METHOD FOR RELEASING VIRAL VECTORS

Abstract

The present invention provides a method of releasing viral vectors from cells producing those viral vectors by contacting the cells with a photosensitising agent which is then irradiated to disrupt the plasma membrane of the cells to release the viral vectors which may be collected and/or purified. The product of such methods as well as kits and apparatuses for performing the methods are also provided.

Claims

1. A method of releasing a viral vector from a cell in which said viral vector has been produced, comprising: a) contacting a cell in which said viral vector is present with a photosensitising agent, b) irradiating said cell with light of a wavelength effective to activate said photosensitising agent, wherein said irradiation is conducted at a dose of light and for a time sufficient to disrupt the plasma membrane of said cell, thereby releasing said viral vector, and c) optionally collecting and/or purifying said released viral vector.

2. The method of claim 1, wherein said cell is a mammalian cell, preferably a human cell.

3. The method of claim 1, wherein said cell is selected from a HEK293 cell, a Vero cell, a sf9 cell and a PER.C6 cell.

4. The method of any one of claims 1 to 3, wherein the viral vector is a virus that lacks an envelope, preferably an adenovirus or an adeno-associated virus.

5. The method of any one of claims 1 to 4, wherein the photosensitising agent is an amphiphilic or hydrophobic photosensitising agent, preferably TPCS.sub.2a or TPPS.sub.2a.

6. The method of any one of claims 1 to 5, wherein the light has a wavelength of 400-700 nm (visible) or 400-475 nm (blue light).

7. The method of any one of claims 1 to 6, wherein said contacting step a) is performed for 0.5-120 minutes, preferably 2-30 minutes.

8. The method of any one of claims 1 to 7, wherein the irradiation in step b) is performed for 0.5-120 minutes.

9. The method of any one of claims 1 to 8, wherein a lysing agent is added to said cell in step a), b) and/or c).

10. The method of any one of claims 1 to 9, wherein the cell is in an aqueous medium during steps a) and b).

11. The method of any one of claims 1 to 10, wherein the plasma membrane is disrupted by the generation of pores in said membrane.

12. The method of any one of claims 1 to 11, wherein at least 30% of the genomic DNA in said cell prior to illumination remains in said cell after release of said viral vector.

13. The method of any one of claims 1 to 12, wherein said collection is by removal of cell debris.

14. The method of claim 13, wherein the cell is in an aqueous medium during steps a) and b) and collection is performed by separation of the aqueous medium from cell debris which is not suspended in said medium, preferably by centrifugation.

15. The method of any one of claims 1 to 14, wherein said viral vector is subject to purification, preferably using at least one of the following methods selected from centrifugation, sonication, freeze-thawing, enzyme digestion and liquid chromatography, preferably to a purity of at least 50% (w/w, dry weight).

16. The method of any one of claims 1 to 15, wherein prior to said contacting step a) a step in which said viral vector is produced in said cell is performed.

17. The method of claim 16, wherein said viral vector is produced by culturing said cell to allow said cell to produce said viral vector and optionally the culture supernatant is removed before step a).

18. The method of claim 17, wherein said cell produces said viral vector after infection of said cell with one or more of said viral vectors and/or transfection with one or more polynucleotides which allow the production of said viral vector in said cell.

19. The method of any one of claims 16 to 18, wherein prior to said step in which said viral vector is produced a step is performed in which said cell is infected with one or more of said viral vectors or transfected with one or more polynucleotides and/or viral vectors which allow the production of said viral vector in said cell.

20. A cell harvesting kit or apparatus for releasing a viral vector from a cell comprising: a) a photosensitising agent; and b) a light source to irradiate said cell.

21. The kit or apparatus of claim 20, wherein said kit or apparatus additionally comprises a container in which said cell may be contained.

22. The kit or apparatus of claim 21, wherein said container is suitable for cell culture or purification of said cell.

23. The kit or apparatus of claim 21 or 22, wherein said container is a bag or a tank and/or said light source is attached to said container.

24. The kit of any one of claims 20 to 23, wherein said kit or apparatus additionally comprises a means to agitate said cells.

25. A preparation of viral vectors obtainable by a method as defined in any one of claims 1 to 19.

Description

[0103] The methods described in the Examples form further preferred aspects of the invention. All combinations of the preferred features described above are contemplated, particularly as described in the Examples. The invention will now be described in more detail in the following non-limiting Examples with reference to the following drawings in which:

[0104] FIG. 1 shows the results of an MTS assay performed on Jurkat cells treated with TPCS.sub.2a at 0.1 ug/mL or 1 ug/mL for 10 minutes followed by irradiation for the times indicated and incubation for 48 hours. A) shows absorbance dependent on time of irradiation and B) shows the corresponding viability of the cells.

[0105] FIG. 2 shows the results of a cell counting experiment on Jurkat cells treated with TPCS.sub.2a at 0.1 ug/mL or 1 ug/mL for 10 minutes followed by irradiation for the times indicated and incubation for 48 hours. A) shows cell density dependent on time of irradiation and B) shows the corresponding relative cell growth for the same irradiation times.

[0106] FIG. 3 shows cell death (based on Hoechst 33258 staining and flow cytometry) of Jurkat cells treated with TPCS.sub.2a at 0.1 ug/mL (A) or 1 ug/mL (B) for 10 minutes followed by irradiation for the times indicated and incubation for 48 hours.

[0107] FIG. 4 shows the cellular localisation of TPCS.sub.2a at the plasma membrane of Jurkat cells treated with TPCS.sub.2a at 1 g/mL in complete RPMI 1640 and HEK293 cells treated with TPCS.sub.2a at 5 g/mL in DMEM medium for 10 minutes. White arrows indicate the presence of TPCS.sub.2a at the plasma membrane.

[0108] FIG. 5 shows the results of LDH assays to assess the leakage of cytosolic material from HEK293 cells treated with TPCS.sub.2a at 0.5 g/mL in serum-free DMEM or Tween 20 at 0.5% (A), or TPCS.sub.2a at 50 g/mL in 10% serum DMEM (B) for 10 minutes followed by irradiation (with light) for 5 minutes or no irradiation (no light). LDH release was assessed after 2 hours. (C) shows the background absorbance values of the LDH assay at FBS concentrations of 1%, 5% and 10%.

[0109] FIG. 6 shows the changes to cellular morphology in HEK293 cells treated with TPCS.sub.2a at 5 g/mL in complete DMEM for 10 minutes, followed by irradiation for 5 minutes. The figure shows cells which have been imaged by light (Nomarski) and fluorescence microscopy prior to illumination and 2 hours after illumination. White arrows indicate cell corpses that remain after illumination and black arrows indicate cell debris after illumination.

[0110] FIG. 7 shows the impact of photochemical treatment or detergent lysis on cellular morphology and DNA leakage in HEK293 cells treated with TPCS.sub.2a at 5 g/mL or Tween 20 at 0.5% in complete DMEM for 10 minutes, followed by irradiation for 5 minutes. Hoechst 33258 was added to samples 2 minutes prior to imaging. The figure shows cells which have been imaged by light (Nomarski) and fluorescence microscopy prior to illumination and 2 hours after illumination.

[0111] FIG. 8 is a diagram illustrating how photochemical treatments may be employed to selectively permeabilise the plasma membranes of producer cells to release viral vectors without DNA contamination or leakage (referred to herein as photochemical lysis, PCL).

[0112] FIG. 9 shows the use of photochemical lysis to release viral vectors (AAV serotype 2/AAV2) from producer cells (HEK293T adherent cells). The figure shows untransfected cells (No Trf.), transfected cells not treated with photosensitiser (Neg. Ctrl) and transfected cells treated with photosensitiser (Fimaporfin, TPCS.sub.2a). Cells were irradiated with blue light as indicated. The figure is representative of three independent experiments.

[0113] FIG. 10 shows the impact of photochemical lysis on HEK293T suspension cells. HEK293T suspension cells were treated with fimaporfin or fimaporfin solvent without photosensitiser (Neg. Ctrl), followed by blue light illumination. Hoechst 33258 DNA stain was used to stain free DNA or DNA in cells with plasma membranes. Cells were imaged by light (Nomarski) microscopy and fimaporfin and Hoechst fluorescence by fluorescence microscopy after 10 minutes (i.e. prior to illumination) and 2 hours after illumination. Arrows indicate the plasma membrane localisation of fimaporfin. Asterisks indicate where the plasma membrane has been disrupted and the corresponding absence of fimaporfin staining. Plus signs indicate Hoechst positive DNA and the corresponding localisation of DNA in lysed cell corpses.

[0114] FIG. 11 shows the impact of photochemical lysis on genomic DNA leakage in HEK293T cells. HEK293T cells were treated with 5 g/mL TPCS.sub.2a (fimaporfin) or 0.5% Tween 20 in complete DMEM for 10 minutes, followed by blue light illumination for 5 minutes (With light) or no illumination (No light). Neg. Ctrl refers to cells that received fimaporfin solvent but no photosensitiser, to control for solvent effects on cell lysis. After 2 hours incubation at 37 C. 5% CO.sub.2, supernatants from all samples were collected. Genomic DNA in supernatants was analysed by ddPCR using primers targeting the human albumin gene. Values were normalised to Neg. Ctrl.

[0115] FIG. 12 shows the impact of photochemical treatments on cellular morphology and DNA leakage in HEK293T cells treated with 5 g/mL verteporfin (FIG. 12A), 0.03 g/mL temoporfin (FIG. 12B), 3 g/mL chlorin E6 (FIG. 12C), 30 g/mL protoporphyrin IX (FIG. 12D), or 10 g/mL AIPcS.sub.2a (FIG. 12E) in complete DMEM for 10 minutes, followed by irradiation for 5 minutes. Hoechst 33258 was added to samples 2 minutes prior to imaging. The figure shows cells which have been imaged by light (Nomarski), and Hoechst and photosensitiser fluorescence imaged by fluorescence microscopy prior to illumination and 2 hours after illumination.

EXAMPLE 1: GENERATION OF PORES IN JURKAT CELLS BY IRRADIATION AFTER TPCS.SUB.2A .TREATMENT

Materials and Methods

[0116] Jurkat cells were incubated with 0.1 ug/mL or 1 ug/mL fimaporfin (TPCS.sub.2a, tetraphenyl chlorin disulfonate) for 10 minutes in complete RPMI 1640 medium. The cells were subsequently illuminated for various durations with blue light as indicated in the figures. Following irradiation, the cells were incubated for 48 hours at 37 C. and 5% CO.sub.2, after which several analyses of cell health were performed.

[0117] Blue light irradiation/illumination was performed using LumiSource according to the manufacturer's protocol (PCI Biotech)

[0118] MTS metabolism was performed as a measure of metabolic activity and performed according the manufacturer's protocol (Promega).

[0119] Cell counting was performed as a measure of cell growth using a Coulter Counter by Beckman Coulter according to the manufacturer's protocol. Counting was performed 48 hours after irradiation.

[0120] Entry of Hoechst 33258 (Thermo Fisher Scientific) into cells was performed as a measure of cell death. When Hoechst 33258 enters cells, it binds to double-stranded DNA generating a strong fluorescent signal. Entry of the stain into the cells requires the presence of pores in the plasma membrane and is a late-stage measure of cell health, i.e. cell death. Hoechst 33258 staining and flow cytometry was performed according to the manufacturer's protocol (Thermo Fisher Scientific).

Results

[0121] MTS provides an assay based on reduction of an MTS tetraxolium compound by cells to produce a detectable dye. This production reduces as metabolic activity of the cells decreases and is an indicator of viability. FIG. 1 shows that on irradiation absorbance is reduced (FIG. 1A). This correlates to reduced viability and is shown in FIG. 1B relative to starting levels of 100%. Illumination of between 2-5 minutes showed reductions in viability. Increasing TPCS.sub.2a from 0.1 to 1 g/ml reduced absorbance and cell viability at lower irradiation times and achieved total loss of viability at 4-5 minutes irradiation. It is evident from these results that activation of TPCS.sub.2a resulted in reduced metabolic activity and viability of the treated cells.

[0122] FIG. 2 shows the cell density (determined by cell counting) of the treated cells 48 hours after irradiation (FIG. 2A). The higher dose of TPCS.sub.2a reduced cell density at corresponding irradiation times. Higher irradiation times decreased cell density. FIG. 2B shows the cell density relative to starting cell density, i.e. to show relative cell growth.

[0123] FIG. 3 shows cell death of the treated cells after irradiation based on Hoechst 33258 staining at 0.1 g/ml (FIG. 3A) or 1 g/ml (FIG. 3B) at various irradiation times. The lower dose of TPCS.sub.2a resulted in some cell death but only at longer irradiation times. The higher dose of TPCS.sub.2a resulted in significant cell death after 2 minutes of irradiation.

[0124] These results show that the Hoechst stain crossed the plasma membrane. Hoechst 33258 is hydrophilic and does not readily cross the plasma membrane. As such, Hoechst 33258's ability to enter the cell serves as a measure of plasma membrane pore-formation, since pores must exist in the plasma membrane for Hoechst 33258 to enter the cell. The presence of such pores will allow the efflux of molecules for release of contained entities such as viral vectors.

EXAMPLE 2: LOCALISATION OF PHOTOSENSITISING AGENT (TPCS.SUB.2A.) TO PLASMA MEMBRANE IN SUSPENSION AND ADHERENT CELLS

Materials and Methods

[0125] Jurkat cells (suspension cancer cells of T-cell origin) were incubated with 1 g/mL fimaporfin (TPCS.sub.2a, tetraphenyl chlorin disulfonate) for 10 minutes in complete RPMI 1640 and HEK293 cells (adherent embryonic kidney cells) were incubated with 5 g/mL TPCS.sub.2a for 10 minutes in DMEM medium. Cells were subsequently washed in PBS/1% FBS prior to imaging to remove unbound TPCS.sub.2a. The cells were subsequently imaged by light (Nomarski) and fluorescence microscopy to determine the cellular localisation of TPCS.sub.2a.

[0126] For imaging, cells were seeded on poly-D-lysine coated cover slips in 24 well plates 1 day prior to treatments. Cover slips were coated with poly-D-lysine for enhanced cell adherence. The coating procedure was performed according to manufacturer's protocol (Thermo Fisher Scientific). Light microscopy (Nomarski) and fluorescence microscopy was performed using Zeiss Imager.Z1. Images were processed using AxioVision. Samples were washed three times in PBS/1% FBS prior to image acquisition in order to remove unbound photosensitiser and thereby visualise cell-bound photosensitiser.

Results

[0127] The localisation of TPCS.sub.2a after incubation with the cells is shown in FIG. 4. The fluorescence images show that TPCS.sub.2a localised to the plasma membrane of both Jurkat and HEK293 cells (see white arrows). It is evident from these results that TPCS.sub.2a localises to the plasma membrane of two highly different cell types (Jurkat and HEK293) after a short incubation period and localises to the same location in both adherent and suspension cells. The incorporation of the photosensitising agent into the plasma membrane allows it to permeabilise the plasma membrane in a cell type-independent manner when activated by irradiation (as shown in the other examples).

EXAMPLE 3: LEAKAGE OF CYTOSOLIC PROTEIN LACTATE DEHYDROGENASE (LDH) AFTER PHOTOCHEMICAL TREATMENT

[0128] Permeabilization of the plasma membrane was assessed using a lactate dehydrogenase (LDH) assay. Such assays are a commonly employed method utilised to indirectly measure cell lysis as LDH is a cytoplasmic enzyme which is released from lysed cells.

Material and Methods

[0129] HEK293 cells were incubated with either 0.5 g/mL TPCS.sub.2a or 0.5% Tween 20 in serum-free DMEM. Alternatively, HEK293 cells were incubated with 50 g/mL TPCS.sub.2a in 10% serum supplemented DMEM for 10 minutes. The cells were subsequently irradiated with blue light for 5 minutes or received no irradiation. Blue light irradiation/illumination was performed using LumiSource according to the manufacturer's protocol (PCI Biotech). The negative control (Neg. Ctrl) was either serum-free DMEM or 10% Fetal Bovine Serum (FBS) supplemented DMEM containing the TPCS.sub.2a solvent to control for the effect of solvents on LDH leakage. Background absorbance values of the LDH assay was assessed using DMEM with increasing concentrations of FBS at 1%, 5% and 10%.

[0130] LDH release was performed as a measure of cell lysis and release of cytosolic material using CyQUANT LDH Cytotoxicity Assay (Thermo Fisher Scientific) according to manufacturer's protocol. Cells were seeded in 48 well plates one day prior to treatments in 400 L. The following day, treatments were given for 10 minutes at 37 C. 5% CO.sub.2, prior to 5 minutes illumination. Plates were subsequently incubated for 2 hours in an incubator (37 C. 5% CO.sub.2), then centrifuged for 5 minutes at 400g, after which 50 L supernatant from each sample was transferred to a 96 well plate for absorbance measurements according to kit instructions. 490 nm absorbance reflects LDH and 680 nm reflects absorbance background from the instrument. 490 nm absorbance minus 680 nm absorbance is directly proportional to the amount of LDH released into the medium.

Results

[0131] FIG. 5 shows LDH release from HEK293 cells treated with 0.5 g/mL TPCS.sub.2a or Tween 20 (FIG. 5A) or 50 g/mL TPCS.sub.2a (FIG. 5B). In the absence of irradiation, HEK293 cells in both serum-free and 10% FBS DMEM treated with TPCS.sub.2a exhibited comparable levels of LDH release to HEK293 cells treated with a negative control. In the presence of irradiation, LDH release was increased significantly in both serum-free and serum-supplemented medium. In contrast, HEK293 cells treated with Tween 20, a commonly used detergent which causes cell lysis, showed elevated levels of LDH release both in the absence and presence of irradiation.

[0132] It is evident from these results that treatment with TPCS.sub.2a allows for light-dependent LDH release, and therefore cell permeabilisation (and potentially lysis), in both serum-free DMEM and 10% FBS DMEM. The results of FIG. 5C further show that elevated concentrations of FBS within the DMEM serum results in increased absorbance values in the LDH assay. This therefore demonstrates that the overall higher absorbance values seen in FIG. 5B compared with FIG. 5A can be attributed to the presence of 10% FBS in FIG. 5B.

EXAMPLE 4: ASSESSMENT OF MORPHOLOGY AFTER PHOTOCHEMICAL TREATMENT

Materials and Methods

[0133] HEK293 cells were incubated with 5 g/mL TPCS.sub.2a complete DMEM for 10 minutes, followed by irradiation with blue light for 5 minutes. Blue light irradiation/illumination was performed using LumiSource according to the manufacturer's protocol (PCI Biotech). Cells were imaged by light (Nomarski) and fluorescence microscopy prior to illumination and 2 hours after illumination. Imaging was performed as described in Example 2.

Results

[0134] The impact of photochemical lysis in HEK293 cells treated with TPCS.sub.2a can be seen in FIG. 6 which demonstrates that in the absence of irradiation, HEK293 cells treated with 5 g/mL TPCS.sub.2a do not exhibit changes to their cellular morphology. In contrast, HEK293 cells treated with 5 g/mL TPCS.sub.2a which had been irradiated exhibited a dramatically altered cellular morphology and had shifted to a lytic phenotype, with cellular material being scattered outside the remaining cellular structures (cell corpses).

EXAMPLE 5: SELECTIVE PERMEABILIZATION OF THE PLASMA MEMBRANE OF HEK293 CELLS BY IRRADIATION AFTER TREATMENT WITH A PHOTOSENSITISING AGENT, TPCS.SUB.2A

[0135] The relative effects of photochemical treatments and detergent lysis on release of cellular components were assessed.

Materials and Methods

[0136] HEK293 cells were incubated with 5 g/mL TPCS.sub.2a or 0.5% Tween 20 in complete DMEM for 10 minutes followed by irradiation for 5 minutes. Blue light irradiation/illumination was performed using LumiSource according to the manufacturer's protocol (PCI Biotech). A negative control of complete DMEM containing the TPCS.sub.2a solvent was used to control for solvent effects on cell morphology and lysis.

[0137] Hoechst 33258 stain was added to samples 2 minutes prior to imaging. Hoechst 33258 staining was performed according to the manufacturer's protocol (Thermo Fisher Scientific). The cells were imaged by light (Nomarski) and fluorescence microscopy prior to irradiation and 2 hours after irradiation. Imaging was performed as described in Example 2. Changes to cellular morphology were analysed visually.

Results

[0138] DNA leakage from cells is a major problem in viral vector manufacturing, specifically the leakage of genomic DNA from producer cells. To understand how TPCS.sub.2a treatment and established lysis methods (Tween 20) impacted DNA leakage, cells lysed by both approaches were studied by microscopy. Hoechst 33258 staining was used to stain free DNA or DNA in cells with plasma membrane pores. The results in FIG. 7 show that while DNA stays within the boundaries of the cell corpse following TPCS.sub.2a treatment and irradiation, detergent lysis with Tween 20 causes DNA leakage from cells after 10 minutes, and after 2 hours DNA is free in solution.

[0139] It is evident from these results that TPCS.sub.2a treatment may be employed to selectively lyse cells without resulting in DNA leakage and contamination, in contrast to detergent lysis.

EXAMPLE 6: RELEASE OF VIRAL VECTORS FROM PRODUCER CELLS BY IRRADIATION AFTER TREATMENT WITH A PHOTOSENSITISING AGENT, TPCS.SUB.2A

[0140] Photochemical lysis was used to release AAV2 viral vectors from adherent HEK293T cells in which they were produced.

Materials and Methods

[0141] 75-80% confluent HEK293T cells were triple transfected with Adeno-associated virus serotype 2 (AAV)-encoding plasmids (pHelper, AAV2 RepCap, and pscAAV-GFP plasmids) using polyethylenimine (PEI) in 12 well plates, resulting in AAV2 production. For each transfection, plasmids and PEI were added to complete DMEM to a total volume of 640 L, followed by vortexing for 10 seconds and 15 minutes incubation at room temperature. Medium was removed from the HEK293T cells in 12 well plates, and replaced by the DMEM-plasmid-PEI mixture. Cells were incubated for three days at 37 C. and 5% CO.sub.2. Three days after transfection, cells were subjected to treatments (as described below) for 10 minutes in complete DMEM.

[0142] Treatments were: [0143] a) Untransfected cells, no further treatment. [0144] b) Transfected cells. Received photosensitiser solvent but no photosensitiser (to control for solvent effect on cell lysis). [0145] c) Transfected cells. Incubated with 5 g/mL TPCS.sub.2a (Fimaporfin) for 10 minutes.

[0146] Samples from treatment b) or c) were previously (on the day of seeding) divided into two 12-well plates and either subjected to blue light illumination for 5 minutes or no light illumination. Blue light irradiation/illumination was performed using LumiSource according to the manufacturer's protocol (PCI Biotech).

[0147] Supernatants were harvested 2 hours later and cell debris (if any) was eliminated by centrifugation. DNase-resistant viral genome (vg) from all samples was quantified by digital droplet PCR amplification (Bio-Rad QX600) of DNase-resistant (i.e. viral capsid-encapsulated) DNA using primers targeting inverted terminal repeats. Viral vector yield was expressed as vg/mL (AAV vector genomes per millilitre).

[0148] The ITR primers' sequences are as set out below:

TABLE-US-00001 ITRforward: (SEQIDNO:1) CGGCCTCAGTGAGCGA ITRreverse: (SEQIDNO:2) GGAACCCCTAGTGATGGAGTT

Results

[0149] The results are shown in FIG. 9. No Trf shows supernatants from untransfected cells. Neg. Ctrl shows supernatant from transfected cells that received photosensitiser solvent but no photosensitiser. Fimaporfin shows supernatant from transfected cells that were incubated with TPCS.sub.2a for 10 minutes. No light shows samples there was not illuminated and with light shows samples that were illuminated.

[0150] The figure shows that photochemical lysis releases non-enveloped viral vectors from producer cells (here, HEK293T, the most common cell type). Whilst this experiment is concerned with AAV2, this virus is representative of other non-enveloped vectors (e.g. other AAV serotypes and adenovirus (AV)) to which the method may be applied.

EXAMPLE 7: PHOTOCHEMICAL LYSIS OF HEK293T SUSPENSION CELLS

[0151] The impact of photochemical treatments and detergent lysis on HEK293T suspension cells was studied by microscopy.

Materials and Methods

[0152] HEK293T suspension cells were treated with 5 g/mL TPCS.sub.2a (fimaporfin) or fimaporfin solvent without photosensitiser (Neg. Ctrl) in complete DMEM for 10 minutes, followed by blue light illumination for 5 minutes (as described in Example 6). Hoechst 33258 was added to samples 2 minutes prior to imaging. Hoechst 33258 DNA stain is not readily cell penetrable, and therefore stains free DNA or DNA in cells with plasma membrane pores.

[0153] Cells were washed in PBS/1% FBS prior to imaging to remove unbound fimaporfin. Cells were imaged by light (Nomarski) microscopy and fimaporfin and Hoechst fluorescence by fluorescence microscopy after 10 minutes (i.e. prior to illumination) and 2 hours after illumination. Imaging was conducted as set out in Example 2.

Results

[0154] The results are shown in FIG. 10. Arrows indicate the plasma membrane localisation of fimaporfin (prior to illumination, i.e. after 10 minutes). Asterisks indicate where the plasma membrane has been disrupted and the corresponding absence of fimaporfin staining. Plus signs indicate Hoechst positive DNA and the corresponding localisation of DNA in lysed cell corpses.

[0155] These results are in line with those observed in FIG. 4 (fimaporfin plasma membrane localisation in Jurkat and adherent HEK293), 6 (plasma membrane disruption of adherent HEK293), and 7 (retention of DNA following photochemical lysis, adherent HEK293) but with HEK293T suspension cells, the most commonly used cell type in viral vector manufacturing performed in suspension culture. The key results are: 1) fimaporfin localises to the plasma membrane of HEK293T suspension cells, 2) photochemical lysis (fimaporfin+light) opens up the plasma membrane of HEK293T suspension cells, and 3) DNA is retained within the boundaries of the lysed cells (cell corpses) after photochemical lysis.

EXAMPLE 8: SELECTIVE PERMEABILIZATION OF THE PLASMA MEMBRANE OF HEK293T CELLS BY IRRADIATION AFTER TREATMENT WITH A PHOTOSENSITISING AGENT, TPCS.SUB.2A., STUDIED BY DIGITAL DROPLET PCR

[0156] The relative effects of photochemical treatments and detergent lysis on release of cellular components were assessed by digital droplet PCR (ddPCR).

Materials and Methods

[0157] 75-80% confluent HEK293T cells were incubated with 5 g/mL TPCS.sub.2a or 0.5% Tween 20 in complete DMEM for 10 minutes followed by irradiation for 5 minutes (where indicated). Blue light irradiation/illumination was performed using LumiSource according to the manufacturer's protocol (PCI Biotech). A negative control of complete DMEM containing the TPCS.sub.2a solvent was used to control for solvent effects on cell lysis.

[0158] Following irradiation, the cells were incubated for 2 hours at 37 C. and 5% CO.sub.2, after which supernatants were collected. Cell debris (if any) was eliminated by centrifugation. Genomic DNA from all samples was quantified by ddPCR (Bio-Rad QX600) using primers targeting human albumin DNA.

[0159] The primers' sequences are as set out below:

TABLE-US-00002 Albuminforward: (SEQIDNO:3) TGAAACATACGTTCCCAAAGAGTTT Albuminreverse: (SEQIDNO:4) CTCTCCTTCTCAGAAAGTGTGCATAT

[0160] Albumin DNA values were normalised to the negative control.

Results

[0161] The results in FIG. 11 show that a photochemical lysis condition known to lyse cells and release viral vectors (Example 6) does not cause the leakage of genomic DNA from HEK293T cells. In contrast, Tween 20, an established lysis method, caused an approximately 6-fold increase in genomic DNA.

[0162] The results reported in FIG. 7 provide qualitative evidence that photochemical lysis, in contrast to Tween 20 lysis, does not cause genomic leakage. The present results quantitatively confirm that photochemical lysis does not open up the nucleus of producer cells, preventing a strong leakage of genomic DNA unlike with Tween 20 and detergent lysis. Therefore, TPCS.sub.2a treatment may be employed to selectively lyse cells without resulting in DNA leakage and contamination, in contrast to detergent lysis.

EXAMPLE 9: ASSESSMENT OF PHOTOCHEMICAL LYSIS WITH ALTERNATIVE PHOTOSENSITISERS

[0163] The effects of five photochemical treatments on morphology and release of cellular components were assessed.

Materials and Methods

[0164] HEK293T cells were incubated with 5 g/mL verteporfin (a benzoporphyrin), 0.03 g/mL temoporfin (a chlorin), 3 g/mL chlorin E6 (a chlorin), 30 g/mL protoporphyrin IX (a porphyrin), or 10 g/mL AIPcS.sub.2a (a phthalocyanine) in complete DMEM for 10 minutes followed by irradiation for 5 minutes. Blue light irradiation/illumination was performed using LumiSource according to the manufacturer's protocol (PCI Biotech).

[0165] Hoechst 33258 stain was added to samples 2 minutes prior to imaging to stain free DNA or DNA in cells with plasma membrane pores. Hoechst 33258 staining was performed according to the manufacturer's protocol (Thermo Fisher Scientific). The cells were imaged by light (Nomarski), and Hoechst and photosensitiser fluorescence imaged by fluorescence microscopy after 10 minutes (i.e. prior to irradiation) and 2 hours after irradiation. Imaging was performed as described in Example 2.

Results

[0166] The impact of photochemical lysis in HEK293T cells treated with five alternative photosensitisers reproduces what has already been shown using TPCS.sub.2a in Examples 4 and 5. FIG. 12 shows that a short incubation with each of the tested photosensitisers can lyse cells in a light-dependent manner (demonstrated by morphological changes in the Nomarski images before and after illumination) and that photochemical lysis prevents DNA leakage from the lysed cells (demonstrated by the round, Hoechst 33258-positive shapes that appear after illumination which are nuclei, or nuclei-like structures).

[0167] Together with the results in Examples 4 and 5, these results illustrate that numerous classes of photosensitisers (benzoporhyrin, porphyrin, phthalocyanine, chlorin) are capable of producing photochemical lysis, demonstrating that photochemical lysis to achieve cellular release of viral vectors is a general principle and is not specific to fimaporfin.