AAV-NAGLU vectors for treatment of mucopolysaccharidosis IIIB

12605465 ยท 2026-04-21

Assignee

Inventors

Cpc classification

International classification

Abstract

Recombinant nucleic acid comprising nucleotides encoding -N-acetylglucosaminidase (NAGLU). Vectors comprising the recombinant nucleic acid for delivery to a subject. In an aspect the NAGLU sequences optimized for expression in human cells. Methods of using the vector to increase secretion of NAGLU from a cell and for treatment and prevention of mucopolysaccharidosis IIIB.

Claims

1. A recombinant nucleic acid comprising a nucleotide sequence encoding human -N-acetylglucosaminidase (NAGLU) that is codon-optimized for expression in human cells, wherein the recombinant nucleic acid comprises the nucleotide sequence of SEQ ID NO: 1.

2. A vector comprising the recombinant nucleic acid of claim 1.

3. The vector of claim 2, comprising the sequence of SEQ ID NO:3 or SEQ ID NO:4 or a sequence at least 90% identical thereto.

4. An adeno-associated virus (AAV) vector genome comprising the recombinant nucleic acid of claim 1.

5. The AAV vector genome of claim 4, wherein the AAV vector genome is a self-complementary AAV vector genome.

6. The AAV vector genome of claim 4, wherein the recombinant nucleic acid is operably linked to a constitutive promoter.

7. The AAV vector genome of claim 6, wherein the constitutive promoter is the CBA promoter.

8. The AAV vector genome of claim 6, wherein the constitutive promoter is the CMV promoter.

9. A cell in vitro comprising the AAV vector genome of claim 4.

10. An AAV particle comprising the AAV vector genome of claim 4.

11. A method of producing a recombinant AAV particle comprising an AAV capsid, the method comprising: providing a cell in vitro with AAV Cap and AAV Rep coding sequences, the AAV vector genome of claim 4, and helper functions for generating a productive AAV infection; and allowing assembly of the recombinant AAV particle comprising the AAV capsid and encapsidating the AAV vector genome.

12. An AAV particle produced by the method of claim 11.

13. The AAV particle of claim 10, wherein the AAV particle is an AAV9 particle.

14. A pharmaceutical formulation comprising the AAV particle of claim 10 and a pharmaceutically acceptable carrier.

15. A method of expressing NAGLU in a cell, comprising contacting the cell with an effective amount of the AAV particle of claim 10, thereby expressing NAGLU in the cell.

16. A method of increasing secretion of NAGLU from a cell, comprising contacting the cell with an effective amount of the AAV particle of claim 10, thereby increasing secretion of NAGLU from the cell relative to the secretion of NAGLU after contacting the cell with an AAV particle comprising a nucleic acid comprising the wild-type sequence for NAGLU.

17. A method of delivering NAGLU to a subject, comprising administering to the subject an effective amount of the pharmaceutical formulation of claim 14, thereby delivering NAGLU to the subject.

18. A method of treating or delaying the onset of mucopolysaccharidosis IIIB (MPS IIIB) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the pharmaceutical formulation of claim 14, thereby treating or delaying the onset of MPS IIIB in the subject.

19. The method of claim 18, wherein the AAV particle is administered to the subject systemically.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the schematic structure of rAAV-hNAGLU.sup.op (PP viral vector genomes. ITR: AAV2 terminal repeat; SD: SV40 splicing signal; hNAGLU.sup.op: codon-optimized human -N-acetylglucosaminidase cDNA; PA: SV40 polyadenylation signal; CBA: chicken actin promoter with CMV enhancer; CMV: human CMV immediate early enhancer/promoter.

(2) FIGS. 2A-2C show AAV-hNAGLU.sup.op mediated effective expression and enhanced secretion of rNAGLU in vitro. HEK 293 cells were transfected in duplicates with 1 g plasmid of pAAV-CMV-hNAGLU (CMV-NAG), pAAV-CBA-hNAGLU.sup.op (CBA-NAG-op), or pAAV-CMV-hNAGLU.sup.op (CMV-NAG-op). Controls were non-transfected cells (NT). Cell lysates and media were assayed in duplicates for NAGLU activity at 48 h post transfection.

(3) FIGS. 3A-3C show AAV9-mediated persistent restoration of NAGLU activity in the CNS and peripheral tissues in MPS IIIB mice following an IV vector delivery. MPS IIIB mice were treated at age 1 month (B, C), 3 months (A), or 6 months (C) with an IV injection of 110.sup.13 vg/kg (B) or 210.sup.13 vg/kg (A, C) rAAV9-CBA-hNAGLU.sup.op. Tissues were assayed for NAGLU activity at 1 week post-injection (pi) (A), 1 month pi (A, C), 7 months pi (B) or endpoint (B, C). NAGLU activity is expressed as units/mg protein, 1 unit=nmol of 4 MU released/hr. There was no detectable NAGLU activity in tissues in non-treated MPS IIIB mice. m/m: Injection age/testing time. *: p<0.05 vs. WT; .sup.#: p>0.05 vs. WT.

(4) FIGS. 4A-4C show AAV9-mediated persistent restoration of NAGLU activity in the CNS and peripheral tissues in MPS IIIB mice following an IV delivery of rAAV9-CMV-hNAGLU.sup.op. MPS IIIB mice were treated at age 1 month (A), 3 months (B), or 6 months (C) with a IV injection of 110.sup.13 vg/kg (A), or 210.sup.13 vg/kg (B, C) rAAV9-CMV-hNAGLU.sup.op. Tissues were assayed for NAGLU activity at 1 week pi (B), 1 month pi (B, C), 7 m pi (A) or endpoint (A, C). NAGLU activity is expressed as units/mg protein, 1 unit=nmol of 4 MU released/hr. There was no detectable NAGLU activity in tissues in non-treated MPS IIIB mice. m/m: Injection age/testing time. *: p<0.05 vs. WT; .sup.#: p>0.05 vs. WT.

(5) FIGS. 5A-5C show clearance of GAG contents in the CNS and peripheral tissues in MPS IIIB mice following an IV rAAV9 vector delivery. MPS IIIB mice were treated at age 1 month (B, C), 3 months (A) or 6 months (C) with an IV injection of 110.sup.13 vg/kg (B) or 210.sup.13 vg/kg (A, C) rAAV9-CBA-hNAGLU.sup.op. Tissues were assayed for GAG contents at 7 days pi (A), 1 month pi (A, C), 7 months pi (B) or endpoint (B, C). GAG contents are expressed as g/mg wet tissue. WT: wt mice; m/m: Injection age/testing time. *: p<0.05 vs. IIIB; .sup.#: p>0.05 vs. IIIB; {circumflex over ()}: p<0.05 vs. WT; +: p>0.05.

(6) FIGS. 6A-6C show clearance of GAG contents in the CNS and peripheral tissues in MPS IIIB mice following an IV rAAV9-CMV-hNAGLU.sup.op delivery. MPS IIIB mice were treated at age 1 month (A), 3 months (B) or 6 months (C) with a IV injection of 110.sup.13 vg/kg (A) or 210.sup.13 vg/kg (B, C) rAAV9-CMV-hNAGLU.sup.op. Tissues were assayed for GAG contents at 7 days pi (A), 1 month pi (A, C), 7 months pi (B) or endpoint (B, C). GAG contents is expressed as g/mg wet tissue. WT: wt mice; m/m: Injection age/testing time. *: p<0.05 vs. IIIB; .sup.#: p>0.05 vs. IIIB; {circumflex over ()}: p<0.05 vs. WT; +: p>0.05.

(7) FIGS. 7A-7C show correction of lysosomal storage pathology and astrocytosis. MPS IIIB mice were treated with an IV injection of 110.sup.13 vg/kg rAAV9-CBA-hNAGLU.sup.op at age 1 month and necropsy was performed at 7 months pi for tissue analyses. Paraffin tissue sections (4 m) were assayed by immunofluorescence for lysosomal associated membrane protein 1 (LAMP1, Red fluorescence) (A, C) or GFAP (green fluorescence) (B). A & B: brain and eye tissues: CTX: cerebral cortex; TH: thalamus; BS: brain stem; Ret: retina; ON: outer nuclear layer; IN: inner nuclear layer. C. somatic and eye tissues: Liv: liver; Lung; Spl: spleen; Cil: ciliary body of eye; NT: non-treated MPS IIIA; AAV9: vector treated MPS IIIB mice.

(8) FIGS. 8A-8B show correction of behavior deficits and extension of survival in MPS IIIB mice following a systemic delivery of rAAV9-CBA-hNAGLU.sup.op. MPS IIIB mice were treated with an IV injection of 110.sup.13 vg/kg, or 210.sup.13 vg/kg scAAV9-CBA-hNAGLU.sup.op vector at age 1 month or 6 months, and were tested for behavior in a hidden task and swimming ability in Morris water maze test at age 7 months (A). WT and non-treated MPS IIIB mice were used as controls. m/m: injection age/testing age. Subsets of animals were observed for longevity (B).

(9) FIGS. 9A-9B show correction of behavior deficits and extension of survival in MPS IIIB mice following a systemic delivery of rAAV9-CMV-hNAGLUop. MPS IIIB mice were treated with an IV injection of 110.sup.13 vg/kg, or 210.sup.13 vg/kg scAAV9-CBA-hNAGLUop vector at age 1 month or 6 months, and were tested for behavior in a hidden task and swimming ability in Morris water maze at age 8 months (A). Subsets of animals were observed for longevity (B). WT and non-treated MPS IIIB mice were used as controls. m/m: injection age/testing age.

(10) FIGS. 10A-10B show bio-distribution of systemically delivered rAAV9-CBA-hNAGLU.sup.op. MPS IIIAB mice were treated by an IV injection of 110.sup.13 vg/kg (A) or 210.sup.13 vg/kg (B) rAAV9-CBA-hNAGLU.sup.op at age 1 month (A, B), 3 months (B), or 6 months (B). Tissues were assayed by qPCR at different time points pi. Data expressed as vector genome per diploid genome (vg/dg). <0.01 vg/dg was detected in tissue in non-treated mice. NT: non-treated mice; m/m: injection age/testing time.

DETAILED DESCRIPTION OF THE INVENTION

(11) The present invention will now be described with reference to the accompanying drawings, in which preferred embodiments of the invention are shown. This invention may, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

(12) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

(13) Nucleotide sequences are presented herein by single strand only, in the 5 to 3 direction, from left to right, unless specifically indicated otherwise. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three letter code, both in accordance with 37 CFR 1.822 and established usage. See, e.g., Patent In User Manual, 99-102 (November 1990) (U.S. Patent and Trademark Office).

(14) Except as otherwise indicated, standard methods known to those skilled in the art may be used for the construction of recombinant parvovirus and AAV (rAAV) constructs, packaging vectors expressing the parvovirus Rep and/or Cap sequences, and transiently and stably transfected packaging cells. Such techniques are known to those skilled in the art. See, e.g., SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed. (Cold Spring Harbor, NY, 1989); AUSUBEL et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).

(15) Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted.

(16) [To illustrate further, if, for example, the specification indicates that a particular amino acid can be selected from A, G, I, L and/or V, this language also indicates that the amino acid can be selected from any subset of these amino acid(s) for example A, G, I or L; A, G, I or V; A or G; only L; etc. as if each such subcombination is expressly set forth herein. Moreover, such language also indicates that one or more of the specified amino acids can be disclaimed. For example, in particular embodiments the amino acid is not A, G or I; is not A; is not G or V; etc. as if each such possible disclaimer is expressly set forth herein.

Definitions

(17) The following terms are used in the description herein and the appended claims.

(18) The singular forms a and an are intended to include the plural forms as well, unless the context clearly indicates otherwise.

(19) Furthermore, the term about, as used herein when referring to a measurable value such as an amount of the length of a polynucleotide or polypeptide sequence, dose, time, temperature, and the like, is meant to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.

(20) Also as used herein, and/or refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).

(21) As used herein, the transitional phrase consisting essentially of is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention (e.g., rAAV replication). Thus, the term consisting essentially of as used herein should not be interpreted as equivalent to comprising.

(22) The term consists essentially of (and grammatical variants), as applied to a polynucleotide or polypeptide sequence of this invention, means a polynucleotide or polypeptide that consists of both the recited sequence (e.g., SEQ ID NO) and a total of ten or less (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional nucleotides or amino acids on the 5 and/or 3 or N-terminal and/or C-terminal ends of the recited sequence such that the function of the polynucleotide or polypeptide is not materially altered. The total of ten or less additional nucleotides or amino acids includes the total number of additional nucleotides or amino acids on both ends added together. The term materially altered, as applied to polynucleotides of the invention, refers to an increase or decrease in ability to express the encoded polypeptide of at least about 50% or more as compared to the expression level of a polynucleotide consisting of the recited sequence. The term materially altered, as applied to polypeptides of the invention, refers to an increase or decrease in enzymatic activity of at least about 50% or more as compared to the activity of a polypeptide consisting of the recited sequence.

(23) The term parvovirus as used herein encompasses the family Parvoviridae, including autonomously-replicating parvoviruses and dependoviruses. The autonomous parvoviruses include members of the genera Parvovirus, Erythrovirus, Densovirus, Iteravirus, and Contravirus. Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mouse, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, H1 parvovirus, muscovy duck parvovirus, snake parvovirus, and B19 virus. Other autonomous parvoviruses are known to those skilled in the art. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).

(24) The genus Dependovirus contains the adeno-associated viruses (AAV), including but not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, avian AAV, bovine AAV, canine AAV, goat AAV, snake AAV, equine AAV, and ovine AAV. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers); and Table 1.

(25) As used herein, the term adeno-associated virus (AAV), includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, and any other AAV now known or later discovered. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). A number of relatively new AAV serotypes and clades have been identified (See, e.g., Gao et al., (2004) J. Virol. 78:6381; Moris et al., (2004) Virol. 33-:375; and Table 1).

(26) The parvovirus vectors, particles, and genomes of the present invention can be from, but are not limited to, AAV. The genomic sequences of various serotypes of AAV and the autonomous parvoviruses, as well as the sequences of the native ITRs, Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank. See, e.g., GenBank Accession Numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC_001701, NC_001510, NC_006152, NC_006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, AY631966, AX753250, EU285562, NC_001358, NC_001540, AF513851, AF513852 and AY530579; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences. See also, e.g., Bantel-Schaal et al., (1999) J. Virol. 73: 939; Chiorini et al., (1997) J. Virol. 71:6823; Chiorini et al., (1999) J Virol. 73:1309; Gao et al., (2002) Proc. Nat. Acad. Sci. USA 99:11854; Moris et al., (2004) Virol. 33-:375-383; Mori et al., (2004) Virol. 330:375; Muramatsu et al., (1996) Virol. 221:208; Ruffing et al., (1994) J. Gen. Virol. 75:3385; Rutledge et al., (1998) J. Virol. 72:309; Schmidt et al., (2008) J. Virol. 82:8911; Shade et al., (1986) J Virol. 58:921; Srivastava et al., (1983) J. Virol. 45:555; Xiao et al., (1999) J. Virol. 73:3994; international patent publications WO 00/28061, WO 99/61601, WO 98/11244; and U.S. Pat. No. 6,156,303; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences. See also Table 1. An early description of the AAV1, AAV2 and AAV3 ITR sequences is provided by Xiao, X., (1996), Characterization of Adeno-associated virus (AAV) DNA replication and integration, Ph.D. Dissertation, University of Pittsburgh, Pittsburgh, PA (incorporated herein in its entirety).

(27) The term tropism as used herein refers to entry of the virus into the cell, optionally and preferably followed by expression (e.g., transcription and, optionally, translation) of sequences carried by the viral genome in the cell, e.g., for a recombinant virus, expression of the heterologous nucleotide sequences(s). Those skilled in the art will appreciate that transcription of a heterologous nucleic acid sequence from the viral genome may not be initiated in the absence of trans-acting factors, e.g., for an inducible promoter or otherwise regulated nucleic acid sequence. In the case of AAV, gene expression from the viral genome may be from a stably integrated provirus, from a non-integrated episome, as well as any other form in which the virus may take within the cell.

(28) As used herein, transduction of a cell by parvovirus or AAV refers to parvovirus/AAV-mediated transfer of genetic material into the cell. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapter 69 (3d ed., Lippincott-Raven Publishers).

(29) The terms 5 portion and 3 portion are relative terms to define a spatial relationship between two or more elements. Thus, for example, a 3 portion of a polynucleotide indicates a segment of the polynucleotide that is downstream of another segment. The term 3 portion is not intended to indicate that the segment is necessarily at the 3 end of the polynucleotide, or even that it is necessarily in the 3 half of the polynucleotide, although it may be. Likewise, a 5 portion of a polynucleotide indicates a segment of the polynucleotide that is upstream of another segment. The term 5 portion is not intended to indicate that the segment is necessarily at the 5 end of the polynucleotide, or even that it is necessarily in the 5 half of the polynucleotide, although it may be.

(30) TABLE-US-00001 TABLE 1 GenBank AAV Accession Serotypes/Isolates Number Clonal Isolates Avian AAV ATCC AY186198, VR-865 AY629583, NC_004828 Avian AAV strain NC_006263, DA-1 AY629583 Bovine AAV NC_005889, AY388617 AAV4 NC_001829 AAV5 AY18065, AF085716 Rh34 AY243001 Rh33 AY243002 Rh32 AY243003 AAV10 AY631965 AAV11 AY631966 AAV12 DQ813647 AAV13 EU285562 Clade A AAV1 NC_002077, AF063497 AAV6 NC_001862 Hu.48 AY530611 Hu 43 AY530606 Hu 44 AY530607 Hu 46 AY530609 Clade B Hu19 AY530584 Hu20 AY530586 Hu23 AY530589 Hu22 AY530588 Hu24 AY530590 Hu21 AY530587 Hu27 AY530592 Hu28 AY530593 Hu29 AY530594 Hu63 AY530624 Hu64 AY530625 Hu13 AY530578 Hu56 AY530618 Hu57 AY530619 Hu49 AY530612 Hu58 AY530620 Hu34 AY530598 Hu35 AY530599 AAV2 NC_001401 Hu45 AY530608 Hu47 AY530610 Hu51 AY530613 Hu52 AY530614 Hu T41 AY695378 Hu S17 AY695376 Hu T88 AY695375 Hu T71 AY695374 Hu T70 AY695373 Hu T40 AY695372 Hu T32 AY695371 Hu T17 AY695370 Hu LG15 AY695377 Clade C AAV 3 NC_001729 AAV 3B NC_001863 Hu9 AY530629 Hu10 AY530576 Hu11 AY530577 Hu53 AY530615 Hu55 AY530617 Hu54 AY530616 Hu7 AY530628 Hu18 AY530583 Hu15 AY530580 Hu16 AY530581 Hu25 AY530591 Hu60 AY530622 Ch5 AY243021 Hu3 AY530595 Hu1 AY530575 Hu4 AY530602 Hu2 AY530585 Hu61 AY530623 Clade D Rh62 AY530573 Rh48 AY530561 Rh54 AY530567 Rh55 AY530568 Cy2 AY243020 AAV7 AF513851 Rh35 AY243000 Rh37 AY242998 Rh36 AY242999 Cy6 AY243016 Cy4 AY243018 Cy3 AY243019 Cy5 AY243017 Rh13 AY243013 Clade E Rh38 AY530558 Hu66 AY530626 Hu42 AY530605 Hu67 AY530627 Hu40 AY530603 Hu41 AY530604 Hu37 AY530600 Rh40 AY530559 Rh2 AY243007 Bb1 AY243023 Bb2 AY243022 Rh10 AY243015 Hu17 AY530582 Hu6 AY530621 Rh25 AY530557 Pi2 AY530554 Pi1 AY530553 Pi3 AY530555 Rh57 AY530569 Rh50 AY530563 Rh49 AY530562 Hu39 AY530601 Rh58 AY530570 Rh61 AY530572 Rh52 AY530565 Rh53 AY530566 Rh51 AY530564 Rh64 AY530574 Rh43 AY530560 AAV8 AF513852 Rh8 AY242997 Rh1 AY530556 Clade F AAV9 (Hu14) AY530579 Hu31 AY530596 Hu32 AY530597

(31) As used herein, the term polypeptide encompasses both peptides and proteins, unless indicated otherwise.

(32) A polynucleotide is a sequence of nucleotide bases, and may be RNA, DNA or DNA-RNA hybrid sequences (including both naturally occurring and non-naturally occurring nucleotides), and can be either single or double stranded DNA sequences.

(33) The term codon-optimized, as used herein, refers to a gene coding sequence that has been optimized to increase expression by substituting one or more codons normally present in a coding sequence (for example, in a wildtype sequence, including, e.g., a coding sequence for NAGLU) with a codon for the same (synonymous) amino acid. In this manner, the protein encoded by the gene is identical, but the underlying nucleobase sequence of the gene or corresponding mRNA is different. In some embodiments, the optimization substitutes one or more rare codons (that is, codons for tRNA that occur relatively infrequently in cells from a particular species) with synonymous codons that occur more frequently to improve the efficiency of translation. For example, in human codon-optimization one or more codons in a coding sequence are replaced by codons that occur more frequently in human cells for the same amino acid. Codon optimization can also increase gene expression through other mechanisms that can improve efficiency of transcription and/or translation. Strategies include, without limitation, increasing total GC content (that is, the percent of guanines and cytosines in the entire coding sequence), decreasing CpG content (that is, the number of CG or GC dinucleotides in the coding sequence), removing cryptic splice donor or acceptor sites, and/or adding or removing ribosomal entry sites, such as Kozak sequences. Desirably, a codon-optimized gene exhibits improved protein expression, for example, the protein encoded thereby is expressed at a detectably greater level in a cell compared with the level of expression of the protein provided by the wildtype gene in an otherwise similar cell.

(34) The term sequence identity, as used herein, has the standard meaning in the art. As is known in the art, a number of different programs can be used to identify whether a polynucleotide or polypeptide has sequence identity or similarity to a known sequence. Sequence identity or similarity may be determined using standard techniques known in the art, including, but not limited to, the local sequence identity algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the sequence identity alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, WI), the Best Fit sequence program described by Devereux et al., Nucl. Acid Res. 12:387 (1984), preferably using the default settings, or by inspection.

(35) An example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351 (1987); the method is similar to that described by Higgins & Sharp, CABIOS 5:151 (1989).

(36) Another example of a useful algorithm is the BLAST algorithm, described in Altschul et al., J. Mol. Biol. 215:403 (1990) and Karlin et al., Proc. Natl. Acad. Sci. USA 90:5873 (1993). A particularly useful BLAST program is the WU-BLAST-2 program which was obtained from Altschul et al., Meth. Enzymol., 266:460 (1996); blast.wustl/edu/blast/README.html. WU-BLAST-2 uses several search parameters, which are preferably set to the default values. The parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity.

(37) An additional useful algorithm is gapped BLAST as reported by Altschul et al., Nucleic Acids Res. 25:3389 (1997).

(38) A percentage amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the longer sequence in the aligned region. The longer sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored).

(39) In a similar manner, percent nucleic acid sequence identity is defined as the percentage of nucleotide residues in the candidate sequence that are identical with the nucleotides in the polynucleotide specifically disclosed herein.

(40) The alignment may include the introduction of gaps in the sequences to be aligned. In addition, for sequences which contain either more or fewer nucleotides than the polynucleotides specifically disclosed herein, it is understood that in one embodiment, the percentage of sequence identity will be determined based on the number of identical nucleotides in relation to the total number of nucleotides. Thus, for example, sequence identity of sequences shorter than a sequence specifically disclosed herein, will be determined using the number of nucleotides in the shorter sequence, in one embodiment. In percent identity calculations relative weight is not assigned to various manifestations of sequence variation, such as insertions, deletions, substitutions, etc.

(41) In one embodiment, only identities are scored positively (+1) and all forms of sequence variation including gaps are assigned a value of 0, which obviates the need for a weighted scale or parameters as described below for sequence similarity calculations. Percent sequence identity can be calculated, for example, by dividing the number of matching identical residues by the total number of residues of the shorter sequence in the aligned region and multiplying by 100. The longer sequence is the one having the most actual residues in the aligned region.

(42) As used herein, an isolated polynucleotide (e.g., an isolated DNA or an isolated RNA) means a polynucleotide separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polynucleotide.

(43) Likewise, an isolated polypeptide means a polypeptide that is separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide.

(44) A therapeutic polypeptide is a polypeptide that may alleviate or reduce symptoms that result from an absence or defect in a protein in a cell or subject. Alternatively, a therapeutic polypeptide is one that otherwise confers a benefit to a subject, e.g., anti-cancer effects or improvement in transplant survivability.

(45) As used herein, the term modified, as applied to a polynucleotide or polypeptide sequence, refers to a sequence that differs from a wild-type sequence due to one or more deletions, additions, substitutions, or any combination thereof.

(46) As used herein, by isolate or purify (or grammatical equivalents) a virus vector, it is meant that the virus vector is at least partially separated from at least some of the other components in the starting material.

(47) By the terms treat, treating, or treatment of (and grammatical variations thereof) it is meant that the severity of the subject's condition is reduced, at least partially improved or stabilized and/or that some alleviation, mitigation, decrease or stabilization in at least one clinical symptom is achieved and/or there is a delay in the progression of the disease or disorder.

(48) The terms prevent, preventing, and prevention (and grammatical variations thereof) refer to prevention and/or delay of the onset of a disease, disorder and/or a clinical symptom(s) in a subject and/or a reduction in the severity of the onset of the disease, disorder and/or clinical symptom(s) relative to what would occur in the absence of the methods of the invention. The prevention can be complete, e.g., the total absence of the disease, disorder and/or clinical symptom(s). The prevention can also be partial, such that the occurrence of the disease, disorder and/or clinical symptom(s) in the subject and/or the severity of onset is less than what would occur in the absence of the present invention.

(49) A treatment effective amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject. Alternatively stated, a treatment effective amount is an amount that will provide some alleviation, mitigation, decrease or stabilization in at least one clinical symptom in the subject. Those skilled in the art will appreciate that the therapeutic effects need not be complete or curative, as long as some benefit is provided to the subject.

(50) A prevention effective amount as used herein is an amount that is sufficient to prevent and/or delay the onset of a disease, disorder and/or clinical symptoms in a subject and/or to reduce and/or delay the severity of the onset of a disease, disorder and/or clinical symptoms in a subject relative to what would occur in the absence of the methods of the invention. Those skilled in the art will appreciate that the level of prevention need not be complete, as long as some benefit is provided to the subject.

(51) The terms heterologous nucleotide sequence and heterologous nucleic acid are used interchangeably herein and refer to a sequence that is not naturally occurring in the virus. In some embodiments, the heterologous nucleic acid comprises an open reading frame that encodes a polypeptide or nontranslated RNA of interest (e.g., for delivery to a cell or subject).

(52) As used herein, the terms virus vector, vector or gene delivery vector refer to a virus (e.g., AAV) particle that functions as a nucleic acid delivery vehicle, and which comprises the vector genome (e.g., viral DNA [vDNA]) packaged within a virion. Alternatively, in some contexts, the term vector may be used to refer to the vector genome/vDNA alone or a plasmid.

(53) The virus vectors of the invention can further be duplexed parvovirus particles as described in international patent publication WO 01/92551 (the disclosure of which is incorporated herein by reference in its entirety). Thus, in some embodiments, double stranded (duplex) genomes can be packaged.

(54) A rAAV vector genome or rAAV genome is an AAV genome (i.e., vDNA) that comprises one or more heterologous nucleic acid sequences. rAAV vectors generally require only the 145 base ITR in cis to generate virus. All other viral sequences are dispensable and may be supplied in trans (Muzyczka (1992) Curr. Topics Microbiol. Immunol. 158:97). Typically, the rAAV vector genome will only retain the one or more ITR sequence so as to maximize the size of the transgene that can be efficiently packaged by the vector. The structural and non-structural protein coding sequences may be provided in trans (e.g., from a vector, such as a plasmid, or by stably integrating the sequences into a packaging cell). In embodiments of the invention the rAAV vector genome comprises at least one ITR sequence (e.g., AAV ITR sequence), optionally two ITRs (e.g., two AAV ITRs), which typically will be at the 5 and 3 ends of the vector genome and flank the heterologous nucleic acid, but need not be contiguous thereto. The ITRs can be the same or different from each other.

(55) The term terminal repeat or TR includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (i.e., mediates the desired functions such as replication, virus packaging, integration and/or provirus rescue, and the like). The ITR can be an AAV ITR or a non-AAV ITR. For example, a non-AAV ITR sequence such as those of other parvoviruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19) or the SV40 hairpin that serves as the origin of SV40 replication can be used as an ITR, which can further be modified by truncation, substitution, deletion, insertion and/or addition. Further, the ITR can be partially or completely synthetic, such as the double-D sequence as described in U.S. Pat. No. 5,478,745 to Samulski et al.

(56) Parvovirus genomes have palindromic sequences at both their 5 and 3 ends. The palindromic nature of the sequences leads to the formation of a hairpin structure that is stabilized by the formation of hydrogen bonds between the complementary base pairs. This hairpin structure is believed to adopt a Y or a T shape. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

(57) An AAV inverted terminal repeat or AAV ITR may be from any AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, or any other AAV now known or later discovered (see, e.g., Table 1). An AAV ITR need not have the native terminal repeat sequence (e.g., a native AAV ITR sequence may be altered by insertion, deletion, truncation and/or missense mutations), as long as the terminal repeat mediates the desired functions, e.g., replication, virus packaging, persistence, and/or provirus rescue, and the like.

(58) The virus vectors of the invention can further be targeted virus vectors (e.g., having a directed tropism) and/or a hybrid parvovirus (i.e., in which the viral ITRs and viral capsid are from different parvoviruses) as described in international patent publication WO 00/28004 and Chao et al., (2000) Mol. Therapy 2:619.

(59) Further, the viral capsid or genomic elements can contain other modifications, including insertions, deletions and/or substitutions.

(60) The term template or substrate is used herein to refer to a polynucleotide sequence that may be replicated to produce the parvovirus viral DNA. For the purpose of vector production, the template will typically be embedded within a larger nucleotide sequence or construct, including but not limited to a plasmid, naked DNA vector, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC) or a viral vector (e.g., adenovirus, herpesvirus, Epstein-Barr Virus, AAV, baculoviral, retroviral vectors, and the like). Alternatively, the template may be stably incorporated into the chromosome of a packaging cell.

(61) As used herein, parvovirus or AAV Rep coding sequences indicate the nucleic acid sequences that encode the parvoviral or AAV non-structural proteins that mediate viral replication and the production of new virus particles. The parvovirus and AAV replication genes and proteins have been described in, e.g., FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

(62) The Rep coding sequences need not encode all of the parvoviral or AAV Rep proteins. For example, with respect to AAV, the Rep coding sequences do not need to encode all four AAV Rep proteins (Rep78, Rep 68, Rep52 and Rep40), in fact, it is believed that AAV5 only expresses the spliced Rep68 and Rep40 proteins. In representative embodiments, the Rep coding sequences encode at least those replication proteins that are necessary for viral genome replication and packaging into new virions. The Rep coding sequences will generally encode at least one large Rep protein (i.e., Rep78/68) and one small Rep protein (i.e., Rep52/40). In particular embodiments, the Rep coding sequences encode the AAV Rep78 protein and the AAV Rep52 and/or Rep40 proteins. In other embodiments, the Rep coding sequences encode the Rep68 and the Rep52 and/or Rep40 proteins. In a still further embodiment, the Rep coding sequences encode the Rep68 and Rep52 proteins, Rep68 and Rep40 proteins, Rep78 and Rep52 proteins, or Rep78 and Rep40 proteins.

(63) As used herein, the term large Rep protein refers to Rep68 and/or Rep78. Large Rep proteins of the claimed invention may be either wild-type or synthetic. A wild-type large Rep protein may be from any parvovirus or AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, or any other AAV now known or later discovered (see, e.g., Table 1). A synthetic large Rep protein may be altered by insertion, deletion, truncation and/or missense mutations.

(64) Those skilled in the art will further appreciate that it is not necessary that the replication proteins be encoded by the same polynucleotide. For example, for MVM, the NS-1 and NS-2 proteins (which are splice variants) may be expressed independently of one another. Likewise, for AAV, the p19 promoter may be inactivated and the large Rep protein(s) expressed from one polynucleotide and the small Rep protein(s) expressed from a different polynucleotide. Typically, however, it will be more convenient to express the replication proteins from a single construct. In some systems, the viral promoters (e.g., AAV p19 promoter) may not be recognized by the cell, and it is therefore necessary to express the large and small Rep proteins from separate expression cassettes. In other instances, it may be desirable to express the large Rep and small Rep proteins separately, i.e., under the control of separate transcriptional and/or translational control elements. For example, it may be desirable to control expression of the large Rep proteins, so as to decrease the ratio of large to small Rep proteins. In the case of insect cells, it may be advantageous to down-regulate expression of the large Rep proteins (e.g., Rep78/68) to avoid toxicity to the cells (see, e.g., Urabe et al., (2002) Human Gene Therapy 13:1935).

(65) As used herein, the parvovirus or AAV cap coding sequences encode the structural proteins that form a functional parvovirus or AAV capsid (i.e., can package DNA and infect target cells). Typically, the cap coding sequences will encode all of the parvovirus or AAV capsid subunits, but less than all of the capsid subunits may be encoded as long as a functional capsid is produced. Typically, but not necessarily, the cap coding sequences will be present on a single nucleic acid molecule.

(66) The capsid structure of autonomous parvoviruses and AAV are described in more detail in BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

(67) Parvovirus Vectors Expressing NAGLU

(68) The present invention provides parvovirus vectors, e.g., AAV vectors, that comprise a nucleotide sequence encoding NAGLU that is codon-optimized for expression in human cells and are capable of provided enhanced expression and secretion of NAGLU from cells infected with the vector.

(69) One aspect of the invention relates to a recombinant nucleic acid comprising, consisting essentially of, or consisting of a nucleotide sequence encoding human -N-acetylglucosaminidase (NAGLU) that is codon-optimized for expression in human cells. In certain embodiments, the nucleic acid is a non-naturally occurring sequence. In some embodiments, the nucleic acid comprises, consists essentially of, or consists of a nucleotide sequence that is at least 90% identical to SEQ ID NO:1, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:1. In some embodiments, the nucleic acid comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:1. In some embodiments, the nucleic acid comprises at least 10 contiguous nucleotides of SEQ ID NO:1, e.g., at least 10, 25, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100 or more.

(70) TABLE-US-00002 SEQIDNO:1 1 ATGGAGGCTGTTGCTGTTGCAGCCGCTGTGGGCGTCTTGCTGTTGGCCGG 51 TGCCGGGGGAGCTGCTGGCGACGAGGCAAGGGAAGCTGCAGCTGTGCGGG 101 CTCTCGTCGCAAGGTTGCTGGGTCCAGGTCCCGCTGCTGACTTTAGTGTG 151 TCAGTGGAGAGGGCTTTGGCCGCTAAACCTGGCCTGGACACCTACTCCCT 201 GGGTGGAGGTGGGGCTGCCCGCGTGAGGGTGAGAGGCTCAACGGGGGTGG 251 CTGCTGCAGCAGGTCTGCATAGGTACCTCAGAGACTTCTGCGGATGCCAT 301 GTCGCTTGGAGCGGCAGTCAACTGAGGCTGCCCCGGCCCCTCCCTGCCGT 351 CCCTGGGGAACTTACAGAAGCTACTCCAAATAGGTACAGATATTATCAAA 401 ATGTGTGTACGCAGAGTTACAGCTTTGTGTGGTGGGACTGGGCAAGGTGG 451 GAGCGCGAAATCGATTGGATGGCCCTCAACGGGATCAATCTGGCCTTGGC 501 ATGGTCCGGACAGGAAGCTATCTGGCAGCGCGTGTATCTGGCTCTCGGGT 551 TGACTCAAGCTGAAATCAACGAGTTTTTCACAGGCCCCGCCTTCCTGGCC 601 TGGGGGCGGATGGGTAATCTTCATACTTGGGACGGGCCACTGCCCCCCTC 651 TTGGCACATCAAACAGTTGTATCTGCAGCACCGCGTCCTGGACCAGATGC 701 GCAGCTTCGGCATGACTCCCGTCCTGCCGGCTTTCGCAGGGCACGTCCCA 751 GAGGCGGTCACACGGGTCTTCCCTCAGGTGAATGTGACAAAAATGGGATC 801 ATGGGGACATTTCAATTGTTCTTACAGTTGTTCCTTCCTGCTGGCACCCG 851 AAGATCCTATCTTCCCAATCATAGGAAGTCTCTTTCTGCGCGAGTTGATT 901 AAGGAGTTCGGTACTGATCACATTTATGGCGCTGATACTTTTAACGAAAT 951 GCAGCCCCCCTCTTCTGAACCATCCTATCTTGCTGCCGCAACCACTGCCG 1001 TTTATGAAGCCATGACCGCCGTGGACACTGAAGCCGTTTGGCTTCTCCAA 1051 GGTTGGCTGTTCCAGCACCAGCCTCAGTTTTGGGGGCCAGCTCAGATAAG 1101 AGCCGTTCTCGGCGCTGTACCTCGCGGAAGACTGCTGGTGCTTGATTTGT 1151 TCGCAGAGTCTCAGCCAGTGTACACGAGAACCGCTTCCTTCCAGGGCCAG 1201 CCGTTTATTTGGTGTATGCTTCACAATTTTGGCGGAAATCATGGGCTGTT 1251 CGGTGCCCTGGAGGCGGTCAATGGGGGACCTGAGGCTGCAAGATTGTTCC 1301 CAAACTCAACCATGGTGGGGACCGGAATGGCACCCGAAGGCATTAGCCAG 1351 AATGAGGTCGTCTACAGTCTGATGGCGGAATTGGGGTGGCGGAAGGACCC 1401 CGTGCCAGATCTCGCCGCCTGGGTGACTAGCTTTGCCGCCCGCCGCTATG 1451 GAGTGAGCCATCCTGATGCAGGCGCAGCCTGGCGGCTGTTGCTTCGATCA 1501 GTATACAATTGTTCAGGAGAGGCCTGCCGGGGGCACAATAGGAGCCCACT 1551 GGTAAGGAGGCCCAGCCTGCAGATGAACACCTCTATCTGGTACAACAGAA 1601 GCGATGTTTTCGAGGCTTGGAGACTTCTCCTTACATCTGCCCCTAGCTTG 1651 GCCACCAGTCCAGCCTTCCGATATGATCTGCTGGACCTCACCCGACAGGC 1701 CGTGCAGGAACTGGTCTCTCTCTACTATGAAGAGGCCAGATCAGCTTACC 1751 TCTCTAAAGAACTGGCCTCCCTCTTGCGAGCAGGAGGCGTCCTGGCATAT 1801 GAGCTGCTCCCTGCACTGGACGAGGTACTGGCATCTGATTCCCGATTCCT 1851 GCTCGGGTCATGGCTGGAGCAAGCCCGAGCAGCGGCTGTAAGCGAGGCTG 1901 AAGCAGACTTCTATGAACAAAATAGTAGGTATCAACTGACTCTGTGGGGT 1951 CCAGAGGGGAATATCCTGGACTACGCGAACAAACAGTTGGCGGGCCTGGT 2001 GGCCAACTACTACACCCCTCGGTGGAGATTGTTTTTGGAGGCGCTGGTGG 2051 ATTCAGTCGCACAGGGGATTCCGTTTCAGCAACATCAGTTTGACAAGAAC 2101 GTCTTTCAGCTGGAACAGGCTTTTGTGCTTTCTAAGCAGCGCTACCCTTC 2151 TCAGCCAAGAGGCGATACCGTTGACCTCGCGAAGAAAATCTTTCTCAAGT 2201 ACTATCCCAGATGGGTGGCCGGATCATGGTAG

(71) Methods of codon optimizing a nucleotide sequence to maximize expression in an organism are well known in the art and can be carried out using software available to the public. The wild-type sequence of human NAGLU is known in the art and shown in SEQ ID NO:2.

(72) TABLE-US-00003 SEQIDNO:2 1 ATGGAGGCGGTGGCGGTGGCCGCGGCGGTGGGGGTCCTTCTCCTGGCCGG 51 GGCCGGGGGCGCGGCAGGCGACGAGGCCCGGGAGGCGGCGGCCGTGCGGG 101 CGCTCGTGGCCCGGCTGCTGGGGCCAGGCCCCGCGGCCGACTTCTCCGTG 151 TCGGTGGAGCGCGCTCTGGCTGCCAAGCCGGGCTTGGACACCTACAGCCT 201 GGGCGGCGGCGGCGCGGCGCGCGTGCGGGTGCGCGGCTCCACGGGCGTGG 251 CGGCCGCCGCGGGGCTGCACCGCTACCTGCGCGACTTCTGTGGCTGCCAC 301 GTGGCCTGGTCCGGCTCTCAGCTGCGCCTGCCGCGGCCACTGCCAGCCGT 351 GCCGGGGGAGCTGACCGAGGCCACGCCCAACAGGTACCGCTATTACCAGA 401 ATGTGTGCACGCAAAGCTACTCCTTCGTGTGGTGGGACTGGGCCCGCTGG 451 GAGCGAGAGATAGACTGGATGGCGCTGAATGGCATCAACCTGGCACTGGC 501 CTGGAGCGGCCAGGAGGCCATCTGGCAGCGGGTGTACCTGGCCTTGGGCC 551 TGACCCAGGCAGAGATCAATGAGTTCTTTACTGGTCCTGCCTTCCTGGCC 601 TGGGGGCGAATGGGCAACCTGCACACCTGGGATGGCCCCCTGCCCCCCTC 651 CTGGCACATCAAGCAGCTTTACCTGCAGCACCGGGTCCTGGACCAGATGC 701 GCTCCTTCGGCATGACCCCAGTGCTGCCTGCATTCGCGGGGCATGTTCCC 751 GAGGCTGTCACCAGGGTGTTCCCTCAGGTCAATGTCACGAAGATGGGCAG 801 TTGGGGCCACTTTAACTGTTCCTACTCCTGCTCCTTCCTTCTGGCTCCGG 851 AAGACCCCATATTCCCCATCATCGGGAGCCTCTTCCTGCGAGAGCTGATC 901 AAAGAGTTTGGCACAGACCACATCTATGGGGCCGACACTTTCAATGAGAT 951 GCAGCCACCTTCCTCAGAGCCCTCCTACCTTGCCGCAGCCACCACTGCCG 1001 TCTATGAGGCCATGACTGCAGTGGATACTGAGGCTGTGTGGCTGCTCCAA 1051 GGCTGGCTCTTCCAGCACCAGCCGCAGTTCTGGGGGCCCGCCCAGATCAG 1101 GGCTGTGCTGGGAGCTGTGCCCCGTGGCCGCCTCCTGGTTCTGGACCTGT 1151 TTGCTGAGAGCCAGCCTGTGTATACCGGCACTGCCTCCTTCCAGGGCCAG 1201 CCCTTCATCTGGTGCATGCTGCACAACTTTGGGGGAAACCATGGTCTTTT 1251 TGGAGCCCTAGAGGCTGTGAACGGAGGCCCAGAAGCTGCCCGCCTCTTCC 1301 CCAACTCCACCATGGTAGGCACGGGCATGGCCCCCGAGGGCATCAGCCAG 1351 AACGAAGTGGTCTATTCCCTCATGGCTGAGCTGGGCTGGCGAAAGGACCC 1401 AGTGCCAGATTTGGCAGCCTGGGTGACCAGCTTTGCCGCCCGGCGGTATG 1451 GGGTCTCCCACCCGGACGCAGGGGCAGCGTGGAGGCTACTGCTCCGGAGT 1501 GTGTACAACTGCTCCGGGGAGGCCTGCAGGGGCCACAATCGTAGCCCGCT 1551 GGTCAGGCGGCCGTCCCTACAGATGAATACCAGCATCTGGTACAACCGAT 1601 CTGATGTGTTTGAGGCCTGGCGGCTGCTGCTCACATCTGCTCCCTCCCTG 1651 GCCACCAGCCCCGCCTTCCGCTACGACCTGCTGGACCTCACTCGGCAGGC 1701 AGTGCAGGAGCTGGTCAGCTTGTACTATGAGGAGGCAAGAAGCGCCTACC 1751 TGAGCAAGGAGCTGGCCTCCCTGTTGAGGGCTGGAGGCGTCCTGGCCTAT 1801 GAGCTGCTGCCGGCACTGGACGAGGTGCTGGCTAGTGACAGCCGCTTCTT 1851 GCTGGGCAGCTGGCTAGAGCAGGCCCGAGCAGCGGCAGTCAGTGAGGCCG 1901 AGGCCGATTTCTACGAGCAGAACAGCCGCTACCAGCTGACCTTGTGGGGG 1951 CCAGAAGGCAACATCCTGGACTATGCCAACAAGCAGCTGGCGGGGTTGGT 2001 GGCCAACTACTACACCCCTCGCTGGCGGCTTTTCCTGGAGGCGCTGGTTG 2051 ACAGTGTGGCCCAGGGCATCCCTTTCCAACAGGACCAGTTTGACAAAAAT 2101 GTCTTCCAACTGGAGCAGGCCTTCGTTCTCAGCAAGGAGAGGTACCCCAG 2151 CCAGCCGCGAGGAGACACTGTGGACCTGGCCAAGAAGATCTTCCTCAAAT 2201 ATTACCCCGGCTGGGTGGCCGGCTCTTGGTGA

(73) The invention also provides a viral vector genome comprising the NAGLU nucleic acid of the invention. The viral vector genome may be a parvovirus vector genome, e.g., an AAV vector genome. In some embodiments, the AAV vector genome is a self-complementary AAV vector genome. The viral vector genome may further comprise a promoter operably linked to the NAGLU nucleic acid. In some embodiments, the promoter may be a constitutive promoter, e.g., the CBA promoter or the CMV promoter. In other embodiments, the promoter may be a tissue-specific or preferred promoter. The invention further provides a cell in vitro comprising the AAV vector genome of the invention, e.g., stably incorporated into the genome of the cell. The invention further provides a recombinant parvovirus particle (e.g., a recombinant AAV particle, e.g., an AAV9 particle) comprising the viral vector genome of the invention. Viral vectors and viral particles are discussed further below.

(74) In some embodiments, the viral vector genome is encoded by a plasmid. Examples include, without limitation, a plasmid encoding rAAV9-CBA-hNAGLU.sup.op comprising, consisting essentially of, or consisting of SEQ ID NO:3 or a plasmid encoding rAAV9-CMV-hNAGLU.sup.op comprising, consisting essentially of, or consisting of SEQ ID NO:4, or a sequence at least 90% identical to SEQ ID NO:3 or 4, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 or 4.

(75) TABLE-US-00004 pTR-CBA-NAGLU-op SEQIDNO:3 GGGGGGGGGGGGGGGGGGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCG ACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAG AGGGAGTGGCCAACTCCATCACTAGGGGTTCCTAGATCTGGAAGCTGATCTTCAATATTGGCCATT AGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGATATTGGCCATTGCATACGTTGTAT CTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTAT TGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCG TTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAA TAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATT TACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACG TCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTT GGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCA CTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCA GCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGG GGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTT TATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCT GCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACT GACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTT GGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCC TTTGTGCGGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGC GGCCCGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGT GTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGGGAACA AAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTATGGGCGCGGCGGTCGGGCT GTAACCCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCC GTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGTGGGGGTGCCGGG CGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGGGCGCGGCGGCCCCCGGAGCGCC GGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCA GGGACTTACTTTGTCCCAAATCTGTGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAG CGGGCGCGGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCG TCGCCGCGCCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCTT CGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGC TAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTC ATCATTTTGGCAAAGAATTCGATAGGATCCGGTACTCGAGGAACTGAAAAACCAGAAAGTTAACT GGTAAGTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACT GCTCCTCAGTGGATGTTGCCTTTACTTCTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAAAAGCTG CGGAATTGTACCCGCGGCCCGGGATCCACCGGCCACCGGtATTCgcAGACCATGGAGGCTGTTGCTG TTGCAGCCGCTGTGGGCGTCTTGCTGTTGGCCGGTGCCGGGGGAGCTGCTGGCGACGAGGCAAGG GAAGCTGCAGCTGTGCGGGCTCTCGTCGCAAGGTTGCTGGGTCCAGGTCCCGCTGCTGACTTTAGT GTGTCAGTGGAGAGGGCTTTGGCCGCTAAACCTGGCCTGGACACCTACTCCCTGGGTGGAGGTGG GGCTGCCCGCGTGAGGGTGAGAGGCTCAACGGGGGTGGCTGCTGCAGCAGGTCTGCATAGGTACC TCAGAGACTTCTGCGGATGCCATGTCGCTTGGAGCGGCAGTCAACTGAGGCTGCCCCGGCCCCTCC CTGCCGTCCCTGGGGAACTTACAGAAGCTACTCCAAATAGGTACAGATATTATCAAAATGTGTGTA CGCAGAGTTACAGCTTTGTGTGGTGGGACTGGGCAAGGTGGGAGCGCGAAATCGATTGGATGGCC CTCAACGGGATCAATCTGGCCTTGGCATGGTCCGGACAGGAAGCTATCTGGCAGCGCGTGTATCTG GCTCTCGGGTTGACTCAAGCTGAAATCAACGAGTTTTTCACAGGCCCCGCCTTCCTGGCCTGGGGG CGGATGGGTAATCTTCATACTTGGGACGGGCCACTGCCCCCCTCTTGGCACATCAAACAGTTGTAT CTGCAGCACCGCGTCCTGGACCAGATGCGCAGCTTCGGCATGACTCCCGTCCTGCCGGCTTTCGCA GGGCACGTCCCAGAGGCGGTCACACGGGTCTTCCCTCAGGTGAATGTGACAAAAATGGGATCATG GGGACATTTCAATTGTTCTTACAGTTGTTCCTTCCTGCTGGCACCCGAAGATCCTATCTTCCCAATC ATAGGAAGTCTCTTTCTGCGCGAGTTGATTAAGGAGTTCGGTACTGATCACATTTATGGCGCTGAT ACTTTTAACGAAATGCAGCCCCCCTCTTCTGAACCATCCTATCTTGCTGCCGCAACCACTGCCGTTT ATGAAGCCATGACCGCCGTGGACACTGAAGCCGTTTGGCTTCTCCAAGGTTGGCTGTTCCAGCACC AGCCTCAGTTTTGGGGGCCAGCTCAGATAAGAGCCGTTCTCGGCGCTGTACCTCGCGGAAGACTGC TGGTGCTTGATTTGTTCGCAGAGTCTCAGCCAGTGTACACGAGAACCGCTTCCTTCCAGGGCCAGC CGTTTATTTGGTGTATGCTTCACAATTTTGGCGGAAATCATGGGCTGTTCGGTGCCCTGGAGGCCGT CAATGGGGGACCTGAGGCTGCAAGATTGTTCCCAAACTCAACCATGGTGGGGACCGGAATGGCAC CCGAAGGCATTAGCCAGAATGAGGTCGTCTACAGTCTGATGGCGGAATTGGGGTGGCGGAAGGAC CCCGTGCCAGATCTCGCCGCCTGGGTGACTAGCTTTGCCGCCCGCCGCTATGGAGTGAGCCATCCT GATGCAGGCGCAGCCTGGCGGCTGTTGCTTCGATCAGTATACAATTGTTCAGGAGAGGCCTGCCGG GGGCACAATAGGAGCCCACTGGTAAGGAGGCCCAGCCTGCAGATGAACACCTCTATCTGGTACAA CAGAAGCGATGTTTTCGAGGCTTGGAGACTTCTCCTTACATCTGCCCCTAGCTTGGCCACCAGTCC AGCCTTCCGATATGATCTGCTGGACCTCACCCGACAGGCCGTGCAGGAACTGGTCTCTCTCTACTA TGAAGAGGCCAGATCAGCTTACCTCTCTAAAGAACTGGCCTCCCTCTTGCGAGCAGGAGGCGTCCT GGCATATGAGCTGCTCCCTGCACTGGACGAGGTACTGGCATCTGATTCCCGATTCCTGCTCGGGTC ATGGCTGGAGCAAGCCCGAGCAGCGGCTGTAAGCGAGGCTGAAGCAGACTTCTATGAACAAAATA GTAGGTATCAACTGACTCTGTGGGGTCCAGAGGGGAATATCCTGGACTACGCGAACAAACAGTTG GCGGGCCTGGTGGCCAACTACTACACCCCTCGGTGGAGATTGTTTTTGGAGGCGCTGGTGGATTCA GTCGCACAGGGGATTCCGTTTCAGCAACATCAGTTTGACAAGAACGTCTTTCAGCTGGAACAGGCT TTTGTGCTTTCTAAGCAGCGCTACCCTTCTCAGCCAAGAGGCGATACCGTTGACCTCGCGAAGAAA ATCTTTCTCAAGTACTATCCCAGATGGGTGGCCGGATCATGGTAGgtcgacccTCGACTAGAGCTCGCT GATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTT GACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCT GAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAA GACAATAGCAGGCATGCTGGGGAGAGATCTAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCT CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGC CCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACCCCCCCCCCCCCCCCCCTGC AGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGTAGCCTGA ATGGCGAATGGCGCGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGC AGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCG CCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGC TTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTG ATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACT GGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCT ATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTA CAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACT CTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGAC GCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGC TGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACG CCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGA AATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGAC AATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTG TCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAA GTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGG TAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCT ATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTC TCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAA GAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGA TCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATC GTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCA ATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTA ATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTG GTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCC AGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGACCTTCCA GGGTCAAGGAAGCTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTT AATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGT TTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCT GCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCA AGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCT TCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCT GCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCT TGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTT CCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGA GGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTG AGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC TTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTC TGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCG CAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTT GGCCGATTCATTAATGCAGCTGGGCTGCA pTR-CMV-NAGLU-op SEQIDNO:4 GGGGGGGGGGGGGGGGGGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCG ACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAG AGGGAGTGGCCAACTCCATCACTAGGGGTTCCTAGATCTGAATTCGGTACCCGTTACATAACTTAC GGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGT TCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAA ATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTA CGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCG GTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCA AAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGC GTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGC CATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGAGGAT CCGGTACTCGAGGAACTGAAAAACCAGAAAGTTAACTGGTAAGTTTAGTCTTTTTGTCTTTTATTTC AGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTGCTCCTCAGTGGATGTTGCCTTTACTTCT AGGCCTGTACGGAAGTGTTACTTCTGCTCTAAAAGCTGCGGAATTGTACCCGCGGCCCGGGATCCA CCGGCCACCGGtATTCgcAGACCATGGAGGCTGTTGCTGTTGCAGCCGCTGTGGGCGTCTTGCTGTT GGCCGGTGCCGGGGGAGCTGCTGGCGACGAGGCAAGGGAAGCTGCAGCTGTGCGGGCTCTCGTCG CAAGGTTGCTGGGTCCAGGTCCCGCTGCTGACTTTAGTGTGTCAGTGGAGAGGGCTTTGGCCGCTA AACCTGGCCTGGACACCTACTCCCTGGGTGGAGGTGGGGCTGCCCGCGTGAGGGTGAGAGGCTCA ACGGGGGTGGCTGCTGCAGCAGGTCTGCATAGGTACCTCAGAGACTTCTGCGGATGCCATGTCGCT TGGAGCGGCAGTCAACTGAGGCTGCCCCGGCCCCTCCCTGCCGTCCCTGGGGAACTTACAGAAGCT ACTCCAAATAGGTACAGATATTATCAAAATGTGTGTACGCAGAGTTACAGCTTTGTGTGGTGGGAC TGGGCAAGGTGGGAGCGCGAAATCGATTGGATGGCCCTCAACGGGATCAATCTGGCCTTGGCATG GTCCGGACAGGAAGCTATCTGGCAGCGCGTGTATCTGGCTCTCGGGTTGACTCAAGCTGAAATCAA CGAGTTTTTCACAGGCCCCGCCTTCCTGGCCTGGGGGCGGATGGGTAATCTTCATACTTGGGACGG GCCACTGCCCCCCTCTTGGCACATCAAACAGTTGTATCTGCAGCACCGCGTCCTGGACCAGATGCG CAGCTTCGGCATGACTCCCGTCCTGCCGGCTTTCGCAGGGCACGTCCCAGAGGCGGTCACACGGGT CTTCCCTCAGGTGAATGTGACAAAAATGGGATCATGGGGACATTTCAATTGTTCTTACAGTTGTTC CTTCCTGCTGGCACCCGAAGATCCTATCTTCCCAATCATAGGAAGTCTCTTTCTGCGCGAGTTGATT AAGGAGTTCGGTACTGATCACATTTATGGCGCTGATACTTTTAACGAAATGCAGCCCCCCTCTTCT GAACCATCCTATCTTGCTGCCGCAACCACTGCCGTTTATGAAGCCATGACCGCCGTGGACACTGAA GCCGTTTGGCTTCTCCAAGGTTGGCTGTTCCAGCACCAGCCTCAGTTTTGGGGGCCAGCTCAGATA AGAGCCGTTCTCGGCGCTGTACCTCGCGGAAGACTGCTGGTGCTTGATTTGTTCGCAGAGTCTCAG CCAGTGTACACGAGAACCGCTTCCTTCCAGGGCCAGCCGTTTATTTGGTGTATGCTTCACAATTTTG GCGGAAATCATGGGCTGTTCGGTGCCCTGGAGGCCGTCAATGGGGGACCTGAGGCTGCAAGATTG TTCCCAAACTCAACCATGGTGGGGACCGGAATGGCACCCGAAGGCATTAGCCAGAATGAGGTCGT CTACAGTCTGATGGCGGAATTGGGGTGGCGGAAGGACCCCGTGCCAGATCTCGCCGCCTGGGTGA CTAGCTTTGCCGCCCGCCGCTATGGAGTGAGCCATCCTGATGCAGGCGCAGCCTGGCGGCTGTTGC TTCGATCAGTATACAATTGTTCAGGAGAGGCCTGCCGGGGGCACAATAGGAGCCCACTGGTAAGG AGGCCCAGCCTGCAGATGAACACCTCTATCTGGTACAACAGAAGCGATGTTTTCGAGGCTTGGAG ACTTCTCCTTACATCTGCCCCTAGCTTGGCCACCAGTCCAGCCTTCCGATATGATCTGCTGGACCTC ACCCGACAGGCCGTGCAGGAACTGGTCTCTCTCTACTATGAAGAGGCCAGATCAGCTTACCTCTCT AAAGAACTGGCCTCCCTCTTGCGAGCAGGAGGCGTCCTGGCATATGAGCTGCTCCCTGCACTGGAC GAGGTACTGGCATCTGATTCCCGATTCCTGCTCGGGTCATGGCTGGAGCAAGCCCGAGCAGCGGCT GTAAGCGAGGCTGAAGCAGACTTCTATGAACAAAATAGTAGGTATCAACTGACTCTGTGGGGTCC AGAGGGGAATATCCTGGACTACGCGAACAAACAGTTGGCGGGCCTGGTGGCCAACTACTACACCC CTCGGTGGAGATTGTTTTTGGAGGCGCTGGTGGATTCAGTCGCACAGGGGATTCCGTTTCAGCAAC ATCAGTTTGACAAGAACGTCTTTCAGCTGGAACAGGCTTTTGTGCTTTCTAAGCAGCGCTACCCTTC TCAGCCAAGAGGCGATACCGTTGACCTCGCGAAGAAAATCTTTCTCAAGTACTATCCCAGATGGGT GGCCGGATCATGGTAGgtcgacccTCGACTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGC CAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCC TTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTG GGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAGAGATC TAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCC CGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAG AGAGGGAGTGGCCAACCCCCCCCCCCCCCCCCCTGCAGCCAGCTGGCGTAATAGCGAAGAGGCCC GCACCGATCGCCCTTCCCAACAGTTGCGTAGCCTGAATGGCGAATGGCGCGACGCGCCCTGTAGC GGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCT AGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTC TAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTG ATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGG AGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTA TtctTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAA AAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCCTGATGCGGTATTTTCTCCTTAC GCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATA GTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGC ATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATC ACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAAT AATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTT TTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATAT TGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTT GCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTG CACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAG AACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGC CGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGT CACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGA GTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTT TGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATA CCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAAC TGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGC AGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGA GCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTAT CTACACGACGGGGAGTCAGGCAACTATGACCTTCCAGGGTCAAGGAAGCTGTCAGACCAAGTTTA CTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTT TTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTA GAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAA AAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTA ACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCAC TTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCA GTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGG TCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAG ATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATC CGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTA TCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGG GGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCT TTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTG AGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAA GAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGGCTGCA
Methods of Producing Virus Vectors

(76) The present invention further provides methods of producing virus vectors. In one particular embodiment, the present invention provides a method of producing a recombinant parvovirus particle, comprising providing to a cell permissive for parvovirus replication: (a) a recombinant parvovirus template comprising (i) the nucleic acid encoding NAGLU of the invention, and (ii) a parvovirus ITR; (b) a polynucleotide comprising Rep and Cap coding sequences; under conditions sufficient for the replication and packaging of the recombinant parvovirus template; whereby recombinant parvovirus particles are produced in the cell. Conditions sufficient for the replication and packaging of the recombinant parvovirus template can be, e.g., the presence of AAV sequences sufficient for replication of the parvovirus template and encapsidation into parvovirus capsids (e.g., parvovirus rep sequences and parvovirus cap sequences) and helper sequences from adenovirus and/or herpesvirus. In particular embodiments, the parvovirus template comprises two parvovirus ITR sequences, which are located 5 and 3 to the heterologous nucleic acid sequence, although they need not be directly contiguous thereto.

(77) In some embodiments, the recombinant parvovirus template comprises an ITR that is not resolved by Rep to make duplexed AAV vectors as described in international patent publication WO 01/92551.

(78) The parvovirus template and parvovirus rep and cap sequences are provided under conditions such that virus vector comprising the parvovirus template packaged within the parvovirus capsid is produced in the cell. The method can further comprise the step of collecting the virus vector from the cell. The virus vector can be collected from the medium and/or by lysing the cells.

(79) The cell can be a cell that is permissive for parvoviral viral replication. Any suitable cell known in the art may be employed. In particular embodiments, the cell is a mammalian cell (e.g., a primate or human cell). As another option, the cell can be a trans-complementing packaging cell line that provide functions deleted from a replication-defective helper virus, e.g., 293 cells or other E1a trans-complementing cells.

(80) The parvovirus replication and capsid sequences may be provided by any method known in the art. Current protocols typically express the parvovirus rep/cap genes on a single plasmid. The parvovirus replication and packaging sequences need not be provided together, although it may be convenient to do so. The parvovirus rep and/or cap sequences may be provided by any viral or non-viral vector. For example, the rep/cap sequences may be provided by a hybrid adenovirus or herpesvirus vector (e.g., inserted into the E1a or E3 regions of a deleted adenovirus vector). EBV vectors may also be employed to express the parvovirus cap and rep genes. One advantage of this method is that EBV vectors are episomal, yet will maintain a high copy number throughout successive cell divisions (i.e., are stably integrated into the cell as extra-chromosomal elements, designated as an EBV based nuclear episome, see Margolski, (1992) Curr. Top. Microbiol. Immun. 158:67).

(81) As a further alternative, the rep/cap sequences may be stably incorporated into a cell.

(82) Typically the parvovirus rep/cap sequences will not be flanked by the TRs, to prevent rescue and/or packaging of these sequences.

(83) The parvovirus template can be provided to the cell using any method known in the art. For example, the template can be supplied by a non-viral (e.g., plasmid) or viral vector. In particular embodiments, the parvovirus template is supplied by a herpesvirus or adenovirus vector (e.g., inserted into the E1a or E3 regions of a deleted adenovirus). As another illustration, Palombo et al., (1998) J. Virology 72:5025, describes a baculovirus vector carrying a reporter gene flanked by the AAV TRs. EBV vectors may also be employed to deliver the template, as described above with respect to the rep/cap genes.

(84) In another representative embodiment, the parvovirus template is provided by a replicating rAAV virus. In still other embodiments, an AAV provirus comprising the parvovirus template is stably integrated into the chromosome of the cell.

(85) To enhance virus titers, helper virus functions (e.g., adenovirus or herpesvirus) that promote a productive parvovirus infection can be provided to the cell. Helper virus sequences necessary for parvovirus replication are known in the art. Typically, these sequences will be provided by a helper adenovirus or herpesvirus vector. Alternatively, the adenovirus or herpesvirus sequences can be provided by another non-viral or viral vector, e.g., as a non-infectious adenovirus miniplasmid that carries all of the helper genes that promote efficient parvovirus production as described by Ferrari et al., (1997) Nature Med. 3:1295, and U.S. Pat. Nos. 6,040,183 and 6,093,570.

(86) Further, the helper virus functions may be provided by a packaging cell with the helper sequences embedded in the chromosome or maintained as a stable extrachromosomal element. Generally, the helper virus sequences cannot be packaged into AAV virions, e.g., are not flanked by ITRs.

(87) Those skilled in the art will appreciate that it may be advantageous to provide the parvovirus replication and capsid sequences and the helper virus sequences (e.g., adenovirus sequences) on a single helper construct. This helper construct may be a non-viral or viral construct. As one nonlimiting illustration, the helper construct can be a hybrid adenovirus or hybrid herpesvirus comprising the AAV rep/cap genes.

(88) In one particular embodiment, the parvovirus rep/cap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector. This vector can further comprise the parvovirus template. The parvovirus rep/cap sequences and/or the parvovirus template can be inserted into a deleted region (e.g., the E1a or E3 regions) of the adenovirus.

(89) In a further embodiment, the parvovirus rep/cap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector. According to this embodiment, the parvovirus template can be provided as a plasmid template.

(90) In another illustrative embodiment, the parvovirus rep/cap sequences and adenovirus helper sequences are provided by a single adenovirus helper vector, and the parvovirus template is integrated into the cell as a provirus. Alternatively, the parvovirus template is provided by an EBV vector that is maintained within the cell as an extrachromosomal element (e.g., as an EBV based nuclear episome).

(91) In a further exemplary embodiment, the parvovirus rep/cap sequences and adenovirus helper sequences are provided by a single adenovirus helper. The parvovirus template can be provided as a separate replicating viral vector. For example, the parvovirus template can be provided by a parvovirus particle or a second recombinant adenovirus particle.

(92) According to the foregoing methods, the hybrid adenovirus vector typically comprises the adenovirus 5 and 3 cis sequences sufficient for adenovirus replication and packaging (i.e., the adenovirus terminal repeats and PAC sequence). The parvovirus rep/cap sequences and, if present, the AAV template are embedded in the adenovirus backbone and are flanked by the 5 and 3 cis sequences, so that these sequences may be packaged into adenovirus capsids. As described above, the adenovirus helper sequences and the parvovirus rep/cap sequences are generally not flanked by ITRs so that these sequences are not packaged into the parvovirus virions.

(93) Zhang et al., ((2001) Gene Ther. 18:704-12) describe a chimeric helper comprising both adenovirus and the AAV rep and cap genes.

(94) Herpesvirus may also be used as a helper virus in parvovirus packaging methods. Hybrid herpesviruses encoding the parvovirus Rep protein(s) may advantageously facilitate scalable parvovirus vector production schemes. A hybrid herpes simplex virus type I (HSV-1) vector expressing the AAV-2 rep and cap genes has been described (Conway et al., (1999) Gene Ther. 6:986 and WO 00/17377.

(95) As a further alternative, the virus vectors of the invention can be produced in insect cells using baculovirus vectors to deliver the rep/cap genes and parvovirus template as described, for example, by Urabe et al., (2002) Human Gene Ther. 13:1935-43.

(96) Parvovirus vector stocks free of contaminating helper virus may be obtained by any method known in the art. For example, parvovirus and helper virus may be readily differentiated based on size. Parvovirus may also be separated away from helper virus based on affinity for a heparin substrate (Zolotukhin et al., (1999) Gene Therapy 6:973). Deleted replication-defective helper viruses can be used so that any contaminating helper virus is not replication competent. As a further alternative, an adenovirus helper lacking late gene expression may be employed, as only adenovirus early gene expression is required to mediate packaging of parvovirus. Adenovirus mutants defective for late gene expression are known in the art (e.g., ts100K and ts149 adenovirus mutants).

(97) Recombinant Virus Vectors

(98) The virus vectors of the present invention are useful for the delivery of nucleic acids to cells in vitro, ex vivo, and in vivo. In particular, the virus vectors can be advantageously employed to deliver or transfer nucleic acids to animal, including mammalian, cells. In particular, the virus vectors of the present invention are useful for the delivery of a nucleic acid encoding NAGLU to a subject.

(99) It will be understood by those skilled in the art that the nucleic acid encoding NAGLU can be operably associated with appropriate control sequences. For example, the nucleic acid can be operably associated with expression control elements, such as transcription/translation control signals, origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters, and/or enhancers, and the like.

(100) Those skilled in the art will appreciate that a variety of promoter/enhancer elements can be used depending on the level and tissue-specific expression desired. The promoter/enhancer can be constitutive or inducible, depending on the pattern of expression desired. The promoter/enhancer can be native or foreign and can be a natural or a synthetic sequence. By foreign, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced.

(101) In particular embodiments, the promoter/enhancer elements can be native to the target cell or subject to be treated. In representative embodiments, the promoters/enhancer element can be native to the NAGLU nucleic acid sequence. The promoter/enhancer element is generally chosen so that it functions in the target cell(s) of interest. Further, in particular embodiments the promoter/enhancer element is a mammalian promoter/enhancer element. In particular embodiments, the promoter/enhancer element functions in all cells so that NAGLU is expressed systemically. The promoter/enhancer element may be constitutive or inducible.

(102) Inducible expression control elements are typically advantageous in those applications in which it is desirable to provide regulation over expression of the nucleic acid sequence. Inducible promoters/enhancer elements for gene delivery can be tissue-specific or -preferred promoter/enhancer elements, and include neuron specific or preferred promoter/enhancer elements. Other inducible promoter/enhancer elements include hormone-inducible and metal-inducible elements. Exemplary inducible promoters/enhancer elements include, but are not limited to, a Tet on/off element, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, and a metallothionein promoter.

(103) In embodiments wherein the nucleic acid sequence is transcribed and then translated in the target cells, specific initiation signals are generally included for efficient translation of inserted protein coding sequences. These exogenous translational control sequences, which may include the ATG initiation codon and adjacent sequences, can be of a variety of origins, both natural and synthetic.

(104) The virus vectors of the invention can be parvovirus vectors, e.g., AAV vectors. The AAV vectors may be any AAV serotype. In some embodiments, the AAV vector is an AAV2, AAV8, or AAV9 vector. In some embodiments, the AAV vector is a hybrid vector, e.g., one having a capsid protein from one serotype and a genome from another serotype or one having a synthetic capsid protein. In certain embodiments, the vector comprises a hybrid capsid with an altered tropism. In one example the hybrid capsid comprising a glycan binding site (e.g., a galactose binding site) from one serotype (e.g., AAV9) in a capsid sequence from another serotype (e.g., AAV8) (see, e.g., WO 2014/144229, incorporated by reference herein in its entirety).

(105) The virus vectors according to the present invention provide a means for delivering NAGLU nucleic acids into a broad range of cells, including dividing and non-dividing cells. The virus vectors can be employed to deliver the nucleic acid to a cell in vitro, e.g., to produce a polypeptide in vitro or for ex vivo gene therapy. The virus vectors are additionally useful in a method of delivering the nucleic acid to a subject in need thereof, e.g., to express NAGLU. In this manner, the polypeptide can be produced in vivo in the subject. The subject can be in need of the polypeptide because the subject has a deficiency of the polypeptide. Further, the method can be practiced because the production of the polypeptide in the subject may impart some beneficial effect.

(106) The virus vectors can also be used to produce NAGLU in cultured cells or in a subject (e.g., using the subject as a bioreactor to produce the polypeptide or to observe the effects of the polypeptide on the subject, for example, in connection with screening methods).

(107) The virus vectors of the present invention can be employed to deliver a nucleic acid encoding NAGLU to treat and/or prevent any disease state for which it is beneficial to deliver NAGLU, e.g., MPS IIIB.

(108) Virus vectors according to the instant invention find use in diagnostic and screening methods, whereby the NAGLU nucleic acid is transiently or stably expressed in a cell culture system, in an organ or organ culture, or alternatively, a transgenic animal model.

(109) The virus vectors of the present invention can also be used for various non-therapeutic purposes, including but not limited to use in protocols to assess gene targeting, clearance, transcription, translation, etc., as would be apparent to one skilled in the art. The virus vectors can also be used for the purpose of evaluating safety (spread, toxicity, immunogenicity, etc.). Such data, for example, are considered by the United States Food and Drug Administration as part of the regulatory approval process prior to evaluation of clinical efficacy.

(110) Alternatively, the virus vector may be administered to a cell ex vivo, and the altered cell is administered to the subject. The virus vector comprising the NAGLU nucleic acid is introduced into the cell, and the cell is administered to the subject, where the nucleic acid can be expressed.

(111) Subjects, Pharmaceutical Formulations, and Modes of Administration

(112) Virus vectors and capsids according to the present invention find use in both veterinary and medical applications. Suitable subjects include both avians and mammals. The term avian as used herein includes, but is not limited to, chickens, ducks, geese, quail, turkeys, pheasant, parrots, parakeets, and the like. The term mammal as used herein includes, but is not limited to, humans, non-human primates, bovines, ovines, caprines, equines, felines, canines, lagomorphs, etc. Human subjects include neonates, infants, juveniles and adults.

(113) In particular embodiments, the present invention provides a pharmaceutical composition comprising a virus vector of the invention in a pharmaceutically acceptable carrier and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will typically be a liquid. For other methods of administration, the carrier may be either solid or liquid. For inhalation administration, the carrier will be respirable, and optionally can be in solid or liquid particulate form.

(114) By pharmaceutically acceptable it is meant a material that is not toxic or otherwise undesirable, i.e., the material may be administered to a subject without causing any undesirable biological effects.

(115) One aspect of the present invention is a method of transferring a nucleic acid to a cell in vitro. The virus vector may be introduced into the cells at the appropriate multiplicity of infection according to standard transduction methods suitable for the particular target cells. Titers of virus vector to administer can vary, depending upon the target cell type and number, and the particular virus vector, and can be determined by those of skill in the art without undue experimentation. In representative embodiments, at least about 10.sup.3 infectious units, more preferably at least about 10.sup.5 infectious units are introduced to the cell.

(116) The cell(s) into which the virus vector is introduced can be of any type. Moreover, the cell can be from any species of origin, as indicated above.

(117) The virus vector can be introduced into cells in vitro for the purpose of administering the modified cell to a subject. In particular embodiments, the cells have been removed from a subject, the virus vector is introduced therein, and the cells are then administered back into the subject. Methods of removing cells from subject for manipulation ex vivo, followed by introduction back into the subject are known in the art (see, e.g., U.S. Pat. No. 5,399,346). Alternatively, the recombinant virus vector can be introduced into cells from a donor subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to a subject in need thereof (i.e., a recipient subject).

(118) Suitable cells for ex vivo gene delivery are as described above. Dosages of the cells to administer to a subject will vary upon the age, condition and species of the subject, the type of cell, the nucleic acid being expressed by the cell, the mode of administration, and the like. Typically, at least about 10.sup.2 to about 10.sup.8 cells or at least about 10.sup.3 to about 10.sup.6 cells will be administered per dose in a pharmaceutically acceptable carrier. In particular embodiments, the cells transduced with the virus vector are administered to the subject in a treatment effective or prevention effective amount in combination with a pharmaceutical carrier.

(119) A further aspect of the invention is a method of administering the virus vector to subjects. Administration of the virus vectors according to the present invention to a human subject or an animal in need thereof can be by any means known in the art. Optionally, the virus vector is delivered in a treatment effective or prevention effective dose in a pharmaceutically acceptable carrier.

(120) Dosages of the virus vector to be administered to a subject depend upon the mode of administration, the disease or condition to be treated and/or prevented, the individual subject's condition, the particular virus vector, and the nucleic acid to be delivered, and the like, and can be determined in a routine manner. Exemplary doses for achieving therapeutic effects are titers of at least about 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, 10.sup.13, 10.sup.14, 10.sup.15, 10.sup.16, 10.sup.17, 10.sup.18 transducing units, optionally about 10.sup.8 to about 10.sup.15 transducing units.

(121) In particular embodiments, more than one administration (e.g., two, three, four or more administrations) may be employed to achieve the desired level of gene expression over a period of various intervals, e.g., daily, weekly, monthly, yearly, etc.

(122) Exemplary modes of administration include systemic administration, e.g., intravenous administration.

(123) Delivery to a target tissue can also be achieved by delivering a depot comprising the virus vector. In representative embodiments, a depot comprising the virus vector is implanted into the tissue or the tissue can be contacted with a film or other matrix comprising the virus vector. Such implantable matrices or substrates are described in U.S. Pat. No. 7,201,898.

(124) In particular embodiments, a virus vector according to the present invention is administered systematically, e.g., intravenously, to treat, delay the onset of and/or prevent symptoms associated with MPS IIIB.

(125) Thus, as one aspect, the invention further encompasses a method of delivering NAGLU to a subject, comprising administering to the subject an effective amount of an AAV particle that expresses NAGLU, thereby delivering NAGLU to the subject.

(126) In another aspect, the invention further encompasses a method of treating, delaying the onset of, and/or preventing MPS IIIB or one or more symptoms associated with MPS IIIB in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an AAV particle that expresses NAGLU, thereby treating, delaying the onset of, and/or preventing MPS IIIB or one or more symptoms associated with MPS IIIB in the subject.

(127) In the methods of the invention, the subject may be one has been diagnosed with MPS IIIB or is suspected of having MPS IIIB. In certain embodiments, the subject is an infant or child, e.g., less than 18 years old, e.g., less than 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 years old. In some embodiments, the subject has not developed symptoms of MPS IIIB.

(128) Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Alternatively, one may administer the virus vector and/or virus capsids of the invention in a local manner, for example, in a depot or sustained-release formulation. Further, the virus vector and/or virus capsid can be delivered adhered to a surgically implantable matrix (e.g., as described in U.S. Patent Publication No. 2004-0013645).

(129) Having described the present invention, the same will be explained in greater detail in the following examples, which are included herein for illustration purposes only, and which are not intended to be limiting to the invention.

Example 1

Development of Improved rAAV-hNAGLU Vectors

(130) rAAV vector product: To develop more effective gene therapy products for treating MPS IIIB, 2 rAAV vector plasmids were constructed to produce second generation rAAV vectors. The single-strand rAAV vector genome contains only minimal elements required for transgene expression, including AAV2 terminal repeats, SV40 splicing signal, codon-optimized hNAGLU cDNA (hNAGLU.sup.op) and SV40 Poly A signal, controlled by a hybrid CBA promoter with CMV enhancer or a CMV promoter (CMV). FIG. 1 illustrates the structure of rAAV-CBA-hNAGLU.sup.op viral vector genome.

(131) Codon-modification enhanced secretion of rNAGLU: To assess the impacts of codon-modification on the transgene product, the rAAV-hNAGLU.sup.op constructs were tested in vitro in HEK293 cells and/or Hela cells by transfection, using the first generation rAAV-CMV-hNAGLU vector construct as control. rAAV-CBA-hNAGLU.sup.op and rAAV-CMV-hNAGLU.sup.op constructs resulted in significant increases of NAGLU activity (per ml) in the media and decreases of NAGLU activity (per mg protein) in cell lysates, compared to rAAV-CMV-hNAGLU (FIGS. 2A-2B). Total combined NAGLU activity levels (cell lysates+media/transfection plate) were significantly higher in samples transfected with rAAV-CBA-hNAGLU.sup.op and rAAV-CMV-hNAGLU.sup.op than in samples transfected with the control rAAV-CMV-hNAGLU (FIG. 2C). These data indicate that the codon-optimization increased the expression of rNAGLU, and more importantly, with significantly enhanced enzyme secretion of the recombinant enzyme. It is therefore believed that the codon-modified rAAV-hNAGLU.sup.op vectors may have added therapeutic benefits for treating MPS IIIB over the first generation product (rAAV-CMV-hNAGLU), by improved by-stander effects of rNAGLU due to the improved rNAGLU expression and enhanced rNAGLU secretion.

(132) Therapeutic impact of systemic rAAV9-hNAGLU.sup.op gene delivery for treating MPS IIIB in mice: MPS IIIB mice (NAGLU knockout through disruption of exon 6 of the gene) were treated at age 1 month, 3 months, or 6 months with an IV injection of 110.sup.13 vg/kg, or 210.sup.13 vg/kg rAAV9-CBA-hNAGLU.sup.op vector via tail vein. Non-treated MPS IIIB and WT littermates were used as controls. The animals were tested for behavior performance at age 7 months and observed for longevity. Necropsies were performed at 1 week, 1 month, or 7 months post injection (pi), or at the humane endpoint, to assess rNAGLU expression, lysosomal storage pathology, vector biodistribution and histopathology. Table 2 summarizes the study design.

(133) TABLE-US-00005 TABLE 2 Study design: systemic rAAV9-CBA-hNAGLU delivery in MPS IIIB mice Vector Number of animals (n) dose Injection Tissue analyses Cohorts (vg/kg) age (m) Total Behavior* 7 d pi 1 m pi 7 m pi End Longevity 1. MPS 1 10.sup.13 1 13 12 4 2 9** 2. MPS 2 10.sup.13 1 9 3 4 3** 3. MPS 2 10.sup.13 3 6 2 4 0 4. MPS 2 10.sup.13 6 11 9 2 3 9 5. MPS.sup.# 33 16 4 6 n/a 23 6. WT.sup.# 41 17 4 6 n/a 31 *Behavior test at 6 m pi; **ongoing; .sup.#combined from multiple historical studies

(134) A similar study was carried out with rAAV9-CMV-hNAGLU.sup.op. MPS IIIB mice were treated at age 1 month, 3 months or 6 months with a IV injection of 110.sup.13 vg/kg, or 210.sup.13 vg/kg rAAV9-rAAV9-CMV-hNAGLU.sup.op vector via tail vein. Non-treated MPS IIIB and WT littermates were used as controls. The animals were tested for behavior performance at age 7 months and observed for longevity. Necropsies were performed at 1 wk, 1 month or 7 months post injection (pi), or at the humane endpoint, to assess rNAGLU expression, the correction of lysosomal storage pathology, vector biodistribution and histopathology. Table 3 summarizes the study designs.

(135) TABLE-US-00006 TABLE 3 Study design: systemic rAAV9-CMV-hNAGLU delivery in MPS IIIB mice Vector Number of animals (n) dose Injection Tissue analyses Cohorts (vg/kg) age (m) Total Behavior* 7 d pi 1 m pi 7 m pi End** Longevity 1. MPS 1 10.sup.13 1 12 12 4 2 8 2. MPS 2 10.sup.13 3 10 2 8 3. MPS 2 10.sup.13 6 11 9 2 2 9 5. MPS.sup.# 33 16 4 6 n/a 23 6. WT.sup.# 41 17 4 6 n/a 31 *Behavior test at age 7 m; **humane endpoint, tissues not available from dead mice; .sup.#combined from multiple historical studies

(136) Rapid and persistent restoration of functional NAGLU in MPS IIIB mice after an IV injection of rAAV9-CBA-hNAGLU.sup.op: NAGLU activity was detected at or above normal levels in the majority of tested tissues from all vector-treated MPS IIIB mice, at 1 week (FIG. 3A) and 1 month pi (FIGS. 3A-3C), with the exception of kidney. These data also showed that tissue NAGLU activity persisted to the endpoint (FIGS. 3B-3C), though there were decreases over time. These data demonstrate the rapid and persistent restoration of functional rNAGLU in the CNS and peripheral tissues, supporting long-lived therapeutic potential of rAAV9-CBA-hNAGLU.sup.op via a systemic delivery.

(137) Rapid and persistent restoration of functional NAGLU in MPS IIIB mice after an IV injection of rAAV9-CMV-hNAGLU.sup.op: NAGLU activity was detected at or above normal levels in the majority of tested tissues from all vector-treated MPS IIIB mice, at 1 wk (FIG. 4B) and 1 m pi (FIGS. 4B-4C). The data also showed that tissue NAGLU activity persisted to the endpoint (FIGS. 4A, 4C), though there were decreases over time. These data demonstrate the rapid and persistent restoration of functional rNAGLU in the CNS and peripheral tissues, supporting long-lived therapeutic potential of rAAV9-CMV-hNAGLU.sup.op via a systemic delivery.

(138) Clearance of lysosomal GAG storage pathology and astrocytosis: To further assess the functionality of AAV9-mediated rNAGLU, tissues were assayed for GAG content at different time points pi. The results showed that an IV injection of rAAV9-CBA-hNAGLU.sup.op vector resulted in significant reduction of GAG content to normal levels in the brain and a majority of tested peripheral tissues, except partial GAG reduction in kidney, in all vector treated MPS IIIB mice (FIGS. 5A-5C). The clearance of tissue GAGs was rapid (FIG. 5A) and persisted to the endpoint (FIGS. 5B-5C).

(139) A similar study was carried out with rAAV9-CMV-hNAGLU.sup.op. The results showed that an IV injection of rAAV9-CMV-hNAGLU.sup.op vector resulted in significant reduction of GAG content to normal levels in the brain and a majority of tested peripheral tissues, except partial GAG reduction in kidney, in all vector treated MPS IIIB mice (FIGS. 6A-6C). The clearance of tissue GAGs was rapid (FIG. 6B) and persisted to the endpoint (FIGS. 6A, 6C).

(140) Immunofluorescence (IF) staining showed clearance of the LAMP1 lysosomal marker throughout brain and eye (FIG. 7A) and the majority of the tested somatic tissues (FIG. 7C). These data support that the rAAV9-mediated rNAGLU is functional, leading to rapid and complete clearance of GAG storage in the CNS and the peripheral tissues. IF staining also showed the clearance of GFAP-positive signals in the brain and retina (FIG. 7B), indicating amelioration of astrocytosis and neuroinflammation in the CNS and optical nervous system.

(141) Functional benefits: correction of behavior deficits and extension of survival: To assess the functional benefits of systemic rAAV9-CBA-hNAGLU.sup.op gene delivery, the animals were tested at age 7 months for cognitive behavior in the Morris water maze test. MPS IIIB mice treated at age 1 month with 110.sup.13 vg/kg vector were tested at age 7 months, and showed normalized latency to find the hidden platform and swimming speed (FIG. 8A), indicating the correction of cognitive and motor function. MPS IIIB mice treated at age 6 months with 210.sup.13 vg/kg vector showed partial correction in latency to find the hidden platform and swimming ability, when tested at age 7 months (FIG. 8A). Notably, these animals were treated at advanced disease stage, and likely need a longer time for the correction of the neuropathological damages, given that it was only 1 month pi when tested, as observed in previous studies in MPS IIIA mice (Fu et al., Mol. Ther. Meth. Clin. Dev. 3:16036, doi:10.1038/mtm.2016.36 (2016)).

(142) Longevity studies showed significantly extended survival in MPS IIIB mice treated at age 1 month with 110.sup.13 vg/kg rAAV9-CBA-hNAGLU.sup.op, and at age 1 month or 6 months with 210.sup.13 vg/kg rAAV9-CBA-hNAGLU.sup.op (FIG. 8B). Importantly, while early vector treatment showed near normalized survival in MPS IIIB mice, the majority of rAAV9-treated animals lived within a normal range of lifespan (FIG. 8B). These data support the correction and reversal of neurological disorders, since premature death is attributed to severe neurological manifestations.

(143) A similar study was carried out with rAAV9-CMV-hNAGLU.sup.op. MPS IIIB mice treated at age 6 m with 210.sup.13 vg/kg vector were tested at age 8 months, and showed near normalized latency to find the hidden platform and swimming speed (FIG. 9A), indicating the correction of cognitive and motor function. Notably, these animals were treated at advanced disease stage, and were only 2 months pi when tested. Therefore, further behavioral improvements are likely as it may need a longer time for the correction of the severe neuropathological damages, as observed in previous studies in MPS IIIA mice (Fu et al., Mol. Ther. Meth. Clin. Dev. 3:16036, doi:10.1038/mtm.2016.36 (2016)).

(144) Longevity studies showed significantly extended survival in MPS IIIB mice treated at age 1 month with 110.sup.13 vg/kg rAAV9-CMV-hNAGLU.sup.op, and at age 1 month or 6 months with 210.sup.13 vg/kg rAAV9-CMV-hNAGLU.sup.op (FIG. 9B). Importantly, while early vector treatment showed near normalized survival in MPS IIIB mice, the majority of rAAV9-treated animals lived within a normal range of lifespan (FIG. 9B). These data support the correction and reversal of neurological disorders, as premature death is attributed to severe neurological manifestations.

(145) Differential bio-distribution of systemically delivered rAAV9-CBA-hNAGLU.sup.op in MPS IIIB mice: qPCR was performed to assay available tissues for rAAV9-CBA-hNAGLU.sup.op vector genome, to assess the bio-distribution of the IV-delivered vector in the CNS and periphery. The result showed differential and persistent bio-distribution of the vector in tissues, with dose-response (FIGS. 10A-10B), correlating to tissue rNAGLU activity levels (FIGS. 3A-3C). A decrease was also observed in vg in tissues over time, especially in liver, possibly due to tissue turnover and the predominantly episomal status of rAAV vector genome.

(146) Summary: The rAAV9-CMV-hNAGLU.sup.op was tested by treatment of MPS IIIB mice at different ages via systemic delivery. The data demonstrate that a single IV injection of rAAV9-CBA-hNAGLU.sup.op or rAAV9-CMV-hNAGLU.sup.op vector is functionally beneficial, leading to the correction and reversal of the disease. Therefore, the rAAV9-CMV-hNAGLU.sup.op, or previously tested rAAV9-CBA-hNAGLU.sup.op will be further developed towards clinical application.

(147) The rAAV9-hNAGLU.sup.op gene therapy product addresses the urgent unmet medical needs for MPS IIIB treatment and offers great potential of significantly improving the quality of life of not only MPS IIIB patients but also their families.

(148) The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.