Method for treating skin diseases using a humanized antibody that binds to vimentin

11649277 · 2023-05-16

Assignee

Inventors

Cpc classification

International classification

Abstract

A method of treating skin diseases by administering a pharmaceutical composition including a humanized antibody which binds to vimentin.

Claims

1. A method for treating a skin disease, comprising administering or applying a pharmaceutical composition comprising a humanized antibody or fragment thereof which specifically binds to a peptide of SEQ ID NO: 1 to an individual in need thereof, wherein the skin disease is selected from the group consisting of pityriasis rosea, lichen simplex chronicus, nummular eczema, eczema, molluscum contagiosum, psoriasis, verruca vulgaris, atopic dermatitis, and allergic contact dermatitis.

2. The method of claim 1, wherein the humanized antibody or fragment thereof comprises: a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 2; a heavy chain CDR2 of SEQ ID NO: 3 or SEQ ID NO: 14; and a heavy chain CDR3 of SEQ ID NO: 4 or SEQ ID NO: 15; and a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 5; a light chain CDR2 of SEQ ID NO: 6, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18; and a light chain CDR3 of SEQ ID NO: 7 or SEQ ID NO: 19.

3. A method for ameliorating a skin disease, comprising administering or applying a cosmetic composition comprising a humanized antibody or fragment thereof which specifically binds to a peptide of SEQ ID NO: 1 to an individual in need thereof wherein the skin disease is selected from the group consisting of pityriasis rosea, lichen simplex chronicus, nummular eczema, eczema, molluscum contagiosum, psoriasis, verruca vulgaris, atopic dermatitis, and allergic contact dermatitis.

4. The method of claim 2, wherein the humanized antibody or the fragment further comprises: a heavy chain variable region comprising a heavy chain framework region 1 (FR1) of SEQ ID NO: 20; a heavy chain FR2 of SEQ ID NO: 21; a heavy chain FR3 of SEQ ID NO: 22 or SEQ ID NO: 28; and a heavy chain FR4 of SEQ ID NO: 23; and a light chain variable region comprising a light chain FR1 of SEQ ID NO: 24; a light chain FR2 of SEQ ID NO: 25; a light chain FR3 of SEQ ID NO: 26; and a light chain FR4 of SEQ ID NO: 27.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a schematic diagram of a vector for the preparation of chimeric VSF.

(2) FIG. 2 is a schematic diagram of chimeric VSF.

(3) FIG. 3 is a diagram confirming the expression of chimeric VSF.

(4) FIG. 4 is a diagram showing the DNA sequence of scFv of VSF.

(5) FIG. 5 is a schematic diagram showing the cloning of scFv of VSF into a vector.

(6) FIG. 6 is a diagram confirming scFV of VSF after purification.

(7) FIG. 7 is a schematic diagram of a vector for the preparation of hzVSF, a humanized antibody.

(8) FIG. 8 is a schematic diagram of hzVSF, a humanized antibody of the present invention.

(9) FIG. 9 is a diagram showing the expression of hzVSF, a humanized antibody.

(10) FIG. 10 is a diagram showing the results of reducing and non-reducing SDS-PAGE, which confirmed the physical properties of hzVSF_var13, a humanized antibody.

(11) FIG. 11 is a diagram showing the LC/MS results, which confirmed the physical properties of hzVSF_var13, a humanized antibody.

(12) FIG. 12 is a diagram showing the SEC-HPLC results, which confirmed the physical properties of hzVSF_var13, a humanized antibody.

(13) FIG. 13 is a diagram showing IF (Isoelectric focusing), which confirmed the physical properties of hzVSF_var13, a humanized antibody.

(14) FIG. 14 is a diagram showing the number of donors with T cell proliferation in response to KLH, hzVSF_var12, and hzVSF_var13 among 51 blood donors.

(15) FIG. 15 is a diagram showing the degree of T cell proliferation of 51 donors in response to hzVSF_var12 and hzVSF_var13, which are representative variants of hzVSF, a humanized antibody.

(16) FIG. 16 is a diagram showing T cell proliferation induced by KLH, hzVSF_var12 and hzVSF_var13 in terms of mean SI values.

(17) FIG. 17 is a diagram showing the results of reactivity between human normal tissues and VSF.

(18) FIG. 18 is a diagram confirming VR expression in various skin diseases.

(19) FIG. 19 is a diagram confirming VR expression in pityriasis rosea, herpes zoster, lichen simplex chronicus, herpes simplex, nummular eczema, and molluscum contagiosum.

(20) FIG. 20 is a diagram confirming VR expression in psoriasis, verruca vulgaris, atopic dermatitis and allergic contact dermatitis.

(21) FIG. 21 a diagram confirming the therapeutic efficacy of VSF in patient 1 with psoriasis.

(22) FIG. 22 is a diagram confirming the therapeutic efficacy of VSF in patient 2 with psoriasis.

(23) FIG. 23 is a diagram confirming the therapeutic efficacy of VSF in patient 1 with lichen simplex chronicus.

(24) FIG. 24 is a diagram confirming the therapeutic efficacy of VSF in patient 2 with lichen simplex chronicus.

(25) FIG. 25 is a diagram confirming the therapeutic efficacy of VSF in patient 3 with lichen simplex chronicus.

(26) FIG. 26 is a diagram confirming the therapeutic efficacy of VSF in patient with nummular eczema.

(27) FIG. 27 is a diagram showing eczema area and severity index (EASI) scores, which measure erythema, edema/tubercles/papules, abrasion, and lichenification in patients with lichen simplex chronicus, nummular eczema, eczema, atopic dermatitis, and dermatitis applied with VSF, and psoriasis area severity index (PASI) scores, which measure erythema, thickness, and scaling in patients with psoriasis.

(28) FIG. 28 is a diagram showing visual analogue scale (VAS) in patients with lichen simplex chronicus, nummular eczema, eczema, atopic dermatitis, dermatitis, and psoriasis applied with VSF.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

(29) The specific details of the present invention may be explained as follows. Meanwhile, the explanations and embodiments disclosed in the present invention may be applied to other explanations and embodiments, respectively. That is, all combinations of various elements disclosed herein belong to the scope of the present invention. Additionally, the scope of the present invention should not be limited by the specific descriptions described herein below.

(30) In order to achieve the objects above, an aspect of the present invention provides a pharmaceutical composition for preventing or treating skin diseases, including, as an active ingredient, a material which specifically binds to a vimentin-derived peptide.

(31) More specifically, the present invention provides a pharmaceutical composition for preventing or treating skin diseases, including, as an active ingredient, a material which specifically binds to a peptide of SEQ ID NO: 1.

(32) As used herein, vimentin, which is a protein encoded by the VIM gene, serves the function of supporting and anchoring intracellular organelles in place, and is known to be mainly involved in maintenance of cytoskeleton, transport of proteins, and cell signaling. In the present invention, it was confirmed that although vimentin is not expressed extracellularly in normal cells, it is expressed extracellularly in the skin tissues of patients with various skin diseases, of which the specific etiology has not yet been clarified, and additionally, when a material that can bind to a vimentin-derived peptide, such as an antibody specific thereto, was applied to the skin tissues of the patients, various skin diseases can be effectively treated.

(33) Specifically, the vimentin-derived peptide may be a peptide of SEQ ID NO: 1.

(34) In the present invention, “the material which specifically binds to a vimentin-derived peptide”, which is a material having a binding affinity to the vimentin-derived peptide, may specifically be a material which specifically binds to the peptide of SEQ ID NO: 1.

(35) In the present invention, the isolated peptide of SEQ ID NO: 1 corresponds to the amino acid sequence of vimentin at amino acid positions 142 to 294, and the peptide may include not only the above amino acid sequence but also any amino acid sequence having a homology of 80% or higher, preferably 90% or higher, more preferably 95% or higher, and even more preferably 97% or higher to the above sequence, as long as the antibody of the present invention or a fragment thereof can bind thereto.

(36) More specifically, the material which specifically binds to the peptide of SEQ ID NO: 1 may be an antibody which specifically binds to the peptide of SEQ ID NO: 1 or a fragment binding to the peptide, a compound, a peptide, or an aptamer of the peptide. More specifically, the material may be an antibody which specifically binds to the peptide of SEQ ID NO: 1 or a fragment binding to the peptide, but is not limited thereto.

(37) Specifically, the present invention provides a pharmaceutical composition for preventing or treating skin diseases, including, as an active ingredient, an antibody which specifically binds to the peptide of SEQ ID NO: 1 or a fragment binding to the peptide.

(38) Examples of the antibody may include mouse antibodies, chimeric antibodies, or humanized antibodies, but are not limited thereto.

(39) The humanized antibody or a fragment binding to the peptide of the present invention has superiority in inhibiting human anti-mouse antibody (HAMA) reaction in the human body while maintaining the original affinity and specificity of mouse antibody by transplanting the complementarity-determining region of the variable region of a mouse monoclone or monoclonal antibody, which directly binds to an antigen, to a human antibody backbone. Additionally, the humanized antibodies of the present invention have immunogenicity lowered by de-immunization, and thus can be used as a safe agent when administered to humans by significantly lowering the immunogenicity. That is, the humanized antibodies of the present invention can treat target cells more efficiently by favorably interacting with the human immune system while responding to and influencing the cells in which the peptide region of SEQ ID NO: 1 is exposed to the outside of cell membrane, for example, preventing complement-dependent cytotoxicity (CDC) or antibody-dependent cell-mediated cytotoxicity (ADCC). Additionally, the humanized antibodies of the present invention have an advantage in that the human immune system does not recognize the humanized antibodies as proteins of foreign origin due to the lowered immunogenicity. Additionally, the humanized antibodies of the present invention also have an advantage in that the half-lives of the humanized antibodies in the human circulatory system are similar to those of naturally occurring antibodies, even when the drug is administered in a smaller dose and less frequently.

(40) In the present invention, the mouse antibodies which specifically bind to the isolated peptide of SEQ ID NO: 1 may be collectively referred to as “mouse virus suppressing factor (mVSF)”; chimeric antibodies as “chimeric virus suppressing factor (chVSF)”; and humanized antibodies as “humanized virus suppressing factor (hzVSF)”. As used herein, the term “humanized antibody hzVSF” or “variants thereof” can be used interchangeably, and hzVSF can be used interchangeably with the wild-type hzVSF (hzVSF_wt) and a variant of hzVSF (e.g., indicated as hzVSF_var1, hzVSF_v1, hzVSF_1, etc.).

(41) The isolated peptide of SEQ ID NO: 1 is an antigenic region including an epitope, and it may be an amino acid sequence of vimentin at amino acid positions 142 to 211 or at amino acid positions 211 to 294, as long as the peptide can exhibit a function similar to that of the present invention, by binding to an antibody or a peptide-binding fragment. Additionally, it is obvious that any amino acid sequence having such homology described above can belong to the scope of the present invention, although the sequence may have deletion, modification, substitution, or addition in part of the sequence. Vimentin, which is a protein encoded by the VIM gene, serves the functions of supporting and anchoring intracellular organelles in place, and is known to be mainly involved in maintenance of cytoskeleton, transport of proteins, and cell signaling. Vimentin is also known to be used as a cancer marker, however, it is not known whether antibodies capable of binding to vimentin can be used for treatment of skin diseases.

(42) The antibody, which specifically binds to the isolated peptide of SEQ ID NO: 1 of the present invention or a fragment binding to the peptide specifically responds to skin cells of patients having skin diseases, and the antibody or a fragment binding to the peptide binds to the receptors of virus-suppressing factor (VSF) which are exposed to the cell surface in the skin tissue or skin cells of the area affected with the diseases. The antibody or a fragment binding to the peptide of the present invention can thus be used effectively in the field of prevention or treatment of various skin diseases, of which the specific etiology has not yet been clarified.

(43) Specifically, the antibody or a fragment binding to the peptide may be one which specifically binds to the amino acid residue at the 9.sup.th, the 45.sup.th, the 54.sup.th, the 76.sup.th, the 94.sup.th, or the 129.sup.th position of the peptide of SEQ ID NO: 1, and more specifically, one which specifically binds to the amino acid residue at the 9.sup.th, the 45.sup.th, the 54.sup.th, the 76.sup.th, the 94.sup.th, and the 129.sup.th positions of the peptide of SEQ ID NO: 1, but is not limited thereto as long as it can specifically bind to the isolated peptide of SEQ ID NO: 1.

(44) As used herein, the term “antibody” immunologically refers to a protein molecule which has the role of a ligand specifically recognizing an antigen, including an immunoglobulin molecule having reactivity to a specific antigen, and it may include all of a polyclonal antibody, a monoclonal antibody, a whole antibody, and an antibody fragment. Additionally, the term “antibody” may include a chimeric antibody (e.g., a humanized murine antibody), a bivalent or bispecific molecule (e.g., a bispecific antibody), a diabody, a triabody, and a tetrabody. Additionally, the term “antibody” may include a single-chain antibody having binding affinity to FcRn, scAb, a derivative of a constant region of an antibody, and an artificial antibody based on a protein scaffold. A whole antibody has a structure consisting of two full-length light chains and two full-length heavy chains, where each light chain is linked to a heavy chain by a disulfide bond. The whole antibody includes IgA, IgD, IgE, IgM, and IgG, and the subtypes of IgG include IgG1, IgG2, IgG3, and IgG4. As used herein, the terms “fragment”, “fragment binding to a peptide”, and “antibody fragment” refer to any fragment of the antibodies of the present invention having an antigen-binding activity of the antibodies and these terms may be used interchangeably. Examples of the antibody fragment include a single-chain antibody, Fd, Fab, Fab′, F(ab′)2, dsFv, or scFv, but is not limited thereto. The Fd refers to a heavy chain part included in the Fab fragment. The Fab has a structure consisting of variable regions of the heavy chain and the light chain, constant regions of the light chain, and the first constant region of the heavy chain (CH1 domain), and has a single antigen-binding domain. Fab′ differs from Fab in that Fab′ has a hinge region containing at least one cysteine residue at the C-terminus of the heavy chain CH1 domain. The F(ab′)2 antibody is produced when the cysteine residues in the hinge region of Fab' form a disulfide bond. As used herein, the term “variable fragment (Fv)” refers to a minimum antibody fragment having only the variable region of a heavy chain and the variable region of a light chain. Disulfide-stabilized Fv (dsFv) is characterized in that the variable region of a heavy chain and the variable region of a light chain are linked by a. disulfide bond, and single-chain Fv (scFv) is characterized in that the variable region of a heavy chain and the variable region of a light chain are generally linked by a covalent bond through a linker. These antibody fragments may be obtained using a protease (for example, papain restriction cleavage of the whole antibody can yield Fab, while pepsin cleavage of the whole antibody can yield F(ab′).sub.2 fragments), and may preferably be prepared using genetic recombinant technology.

(45) Specifically, the fragment binding to the peptide may be Fab, Fab′, F(ab′).sub.2, scFv, dsFv, ds-scFv, dimers thereof, minibodies, diabodies, multimers, or bispecific antibody fragments.

(46) As used herein, the term “monoclonal antibody” refers to an antibody molecule consisting of a single molecule obtained from substantially the same antibody group, and the monoclonal antibody exhibits a single binding specificity and affinity to a particular epitope.

(47) Typically, immunoglobulins have heavy chains and light chains, and each of the heavy chains and light chains includes a constant region and a variable region (also known as a domain). The variable regions of the light chain and the heavy chain include three highly variable regions, which are called complementarity-determining regions (hereinafter, “CDR”), and four framework regions (hereinafter, “FR”). The CDR mainly has a role of binding to the epitope of an antigen. The CDR in each chain is called CDR1, CDR2, and CDR3 in sequence, typically starting from the N-terminus, and these are identified by the chain in which a particular CDR is located.

(48) Additionally, when the antibody of the present invention includes a constant region, a constant region derived from IgG, IgA, IgD, IgE, and IgM, or a combination thereof or a hybrid thereof may be included.

(49) As used herein, the term “combination” refers to the formation of a binding between a polypeptide encoding a single-chain immunoglobulin constant region of the same origin and a single-chain polypeptide of a different origin when forming a dimer or multimer. For example, a dimer or multimer may be formed from two or more constant regions selected from the group consisting of the constant regions of IgG, IgA, IgD, IgE, and IgM.

(50) As used herein, the term “hybrid” refers to the presence of sequences corresponding to two or more immunoglobulin heavy chain constant regions of different origins within a single-chain immunoglobulin heavy chain constant region, and for example, a hybrid consisting of one to four domains selected from the group consisting of the CH1, CH2, CH3, and CH4 of IgG, IgA, IgD, IgE, and IgM may be possible.

(51) The humanized antibody of the present invention may be humanized based on human immunoglobulin γ4, although humanization is not limited thereto, and it may have an advantage in that it does not cause CDC due to lack of complement binding.

(52) The humanized antibody or a fragment binding to the peptide may include: a heavy chain variable region including a heavy chain CDR1 of SEQ ID NO: 2; a heavy chain CDR2 of SEQ ID NO: 3 or SEQ ID NO: 14 (in which threonine, the 9.sup.th amino acid of SEQ ID NO: 3, is substituted with aspartic acid); and a heavy chain CDR3 of SEQ ID NO: 4 or SEQ ID NO: 15 (in which threonine, the 4.sup.th amino acid of SEQ ID NO: 4, is substituted with asparagine); and a light chain variable region including a light chain CDR1 of SEQ ID NO: 5; a light chain CDR2 of SEQ ID NO: 6, SEQ ID NO: 16 (in which threonine, the 3.sup.rd amino acid of SEQ ID NO: 6, is substituted with aspartic acid), SEQ ID NO: 17 (in which threonine, the 3.sup.rd amino acid of SEQ ID NO: 6, is substituted with aspartic acid; and alanine, the 6.sup.th amino acid of SEQ ID NO: 6, is substituted with glycine), or SEQ ID NO: 18 (in which threonine, the 3.sup.rd amino acid of SEQ ID NO: 6, is substituted with aspartic acid; leucine, the 5.sup.th amino acid of SEQ ID NO: 6, is substituted with arginine; and alanine, the 6.sup.th amino acid of SEQ ID NO: 6, is substituted with glycine); and a light chain CDR3 of SEQ ID NO: 7 or SEQ ID NO: 19 (in which serine, the 6.sup.th amino acid of SEQ ID NO: 7, is substituted with threonine).

(53) Additionally, the humanized antibody or a fragment binding to the peptide may include a human framework region (FR), and may be human immunoglobulin gamma of SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31, or a heavy chain variable region, which includes a heavy chain framework region 1 (FR1) of SEQ ID NO: 20, a heavy chain FR2 of SEQ ID NO: 21, a heavy chain FR3 of SEQ ID NO: 22 or SEQ ID NO: 28 (in which lysine, the 8.sup.th amino acid of SEQ ID NO: 22, is substituted with threonine; and isoleucine, the 10.sup.th amino acid of SEQ ID NO: 22, is substituted with alanine), and a heavy chain FR4 of SEQ ID NO: 23; and a light chain variable region, which includes a light chain FR1 of SEQ ID NO: 24, a light chain FR2 of SEQ ID NO: 25, a light chain FR3 of SEQ ID NO: 26, and a light chain FR4 of SEQ ID NO: 27, but is not limited thereto.

(54) Specifically, the humanized antibody or a fragment binding to the peptide may include: (a) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ NO: 3, and SEQ ID NO: 4, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively; (b) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 16, and SEQ ID NO: 7, respectively; (c) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 17, and SEQ ID NO: 7, respectively; (d) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ NO: 5, SEQ M NO: 18, and SEQ NO: 7, respectively; (e) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 18, and SEQ ID NO: 19, respectively; (f) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ NO: 2, SEQ ID NO: 14, and SEQ ID NO: 4, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively; (g) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ NO: 2, SEQ ID NO: 3, and. SEQ ID NO: 4, respectively; heavy chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 28, and SEQ ID NO: 23, respectively; a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 6, and SEQ NO: 7, respectively; and light chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27, respectively; (h) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ ID NO: 14, and SEQ ID NO: 4, respectively; heavy chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 28, and SEQ ID NO: 23, respectively; a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively; and light chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27, respectively; (i) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ ID NO: 14, and SEQ ID NO: 15, respectively; heavy chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 28, and SEQ ID NO: 23, respectively; a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ NO: 6, and SEQ NO: 7, respectively; and light chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27, respectively; (j) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ ID NO: 14, and SEQ ID NO: 4, respectively; heavy chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 28, and SEQ ID NO: 23, respectively; a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 18, and SEQ ID NO: 7, respectively; and light chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27, respectively; (k) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ ID NO: 14, and SEQ ID NO: 15, respectively; heavy chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 28, and SEQ NO: 23, respectively; a light chain CDRI, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 18, and SEQ ID NO: 7, respectively; and light chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27, respectively; (I) a heavy chain CDRI, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ ID NO: 14, and SEQ ID NO: 4, respectively; heavy chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 28, and SEQ ID NO: 23, respectively; a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 18, and SEQ ID NO: 19, respectively; and light chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27, respectively; (m) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ ID NO: 14, and SEQ ID NO: 15, respectively; heavy chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 28, and SEQ ID NO: 23, respectively; a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 18, and SEQ ID NO: 19, respectively; and light chains FR1, FR2, FR3, and FR4 of SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27, respectively; and (n) a heavy chain CDR1, a heavy chain CDR2, and a heavy chain CDR3 of SEQ ID NO: 2, SEQ ID NO: 14, and SEQ ID NO: 4, respectively; and a light chain CDR1, a light chain CDR2, and a light chain CDR3 of SEQ ID NO: 5, SEQ ID NO: 16, and SEQ ID NO: 7, respectively.

(55) The antibody (a) may include hzVSF_WT, antibody (b) may include hzVSF_var1, antibody (c) may include hzVSF_var2, antibody (d) may include hzVSF_var3, antibody (e) may include hzVSF_var4, antibody (f) may include hzVSF_var5, antibody (g) may include hzVSF_var6, antibody (h) may include hzVSF_var7, antibody (i) may include hzVSF_var8, antibody (j) may include hzVSF_var9, antibody (k) may include hzVSF_var10, antibody (l) may include hzVSF_var11, antibody (m) may include hzVSF_var12, and antibody (n) may include hzVSV_var13.

(56) The humanized antibody or a fragment binding to the peptide may include a heavy chain variable region and a light chain variable region of SEQ ID NO: 10 and SEQ ID NO: 12; SEQ ID NO: 32 and SEQ ID NO: 34; SEQ ID NO: 36 and SEQ ID NO: 38; SEQ ID NO: 40 and SEQ ID NO: 42; SEQ ID NO: 44 and SEQ ID NO: 46; SEQ ID NO: 48 and SEQ ID NO: 50; SEQ ID NO: 52 and SEQ ID NO: 54; SEQ ID NO: 56 and SEQ ID NO: 58; SEQ ID NO: 60 and SEQ ID NO: 62; SEQ ID NO: 64 and SEQ ID NO: 66; SEQ ID NO: 68 and SEQ ID NO: 70; SEQ ID NO: 72 and SEQ ID NO: 74; SEQ ID NO: 76 and SEQ ID NO: 78; or SEQ ID NO: 80 and SEQ ID NO: 82, respectively, but is not limited thereto.

(57) Specifically, the mouse antibody may include a heavy chain variable region including a heavy chain CDR1 of SEQ ID NO: 137; a heavy chain CDR2 of SEQ ID NO: 138; and a heavy chain CDR3 of SEQ ID NO: 139; and a light chain variable region including a light chain CDR1 of SEQ ID NO: 134; a light chain CDR2 of SEQ ID NO: 135; and a light chain CDR3 of SEQ ID NO: 136, and more specifically, include a heavy chain variable region of SEQ ID NO: 9 and a. light chain variable region of SEQ ID NO: 8, but is not limited thereto.

(58) Specifically, the chimeric antibody may include a heavy chain variable region of SEQ ID NO: 141 or SEQ ID NO: 142 and a light chain variable region of SEQ ID NO: 140, and more specifically, a heavy chain of SEQ ID NO: 146 or SEQ ID NO: 148 and a light chain of SEQ ID NO: 144, but is not limited thereto.

(59) The scFv may also include a scFv prepared for the safety of mVSF, but is not limited thereto, and for example, the scFv may be prepared by the sequence shown in FIG. 4. Additionally, the scFv may be in the form where the heavy chain variable region of SEQ ID NO: 131 and the light chain variable region of SEQ ID NO: 133 are linked by a linker. Additionally, the scFv may be in the form where the heavy chain variable region encoding the nucleotide sequence of SEQ ID NO: 130 and the light chain variable region encoding the nucleotide sequence of SEQ ID NO: 132 are linked by a linker. Such scFv may be cloned into an E. coli expression vector with a nucleotide sequence of SEQ ID NO: 150.

(60) According to a specific embodiment of the present invention, the present inventors prepared humanized antibodies, i.e., hzVSF_wt, three alternatives, and 13 variants thereof (Example 5). Additionally, as a result of comparing the immunogenicity of the humanized antibodies with commercially available drugs which have received FDA approval, it was confirmed that the immunogenicity of the humanized antibodies was similar to that of Humira, which is the human antibody having the lowest immunogenicity among the commercially available antibodies (Table 7), thus confirming that the humanized antibodies can be used as safe drugs, quasi-drugs, external skin preparations, etc., without any adverse effects that may occur when used as therapeutic agents for skin diseases.

(61) Additionally, the T cells analysis revealed that hzVSF_wt variants do not significantly affect T cell proliferation (Table 8), and thus it was confirmed that they have a low risk of causing adverse reactions by acting as immunogens when used in clinical trials.

(62) In the present invention, the skin disease may be pityriasis rosea, herpes zoster, lichen simplex chronicus, herpes simplex, nummular eczema, eczema, molluscum contagiosum, psoriasis, verruca vulgaris, atopic dermatitis or allergic contact dermatitis, and specifically, the skin disease may be lichen simplex chronicus, psoriasis, nummular eczema, eczema, atopic dermatitis or allergic contact dermatitis. However, the skin disease of the present invention may include any skin disease as long as VR is expressed in the skin tissue or skin cells thereof.

(63) In a specific embodiment of the present invention, it was confirmed that the vimentin-derived peptide of SEQ ID NO: 1 was expressed in the skin tissues of patients having various skin diseases, however, the peptide was not expressed in normal cell (FIG. 17). Additionally, it was confirmed that the material which specifically binds to the peptide of SEQ ID NO: 1 substantially showed excellent therapeutic efficacy for skin diseases even in patients with lichen simplex chronicus, nummular eczema, eczema, atopic dermatitis or allergic contact dermatitis (FIGS. 21 to 28), and thus can be used as a pharmaceutical composition for preventing and treating various skin diseases, of which the specific etiology has not yet been clarified.

(64) The pharmaceutical composition may further include a pharmaceutically acceptable carrier.

(65) As used herein, the term “pharmaceutically acceptable carrier” refers to a carrier or diluent which does not inhibit the biological activities or properties of a compound to be administered to an organism without causing irritation to the organism. Examples of the pharmaceutically acceptable carrier used in the composition to be formulated into a liquid solution include saline, sterile water, Ringer's solution, buffered saline, an albumin injection solution, a dextrose solution, a maltodextrin solution, glycerol, ethanol, and a mixture of at least one component thereof, as those suitable for sterilization and in vivo use, and other conventional additive(s) such as an antioxidant, a buffer, a bacteriostatic agent, etc. may be further added as necessary. Additionally, the composition may be formulated into injection formulations such as an aqueous solution, a suspension, an emulsion, etc., pills, capsules, granules, or tablets by additionally adding a diluent, a dispersant, a surfactant, a binder, a lubricant, etc.

(66) The pharmaceutical composition may be prepared in various oral or parenteral formulations. For the preparation of these formulations, the pharmaceutical composition may be formulated in combination with a commonly-used diluent or excipient such as a filler, an extender, a binder, a humectant, a disintegrating agent, a surfactant, etc. Solid formulations for oral administration may include tablets, pills, powders, granules, capsules, etc., and these solid formulations may be prepared by mixing at least one excipient, e.g., starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to a simple excipient, a lubricant such as magnesium stearate, talc, etc. may be used. Liquid formulations for oral administration may include suspensions, oral solutions, emulsions, syrups, etc., and in addition to a simple diluent such as water or liquid paraffin, various excipients such as humectants, sweeteners, flavoring agents, preservatives, etc. may be included in the liquid preparations. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formlations, suppositories. Examples of the non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, an injectable ester such as ethyl oleate, etc. Examples of the bases for suppositories may include Witepsol, macrogol, Tween 61, cacao butter, laurinum, glycerogelatin, etc.

(67) The pharmaceutical composition may have any formulation type selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, oral solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solvents, suspensions, lyophilized formulations, and suppositories.

(68) The composition of the present invention is administered in a pharmaceutically effective dose.

(69) As used herein, the term “pharmaceutically effective dose” refers to an amount sufficient for the treatment of diseases at a reasonable benefit/risk ratio applicable to a medical treatment, and the level of the effective dose may be determined based on the factors including the kind of a subject, severity of illness, age, sex, kind of disease(s), drug activity, drug sensitivity, administration time, administration route and dissolution rate, duration of treatment, factors including drug(s) to be simultaneously used in combination, and other factors well-known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent, in combination with other therapeutic agent(s), and sequentially or simultaneously with a conventional therapeutic agent(s). Additionally, the composition of the present invention may be administered in a single dose or multiple doses. It is important to administer an amount to obtain the maximum effect with a minimum amount without adverse effects considering the factors described above, and these factors can easily be determined by one of ordinary skill in the art. The other therapeutic agent may be interferon but is not limited thereto.

(70) As used herein, the term “prevention” may refer to all actions resulting in suppression or delay of the onset of a disease by the administration of the composition, and the term “treatment” may refer to all actions associated with the amelioration or advantageous changes in symptoms of a disease by the administration of the composition.

(71) Another aspect of the present invention provides a cosmetic composition for preventing or ameliorating skin diseases, including, as an active ingredient, a material which specifically binds to a peptide of SEQ ID NO: 1.

(72) More specifically, the present invention provides a cosmetic composition tier preventing or ameliorating skin diseases, including, as an active ingredient, an antibody which specifically binds to a peptide of SEQ ID NO: 1 or a fragment binding to the peptide.

(73) The material which specifically binds to the peptide of SEQ ID NO: 1, the peptide of SEQ ID NO: 1, the antibody, the fragment binding to the peptide, the skin disease, and the prevention are as described above.

(74) In a specific embodiment of the present invention, it was confirmed that the material which specifically binds to the peptide of SEQ ID NO: 1 substantially showed excellent therapeutic efficacy even in patients with psoriasis, lichen simplex chronicus, nummular eczema, eczema, atopic dermatitis or allergic contact dermatitis (FIGS. 21 to 28), and thus can be used as a cosmetic composition for preventing and ameliorating various skin diseases, of which the specific etiology has not yet been clarified.

(75) The cosmetic composition according to the present invention may be prepared in formulations selected from the group consisting of solution, topical ointment, cream, foam, nutritive cosmetic water, softening cosmetic water, pack, softening water, latex, makeup base, essence, soap, liquid washing agent, bath foam, sunscreen cream, sun oil, suspension, emulsion, paste, gel, lotion, powder, surfactant-containing cleanser, oil, powder foundation, emulsion foundation, wax foundation, patch and spray, but is not limited thereto.

(76) Additionally, the cosmetic composition of the present invention may further include at least one cosmetically acceptable carrier mixed to a general skin cosmetic composition. As common ingredients, for example, oil, water, surfactants, moisturizers, lower alcohols, thickening agents, chelating agents, colorings, preservatives, fragrances, etc. may be appropriately mixed, but are not limited thereto.

(77) The cosmetically acceptable carrier contained in the cosmetic composition of the present invention may vary depending on the formulations.

(78) When the fbrmulation of the present invention is an ointment, paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, or mixtures thereof may be used as a carrier ingredient.

(79) When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder or mixtures thereof may be used as a carrier ingredient, and in particular, when it is a spray, a propellant such as chlorofluorohydrocarbon, propane/butane or dimethyl ether may be additionally included.

(80) When the formulation of the present invention is a solution or emulsion, solvents, solubilizing agents or emulsifying agents may be used as a carrier ingredient, and for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-buthylglycol oil may be used. In particular, cottonseed oil, peanut oil, maize germ oil, olive oil, castor oil and sesame seed oil, glycerol aliphatic ester, polyethylene glycol or aliphatic ester of sorbitan may be used.

(81) When the formulation of the present invention is a suspension, liquid diluents such as water, ethanol or propylene glycol, suspending agent, such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tragacanth, etc. may be used as a carrier ingredient.

(82) When the formulation of the present invention is a soap, alkali metal salts of fatty acids, fatty acid hemiester salts, fatty acid protein hydrolysates, isethionate, lanolin derivatives, aliphatic alcohols, vegetable oil, glycerol, sugars, etc. may be used as a carrier ingredient.

(83) Still another aspect of the present invention provides a quasi-drug composition for preventing or ameliorating skin diseases, including, as an active ingredient, a material which specifically binds to a peptide of SEQ ID NO: 1.

(84) More specifically, the present invention provides a quasi-drug composition for preventing or ameliorating skin diseases, including, as an active ingredient, an antibody which specifically binds to a peptide of SEQ ID NO: 1 or a fragment binding to the peptide.

(85) The material which specifically binds to the peptide of SEQ ID NO: 1, the peptide of SEQ ID NO: 1, the antibody, the fragment binding to the peptide, the skin disease, and the prevention are as described above.

(86) The quasi-drug composition of the present invention may further include a pharmaceutically acceptable carrier, excipient or diluent as necessary in addition to the above components. The pharmaceutically acceptable carrier, excipient or diluent is not limited as long as the effect of the present invention is not impaired, and may include, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, flavoring agents, preservatives, etc.

(87) Examples of the quasi-drug composition of the present invention may include disinfecting cleaners, shower foams, ointments, wet wipes, coating agents, etc., but are not limited thereto. The formulation method, dosage, method of use, components, etc. of the quasi-drug can be suitably selected from conventional techniques known in the art.

(88) Still another aspect of the present invention provides an external skin preparation for preventing or ameliorating skin diseases, including, as an active ingredient, a material which specifically binds to a peptide of SEQ ID NO: 1.

(89) Specifically, the present invention provides an external skin preparation for preventing or ameliorating skin diseases, including, as an active ingredient, an antibody which specifically binds to a peptide of SEQ ID NO: 1 or a fragment binding to the peptide.

(90) The material which specifically binds to the peptide of SEQ ID NO: 1, the peptide of SEQ ID NO: 1, the antibody, the fragment binding to the peptide, the skin disease, and the prevention are as described above.

(91) As used herein, the term “external skin preparation” is a general concept encompassing all substances generally used for external application of the skin. Non-limiting examples of formulations including the pharmaceutical composition may include plasters, lotions, liniments, liquids and solutions, aerosols, extracts, ointments, fluid extracts, emulsions, suspensions, capsules, creams, soft or hard gelatin capsules, patches, or sustained release agents.

(92) The external skin preparation according to the present invention may be a parent era administration preparation formulated into solids, semisolids or liquids by adding a commonly used inorganic or organic carrier, excipient, and diluent. For the parenteral administration, the external skin preparation may be a transdermal administration formulation selected from the group consisting of drops, ointments, lotions, gels, creams, patches, sprays, suspensions and emulsions, but is not limited thereto.

(93) Carriers, excipients, and diluents that may be included in the external skin preparation include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

(94) In the composition for external skin preparation according to each formulation, other components, in addition to the composition of the present invention described above, may be appropriately selected and blended without difficulty by one of ordinary skill in the art according to the formulation or the purpose of use of other external skin preparations, and in this case, a synergistic effect may be achieved when these components are simultaneously applied together with other raw materials.

(95) Still another aspect of the present invention provides a method for preventing or treating skin diseases, including administering a composition including, as an active ingredient, a material which specifically binds to a peptide of SEQ ID NO: 1 to a subject.

(96) Specifically, the present invention provides a method for preventing or treating skin diseases, including administering a composition including, as an active ingredient, an antibody which specifically binds to a peptide of SEQ ID NO: 1 or a fragment binding to the peptide to a subject.

(97) The method for treating skin diseases may be a method including administering a pharmaceutical composition, which includes an antibody or additional pharmaceutically acceptable carrier, to a subject having a skin disease or suspected of having the same. The pharmaceutically acceptable carrier is as described above.

(98) The subject may include mammals, birds, etc., such as cattle, pigs, sheep, chickens, dogs, humans, etc., and may include without limitation any subject in which the skin diseases can be treated by administering the composition of the present invention.

(99) In particular, the composition may be administered in a pharmaceutically acceptable amount in a single or multiple dose. The composition may be administered in the form of liquids, powders, aerosols, capsules, enteric coated tablets, capsules, or suppositories. Examples of the administration routes may include intraperitoneal, intravenous, intramuscular, subcutaneous, endothelial, oral, topical, intranasal, intrapulmonary, or intrarectal administration, etc., but is not limited thereto. However, since peptides are digested when being administered orally, the composition for oral administration must be formulated such that the active ingredient can be coated or protected from degradation in the stomach. Additionally, the pharmaceutical composition may be administered using any device which can transport the active ingredient to the target cell.

(100) Still another aspect of the present invention provides the use of a composition for preventing or treating skin diseases, including, as an active ingredient, a material which specifically binds to a peptide of SEQ NO: 1.

(101) Still another aspect of the present invention provides the use of a composition including, as an active ingredient, a material which specifically binds to a peptide of SEQ ID NO: 1 for the preparation of medicine in the prevention or treatment of skin diseases.

(102) Still another aspect of the present invention provides the use of a composition including, as an active ingredient, a material which specifically binds to a peptide of SEQ ID NO: 1 for the preparation of cosmetics, quasi-drugs, or external skin preparations in the amelioration of skin diseases.

MODE FOR CARRYING OUT THE INVENTION

(103) The present invention will be described in more detail by Examples. However, these Examples are given for illustrative purposes only, and are not intended to limit the scope of the present invention.

EXAMPLE 1

Preparation of Vsf (Virus Suppressing Factor)

EXAMPLE 1-1

Preparation of chVSF (Chimeric VSF)

(104) Based on the assumption that the major functional part of the mouse VSF (mVSF) is a monoclonal antibody, a mouse/human chimeric antibody (chAb) was chimerized by genetic engineering using the mVSF and human immunoglobulin.

(105) Specifically, for the preparation of a chimeric antibody, the constant regions of the light and heavy chains of mVSF were replaced with the constant regions of human immunoglobulin antibody (κ, γ2, or γ4). For chVSF, an expression vector was prepared using the pCAGGS vector as a template (FIG. 1). The heavy chain variable region of mVSF (mVH) (SEQ ID NO: 9) including the SacI and KpnI restriction enzyme sites was amplified by PCR. The light chain variable region (mVL) (SEQ ID NO: 8) including the ClaI and XhoI restriction enzyme sites was amplified by PCR. The primers used in PCR are described in Table 1, and the PCR was performed for a total of 35 cycles at 94° C. for 45 sec, at 60° C. for 45 sec, and at 72° C. for 45 sec, followed by performing at 72° C. for 10 min.

(106) TABLE-US-00001 TABLE 1  Primer Sequence Sequence No. mVH F cgagctcatgggatggagctggatc 124 mVH R cggtacctgaggagacggtgactg 125 Kpnl_delR gggcccttggtgaaagctgaggaga 126 cggtaactgagg mVL F catcgatatgagtgtgcccactcag 127 mVL R cctcgagtttgatttccagcttgg 128 Xho_modR agatggtgcagccaccgtgcgtttg 129 atttccagcttggtgcc

(107) The human heavy chain (SEQ ID NO: 11) was cloned using the KpnI and SphI restriction enzyme sites, and the light chain (SEQ ID NO: 13) was cloned using the XhoI and BglI restriction enzyme sites. For the simultaneous expression of both heavy and light chains, an internal ribosome entry site (IRES) was cloned between the light chain and the heavy chain using the SphI and ClaI restriction enzyme sites. A selectable marker was inserted into the SalI restriction enzyme site. Accordingly, the chVSFs were prepared as illustrated in the schematic diagram of FIG. 2.

EXAMPLE 1-2

Expression of chVSF Using Two-Vector Expression System

(108) 15 μg of pCAGGS-GFP was transfected into HEK 293T cells using 1 mg/mL of polyethylenimine (PEI) to examine the levels of transfection and expression. The chVSF prepared in Example 1-1 was transfected into HEK 293T cells in the same manner, and after 6 hours, the medium was replaced with a medium containing 2% FBS. The cell culture supernatant was collected every 3 days, and impurities contained therein were removed using a filter (0.45 μm). The chVSF was purified using nProtein A Sepharose® beads. The chVSF was eluted with 0.2 M glycine/HCl buffer (pH 2.5), and 1 M Tris-Cl buffer (pH 9.0) was used as a neutralization buffer. Specifically, after homogenizing a resin with a 10-fold volume of 1 M Tris-Cl buffer (pH 8.0) relative to the resin volume, the VSF culture supernatant was passed through a column. The resultant was washed by flowing thereinto an at least 5-fold volume of 0.1 M Tris-Cl butler (pH 8.0) relative to the column volume. The resultant was eluted by flowing thereinto a 5-fold volume of 0.2 M glycine/HCl buffer (pH 2.5) relative to the resin volume, and purified VSFs were thereby obtained in a tube added with a neutralization buffer in advance. The purified VSFs were then confirmed by SDS-PAGE.

(109) As a result, as illustrated in FIG. 3, it was confirmed that the chVSF has a structure consisting of a heavy chain (50 kDa) and a light chain (25 kDa), which have the characteristics of an immunoglobulin.

EXAMPLE 2

Preparation of Single-Chain Variable Fragment (say)

(110) A single-chain variable fragment (scFv) was prepared using the variable regions of VSF. The scFv has the DNA sequence of SECT ID NO: 150, and the scFv was prepared by cloning the DNA into pET-22b (+), an E. coli expression vector (FIGS. 4 and 5).

(111) Specifically, the scFV was prepared by linking the VH and VL of mVSF via a linker, inserted into the bacterial expression vector, pET-22b (+), treated with IPTG to induce its expression, and then purified using a Ni-NTA column (FIG. 6).

EXAMPLE 3

Preparation of Humanized Antibody VSF

(112) hzVSF, a humanized antibody, was prepared using the chVSF based on Example 1.

(113) In particular, the pdCMV-dhfr vector, which corresponds to a two-gene expression vector, i.e., an expression system used for expressing two different kinds of recombinant proteins using a eukaryotic cell (FIG. 7), was used. The vector consists of two different transcription units for two different kinds of genes in a single vector and thereby expresses the two different genes using the promoter and polyA signal in each transcription unit, and it is a vector system utilizing the cytomegalovirus (CMV) promoter, a strong mammalian promoter. The hzVSFs were prepared using the promoter, as illustrated in FIG. 8.

(114) In this regard, the amino acid sequence of the heavy chain variable region of the hzVSF was indicated by SEQ ID NO: 10, and the amino acid sequence of the heavy chain region was indicated by SEQ ID NO: 11, whereas the amino acid sequence of the light chain variable region was indicated by SEQ ID NO: 12, and the amino acid sequence of the light chain was indicated by SEQ ID NO: 13.

(115) 15 μg of pCAGGS-GFP was transfected into HEK 293T cells using 1 mg/mL of polyethylenimine (PEI) to examine the levels of transfection and expression. The chVSF and hzVSF were transfected into HEK 293T cells in the same manner, and after 6 hours, the medium was replaced with a medium containing 2% FBS. The cell culture supernatant was collected every 3 days, and impurities contained therein were removed using a filter (0.45 μm). The chVSF and hzVSF were purified using nProtein A Sepharose® beads. The chVSF and hzVSF were eluted with 0.2 M glycine/HCl buffer (pH 2.5), and 1 M Tris-Cl buffer (pH 9.0) was used as a neutralization buffer. Specifically, after homogenizing a resin with a 10-fold volume of 1 M Tris-Cl buffer (pH 8.0) relative to the resin volume, the VSF culture supernatant was passed through a column. The resultant was washed by flowing thereinto an at least 5-fold volume of 0.1 M Tris-Cl buffer (pH 8.0) relative to the column volume. The resultant was eluted by flowing thereinto a 5-fold volume of 0.2 M glycine/HCl buffer (pH 2.5) relative to the resin volume, and purified VSFs were thereby obtained in a tube added with a neutralization buffer in advance. The purified VSFs were then confirmed by SDS-PAGE, and their activities were confirmed by MVIT assay.

(116) The VSFs used in the experiment are shown in Table 2 below

(117) TABLE-US-00002 TABLE 2 Types of VSF Expression Cells mg/L Harvested Sup. mVSF Mouse hybridoma 4.14 *rmVSF HEK293T 5.71 chVSF γ 2 HEK293T 5.15 chVSF γ 4 HEK293T 7.32 hzVSF γ 2 HEK293T 5.01 hzVSF γ 4 HEK293T 9.38 *rmVSF: recombinant of mouse VSF

(118) As a result, as can be seen in FIG. 9, it was confirmed that the chVSFγ2 and chVSFγ4, and hzVSFγ2 and hzVSFγ4 consist of a heavy chain (50 kDa) and a light chain (25 kDa), respectively, which have the characteristics of an immunoglobulin.

EXAMPLE 4

Confirmation of Physical Properties of Humanized Antibody VSF

(119) The physical properties of the hzVSF prepared in Example 3 were confirmed as follows.

EXAMPLE 4-1

Confirmation of Basic Molecular Weight Patterns and Purity

(120) Molecular weight patterns and purities were confirmed by reducing and non-reducing SDS-PAGE. Specifically, hsVSF_v13 was stained by Coomassie staining using SDS-PAGE according to molecular weight, and thereby the molecular weight and purity were confirmed.

(121) As a result, as illustrated in FIG. 10, in lane 1 as a non-reducing gel, a major band was observed in the position where IgG antibody (150 kDa) was expected to appear; and in lane 2 as a reducing gel, the bands corresponding to the positions of the heavy chain (about 50 kDa) and the light chain (about 25 kDa) of immunoglobulin G (IgG) antibody were observed, thus confirming that the hzVSF_v13 showed a general IgG antibody pattern.

EXAMPLE 4-2

Confirmation of Molecular Weight, Glycosylation Pattern, Size Variation, etc

(122) In order to confirm the molecular weight, glycosylation pattern, size variation, etc., of the hzVSF_v13, liquid chromatography/mass spectrometry was performed. A small amount of the hzVSF_v13 was injected into HPLC, and the peaks were observed.

(123) As a result, it was confirmed that the hzVSF_v13 exhibited the characteristics of IgG (FIG. 11). In Intact Mass, the total molecular weight (about 140 kDa) of the hzVSF_v13 was observed, and the peak patterns corresponding to general glycosylated IgG (e.g., G0/G0, G0F/G1, G1/G1, etc.) were observed. Additionally, the heavy chain (about 49 kDa) and the light chain (about 23 kDa) after deglycosylation were observed. Based on the molecular weights of the heavy chain, where the glycan was removed by treating with PNGase F, and the heavy chain without PNGase F treatment, a general glycan pattern of IgG could be confirmed (G0F, G1F, and G2F).

EXAMPLE 4-3

Confirmation of Purity and Aggregation

(124) In order to confirm the purity and aggregation of the hzVSF_v13, SEC-HPLC was performed.

(125) SEC-HPLC conditions are as follows: HPLC system: Dionex Ultimate 3000 Column: Tosoh TSKgel G3000 SWx1 Mobile phase: phosphate buffer, 0.5 ml/min Injection Volume: 10 μL

(126) As a result, 92.44% of the major peak was observed at the position corresponding to the monomers of a typical IgG antibody (at the retention time of about 16 minutes) and about 6.84% of the peak was observed at the position corresponding to the dimers of a typical IgG antibody (at the retention time of about 13 minutes) (FIG. 12).

EXAMPLE 4-4

Confirmation of pI and Charge Heterogeneity

(127) In order to confirm the isoelectric point of the hzVSF_v13, electrophoresis was performed using a gel exhibiting a gradient of pH 3 to pH 10.

(128) As a result, as illustrated in FIG. 13, the hzVSF_v13 was shown to have a pI of 7.7, and acidic/basic isoforms were also observed in addition to the major bands. This corresponds to the isomers generally observed in IgG antibodies (e.g., deamination at the C-terminal region).

(129) The above results support that the hzVSF_v13s, humanized antibodies of the present invention, have physical properties similar to those of IgG antibodies.

EXAMPLE 5

Preparation of hzVSF Variants which are Humanized Antibodies with Reduced Immunogenicity

EXAMPLE 5-1

Preparation of hzVSF Alternatives

(130) Three hzVSF alternatives were prepared based on the hzVSF prepared in Example 3. The activity of each alternative was similar to or lower than that of the wild-type (0.5=≤1 U<1 mg/mL) (Tables 3 and 4). The amino acid sequences of CDR 1 to CDR 3 for each of the alternatives are shown in Table 3, and the amino acid sequences of FR1 to FR4 of each of the variants are shown in Table 4.

(131) TABLE-US-00003 TABLE 3  Antibody CDR1 CDR2 CDR3 hzVSF_WT Heavy GYNMN  NIDPYYGSTTYA ETGTRAMDY chain (SEQ ID  QKFQG (SEQ (SEQ ID  NO: 2) ID NO: 3) NO: 4) Light RASENTYS VATNLAD (SEQ QHFYGSPRT chain NLA (SEQ ID NO: 6) (SEQ ID  ID NO: 5) NO: 7) hzVSf_a1 Heavy GYNMN NIDPYYGSTTYA ETGTRAMDY chain (SEQ ID  QKFQG (SEQ (SEQ ID  NO: 2) ID NO: 3) NO: 4) Light  RASENIYSNL VATNLAD (SEQ QHFYGSPRT chain A (SEQ ID ID NO: 6) (SEQ ID  NO: 5) NO: 7) hzVSF_a2 Heavy GYNMN (SEQ NIDPYYGSTINA ETGTRAMDY chain ID NO: 2) QKFQG (SEQ (SEQ ID  ID NO: 3) NO: 4) Light  RASENIYSNL VATNLAD (SEQ QUIFYGSPRT chain A (SEQ ID ID NO: 6) (SEQ ID  NO: 5) NO: 7) hzVSF_a3 Heavy GYNMN (SEQ NIDPYYGSTTYA ETGTRAMDY chain ID NO: 2) QKFQG (SEQ  (SEQ ID  ID NO: 3) NO: 4) Light  RASENIYSNL VATNLAD  QHFYGSPRT chain A (SEQ ID (SEQ ID (SEQ ID  NO: 5) NO: 6) NO: 7)

(132) TABLE-US-00004 TABLE 4 Antibody FR1 FR2 FR3 FR4 hzVSF_WT Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 22 NO: 23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_a1 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 151 NO: 21 NO: 22 NO:23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_a2 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 152 NO: 22 NO: 23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_a3 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 151 NO: 152 NO: 22 NO: 23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27

EXAMPLE 5-2

Preparation of hzVSF Variants

(133) Based on the hzVSF prepared in Example 3, hzVSF variants for actual use in viva were prepared via immunogenicity reduction and affinity maturation. As a result, a total of 13 variants were prepared (Tables 5 and 6). The amino acid sequences of CDR 1 to CDR 3 for each of the variants are shown in Table 5, and the amino acid sequences of FR1 to FR4 for each of the variants are shown in Table 6.

(134) TABLE-US-00005 TABLE 5  Antibody CDR1 CDR2 CDR3 hzVSF_var Heavy GYNMN (SEQ ID NIDPYYGSDTYAQKFQ ETGTRAMDY 7 chain NO: 2) G (SEQ ID NO: 14) (SEQ ID NO: 4) Light RASENIYSNL VATNLAD (SEQ ID QHFYGSPRT chain A (SEQ ID NO: 5) NO: 6) (SEQ ID NO: 7) hzVSF_var  Heavy GYNMN (SEQ ID NIDPYYGSDTYAQKFQ ETGNRAMD 8 chain NO: 2) G (SEQ ID NO: 14) (SEQ ID NO: 15) Light RASENIYSNL VATNLAD (SEQ ID QHFYGSPRT chain A (SEQ ID NO: 5) NO: 6) (SEQ ID NO: 7) hzVSF_var  Heavy GYNMN (SEQ ID NIDPYYGSDTYAQKFQ ETGTRAMDY 9 chain NO: 2) G (SEQ ID NO: 14) (SEQ ID NO: 4) Light RASENIYSNL VADNRGD (SEQ ID QHFYGSPRT chain A (SEQ ID NO: 5) NO: 18) (SEQ ID NO: 7) hzVSF_var Heavy GYNMN (SEQ ID NIDPYYGSDTYAQKFQ ETGNI ID 10 chain NO: 2 G (SEQ ID NO: 14) (SEQ ID NO: 15) Light RASENIYSNL VADNRGD (SEQ ID QHFYGSPRT chain A (SEQ ID NO: 5) NO: 18) (SEQ ID NO: 7) hzVSF_var Heavy GYNMN (SEQ ID NIDPYYGSDTYAQKFQ ETGTRAMDY 11 chain NO: 2) G (SEQ ID NO: 14) (SEQ ID NO: 4) Light RASENIYSNL VADNRGD (SEQ ID QHFYGTPRT chain A (SEQ ID NO: 5) NO: 18) (SEQ ID NO: 19) hzVSF_var  Heavy GYNMN SEQ ID NIDPYYGSDTYAQKFQ ETGNRAMD 12 chain NO: 2) G (SEQ ID NO: 14) (SEQ ID NO: 15) Light RASENIYSNL VADNRGD (SEQ ID QHFYGTPRT chain A (SEQ ID NO: 5) NO: 18) (SEQ ID NO: 19) hzVSF_var Heavy GYNMN SEQ ID NIDPYYGSDTYAQKFQ ETGTRAMDY 13 chain NO: 2) G (SEQ ID NO: 14) (SEQ ID NO: 4) Light RASENIYSNL VADNLAD (SEQ ID QHFYGSPRT chain A (SEQ ID NO: 5) NO: 16) (SEQ ID NO: 7)

(135) TABLE-US-00006 TABLE 6 Antibody FR1 FR2 FR3 FR4 hzVSF_WT Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 22 NO: 23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var1 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 22 NO: 23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var2 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 22 NO: 23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var3 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 22 NO: 23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var4 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 22 NO: 23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var5 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 22 NO: 23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var6 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 28 NO: 23 (K74T, I76A) Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var7 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 28 NO: 23 (K74T, I76A) Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var8 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 28 NO: 23 (K74T, I76A) Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var9 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 28 NO: 23 (K74T, I76A) Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var10 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 28 NO: 23 (K74T, I76A) Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var11 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 28 NO: 23 (K74T, I76A) Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var12 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 28 NO: 23 (K74T, I76A) Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27 hzVSF_var13 Heavy SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 20 NO: 21 NO: 22 NO: 23 Light SEQ ID SEQ ID SEQ ID SEQ ID chain NO: 24 NO: 25 NO: 26 NO: 27

(136) It was confirmed that all of the 13 variants prepared above had reduced immunogenicity compared to those of the wild-type.

EXAMPLE 5-3

Confirmation of Epitope Counts of hzVSF Wild-Type and Variants Thereof

(137) The epitope counts of the hzVSF wild-type; hzVSF_var12 and hzVSF_var13, which are the representative variants among the variants with reduced immunogenicity of the wild-type; and four kinds of blockbuster antibody drugs currently available in the pharmaceutical market were compared. As a result, the possibility of relative immunogenicity in each HLA class II was confirmed, as shown in Table 7.

(138) TABLE-US-00007 TABLE 7 Type of Protein DRB1 DRB 3/4/5 DQ DP Total hzVSF wt 31 17 1 3 52 hzVSF_var1 30 18 1 3 52 hzVSF_var2 30 17 0 3 50 hzVSF_var3 30 16 0 3 49 hzVSF_var4 28 16 0 3 47 hzVSF_var5 30 16 1 3 50 hzVSF_var6 29 16 1 3 49 hzVSF_var7 28 15 1 3 47 hzVSF_var8 27 14 1 3 45 hzVSF_var9 27 14 0 3 44 hzVSF_var10 26 13 0 3 42 hzVSF_var11 25 14 0 3 42 hzVSF_var12 24 13 0 3 40 hzVSF_var13 29 17 0 3 49 Humira (human) 25 12 4 1 42 Remicade (chimeric) 74 37 3 1 115 Rituxan (chimeric) 65 33 9 3 110 Herceptin 40 20 3 1 64 (humanized)

(139) In Table 7, a higher total value means that there is a higher likelihood of adverse effects due to the HLA class II. From the above results, it was confirmed that the epitope counts of the hzVSF_var12 and hzVSF_var13 with reduced immunogenicity of the present invention were similar to that of Humira, which has the lowest epitope count among the four kinds of pharmaceutical drugs. These results suggest that the humanized antibodies of the present invention would have a very low level of serious side effects that may arise, and thus support the safety of the humanized antibodies of the present invention as safe drugs.

EXAMPLE 5-4

Confirmation of T Cell Analysis of hzVSF Variants

(140) In order to evaluate the immunogenicity of the hzVSF_var12 and hzVSF_var13, it was confirmed whether the material examined by in vitro T cell analysis of Lonza can have an effect on T cell proliferation using the blood samples of 51 healthy donors. The total peripheral blood mononuclear cells (PBMC) of each donor were treated with the hzVSF_var12, hzVSF_var13, or Keyhole limpet hemocyanin (KLH) and cultured for 7 days. The KLH is an oxygen-carrying metalloprotein that can be used as a carrier protein in the production of antibodies, and it was used as a positive control for its ability to effectively elicit immune responses. Then, the ratio (%) of T cells stained with CD3.sup.+CD4.sup.+Edu.sup.+ was measured. As a result, the KLH showed T cell proliferation in 45 blood donors (a response rate of 88%), whereas the hzVSF_var12 and hzVSF_var13 induced T cell proliferation in only 3 subjects (a response rate of 5.8%), in response to the material (FIG. 14).

(141) Meanwhile, the stimulation index (SI) of T cell proliferation induced by the KLH, hzVSF_v12, or hzVSF_v13 was calculated using the PBMC cultured as a control for 7 days. When the SI value is greater than 2, the immunogenicity is expected to be large when applied to humans. In contrast, when the SI value is less than 0.5, T cell proliferation is expected to be inhibited. As a result, it was confirmed that the hzVSF_v12 and hzVSF_v13 showed low SI values of 1.12 and 1.03, respectively, and also showed SI values in the range of 0.6 or greater and 2 or less. In contrast, the KUL which was used as a positive control, showed a high SI value of 3.91 (FIGS. 15 and 16; and Table 8).

(142) TABLE-US-00008 TABLE 8 Product (Antigen) Mean SI p-value hzVSF_var12 1.12 0.008 hzVSF_var13 1.05 0.3229 KLH 3.91 <0.0001

(143) From the above results, it is expected that the hzVSF_v12 and hzVSF_v13 would have less immunogenicity when administered to patients having skin diseases and subsequently have few side effects.

EXAMPLE 6

Investigation of Reactivity Between Human Normal Tissues and VSF

(144) Hereinafter, the therapeutic effects of the hzVSF (hereinafter, VSF) prepared and confirmed in Examples 1 to 5 on skin diseases were confirmed in various ways.

(145) First, in order to investigate activity between human normal tissues and VSF, immunohistochemical staining was performed with mVSF using tissue microarray (TMA), a slide in which normal tissues for human major organs were arrayed.

(146) As a result, no staining by mVSF was observed at all in normal tissues (FIG. 17). Therefore, it can be seen that VR, which is a VSF receptor, is not expressed in normal tissues, and VSF will only act on skin cells with skin diseases. Additionally, VSF does not affect normal tissues, and thus it may have excellent pharmacological effects with small side effects, even when used as a pharmaceutical composition, etc.

EXAMPLE 7

Confirmation of VR Expression in Various Skin Diseases

(147) Since it was confirmed in Example 6 that YR was not expressed in normal tissues (normal cells), it was confirmed whether VR was expressed in skin tissues with skin diseases.

(148) First, immunohistochemical staining was performed with mVSF using slides on which skin tissues of patients with various skin diseases were fixed. Specific experimental method of each step is as follows:

EXAMPLE 7-1

Paraffin Embedding

(149) Skin specimens of tissues obtained from patients with skin disease were fixed for 48 hours in 10% neutral buffered formalin (NBF). The fixed solution (10% NBF) was removed from the fixed skin specimens and washed with 1× PBS for 30 minutes using an agitator. After removing 1× PBS, a dehydration process was performed in the agitator using 70%, 90%, and 100% alcohol for 1 hour each. Then, a clearing process was carried out as a pretreatment for 1 hour in a solution of xylene: 100% alcohol (1:1). Subsequently, a clearing process was carried out using xylene for 3 times within 1 hour, and an infiltration process was carried out using paraffin melted at 60° C. for 2 times within 1 hour. Thereafter, an infiltration process was carried out by treating paraffin melted in an oven at 60° C. to the skin specimens for 12 hours. 50% of the paraffin melted at 60° C. was filled into a mold using a paraffin section preparation machine, and then 50% of the melted paraffin was added thereto. The paraffin mold was then dried for 1 hour on a cold pad and 6 hours on an experimental table.

(150) After drying, the mold was removed to obtain a paraffin block, which was refrigerated (4° C.). Specifically, 80% of an ice box was filled with ice, and an appropriate amount of tap water was added to make a cold state, then the refrigerated paraffin block was placed in the ice box in the direction of the specimen. This was because the tissues may crack and suitable tissues may not be obtained, unless the block is kept in a cold state.

(151) Thereafter, the tissues were cut into 4 μm using a tissue cutting machine, and the thus-cut tissues were immersed in 50% alcohol and subsequently placed in a constant temperature bath at 43° C. The cut-skin tissues were attached to the slide. The slide was placed on a heating pad warmed to 43° C., dried for 1 hour, and then refrigerated (4° C.).

EXAMPLE 7-2

Hematoxylin-Eosin Staining (H&E Staining)

(152) The skin specimen slides were allowed to stand in xylene for 10 minutes. The slides were filled with new xylene, and allowed to stand therein for 10 minutes and then in 100% alcohol (1:1) for 3 minutes. Thereafter, deparaffinization was carried out by allowing the slides to stand in 100%, 95%, 90%, 70%, and 50% alcohol for 3 minutes each. After hydrating the slides for 10 minutes under running tap water, the slides were allowed to stand in Harris hematoxylin for 3 minutes to first stain the nuclei. Subsequently, the hydration process was performed for 5 minutes under running tap water.

(153) The slides were bleached by adding 1% hydrochloric acid (a few drops) to remove stained hematoxylin, and were allowed to stand in eosin for 3 minutes to stain surrounding tissues, followed by hydration for 3 minutes under running tap water. Thereafter, the slides were allowed to stand in 70%, 90%, 95%, and 100% alcohol for 3 minutes each and then allowed to stand in xylene for 5 minutes, and encapsulated with an organic solvent encapsulant. The slides were dried in the hood until the smell of xylene disappeared, and the tissues were observed under a microscope.

EXAMPLE 7-3

Immunohistochemistry (IHC) Staining

(154) The skin specimen slides were allowed to stand in xylene for 10 minutes. The slides were filled with new xylene, and allowed to stand therein for 10 minutes, and then in xylene: 100% alcohol (1:1) for 3 minutes. Thereafter, deparaffinization was carried out by allowing the slides to stand in 100%, 95%, 90%, 70%, and 50% alcohol for 3 minutes each. After hydrating the slides for 10 minutes under running tap water, the slides were allowed to stand in 3% hydrogen peroxide for 5 minutes and washed twice with PBS for 3 minutes each. The slides were added to the retrieval buffer and boiled in a microwave oven (95° C.) for 10 minutes (additional buffer was added when the buffer was boiled away so as to avoid drying of tissues). The buffer was cooled at room temperature for 30 minutes and washed twice with PBS twice for 3 minutes each. 1% bovine serum albumin (BSA) was prepared using 1× TBST (50 mM Tris, 150 mM NaCl, 0.1% Tween 20) and allowed to stand at room temperature for 1 hour. The slides were incubated overnight in a 4° C. constant humidity chamber with mVSF (1:50) and washed 3 times for 10 minutes using 1× TBST. Then, the slides were incubated with horseradish peroxidase (HRP)-conjugated anti-mouse IgG antibody (1:2000) for 30 minutes at room temperature and washed 3 times for 10 minutes using 1× TBST. Subsequently, the slides were allowed to stand in a diaminobenzidine (DAB): hydrogen peroxide (1:20) solution for 5 minutes to detect chromogens, and then allowed to stand in Harris hematoxylin for 30 seconds to stain the nuclei, followed by hydration under running tap water. Finally, the slides were encapsulated using a water-soluble encapsulant.

EXAMPLE 7-4

Confirmation Result of VR Expression in Skin Tissues of Patients with Skin Diseases

(155) In the same manner as above, the expression of VR, a receptor of VSF in skin tissues of patients with various skin diseases and a biomarker expressed only in skin cells with skin diseases, were confirmed through immunohistochemical staining.

(156) Specifically, a punch biopsy was performed on the skin tissue of patients with skin diseases to make paraffin blocks by the above method. Accordingly, H&E staining and immunohistochemical staining were performed with mVSF to confirm VR expression.

(157) As a result, as shown in FIGS. 18 to 20, VR was expressed in all skin tissues of 10 patients with pityriasis rosea, and VR was expressed 90% or more in the skin tissues of patients with herpes zoster, lichen simplex chronicus and herpes simplex. Additionally, VR was expressed 67% or more in the skin tissues of patients with circular eczema, molluscum contagiosum, psoriasis, verruca vulgaris, atopic dermatitis and allergic contact dermatitis. Finally, it was confirmed that VR expression was observed in the skin issues of 88 patients with skin diseases (a response rate of 80%) out of 110 patients.

(158) Therefore, VR, which can bind to the VSF, is expressed in the skin tissues of patients with pityriasis rosea, lichen simplex chronicus, nummular eczema, psoriasis, atopic dermatitis, etc., which are skin diseases of which the definite etiology has not yet been clarified. Thus, it can be implied that the treatment effect on the skin diseases can be expected by treatment with VSF.

(159) Accordingly, the therapeutic effect of VSF in patients with skin diseases was examined in more detail.

EXAMPLE 8

Evaluation of Therapeutic Efficacy of VSF in Patients with Skin Diseases

(160) The aim of this Example was to determine the therapeutic effect of VSF in patients with skin diseases.

(161) This evaluation was conducted under the guidance of dermatologists for a more objective evaluation of efficacy and was applied to patients who voluntarily requested the application of hzVSF.

(162) The efficacy of the hzVSF was evaluated using 50 μl of 5 mg/ml hzVSF dissolved in PBS for each application, and the treatment effect was visually evaluated by the dermatologists.

EXAMPLE 8-1

Confirmation of Therapeutic Efficacy of VSF in Patients with Psoriasis

(163) The psoriasis patient 1, who had psoriasis in his right leg, was applied with hzVSF to the knee lesion at the first visit (Aug. 17, 2016) and additionally applied with the same on Aug. 29, 2016 and Sep. 7, 2016.

(164) As a result, when the knee lesion was examined on Sep. 15, 2016, a remarkable therapeutic effect was observed in the knee area where the hzVSF was applied as compared to other areas, and when the lesion area was examined again on Oct. 20, 2016, which was about one month after the fourth application on Sep. 15, 2016, it was confirmed that the lesion area with application was reduced by 90% or more (FIG. 21).

(165) Therefore, it can be seen that the hzVSF prepared in Example 5 has an excellent therapeutic effect on skin diseases expressing VR, such as psoriasis.

(166) Meanwhile, the psoriasis patient 2 had psoriasis on his back, and a biopsy was performed at the first visit (Aug. 19, 2016) to confirm the expression of VR, a receptor of hzVSF, by immunohistochemistry staining, thereby confirming the degree of VR expression. At the first visit, hzVSF was applied to the lesion on the back, and when the lesion area was examined five days later, on August 24, the degree of keratin formation and redness were decreased by 50% or more (FIG. 22). Therefore, an excellent treatment effect was confirmed even in patient 2.

EXAMPLE 8-2

Confirmation of Therapeutic Efficacy of VSF in Patients with Lichen Simplex Chronicus

(167) The patient 1 with lichen simplex chronicus had a lesion on the right leg. At the first visit (Aug. 7, 2016), hzVSF was applied to the lesion area of the shin once every 5 days. When the lesion area was examined on Aug. 22, 2016, which was after third application, it was confirmed that 70% or more of keratin formation and redness was suppressed (FIG. 23).

(168) After that, hzVS was also applied to the lesion area of the ankle. Specifically, the shin area was applied with hzVS six times in total until Sep. 2, 2016, and examined a month later on Oct. 2, 2016. As a result, it was confirmed that the therapeutic effect was maintained without recurrence of the disease. The ankle was administered with the hzVS three times in total until Sep. 2, 2016, and examined a month later, on Oct. 2, 2016. As a result, it was confirmed that the lesion area was reduced by 50% or more (FIG. 23).

(169) The patient 2 with lichen simplex chronicus had lesions on the ankles of both legs and applied with hzVSF to the lesions at the first visit (Aug. 7, 2016). When the lesion areas were examined on Sep. 30, 2016, which was about six weeks after the second application on Aug. 19, 2016, it showed a therapeutic effect to the extent that the lesion was almost cured. In particular, upon application of hzVSF, the area where keratin formation occurred almost disappeared, and it showed a therapeutic effect to the extent that the lesion area was reduced by 90% or more (FIG. 24).

(170) The patient 3 with lichen simplex chronicus had lesions on the shin of the right leg, and received the first application of the hzVSF at the first visit (Sep. 17, 2016). When the lesion was examined on Sep. 19, 2016, which was two days later, it was confirmed that the lesion was decreased by 50% or more, confirming an excellent therapeutic effect of the hzVSF (FIG. 25).

EXAMPLE 8-3

Confirmation of Therapeutic Efficacy of VSF in Patients with Nummular Eczema

(171) The patient with nummular eczema had lesions on the right calf and received the application of hzVSF twice daily from the first visit (Feb. 9, 2018). When the lesion area was examined on Feb. 23, 2018 and Mar. 26, 2018, it was visually confirmed that the lesion area was ameliorated, and the EASI score, which measures erythema, edema/tubercles/papules, abrasions and lichenification, improved from 11 to 4 at the third visit (after 45 days), compared to the first visit. Additionally, pruritus was also ameliorated from 10 to 5 at the third visit, thereby confirming a therapeutic effect (FIG. 26).

EXAMPLE 8-4

Quantitative Measurement of Therapeutic Efficacy of VSF in Patients with Skin Diseases

(172) HzVSF was applied twice daily to the lesion areas of patients with lichen simplex chronicus, nummular eczema, eczema, atopic dermatitis and psoriasis from the first visit, and the lesion areas were examined at the second and third visits. In the case of lichen simplex chronicus, the experiment was progressed for an average of 40 days from the first visit to the third visit, and the EASI score improved from 8.5 to 4 on average and the pruritus from 6.5 to 2.5. In the case of nummular eczema, the experiment was progressed for an average of 36 days from the first visit to the third visit, and the EASI score improved fr©m 8.3 to 3 on average and the pruritus from 8 to 3. In the case of eczema, the experiment was progressed for 35 days from the first visit to the third visit, and the EASI score improved from 5 to 1 and the pruritus from 5 to 2. In the case of atopic dermatitis, the experiment was progressed for 42 days from the first visit to the third visit, and the EASI score improved from 10 to 4, and the pruritus from 6 to 2. In the case of dermatitis, the experiment was progressed for 35 days from the first visit to the third visit, and the EASI score improved from 6 to 3 and the pruritus from 5 to 4. In the case of psoriasis, the experiment was progressed for an average of 26 days from the first visit to the third visit, and the PASI score improved from 8 to 3.6 on average and the pruritus from 6.3 to 2.6. From these results, it was confirmed that the lesion areas were visually ameliorated, and the EASI score, which measures erythema, edema/tubercles/papules, abrasions, and lichenification, and the PASI score, which measures erythema, thickness, and scaling, were improved in all skin diseases at the third visit as compared to the first visit. Additionally, it was confirmed that the pruritus was also ameliorated at the third visit, thereby confirming a therapeutic effect (FIGS. 27 and 28).

(173) In conclusion, the VSF of the present invention, i.e., the hzVSF prepared in Examples 5 and 8, can exhibit an excellent therapeutic effect when applied to skin diseases expressing VR, such as psoriasis, lichen simplex chronicus, pityriasis rosea, herpes simplex, nummular eczema, molluscum contagiosum, verruca vulgaris, atopic dermatitis and allergic contact dermatitis. Therefore, it can be suggested that the VSF can effectively be used as a therapeutic composition for the prevention and treatment of skin diseases expressing VR, etc.

(174) One of ordinary skill in the art would recognize that the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the present invention is therefore indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within the scope of the present invention.