglycolic acid, ascorbic acid, cysteine hydrochloride, mercaptoacetic acid, thiolacetic acid, glutathione, sodium sulfide) to distilled water or the like, thereby preparing an aqueous solution for the reaction in reducing conditions.

(170) As needed, combination of the above-mentioned methods may also serve as a method for preparing an effective aqueous solution for the reaction in reducing conditions.

(171) Additionally, it is preferable that the reducing conditions of the reaction medium (X) is maintained during the reaction. In order to continuously maintain the reducing conditions of the reaction medium (X) during the reaction, it is desirable to prevent oxygen from mixing into the reaction medium (X) from the outside of the reaction system as much as possible, and specifically, a method of shielding the reaction system with an inert gas such as a nitrogen gas, carbon dioxide gas, or the like can be mentioned therefor. As for a method of more effectively preventing the oxygen contamination, although there may be a case where it is required to appropriately add, to a reaction medium, a solution for adjusting and maintaining the pH of the reaction system, or a solution containing various nutrients dissolved therein, during the course of reaction, in order to allow metabolic functions inside cells of aerobic bacteria of the invention to work efficiently, it will be effective to remove oxygen from the solution to be added to the reaction medium, in advance.

(172) In addition, in a case where the method of the invention includes Step (p), the resulting culture medium (Y), in which a predetermined genetically modified microorganism of the invention has proliferated through Step (p), may be adjusted so as to fulfill reducing conditions where the genetically modified microorganism does not substantially proliferate, for example, by way of: carrying out a predetermined operation with respect to the culture medium (Y); and/or adding a reducing agent to the culture medium (Y), and then, the culture medium (Y) may be used as the reaction medium (X) in Step (p).

(173) [Reaction Conditions]

(174) It is only sufficient that the reaction temperature in Step (p) is within the range where a desired target substance is produced. The reaction temperature may appropriately be set depending on properties or the like of a genetically modified microorganism to be adopted, and is not particularly limited. The reaction temperature is typically from about 20 to about 50 C., preferably from about 25 to about 47 C., and more preferably from about 27 to about 37 C., and, within such temperature ranges, a target substance can efficiently be produced.

(175) It is only sufficient that the reaction time is appropriately adjusted so as to obtain a desired target substance, and is not particularly limited. For example, the reaction time may be from about 1 hour to about 7 days. In terms of efficient acquisition of a target substance, the reaction time may preferably be set to from about 1 hour to about 3 days, and, for example, from about 1 hour to 48 hours.

(176) The reaction may be any of a batch type, fed-batch type, and continuous type. Among these, a batch type is preferred.

(177) After completion of the reaction in Step (p), the genetically modified microorganism, the treated cell product thereof, or the like may be recovered from the reaction medium (X) based on a suitable operation such as centrifugal separation, and then, Step (p) may be repeated multiple times reusing the recovered genetically modified microorganism. Since the configuration in which Step (p) is repeated multiple times reusing the genetically modified microorganism in this manner results in reductions in production costs, thereby realizing efficient production of a target substance, the configuration is a preferred embodiment of the invention.

(178) Step (q)

(179) After a target substance is produced in Step (p), the target substance is recovered in Step (q). Herein, the term recovering the target substance in Step (q) refers to an idea encompassing recovering the target substance by way of harvesting a genetically modified microorganism and/or a culture solution or a reaction medium containing the target substance.

(180) Although, as mentioned above, by way of harvesting the genetically modified microorganism and/or the culture solution or the reaction medium containing the target substance, the target substance may be recovered in Step (q), the target substance may also be recovered by way of, for example, separating and/or purifying the target substance from the culture solution, the reaction medium, the genetically modified microorganism cells, or the treated cell product thereof containing the target substance.

(181) In an embodiment adopting such a process for separation and/or purification of the target substance, suitable separation/purification techniques may be adopted for the separation and purification processes, according to required purity or the like, in consideration of the type or purpose of the target substance. Although it is not particularly limited, the target substance can be recovered, as necessary, by combining, for example, any types of crystallization methods; any types of filtration techniques such as ultrafiltration; any types of chromatography techniques such as ion-exchange chromatography, affinity chromatography, hydrophobic chromatography and reversed-phase chromatography; concentration techniques; dialysis; and activated carbon adsorption techniques. Various types of these substance separation/purification techniques have been known, and therefore, such known techniques may appropriately be employed.

(182) Furthermore, the method of the invention may further optionally include a step of washing, drying, crushing, pulverizing or granulating, and/or packaging the target substance.

(183) <Type of Target Substance>

(184) According to the method of the invention, various target substances can be produced using the genetically modified microorganism according to the invention with excellent yields. Although types of target substances would vary with a type of the genetically modified microorganism to be adopted, specific examples thereof include nucleic acid-related compounds (e.g., adenine, guanine, cytosine, thymine, uracil, 5-guanylic acid, adenosine, ATP, and CDP-choline); various physiologically active substances such as hormone substances; carbohydrates or sugars; vitamin-related substances and coenzymes (e.g., vitamin C, vitamins B2 and B12, sorbose, NAD, FAD, and coenzyme A); proteins, peptides, amino acids; amino-acid derivatives such as L-3,4-dihydroxyphenylalanine (L-DOAP), 5-hydroxytryptophan, and pyrrolidone carboxylate; alcohols such as ethanol, butanol, and isopropanol; and various organic compounds such as phenol, catechol, 4-hydroxybenzoic acid, 4-aminobenzoic acid, anthranilic acid, gallic acid, succinic acid, fumaric acid, malic acid, shikimic acid, 3-dehydroshikimic acid, 3-dehydroquinic acid, protocatechuic acid, and chorismic acid.

(185) In a specific embodiment, the target substance is at least one selected from the group consisting of an amino acid, an alcohol, an aromatic compound, and an organic acid.

(186) Furthermore, in the invention, the target substance is preferably an L-amino acid or a derivative thereof. Specific examples of the amino acid include valine, leucine, isoleucine, glutamine, aspartic acid, glutamic acid, arginine, alanine, proline, cysteine, lysine, threonine, asparagine, phenylalanine, serine, methionine, glycine, tyrosine, histidine, tryptophan, cystine, and theanine.

(187) Moreover, the derivative of L-amino acid may specifically be a metabolite derived from an L-amino acid in the metabolic system of the genetically modified microorganism.

(188) Furthermore, in the invention, the target substance is preferably L-aspartic acid or a metabolite derived therefrom. The metabolite derived from L-aspartic acid includes amino acids or amino acid derivatives such as L-threonine, L-lysine, L-arginine, and L-homoserine.

(189) In a specific embodiment, the target substance is citric acid, cis-aconitic acid, D-isocitric acid, -ketoglutaric acid, succinyl CoA, succinic acid, or additional metabolites derived therefrom. These metabolites can efficiently be produced by culturing or reacting the genetically modified microorganism according to the invention under aerobic conditions (FIG. 1). In another embodiment, the target substance is oxaloacetic acid, L-malic acid, fumaric acid, or metabolites derived therefrom. These metabolites can efficiently be produced by reacting the genetically modified microorganism according to the invention under reducing conditions where the genetically modified microorganism does not substantially proliferate (FIG. 1).

(190) In still another embodiment, the target substance is oxaloacetic acid, malic acid, or a metabolite produced via these compounds in a biosynthetic pathway.

(191) In a preferred embodiment, the target substance is aspartic acid or a metabolite derived therefrom. In a more preferred embodiment, the target substance is aspartic acid, beta alanine, or asparagine.

(192) The target substance may be produced, under predetermined conditions in the invention, through a metabolic system that the genetically modified microorganism inherited from the wild type microorganism, or may be produced through an additional metabolic system created artificially based on gene manipulations, mutation treatments, or the like, or may be produced by a combination of both of the above metabolic systems. Moreover, in the method for producing a target substance according to the invention, an embodiment further including a step of synthesizing the final target substance from a substance produced by the genetically modified microorganism, based on a chemical synthesis process or a cell-free system of enzymatic metabolism-based bioprocess is also encompassed.

(193) In addition, although applications of the target substances produced in the invention are not limited at all, examples thereof include pharmaceutical application, food application, industrial application, fuel application, and cosmetic application. In addition, the target substance produced in the invention may be a substance employed directly for any types of applications, or may serve as an intermediate raw material employed for production of a final product.

(194) <Mutant-Type PEPC>

(195) According to a fourth aspect of the invention, there is provided the following mutant-type phosphoenolpyruvate carboxylase.

(196) A mutant-type phosphoenolpyruvate carboxylase including an amino acid mutation with respect to an amino acid sequence of a wild-type phosphoenolpyruvate carboxylase of a microorganism belonging to coryneform bacteria, the amino acid mutation being capable of reducing feedback inhibition by aspartic acid in the wild-type phosphoenolpyruvate carboxylase activity, wherein the amino acid mutation at least includes: based on the amino acid sequence set forth in SEQ ID NO: 2, (g) an amino acid substitution of an amino acid corresponding to the 299th aspartic acid with asparagine; (i) an amino acid substitution of an amino acid corresponding to the 813th lysine with a predetermined amino acid, wherein the substituted amino acid is not lysine; or (l) an amino acid substitution of an amino acid corresponding to the 917th asparagine with a predetermined amino acid, wherein the substituted amino acid is not asparagine, wherein the mutant-type phosphoenolpyruvate carboxylase has higher resistance to feedback inhibition by aspartic acid than that of a protein having only the amino acid substitution defined in (g), (i), or (l) above with respect to the amino acid sequence of the wild-type phosphoenolpyruvate carboxylase.

(197) In a preferred embodiment, the mutant-type phosphoenolpyruvate carboxylase is a mutant-type PEPC having an amino acid sequence shown in any one of the following (J) to (L): (J) an amino acid sequence obtained by introducing the amino acid substitution set forth in (g) above and the amino acid substitution set forth in (i) or (l) above into the amino acid sequence set forth in any one of SEQ ID NOs: 2 to 13 (preferably SEQ ID NOs: 2 to 12, more preferably SEQ ID NOs: 2 to 11); (K) an amino acid sequence having deletion, substitution, and/or addition of one or more amino acids in the amino acid sequence defined in (J) above, wherein each of the above amino acid substitutions has been maintained; and (L) an amino acid sequence having a sequence identity of at least 60% to the amino acid sequence defined in (J) above, wherein each of the above amino acid substitutions has been maintained.

(198) Herein, in (K) above, the range of one or more is, for example, from 1 to 100, from 1 to 50, or from 1 to 30, preferably from 1 to 20, from 1 to 15, or from 1 to 10, and more preferably from 1 to 9, from 1 to 8, from 1 to 7, from 1 to 6, from 1 to 5, from 1 to 4, from 1 to 3, or from 1 to 2.

(199) In addition, in (L) above, at least 60% may be replaced with preferably at least 70%, more preferably at least 80%, and still more preferably at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

(200) Moreover, in (J) above, an embodiment in which the amino acid sequence set forth in any one of SEQ ID NOs: 2 to 13 (preferably, SEQ ID NOs: 2 to 12, more preferably SEQ ID NOs: 2 to 11) is replaced with the amino acid sequence set forth in SEQ ID NO: 2 (that is, the wild-type PEPC amino acid sequence of Corynebacterium glutamicum strain ATCC13032) is particularly preferred.

(201) <Nucleic Acid Encoding Mutant-Type PEPC>

(202) According to a fifth aspect of the invention, there is provided a nucleic acid coding for the mutant-type phosphoenolpyruvate carboxylase according to the fourth aspect.

(203) In the invention, the nucleic acid may be provided in any of forms of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Furthermore, the nucleic acid according to the invention may be in the form of a single strand or a double strand. Additionally, the nucleic acid is specifically an isolated nucleic acid, cDNA, or cRNA. Taking is into consideration that, for example, DNA is more chemically stable than RNA, the nucleic acid of the invention is preferably provided in the form of DNA. In addition, the nucleic acid may be chemically modified, e.g., methylated, in the invention.

(204) Moreover, the nucleic acid according to the invention may include a replication origin or the like enabling autonomous replication in cells of a specific microorganism, and may be provided in the form of a plasmid, although these conditions are not necessarily essential. Furthermore, the nucleic acid according to the invention may include, in addition to the mutant-type PEPC coding sequence, a gene regulation sequence, such as a promoter sequence or Shine-Dalgarno sequence, such that the mutant-type PEPC according to the invention can be expressed in cells of microorganisms. The nucleic acid according to the invention may include the mutant-type PEPC coding region.

(205) Furthermore, needless to say, a genetically modified microorganism into which the nucleic acid according to the invention has been introduced is encompassed by the invention as a part of the genetically modified microorganism in the first or second aspect of the invention. Additionally, needless to say, the method for producing a target substance using the genetically modified microorganism into which the nucleic acid according to the invention has been introduced is also encompassed by the invention as a part of the method for producing a target substance according to the third embodiment of the invention.

(206) Hereinbefore, the specific embodiments of the invention have been described in detail, but the invention is not limited to the aforementioned embodiments. With respect to the configurations, the elements, and the features, various modifications, corrections, and combinations can be made without departing from the scope of the invention.

(207) In addition, with regard to the terms contain and have in the invention, unless otherwise specified, existence of elements other than elements referred to as objects by these terms are not excluded, and these terms may mixedly be used herein. Moreover, besides the contents of Japanese Patent Application No. JP2019-76629, based on which this application claims priority, the contents of the documents mentioned in the present specification are incorporated by reference herein in their entirety.

EXAMPLES

(208) <Example Using Corynebacterium glutamicum>

(209) Using Corynebacterium glutamicum strain ATCC13032 as a starting material, recombinant coryneform bacteria in which predetermined enzyme activities were inactivated by a gene disruption technique, and into which a mutant-type phosphoenolpyruvate carboxylase gene having a predetermined amino acid substitution was introduced were prepared. Hereinafter, the procedures therefor are shown.

(210) (1) Preparation of Gene-Deficient Strain (Corynebacterium glutamicum Strain ATCC13032 ldhsdhpoxB)

(211) At first, a SacB gene fragment was amplified by the PCR method using plasmid pNIC-Bsa4 (Source BioScience) serving as a template, and a pair of primers shown in Table 12 below.

(212) TABLE-US-00010 TABLE12 SEQ Primer ID name Sequenceanddescription NO: Primer 5-GGGGAAGCTTGACGTCCACATATACCTGCC-3 14 F1 Underlinedpart:HindIII- recognitionsite Primer 5-ATTCGGATCCGTATCCACCTTTAC-3 15 R1 Underlinedpart:BamHI- recognitionsite

(213) The amplified DNA fragment and plasmid pHSG299 (Takara Bio Inc.) were subjected to a restriction enzyme treatment with BamHI and HindIII, and then, the resulting fragments were ligated using DNA ligation Kit Ver. 2 (Takara Bio Inc.), thereby obtaining plasmid pGE015.

(214) Furthermore, a region with a size of about 1000 bp, present upstream of the ldh gene coding region, and a region with a size of about 1000 bp, downstream of the ldh gene coding region were each amplified through PCRs using, as a template, a genomic DNA of Corynebacterium glutamicum strain ATCC13032.

(215) In addition, in the PCRs, a pair of Primers F2 and R2 were used for the upstream region, and Primers F3 and R3 were used for the downstream region (Table 13).

(216) Additionally, in FIG. 2A, a positional relationship between each of the primers and a gene coding region is schematically shown.

(217) TABLE-US-00011 TABLE13 SEQ Primer ID name Sequence NO: Primer 5-GACGGCCAGTGAATTTTTCATAC 16 F2 GACCACGGGCTA-3 Primer 5-GACAATCTTGTTACCGACGG-3 17 R2 Primer 5-GGTAACAAGATTGTCACCCTGCG 18 F3 CGAAATTCAGAA-3 Primer 5-TACCGAGCTCGAATTGAACTCAC 19 R3 TGAAAAATGCTG-3

(218) In addition, in the above procedures, for the PCRs, a thermal cycler T100 (Bio-Rad Laboratories, Inc.) was used, and PrimeStar MAX (Takara Bio Inc.) was used as a PCR enzyme reagent. The same applies to PCRs in procedures described below unless otherwise specified.

(219) With the In-Fusion cloning kit (Takara Bio Inc.), the amplified DNA fragments upstream and downstream of the ldh gene were ligated to the pGE15 vector that had been linearized by a restriction enzyme treatment with EcoRI, and thus, were cloned therein. The plasmid obtained in this way was named pGE033.

(220) In the plasmid pGE33, the fragments of regions upstream and downstream of the ldh gene were inserted into the multiple cloning site in a state where the fragments were tandem-ligated. However, the coding region of the ldh gene was deficient therein. In addition, pGE33 can be replicated in E. coli, but is a plasmid that cannot be replicated in cells of coryneform bacteria. The plasmid pGE33 was introduced into Corynebacterium glutamicum strain ATCC13032 based on electroporation (2500 V, 25 F, 200; Van der Rest et al. Appl. Microbiol Biotechnol 52, pp 541-545, 1999). The sample after the electroporation was applied to an A agar medium (a composition for 1 L of the medium: 2 g of urea, 7 g of (NH.sub.4).sub.2SO.sub.4, 0.5 g of KH.sub.2PO.sub.4, 0.5 g of K.sub.2HPO.sub.4, 0.5 g of MgSO.sub.4.Math.7H.sub.2O, 6 mg of FeSO.sub.4.Math.7H.sub.2O, 4.2 mg of MnSO.sub.4.Math.nH.sub.2O, 200 g of D-biotin, 200 g of thiamine hydrochloride, 2 g of yeast extract, 7 g of casamino acid, 20 g of glucose, and 16 g of agar, dissolved in 1000 mL of distilled water (pH 6.6)) containing 25 g/ml of kanamycin, and culturing was carried out by an ordinary method.

(221) In the meantime, since pGE33 has a kanamycin-resistance gene as a drug-resistance marker, growing strains that had proliferated on the A agar medium containing kanamycin, were strains into which the entire plasmids of pGE33 were incorporated into the genomic DNAs through occurrence of one-site homologous recombination between the plasmid and the wild-type ldh gene in the chromosome, as described above.

(222) The growing strains obtained in this way were applied to LB agar media (composition for 1 L of the medium: 10 g of bactopeptone, 5 g of yeast extract, 10 g of sodium chloride, and 16 g of agar) added with 10% sucrose, and were cultured based on an ordinary method. In this case, any transformants retaining the SacB genes derived from pGE33 cannot be survived on the culture media added with sucrose, since a toxic substance is produced in transformants. On the other hand, any transformants from which plasmid-derived regions including the SacB gene are omitted through second homologous recombination can survive even on the culture media added with sucrose, and thus, the transformants, from which the plasmid-derived regions were omitted and which lacked the ldh genes, were obtained as growing strains. In addition, those from which the entire plasmid regions in the intact forms of pGE33 were omitted during the second homologous recombination return to the trait of the wild-type strain ATCC13032 retaining the intact ldh gene.

(223) The microbial cell colonies obtained as growing strains on the LB agar media as described above were screened based on the colony PCR method using a pair of Primers F2 and R3, to obtain the ldh gene-deficient strains.

(224) Since Primers F2 and R3 were primers designed at the 5-terminal of the region with a size of about 1000 bp, present upstream of the ldh gene, and at the 3-terminal of the region with a size of about 1000 bp, present downstream of the gene, respectively, it was supposed that DNA fragments with size of about 2 kb were produced in cases of ldh gene-deficient strains. The products obtained by the colony PCR were subjected to agarose electrophoresis (Molecular Cloning, Sambrook et al., 1989 Cold Spring Harbor Laboratory Press) based on the above-mentioned size of fragments serving as an indicator, and thus, microbial cells of colonies for which losses of the ldh genes had been confirmed were obtained as ldh gene-deficient strains (GES168).

(225) Next, the sdhCAB genes were further deleted from the ldh gene-deficient strains (strains ATCC13032ldh) (GES168), in the same manner as the above-described method of obtaining ldh gene-deficient strains.

(226) That is, a region with a size of about 1000 bp, present upstream of the sdhCAB gene coding region, and a region with a size of about 1000 bp, present downstream of the gene coding region were each amplified using as a template the genomic DNA of Corynebacterium glutamicum strain ATCC13032.

(227) In addition, in the PCRs, a pair of Primers F4 and R4 were used for the upstream region, while Primers F5 and R5 were used for the downstream region (Table 14). Additionally, as mentioned above, the sdhCAB forms an operon including the sdhC coding region, the sdhA coding region, and the sdhB coding region, in the genome. A positional relationship between each of the primers and each of the coding region is shown in FIG. 2B.

(228) TABLE-US-00012 TABLE14 SEQ Primer ID name Sequence NO: Primer 5-GACGGCCAGTGAATTGCGGCGGT 20 F4 CAAGGGCATCGA-3 Primer 5-GCTAGCGGCACCTCCAGTGTCGT 21 R4 TGT-3 Primer 5-GGAGGTGCCGCTAGCTCTTTAAT 22 F5 CCAAGTAAGTAC-3 Primer 5-TACCGAGCTCGAATTCTTCAAAG 23 R5 TAGTTCAGGGTG-3

(229) Using the In-Fusion cloning kit (Takara Bio Inc.), the above-amplified DNA fragments corresponding to regions present upstream and downstream, respectively, of the SdhCAB gene, were ligated to a pGE15 vector that had been linearized by a restriction enzyme treatment with EcoRI, and thus, were cloned therein. The plasmid obtained in this way was named pGE020.

(230) The plasmid pGE020 was introduced into the strain ATCC13032ldh (GES168) based on the aforementioned electroporation, and thus, a strain ATCC13032ldhsdh (GES439) was obtained by way of selection with kanamycin-containing culture media and sucrose-containing culture media, as well as screening based on the colony PCR, in the same manner as the above acquisition of the strain ATCC13032ldh (GES168).

(231) Furthermore, the poxB gene was further deleted from the ATCC13032ldhsdh strain (GES439) according to the method of obtaining the gene-deficient strain.

(232) That is, a region with a size of about 1000 bp, present upstream of the poxB gene coding region, and a region with a size of about 1000 bp, present downstream of the gene coding region, were each amplified using, as a template, a genomic DNA of Corynebacterium glutamicum strain ATCC13032.

(233) In addition, in the PCRs, a pair of Primers F6 and R6 were used for the upstream region, and Primers F7 and R7 were used for the downstream region (Table 15).

(234) Additionally, in FIG. 2C, a positional relationship between each of the primers and the gene coding region is schematically shown.

(235) TABLE-US-00013 TABLE15 SEQ Primer ID name Sequence NO: Primer 5-GACGGCCAGTGAAAACGTTAATG 24 F6 AGGAAAACCG-3 Primer 5-AATTAATTGTTCTGCGTAGC-3 25 R6 Primer 5-GCAGAACAATTAATTCTCGAGTC 26 F7 GAACATAAGGAATATTCC-3 Primer 5-TACCGAGCTCGAATTTTCCAGGT 27 R7 ACGGAAAGTGCC-3

(236) Using the In-Fusion cloning kit (Takara Bio Inc.), the above-amplified DNA fragments corresponding to the regions present upstream and downstream, respectively, of the poxB gene were ligated to a pGE15 vector that had been linearized by a restriction enzyme treatment with EcoRI, and thus, were cloned therein. The plasmid obtained in this way was named pGE191. The plasmid pGE191 was introduced into the strain ATCC13032ldhsdh (GES439) according to the aforementioned electroporation, and thus, a strain ATCC13032ldhsdhpoxB (GES524) was obtained by way of selection with a kanamycin-containing culture medium and a sucrose-containing culture medium, followed by screening with the colony PCR, in the same manner as the acquisition of the ATCC13032ldh strain (GES168).

(237) (2) Introduction of Mutant-Type PEPC Genes into Gene-Deficient Strains

(238) (2-1) Construction of Shuttle Vector

(239) At first, a shuttle vector for Corynebacterium glutamicum ATCC13032 was constructed by way of linking a DNA fragment including a replication origin enabling autonomous replication in cells of the Corynebacterium, a DNA fragment including a replication origin enabling autonomous replication in E. coli, and a DNA fragment including a kanamycin-resistance gene.

(240) The DNA fragment relating to the replication origin for the Corynebacterium was amplified based on the PCR method using pBL1 (kindly provided by Dr. Masaaki Wachi, nucleotide sequence GenBank ID: AF092037.1) serving as a template, and using a pair of Primers F8 and R8 shown in Table 16. Moreover, the DNA fragment relating to the replication origin for E. coli was amplified based the PCR method using pMW119 (Takara Bio Inc.) serving as a template, and using a pair of Primers F9 and R9 shown in Table 16. Furthermore, the kanamycin-resistance gene DNA fragment was amplified based on the PCR method using pHSG299 (Takara Bio Inc.) serving as a template, and using a pair of Primers F10 and R10 shown in Table 16.

(241) TABLE-US-00014 TABLE16 SEQ Primer ID name Sequence NO: Primer 5-TTTCTACGCGGCCGCAACAACAAG 28 F8 ACCCATCATAG-3 Primer 5-TCGTCGACGGTACCGGATCCCAT 29 R8 GCACATGCAGTCATGTC-3 Primer 5-GAACCGTAAAAAGGCGACAGTAA 30 F9 GACGGGTAAGCC-3 Primer 5-GCGGCCGCGTAGAAAGTAACGGT 31 R9 GAACAGTTGTTC-3 Primer 5-CGGTACCGTCGACGATATCGAGG 32 F10 TCTGCCTCGTGAAGAA-3 Primer 5-GCCTTTTTACGGTTCGATTTATT 33 R10 CAACAAAGCCGC-3

(242) A product obtained by circularizing the above-obtained three amplified fragments based on ligation of the fragments with the In-Fusion cloning kit (TAKARA) was named plasmid pGEK004 serving as a shuttle vector for Corynebacterium glutamicum ATCC13032.

(243) (2-2) Construction of Plasmids Containing Various Mutant-Type Phosphoenolpyruvate Carboxylase Genes

(244) Next, DNA fragments of mutant-type phosphoenolpyruvate carboxylase genes having various types of amino acid substitutions were amplified through the site specific mutagenesis, which is based on the PCR, and then, plasmids obtained by inserting each of the above DNA fragments into the shuttle vector pGEK004 were constructed.

(245) Names of the constructed plasmids, and contents of the amino acid substitutions for the PEPC are shown in Table 17 below.

(246) TABLE-US-00015 TABLE 17 Plasmid name Amino acid substitutions in Mutant-type PEPCs pGE320 D299N pGE343 K813S pGE321 N917G pGE333 D299N and K813S pGE322 D299N and N917G

(247) Hereinafter, methods for constructing each of the above plasmids will be described in detail.

(248) (2-2-1) pGE320 (ppcD299N Gene)

(249) At first, a DNA fragment including a gapA gene promoter region that serves as a promoter capable of functioning in a coryneform bacterium was amplified based on the PCR, using, as a template, a genomic DNA of the Coryne strain ATCC13032 and using a pair of Primers F11 and R11 shown in Table 18.

(250) TABLE-US-00016 TABLE18 SEQ Primer ID name Sequenceanddescription NO: Primer 5-CATGTGCATGGGATCGAAGAAAT 34 F11 TTAGATGATTGA-3 Primer 5-AAATCCGTTAATACCAACAC-3 35 R11 Primer 5-GGTATTAACGGATTTATGACTG 36 F12 ATTTTTTACGCGA-3 *Theunderlinedpartrefers toacodingregion. Primer 5-CATGCGGTTCGACAGGCTGAGCT 37 R12-1 CATGCT-3 *Theunderlinedpartcorre- spondstoamutation- introducedsiteofD299N. Primer 5-CTGTCGAACCGCATGAATAAGGTC 38 F13-1 ACCCC-3 *Theunderlinedpartcorre- spondstoamutation- introducedsiteofD299N. Primer 5-CGACGGTACCGGATCGCTGGAGAG 39 R13 TCCGCCGCCTT-3 *Theunderlinedpartcorre- spondstoasequencepresent 3downstreamofthePEPC- codingregion.

(251) For the PEPC coding region, at first, a region of about 900 bp corresponding to the N-terminal side of PEPC was amplified based on the PCR method using the genomic DNA of the strain ATCC13032 and using a pair of Primers F12 and R12-1 shown in Table 18, while a region of about 3500 bp including the C-terminal side region of PEPC was amplified in the similar manner using the genomic DNA of the strain ATCC13032 as a template and using a pair of Primers F13-1 and R13 shown in Table 18.

(252) Meanwhile, Primer R12-1 (reverse primer) used for the amplification of the N-terminal side fragment of PEPC, and Primer F13-1 (forward primer) used for the amplification of the C-terminal side fragment of PEPC overlap with each other over the coding region of PEPC, and also, each include mutant codons relating to D299N (GTT/AAC, which are underlined in Table 18, respectively). In addition, the corresponding wild-type codon is GAC (sense strand).

(253) Using the In-Fusion cloning kit (Takara Bio Inc.), the three DNA fragments obtained in the above way were tandem-ligated to a linearized vector fragment that had been obtained by way of subjecting pGEK004 to a restriction enzyme treatment with BamHI, and thus, the fragments were circularized, thereby obtaining plasmid pGE320.

(254) (2-2-2) pGE343 (ppcK813S Gene)

(255) At first, a DNA fragment including a gapA gene promoter region was amplified based on the PCR reaction in the same manner as the above preparation of pGE320.

(256) Furthermore, for the PEPC coding region, at first, a region of about 2430 bp corresponding to the N-terminal side of PEPC was amplified based on the PCR method using the genomic DNA of the strain ATCC13032 as a template and using a pair of Primer F12 shown in Table 18 and Primer R12-2 shown in Table 19, while a region of about 530 bp including the C-terminal side region of PEPC was amplified in the same manner using the genomic DNA of the strain ATCC13032 as a template and using a pair of Primer F13-2 shown in Table 19 and Primer R13 shown in Table 18.

(257) TABLE-US-00017 TABLE19 SEQ Primer ID name Sequenceanddescription NO: Primer 5-CGAGGACATCACCTGAGCCATG-3 40 R12-2 *Theunderlinedpartcorrespondsto amutation-introducedsiteofK813S. Primer 5-CAGGTGATGTCCTCGGCAGAGCTG 41 F13-2 CGTTTGGCAAA-3 *Theunderlinedpartcorrespondsto amutation-introducedsiteofK813S.

(258) Meanwhile, Primer R12-2 (reverse primer) used for the amplification of the N-terminal side fragment of PEPC and Primer F13-2 (forward primer) used for the amplification of the C-terminal side fragment of PEPC overlap with each other over the coding region of PEPC, and also, each include mutant codons relating to K813S (CGA/TCG which are underlined in Table 19, respectively). In addition, the corresponding wild-type codon is AAG (sense strand).

(259) Then, using the In-Fusion cloning kit (Takara Bio Inc.), the three DNA fragments obtained in the above way were tandem-ligated to a linearized vector fragment that had been obtained by way of subjecting pGEK004 to a restriction enzyme treatment with BamHI, and the DNA fragments were circularized, thereby obtaining plasmid pGE343.

(260) (2-2-3) pGE321 (ppcN917G Gene)

(261) At first, a DNA fragment including a gapA gene promoter region was amplified based on the PCR reaction in the same manner as the above preparation of pGE320.

(262) Furthermore, for the PEPC coding region, at first, the region of about 2430 bp corresponding to the N-terminal side of PEPC was amplified based on the PCR method using the genomic DNA of the strain ATCC13032 as a template, and using a pair of Primer F12 shown in Table 18 and Primer R12-3 shown in Table 20, while a region of about 530 bp including the C-terminal side region of PEPC was amplified in the same manner using the genomic DNA of the strain ATCC13032 as a template and using a pair of Primer F13-3 shown in Table 20 and Primer R13 shown in Table 18.

(263) TABLE-US-00018 TABLE20 SEQ Primer ID name Sequenceanddescription NO: Primer 5-GCCGGAGCCGCGCAGCGCAGTGG 42 R12-3 AAAGAC-3 *Theunderlinedpartcorrespondsto amutation-introducedsiteofN917G. Primer 5-CTGCGCGGCTCCGGCTAGTCCAG 43 F13-3 CCGGCT-3 *Theunderlinedpartcorrespondsto amutation-introducedsiteofN917G.

(264) In this case, Primer R12-3 (reverse primer) used for amplification of the N-terminal side fragment of PEPC and Primer F13-3 (forward primer) used for the amplification of the C-terminal side fragment of PEPC overlap with each other over the coding region of PEPC, and also, each include mutant codons relating to N917G (GCC/GGC which are underlined in Table 20, respectively). In addition, the corresponding wild-type codon is AAC (sense strand).

(265) Then, using the In-Fusion cloning kit (Takara Bio Inc.), the three DNA fragments obtained in the above way were tandem-ligated to a linearized vector fragment that had been obtained by way of subjecting pGEK004 to a restriction enzyme treatment with BamHI, and thus, the DNA fragments were circularized, thereby obtaining plasmid pGE321.

(266) (2-2-4) pGE333 (ppcD299N/K813S Gene)

(267) A DNA fragment corresponding to the gapA gene promoter region and the ppc gene N-terminal side region was amplified based on the PCR method using the aforementioned plasmid pGE320 serving as a template and using a pair of Primers F12 and R13-2. Furthermore, a DNA fragment corresponding to the C-terminal side of the ppc gene and a region 3 downstream thereof was amplified in the same manner based on the PCR method using a pair of Primers F-14-2 and R14.

(268) Using the In-Fusion cloning kit (Takara Bio Inc.), the two DNA fragments obtained in the above way were tandem-ligated to a linearized vector fragment that had been obtained by way of subjecting pGEK004 to a restriction enzyme treatment with BamHI, and thus, the DNA fragments were circularized, thereby obtaining plasmid pGE333.

(269) (2-2-5) pGE322 (ppcD299N/N917G Gene)

(270) A DNA fragment corresponding to the gapA gene promoter region and the ppc gene N-terminal side region were amplified by the PCR method using the aforementioned plasmid pGE320 serving as a template and using a pair of Primer F12 and Primer R13-3. Further, DNA fragments corresponding to the ppc gene C-terminal and 3 downstream regions were amplified similarly by the PCR method using a pair of a primer F-14-3 and a primer R14.

(271) Using the In-Fusion cloning kit (Takara Bio Inc.), the two DNA fragments obtained in the above way were tandem-ligated to a linearized vector fragment that had been obtained by way of subjecting pGEK004 to a restriction enzyme treatment with BamHI and thus, the DNA fragments were circularized, thereby obtaining plasmid pGE322.

(272) (2-3) Preparation of Recombinant Coryneform Bacteria by Way of Introducing Mutant-Type ppe Genes into Gene-Deficient Strains of Corynebacterium glutamicum, and Production of Aspartic Acid Using the Coryneform Bacteria

Test Example 1

(273) (Test Procedures)

(274) Based on the above-described electroporation, the gene-deficient strain GES439 (ATCC13032ldhsdhCAB strain) of Corynebacterium glutamicum prepared in Section (1) above was transformed with each of the plasmids pGEK004, pGE320, pGE343, pGE321, pGE333, and pGE322 constructed in Section (2-2) above, thereby obtaining recombinant coryneform bacteria.

(275) Then, each of the recombinant strains of coryneform bacteria was pre-cultured in 5 mL of the A medium (in test tube). 2 mL of each of the resulting pre-culture solutions was inoculated into 100 mL of the NA medium (2 g of urea, 7 g of (NH.sub.4).sub.2SO.sub.4, 0.5 g of KH.sub.2PO.sub.4, 0.5 g of K.sub.2HPO.sub.4, 0.5 g of MgSO.sub.4.Math.7H.sub.2O, 6 mg of FeSO.sub.4.Math.7H.sub.2O, 4.2 mg of MnSO.sub.4.Math.nH.sub.2O, 200 g of D-biotin, 200 g of thiamine hydrochloride, 1 g of yeast extract, and 10 g of glucose dissolved in 1000 mL of distilled water) in a 500-mL flask, so as to prepare two culture samples for each strain, and then, the prepared culture samples were subjected to shaking culture at 33 C. at 200 rpm for 20 hours.

(276) After the cultivation, culture solutions in the above two flasks for each strain were combined together, the liquid culture medium supernatant was removed therefrom based centrifugation, and the separated microbial cells were suspended in 60 mL of BT solution (7 g of (NH.sub.4).sub.2SO.sub.4, 0.5 g of KH.sub.2PO.sub.4, 0.5 g of K.sub.2HPO.sub.4, 0.5 g of MgSO.sub.4.Math.7H.sub.2O, 6 mg of FeSO.sub.4.Math.7H.sub.2O, 4.2 mg of MnSO.sub.4.Math.nH.sub.2O per Litter), such that the OD value was adjusted to be around 30 to 40. This was transferred to a 100 mL medium bottle with a stirring bar placed inside, and then, 5 mL of 50% glucose and 5 mL of 2 M (NH.sub.4).sub.2CO.sub.3 were further added thereto. This medium bottle was put in a thermostat bath set to 33 C., and was left to stand still, thereby causing a reaction while stirring the reaction solution. The pH of the reaction solution was adjusted to 7.5 with 2 M (NH.sub.4).sub.2CO.sub.3 using a pH controller. In addition, when, during the course of a reaction based on coryneform bacteria in the BT solution, an oxidation-reduction potential of the reaction solution is measured with an oxidation-reduction potentiometer (ORP sensor), the oxidation-reduction potential generally falls approximately between 400 mV to 500 mV.

(277) 24 hours after from the start of the reaction, 0.5 mL of the reaction solution was collected, a supernatant thereof was separated by centrifugation, and then, the amount of consumed glucose and amounts of produced amino acids were measured. For the measurement of the amounts of amino acids, an amino acid analysis system Prominence (SHIMADZU CORPORATION) was used.

Results

(278) The results of the aspartic acid production test are shown in FIG. 4. In the graph of FIG. 4, the vertical axis indicates aspartic acid concentrations in samples after the reactions. Furthermore, Table 21 shows genetic types of the obtained recombinant coryneform bacteria, and aspartic acid production efficiencies (%) calculated based on the aspartic acid production test. Each of the values in the aspartic acid production efficiency (%) refers to a ratio of the produced aspartic acid to 0.5 mol of glucose incorporated into the microbial cells.

(279) TABLE-US-00019 TABLE 21 Names of recombinant Amino acid substitutions Aspartate production coryneform bacteria Genotype in mutant-type PEPCs efficiency (%) GES439/pGEK004 ldhsdhCAB Any amino acid 0.3 substitutions of mutant-type PEPCs were NOT introduced. GES439/pGE320 ldhsdhCAB D299N 1.2 GES439/pGE343 ldhsdhCAB K813S 0.4 GES439/pGE321 ldhsdhCAB N917G 0.2 GES439/pGE333 ldhsdhCAB D299N and K813S 8.1 GES439/pGE322 ldhsdhCAB D299N and N917G 7.8

(280) First, in all of the recombinant coryneform bacteria prepared in this test example, including GES439/pGEK004, which served as a negative control, the ldh gene (lactate dehydrogenase gene) and the sdhCAB gene (succinate dehydrogenase gene) in the genome were disrupted.

(281) In the above background, for GES439/pGE320 and GES439/pGE343, into which the ppc genes (phosphoenolpyruvate carboxylase genes) having only the respective single amino acid substitutions of D299N and K813S had further been introduced, slight increases in the aspartic acid production efficiencies were observed, relative to GES439/pGEK004, which served as a negative control. On the other hand, any increase in aspartic acid production efficiency was not observed for GES439/pGE321, into which the ppc gene having only a single amino acid substitution of N917G had been introduced.

(282) To the contrary, for GES439/pGE333 and GES439/pGE322 having amino acid substitutions of: a combination of D299N and K813S; and a combination of D299N and N917G, respectively, the aspartic acid production efficiencies showed values of 8.1% and 7.8%, respectively. In this way, for GES439/pGE333 and GES439/pGE322, significant increases were observed relative to GES439/pGEK004, which served as a negative control.

(283) Thus, it was realized that, when introduction of a mutant-type phosphoenolpyruvate carboxylase (PEPC) having a combination of: an amino acid substitution at the N-terminal side; and an amino acid substitution at the C-terminal side is adopted under the conditions where the predetermined enzyme activities are inactivated, the production efficiency of a substance will significantly be improved.

Test Example 2

(284) (Test Procedures)

(285) Based on the above-described electroporation, the gene-deficient strains GES168 (ldh), GES439 (ldhsdhCAB) and GES524 (ldhsdhCABpoxB) of Corynebacterium glutamicum prepared in Section (1) above were each transformed with the plasmid pGE333 (ppcD299N/K813S) constructed in Section (2-2) above, thereby obtaining recombinant coryneform bacteria.

(286) A test for production of aspartic acid was performed using the above-obtained recombinant coryneform bacteria based on the same manner as Test Example 1.

Results

(287) Results of the test for production of aspartic acid are shown in FIG. 5. In the graph of FIG. 5, the vertical axis refers to concentrations of aspartic acid in the samples after the reactions. Furthermore, in Table 22 below, genetic types of the obtained recombinant coryneform bacteria and aspartic acid production efficiencies (%) calculated in the test for production of aspartic acid are shown. Each of values of the aspartic acid production efficiencies (%) is a ratio of aspartic acid that was actually produced, to 0.5 mol of glucose incorporated into the microbial cells. The value is a value based on the fact that, theoretically, 2 mol of aspartic acid can be produced from 1 mol of glucose.

(288) TABLE-US-00020 TABLE 22 Names of recombinant Amino acid Aspartate production coryneform substitutions in efficiency bacteria Genotype mutant-type PEPCs (%) GES168/pGE333 ldh D299N and K813S 0.2 GES439/pGE333 ldhsdhCAB Same as above 8.1 GE5524/pGE333 ldhsdhCABpoxB Same as above 16.8

(289) First, with regard to the strain GES168/pGE333, which had the mutant-type ppc gene having an amino acid substitution of a combination of D299N/K813S, but which was deficient only in the ldh gene, any significant improvements were not observed in the aspartic acid production efficiency, as shown in FIG. 5 and Table 22.

(290) On the other hand, as confirmed in Test Example 1, with regard to the strain ES439/pGE333, which also had the mutant-type ppc gene having an amino acid substitution of a combination of D299N/K813S, but which was deficient in two genes, namely the ldh gene and sdhCAB, significant improvements were observed in the aspartic acid production efficiency.

(291) Even more surprisingly, with regard to the strain GES524/pGE333, which also had the mutant-type ppc gene having an amino acid substitution of a combination of D299N/K813S, but which was deficient in three genes, namely the ldh gene, sdhCAB, and the poxB gene (pyruvate:quinone oxidoreductase), the aspartic acid production efficiency showed a value of 16.8%, and thus, this strain exhibited remarkably significant improvements in the production efficiency.

Test Example 3

(292) In Test Examples 1 and 2, after the recombinant coryneform bacteria were proliferated in advance using the A media, and the NA media under aerobic cultivation conditions, the culture medium supernatants were then removed by centrifugal separation, and then, the separated microbial cells were suspended in predetermined amounts of BT solutions to perform the reactions for production of aspartic acid. On the other hand, in this test example, after the recombinant coryneform bacteria were proliferated using the A medium and the NA medium under aerobic cultivation conditions, a reaction for production of aspartic acid was performed using the culture solution itself without separation of the microbial cells based on centrifugation or the like. Hereinafter, the procedures therefor will be shown.

(293) At first, GES439/pGEK004 (ldhsdhCAB/without introduction of mutant-type PEP) and GES439/pGE322 (ldhsdhCAB/mutant-type PEPC of D299N and N917G) prepared in Test Example 1 were each inoculated into 5 mL of the A media in test tubes to perform pre-cultivation. Then, 2 mL of each of the resulting pre-culture solutions was inoculated into 100 mL of the NA medium in a 500-mL flask, and the culture samples were subjected to shaking culture at 33 C. at 200 rpm for 20 hours. After the cultivation, 60 mL of each of the sample culture solutions was transferred directly to a 100-mL medium bottle with a stirring bar placed therein, and then, 5 mL of 50% glucose, and 5 mL of 2 M (NH.sub.4).sub.2CO.sub.3 were added thereto. The medium bottle was placed inside a thermostat bath set to 33 C., and was left to stand still therein to thereby perform a reaction while stirring the sample culture solution with the stirring bar. After 24 hours, 0.5 mL of the reaction solution was harvested, the supernatant was collected based on centrifugation, and then, an amount of consumed glucose, and amounts of produced amino acids were measured.

(294) In addition, for identification and measurement of amino acids, an amino acid analysis system Prominence (SHIMADZU CORPORATION) was used.

Results

(295) Results of the test for production of aspartic acid in this test example are shown in FIG. 6. In the graph of FIG. 6, the vertical axis refers to concentrations of aspartic acid in the samples after the reactions.

(296) Furthermore, in Table 23 below, genetic types of the obtained recombinant coryneform bacteria, and aspartic acid production efficiencies (%) calculated in the test for production of aspartic acid are shown. A value of the aspartic acid production efficiency (%) is, as described above, a ratio of aspartic acid that was actually produced, to 0.5 mol of glucose incorporated into the microbial cells.

(297) TABLE-US-00021 TABLE 23 Amino acid Aspartate production Names of recombinant substitutions in efficiency coryneform bacteria Genotype mutant-type PEPCs (%) GES439/pGEK004 ldhsdhCAB Any amino acid 0.2 substitutions of mutant-type PEPCs were introduced. GES439/pGE322 ldhsdhCAB D299N and N917G 4.0

(298) Also in this test example, while the aspartic acid production efficiency for GES439/pGEK004, which served as a negative control, was at a remarkably poor level of 0.2%. On the other hand, GES439/pGE322 having an amino acid substitution of a combination of D299N and N917G exhibited 4.0% for the aspartic acid production efficiency, and thus, such significant increases therefor were observed. That is, according to this test example, it was revealed that the conversion to a target substance (aspartic acid) can efficiently be achieved even in a case where a culture in which the recombinant microbial cells have been proliferated in advance through pre-cultivation under aerobic conditions is employed directly for production of a substance (aspartic acid) without removing the part of culture medium supernatant based on centrifugal manipulations or the like.

(299) As shown in Test Examples 1 to 3 above, it becomes possible to improve efficiency of conversion of a starting substrate, e.g., sugars, to a target substance when a predetermined recombinant coryneform bacterium of the invention.

(300) <Examples Using Escherichia coli (E. coli)>

(301) Next, an example in which a recombinant microorganism according to the invention, and production of aspartic acid using the recombinant microorganism were carried out using Escherichia coli (E. coli) will be shown.

(302) Predetermined genes were disrupted in Escherichia coli in accordance with the following procedures.

(303) (1) Disruption of pflB Gene

(304) At first, the strain BW25113 (lacI.sup.q rrnB.sub.T14 lacZ.sub.wj16 hsdR514 araBAD.sub.AH33 rhaBAD.sub.LD78) described in Datsenko and Wanner (Proc Natl Acad Sci USA 2000, 97:6640-6645.) was prepared in accordance with the method described in this reference document.

(305) Then, in order to disrupt the pflB gene in the above strain BW25113, the strain was transformed in advance with a bacteriophage recombinase expression vector pKD46 (Life Science Market). The resulting transformant was inoculated into 100 mL of the LB culture medium (containing arabinose at a final concentration of 10 mM), and this was cultured at 30 C. until a turbidity of the culture medium at OD600 reached around 0.6. The resulting microbial cells of recombinant E. coli were washed with 10% glycerol three times, and were finally suspended in 1 mL of 10% glycerol, thereby preparing competent cells.

(306) Next, a DNA fragment including a coding region for a kanamycin-resistance gene was amplified based on the PCR method using a pair of Primers F14 and R14 shown in Table 24 below, and further using pKD13 serving as a template. In that case, Primers F14 and R14 includes nucleotide sequences homologous to regions upstream and downstream, respectively, of the coding region for the pflB gene in the chromosomal DNA of E. coli.

(307) TABLE-US-00022 TABLE24 SEQ Primer ID name Sequenceanddescription NO: Primer 5-CGAAGTACGCAGTAAATAAAAAA 44 F14 TCCACTTAAGAAGGTAGGTGTTACAT GATTCCGGGGATCCGTCGACC-3 Primer 5-TTTTACTGTACGATTTCAGTCAA 45 R14 ATCTAATTACATAGATTGAGTGAAGG TTGTAGGCTGGAGCTGCTTCG-3

(308) The resulting PCR product was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.).

(309) Then, 10 L of the purified PCR product was added to 150 L of the above-prepared competent cells, followed by performing the gene introduction based on electroporation (2500 V, 25 F, 200). The resulting transformants were caused to proliferate on an LB agar medium containing 50 g/mL of kanamycin, and thus, the growing strains were selected. Disruption of the pflB gene in each of the selected growing strains was confirmed by way of cultivation of the strains in predetermined culture media, followed by performing organic acid analysis on a supernatant of the culture solution, from which the microbial cells had been separated through centrifugal manipulations. That is, in the organic acid analysis, a strain in which production of formic acid had not been observed was collected as a pflB gene-deficient strain. In addition, the organic acid analysis was performed based on HPLC analysis using TSKgel OApak column (Tosoh Corporation).

(310) Then, the strain BW25113pflB::Km obtained in the above way was transformed with pCP20 (Life Science Market) at 30 C., and then, the obtained transformant was streaked on an LB culture medium plate, containing no antibiotic substance, followed by cultivation at 42 C. In the meantime, pCP20 is a plasmid vector designed so as to express the Flp recombinase, which removes the kanamycin-resistance gene cassette, under high culture temperature conditions. According to this, over the LB culture medium plate, on which the strains had been cultured at 42 C., a colony that showed susceptibility to kanamycin was selected, and the colony was named BW25113pflB.

(311) (2) Disruption of the ldhA Gene

(312) The strain BW25113pflB obtained in the above way was again transformed with pKD46 (Life Science Market), and then, competent cells of the resulting transformant were prepared in the same manner.

(313) Next, a DNA fragment including a coding region for the kanamycin-resistance gene was amplified based on the PCR method using a pair of Primers F15 and R15 shown in Table 25 below, and further using pKD13 serving as a template. In that case, the primers F15 and R15 includes nucleotide sequences homologous to regions present upstream and downstream, respectively, of 5 the ldhA gene coding region in the chromosomal DNA of E. coli.

(314) TABLE-US-00023 TABLE25 SEQ Primer ID name Sequenceanddescription NO: Primer 5-CTGCCGGGAAATGACTGTCCGCA 46 F15 AGGAAAAGAGTGTGAGGAAAAACAAT GATTCCGGGGATCCGTCGACC-3 Primer 5-AAAGAAGTAATGTTTTCTTCATC 47 R15 ATCACCTCAGAAAAGATCGCTACGAG TTGTAGGCTGGAGCTGCTTCG-3

(315) In the same manner as the above described manipulations for disruption of the pflB gene, the purified PCR product was transfected into the above competent cells to prepare an ldhA gene-deficient strain. In addition, deletion of the ldhA gene was confirmed by way of cultivation of transformants in predetermined culture media, followed by performing organic acid analysis on a supernatant separated from culture solution based on centrifugal manipulations, as described above. That is, in the organic acid analysis, a strain in which production of lactic acid had not been observed was obtained as the ldhA gene-deficient strain. In addition, removal of the kanamycin-resistance gene from the chromosomal DNA was also performed based on the method using pCP20 (Life Science Market) as described above, a colony showing sensitivity to kanamycin was selected, and the colony was named Strain BW25113pflBldhA.

(316) (3) Disruption of frdA Gene

(317) The strain BW25113pflBldhA obtained in the above way was transformed again with pKD46 (Life Science Market), and then, competent cells of the obtained transformant were prepared in the same manner.

(318) Next, a DNA fragment including a coding region for the kanamycin-resistance gene was amplified based on the PCR method using a pair of Primers F16 and R16 shown in Table 26 below and further using pKD13 serving as a template. In that case, the primers F16 and R16 includes nucleotide sequences homologous to regions present upstream and downstream, respectively, of the coding region for the frdA gene in the chromosomal DNA of E. coli.

(319) TABLE-US-00024 TABLE26 SEQ Primer ID name Sequenceanddescription NO: Primer 5-ACCCTGAAGTACGTGGCTGTGGG 48 F16 ATAAAAACAATCTGGAGGAATGTCGT GATTCCGGGGATCCGTCGACC-3 Primer 5-GCACCACCTCAATTTTCAGGTTT 49 R16 TTCATCTCAGCCATTCGCCTTCTCCT TTGTAGGCTGGAGCTGCTTCG-3

(320) In the same manner as the above-described manipulations for disruption of the pflB, the purified PCR product was transfected into the above competent cells to thereby prepare an frdA gene-deficient strain. In addition, deletion of the frdA gene was confirmed by way of cultivation of transformants in predetermined culture media, followed by performing organic acid analysis on a supernatant separated from culture solution based on centrifugal manipulations, in the same manner above. That is, in the organic acid analysis, a strain in which production of succinic acid had not been observed was obtained as the frdA gene-deficient strain. In addition, removal of the kanamycin-resistance gene from the chromosomal DNA was also performed based on the method using pCP20 (Life Science Market) as described above, a colony sensitive to kanamycin was selected, and the colony was named Strain BW25113pflBldhAfrdA.

Test Example 4

(321) The BW25113pflBldhAfrdA strains obtained in the above way were transformed with pGEK004, pGE333 (ppcD229N/K813S), and pGE322 (ppcD229N/N917G) constructed in Test Example 1, respectively, based on an ordinary method, thereby obtaining various strains of predetermined recombinant Escherichia coli of the invention.

(322) Each of the above various recombinant strains was pre-cultured in 5 mL of an LB culture medium in a test tube. The resulting preculture was inoculated into 100 mL of Terrific culture medium (composition for 1 L of the culture medium: 12 g of bactotryptone, 24 g of yeast extract, 4 mL of glycerol, 2.31 g of KH.sub.2PO.sub.4, 12.54 g of K.sub.2HPO.sub.4) in a 500-mL flask, and then, this was subjected to shaking culture at 37 C. at 200 rpm for 20 hours. After the cultivation, the cells were centrifuged to remove the culture medium supernatant, and then, the obtained microbial cells were suspended in 40 mL of the BT solution, followed by adjustment of the OD value of the suspension to around 15-20. The suspension was transferred to a 100 mL medium bottle with a stirring bar placed therein, and then, 5 mL of 50% glucose and 5 mL of 2 M (NH.sub.4).sub.2CO.sub.3 were added thereto. The medium bottle was placed inside a thermostat bath set to 33 C., and was left to stand still, thereby performing a reaction while stirring the suspension. After 20 hours, 0.5 mL of the reaction solution was collected from the medium bottle, the collected reaction solution was subjected to centrifugation to thereby obtain a supernatant, and then, an amount of consumed glucose, and amounts of produced amino acids were measured. For identification and measurement of amino acids, an amino acid analysis system (SHIMADZU CORPORATION) was used.

Results

(323) The chromatograph obtained through the amino acid analysis is shown in FIG. 7. Additionally, in the chromatograph shown in FIG. 7, the peak appearing around 7 minutes is a peak for aspartic acid. Furthermore, in Table 27 below, genetic types of the obtained recombinant strains of Escherichia coli, aspartic acid production efficiencies (%) calculated in the test for production of aspartic acid, etc. are shown. A value of the aspartic acid production efficiency (%) is a ratio of aspartic acid that was actually produced, to 0.5 mol of glucose incorporated into the microbial cells. The value is a value based on the fact that, theoretically, 2 mol of aspartic acid can be produced from 1 mol of glucose.

(324) TABLE-US-00025 TABLE 27 Amino acid substi- Aspartate production tutions in mutant- efficiency Strain name type PEPCs (%) BW25113ldhpflBfrdA/pGEK004 1.0 BW25113ldhpflBfrdA/pGEK333 D299N and K813S 4.3 BW25113ldhpflBfrdA/pGEK322 D299N and N917G 11.9

(325) Also in this test example, in which the predetermined recombinant microorganism of the inventions were produced using Escherichia coli, the aspartic acid production efficiency of the strain BW25113ldhpflBfrdA/PGEK004, which served as a negative control, was at a remarkably poor level of 1%. On the other hand, with regard to the strain BW25113ldhpflBfrdA/PGEK333 having an amino acid substitution of a combination of D299N and K813S, and the strain BW25113ldhpflBfrdA/PGEK322 having an amino acid substitution of a combination of D299N and N917G, the aspartic acid production efficiencies of these microorganism showed values of 4.3% and 11.9%, respectively, and thus, significant improvements were recognized in the aspartic acid production efficiencies, exceeding four times that of the negative control. In particular, the strain BW25113ldhpflBfrdA/PGEK322 having an amino acid substitution of a combination of D299N and N917G, significant improvements were recognized in the aspartic acid production efficiency, exceeding 11 times that of the negative control. That is, according to this test example, it was shown that, also in predetermined recombinant microorganisms of the invention using Escherichia coli serving as a host, sugars can efficiently be converted into aspartic acid, and that the aspartic acid can significantly efficiently be produced.

(326) From the results of Test Examples 1 to 4 above, it was shown that, according to the invention, production efficiency of aspartic acid or a metabolite produced in a metabolic pathway derived therefrom can be improved, thus improving the yield of a target substance. That is, it was revealed that, according to the invention, efficiency of conversion of a starting substrate, e.g., sugars, into a target substance can be improved, thus realizing energy saving, cost reduction, and efficient substance production in bioprocess.

Supplementary Notes

(327) In Examples, there is also a step of using an In-Fusion cloning kit (Takara Bio Inc.) in cloning of various gene coding regions, promoter regions, and the like as described above, but regarding the primer pairs used at the time of PCR amplification, a supplemental description is given in which an appropriate adapter sequence is added to each 5-terminal of forward/reverse primers according to the instructions of the cloning kit.

INDUSTRIAL APPLICABILITY

(328) The invention has high industrial applicability in the fields of biotechnology, substance production, and the like.