Replicase cycling reaction (RCR) and the related SamRNA designs thereof

12618068 ยท 2026-05-05

    Inventors

    Cpc classification

    International classification

    Abstract

    This invention generally relates to a novel composition of RNA/mRNA medicines as well as vaccines produced by using replicase- and/or RNA-dependent RNA polymerase (RdRp)-mediated RNA cycling reaction (RCR). The present invention is useful for developing a variety of self-amplifying RNA/mRNA (samRNA) medicines and vaccines containing at least a replicase/RdRp-binding site in the 5- or 3-end, or both, of any desired RNA molecule, including but not limited to antisense RNA (aRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA)/miRNA precursor, long non-coding RNA (lnRNA) and mRNA. These RNA molecules can be either in single-stranded or in double-stranded, or mixed, conformation. The samRNA so obtained is useful not only for producing RNA-based vaccines and/or medicines but also for generating the mRNA-associated proteins, peptides, and/or antibodies under a proper in-vitro or in-cell translation condition. The replicase/RdRp-binding sites used in samRNA are derived or modified from coronaviral (e.g. COVID-19) and/or hepatitis C viral (HCV) RNA-dependent RNA polymerases (RdRp) in either single-stranded or double-stranded compositions.

    Claims

    1. A novel composition of self-amplifying RNA (samRNA), comprising: at least an isolated RNA sequence flanked with at least a 5-end RdRp-binding site and at least a 3-end RdRp-binding site, so as to form at least a samRNA platform construct; wherein said 5-end RdRp-binding site contains a nucleotide sequence of UCWCYWA (SEQ ID NO: 2) and said 3-end RdRp-binding site contains a nucleotide sequence of UWRGWR (SEQ ID NO: 4) and wherein said isolated RNA sequence is not a viral genome, wherein W comprises A/U; wherein Y comprises U/C; and wherein R comprises A/G.

    2. The composition as defined in claim 1, wherein said 5-end and 3-end RdRp-binding sites contain over 57% complementarity to each other.

    3. The composition as defined in claim 1, wherein said isolated RNA is single-stranded.

    4. The composition as defined in claim 1, wherein said isolated RNA is double stranded.

    5. The composition as defined in claim 1, wherein said isolated RNA contains modified nucleotide analogs.

    6. The composition as defined in claim 1, wherein said isolated RNA is a pharmaceutical compound or composition.

    7. The composition as defined in claim 1, wherein a plurality of said 5-end and 3-end RdRp-binding sites are used together in a combination.

    8. The composition as defined in claim 1, wherein said isolated RNA is further formulated with at least a delivery agent for facilitating intracellular transfection.

    9. The composition as defined in claim 8, wherein said delivery agent is liposomal nanoparticles (LNP).

    10. The composition as defined in claim 1, wherein said samRNA is mRNA.

    11. The composition as defined in claim 1, wherein said samRNA is precursor microRNA (pre-miRNA).

    12. The composition as defined in claim 1, wherein said isolated RNA comprises a 5-cap molecule.

    13. The composition as defined in claim 1, wherein said isolated RNA comprises modified uridine nucleotides.

    14. The composition as defined in claim 1, wherein said isolated RNA comprises at least a Kozak sequence.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    (1) Referring particularly to the drawings for the purpose of illustration only and not limitation, there is illustrated:

    (2) FIG. 1 depicts the step-by-step procedure of the prior PCR-IVT methodology. For RNA production, a part or whole procedure of this PCR-IVT method can be adopted for either single or multiple cycle amplification of desired RNA products.

    (3) FIG. 2 depicts the step-by-step procedure of the presently invented RCR methodology. For preparing RCR-ready cDNA and/or samRNA templates, at least a coronaviral and/or HCV replicase/RdRp-binding site is incorporated into the 5- or 3-ends, or both, of the cDNAs of desired RNA sequences, using conventional RT-PCR or PCR methods. Then, a part or whole procedure of this novel RCR method is used to produce and amplify the desired RNA sequences from the RCR-ready cDNA/samRNA templates after single or multiple cycle amplification. Alternatively, since IVT and RCR methods can be performed simultaneously under the same buffer condition, the RCR-ready cDNA/samRNA templates can also be used as starting materials for amplifying the desired RNA sequences in a combined IVT-RCR reaction.

    (4) FIG. 3 depicts the designed structures of RCR-ready cDNA/samRNA templates. It is noted that the RCR-ready cDNA templates are in double-stranded DNA conformation (useful for IVT and combined IVT-RCR reactions), while the RCR-ready samRNA templates are in single-stranded RNA conformation (useful for RCR). For further enhancing the stability of RCR-ready samRNA templates, the uridine/uracil (U) contents of the templates can be replaced by pseudouridine, 5-methyluridine, methoxyuridine, or other modified nucleotide analogs.

    (5) FIG. 4 shows the Northern blot analysis results of markedly increased expressions of miR-302 microRNAs (i.e. from top to bottom: b, c, d, a) and RdRp mRNA (e.g. HCV NS5B or modified COVID-19 NSP12) in transfected human cells after co-transfection with RCR-ready miR-302 precursor microRNA (pre-miR-302) samRNA and viral RdRp mRNA templates (as shown in most right) compared to the result of cells transfected with only the pre-miR-302 samRNA template (in middle), demonstrating the evidence of RCR-mediated amplification in the transfected cells.

    (6) FIG. 5 shows Northern blot analysis results of RCR-ready cDNA and samRNA templates as well as the resulting samRNA products (i.e. samRNA sequences containing viral antigen proteins/peptides) amplified by RdRp enzymes in an in-vitro IVT-RCR reaction, demonstrating the evidence of RCR in vitro.

    (7) FIG. 6 shows the immunohistochemical staining of coronaviral (e.g. COVID-19) S 2 proteins produced in the mouse muscle cells in vivo after co-transfection with RCR-amplified S protein samRNA (from FIG. 5) and isolated RdRp mRNA (from FIG. 4), indicating that the present invention is useful for developing and manufacturing anti-viral mRNA vaccines.

    EXAMPLES

    (8) 1. Human Cell Isolation and Cultivation

    (9) Starting tissue cells can be obtained from either enzymatically dissociated skin cells using Aasen's protocol (Nat. Protocols 5, 371-382, 2010) or simply from the buffy coat fraction of heparin-treated peripheral blood cells. The isolated tissue samples must be kept fresh and used immediately by mixing with 4 mg/mL collagenase I and 0.25% TrypLE for 15-45 min, depending on cell density, and rinsed by HBSS containing trypsin inhibitor two times and then transferred to a new sterilized microtube containing 0.3 mL of feeder-free SFM culture medium (IrvineScientific, CA). After that, cells were further dissociated by shaking in a microtube incubator for 1 min at 37 C. and then transferred the whole 0.3 mL cell suspension to a 35-mm Matrigel-coated culture dish containing 1 mL of feeder-free SFM culture medium supplemented with formulated pre-miR-302+RdRp mRNA mixture, LIF, and bFGF/FGF2, or other optional defined factors. The concentrations of pre-miR-302+RdRp mRNA mixture, LIF, bFGF/FGF2, and other optional defined factors are ranged from 0.1 to 500 microgram (g)/mL, respectively, in the cell culture medium. The cell culture medium and all of the supplements must be refreshed every 2-3 days and the cells are passaged at about 50%60% confluence by exposing the cells to trypsin/EDTA for 1 min and then rinsing two times in HBSS containing trypsin inhibitor. For ASC expansion, the cells were replated at 1:5-1:500 dilution in fresh feeder-free MSC Expansion SFM culture medium supplemented with formulated pre-miR-302+RdRp mRNA mixture, LIF, bFGF/FGF2, and/or other optional defined factors. For culturing keratinocytes, cells are isolated from skin tissues and cultivated in EpiLife serum-free cell culture medium supplemented with human keratinocyte growth supplements (HKGS, Invitrogen, Carlsbad, CA) in the presence of proper antibiotics at 37 C. under 5% CO.sub.2. Culture cells are passaged at 50%-60% confluency by exposing cells to trypsin/EDTA solution for 1 min and rinsing once with phenol red-free DMEM medium (Invitrogen), and the detached cells are replated at 1:10 dilution in fresh EpiLife medium with HKGS supplements. Human cancer and normal cell lines A549, MCF7, PC3, HepG2, Colo-829 and BEAS-2B were obtained either from the American Type Culture Collection (ATCC, Rockville, MD) or our collaborators and then maintained according to manufacturer's or provider's suggestions. After reprogramming, the resulting iPS cells (iPSCs) were cultivated and maintained following either Lin's feeder-free or Takahashi's feeder-based iPSC culture protocols (Lin et al., RNA 14:2115-2124, 2008; Lin et al., Nucleic Acids Res. 39:1054-1065, 2011; Takahashi K and Yamanaka S, Cell 126:663-676, 2006).

    (10) 2. In-Vitro RNA Transfection

    (11) For intracellular delivery/transfection, 0.5-200 g of RCR-amplified RNA/mRNA (i.e. pre-miR-302 or coronaviral S protein mRNA) and RdRp mRNA mixture (ratio ranged from about 20:1 to 1:20) is dissolved in 0.5 ml of fresh cell culture medium and mixed with 1-50 l of In-VivoJetPEI or other similar transfection reagents. After 1030 min incubation, the mixture is then added into a cell culture containing 50%-60% confluency of the cultivated cells. The medium is reflashed every 12 to 48 hours, depending on cell types. This transfection procedure may be performed repeatedly to increase transfection efficiency.

    (12) 3. Preparation of RCR-Ready cDNA/samRNA Templates

    (13) Reverse transcription (RT) of desired RNA/mRNA is performed by adding about 0.01 ng-10 microgram (g) of isolated RNA/mRNA into a 20-50 L RT reaction (SuperScript III cDNA RT kit, ThermoFisher Scientific, MA, USA), following the manufacturer's suggestions. Depending on the RNA/mRNA amount, the RT reaction mixture further contains about 0.01-20 nmole RT primer, a proper amount of deoxyribonucleoside triphosphate molecules (dNTPs) and reverse transcriptase in 1RT buffer. Then, the RT reaction is incubated at 37-65 C. for 1-3 hours (hr), depending on the length and structural complexity of the desired RNA/mRNA sequences, so as to make the complementary DNA (cDNA) templates thereof for the next step of PCR. For isolation of viral RdRp mRNA, we have designed and used an RT-reverse primer 5-GACAACAGGT GCGCTCAGGT CCT-3 (SEQ ID NO: 13) to generate the coronaviral RdRp cDNA sequence, which already possesses internal motif sequences similar to SEQ ID NO:9.

    (14) Next, polymerase chain reaction (PCR) is performed by adding about 0.01 pg-10 g of the RT-derived cDNAs into a 20-50 L PCR preparation mixture (High-Fidelity PCR master kit, ThermoFisher Scientific, MA, USA), following the manufacturer's suggestions. Then, the PCR mixture is first incubated in five to twenty (5-20) cycles of denaturation at 94 C. for 1 mim, annealing at 30-55 C. for 30 sec-1 min, and then extension at 72 C. for 1-3 min, depending on the structure and length of the desired cDNA sequences. After that, another ten to twenty (10-20) cycles of PCR are performed with a series of sequential cycling steps of denaturation at 94 C. for 1 mim, annealing at 50-58 C. for 30 sec, and then extension at 72 C. for 1-3 min, depending on the structure and length of the resulting PCR products. Finally, the resulting PCR products are used as cDNA templates for IVT and RCR. For IVT-RCR template preparation, we design and use a specific pair of RCR-ready PCR primers for incorporating the identified RdRp-binding sites into the PCR-derived RdRp cDNA templates, including SEQ ID NO: 13 and 5-GATATCTAAT ACGACTCACT ATAGGGAGAG GTATGGTACT TGGTAGTT-3 (SEQ ID NO:14). Later, a 5-cap molecule, such as m7G(5)ppp(5)N and/or its analogs, may be further incorporated in the resulting mRNA products of IVT-RCR or RCR. On the other hand, we also design and use another pair of RCR-ready PCR primers for incorporating the identified RdRp-binding sites into the PCR-derived cDNA templates of human pre-miR-302 familial cluster (pre-miR-302), including 5-GATATCTAAT ACGACTCACT ATAGGGAGAT CTGTGGGAAC TAGTTCAGGA AGGTAA-3 (SEQ ID NO:15) and 5-GTTCTCCTAA GCCTGTAGCC AAGAACTGCA CA-3 (SEQ ID NO:16). In the current primer designs, various sequences and different combinations of RNA promoters and/or RdRp-binding sites can also be used, such as T7, T3, M13 and/or SP6 promoter, and at least an RdRp binding site must be incorporated in the 5-end or 3-end primers, or both.

    (15) For generating RCR-ready samRNA templates, since at least a promoter and at least an RdRp-binding site have been incorporated into the resulting PCR-derived cDNA products (served as RCR-ready cDNA templates), an IVT-RCR reaction can then be performed to amplify desired samRNA sequences from the cDNA templates. The IVT-RCR reaction mixture contains 0.01 ng10 g of the PCR-derived cDNA product, 0.1-50 U of isolated coronaviral RdRp/helicase (Abcam, MA, USA/Creative Enzymes, NY), a proper amount of ribonucleoside triphosphate molecules (rNTPs) and RNA polymerase (i.e. T7, T3, M13 and/or SP6) in 1 transcription buffer. The transcription buffer is commercially available and may be further adjusted according to the manufacturer's suggestions. Preferably, the 1 transcription buffer may further contain 0.00110 mM of betaine (trimethylglycine, TMG), dimethylsulfoxide (DMSO), and/or 3-(N-morpholino)propane sulfonic acid (MOPS), and/or a combination thereof. Then, the IVT-RCR reaction is incubated at 30-40 C. for 1-6 hr, depending on the stability and activity of the used RdRp and RNA polymerase enzymes.

    (16) 4. Novel RCR Protocol

    (17) The starting RCR mixture contains about 0.01 ng-10 g of the RCR-ready samRNA templates, about 0.1-50 U of isolated coronaviral RdRp/helicase, and a proper amount of rNTPs in 1 transcription buffer. RdRp/helicase is either an RdRp enzyme with an additional RNA unwinding activity or a mixture of RdRp and helicase. The transcription buffer is commercially available in the market and may be further adjusted according to the manufacturer's suggestions. Additionally, the 1 transcription buffer may further contain 0.00110 mM of betaine (trimethylglycine, TMG), dimethylsulfoxide (DMSO), and/or 3-(N-morpholino)propane sulfonic acid (MOPS), and/or a combination thereof, which facilitates the denaturation of highly structured RNA/DNA sequences, such as hairpins and stem-loop structures. After that, the RCR reaction is incubated at 20-45 C. for 1-6 hr, depending on the stability and activity of the used RdRp enzymes.

    (18) 5. RNA Purification and Northern Blot Analysis

    (19) Desired RNAs (10 g) are isolated with a mirVana RNA isolation kit (Ambion, Austin, TX) or similar purification filter column, following the manufacturer's protocol, and then further purified by using either 5%10% TBE-urea polyacrylamide or 1%3.5% low melting point agarose gel electrophoresis. For Northern blot analysis, the gel-fractionated RNAs are electroblotted onto a nylon membrane. Detection of the RNA and its IVT template (the PCR-derived cDNA product) is performed with a labeled [LNA]-DNA probe complementary to a target sequence of the desired RNA. The probe is further purified by high-performance liquid chromatography (HPLC) and tail-labeled with terminal transferase (20 units) for 20 min in the presence of either a dye-labeled nucleotide analog or [.sup.32P]-dATP (>3000 Ci/mM, Amersham International, Arlington Heights, IL).

    (20) 6. Protein Extraction and Western Blot Analysis

    (21) Cells (10.sup.6) are lysed with a CelLytic-M lysis/extraction reagent (Sigma) supplemented with protease inhibitors, Leupeptin, TLCK, TAME and PMSF, following the manufacturer's suggestion. Lysates are centrifuged at 12,000 rpm for 20 min at 4 C. and the supernatant is recovered. Protein concentrations are measured using an improved SOFTmax protein assay package on an E-max microplate reader (Molecular Devices, CA). Each 30 g of cell lysate are added to SDS-PAGE sample buffer under reducing (+50 mM DTT) and non-reducing (no DTT) conditions, and boiled for 3 min before loading onto a 68% polyacylamide gel. Proteins are resolved by SDS-polyacrylamide gel electrophoresis (PAGE), electroblotted onto a nitrocellulose membrane and incubated in Odyssey blocking reagent (Li-Cor Biosciences, Lincoln, NB) for 2 hr at room temperature. Then, a primary antibody is applied to the reagent and incubated the mixture at 4 C. After overnight incubation, the membrane is rinsed three times with TBS-T and then exposed to goat anti-mouse IgG conjugated secondary antibody to Alexa Fluor 680 reactive dye (1:2,000; Invitrogen-Molecular Probes), for 1 hr at the room temperature. After three additional TBS-T rinses, fluorescent scanning of the immunoblot and image analysis are conducted using Li-Cor Odyssey Infrared Imager and Odyssey Software v. 10 (Li-Cor).

    (22) 7. Immunostaining Assay

    (23) Cell/Tissue samples are fixed in 100% methanol for 30 min at 4 C. and then 4% paraformaldehyde (in 1PBS, pH 7.4) for 10 min at 20 C. After that, the samples are incubated in 1PBS containing 0.1%0.25% Triton X-100 for 10 min and then washed in 1PBS three times for 5 min. For immunostaining, primary antibodies were purchased from Invitrogen (CA, USA) and Sigma-Aldrich (MO, USA), respectively. Dye-labeled goat anti-rabbit or horse anti-mouse antibody are used as the secondary antibody (Invitrogen, CA, USA). Results are examined and analyzed at 100 or 200 magnification under a fluorescent 80i microscopic quantitation system with a Metamorph imaging program (Nikon).

    (24) 8. In Vivo Transfection Assay

    (25) The mixture of RCR-amplified samRNA and RdRp mRNA (ratio ranged from about 20:1 to 1:20) is mixed well with a proper amount of delivery agent, such as an In-VivoJetPEI transfection reagent or other similar LNP-based delivery/transfection agents, following the manufacturer's protocol, and then injected into blood veins or muscles of an animal, depending the purpose of applications. The delivery/transfection agent is used for mixing, conjugating, encapsulating or formulating the amplified samRNA and RdRp mRNA mixture, so as to not only protect the RNA contents from degradation but also facilitate the delivery/transfection of the samRNA and RdRp mRNA mixture into specific target cells of interest in vitro, ex vivo and/or in vivo.

    (26) 9. Statistic Analysis

    (27) All data were shown as averages and standard deviations (SD). Mean of each test group was calculated by AVERAGE of Microsoft Excel. SD was performed by STDEV. Statistical analysis of data was performed by One-Way ANOVA. Tukey and Dunnett's t post hoc test were used to identify the significance of data difference in each group. p<0.05 was considered significant (SPSS v 12.0, Claritas Inc).

    REFERENCES

    (28) 1. WO2002/092774 to Shi-Lung Lin et al. 2. U.S. Pat. No. 7,662,791 to Shi-Lung Lin et al. 3. U.S. Pat. No. 8,080,652 to Shi-Lung Lin et al. 4. U.S. Pat. No. 8,372,969 to Ying SY and Shi-Lung Lin. 5. U.S. Pat. No. 8,609,831 to Shi-Lung Lin and Ying SY. 6. Shi-Lung Lin and Ji H; cDNA library construction using in-vitro transcriptional amplification. Methods Mol Biol. 221:93-101, 2003. 7. Ahn et al.; Biochemical characterization of a recombinant SARS coronavirus nsp12 RNA-dependent RNA polymerase capable of copying viral RNA templates. Arch. Virol. 157:2095-2104, 2012. 8. Bloom et al; Self-amplifying RNA vaccines for infectious diseases. Gene Therapy 28:117-129, 2021. 9. McDowell et al.; Determination of intrinsic transcription termination efficiency by RNA polymerase elongation rate. Science 266:822-825, 1994. 10. Aasen et al.; Isolation and cultivation of human keratinocytes from skin or plucked hair for the generation of induced pluripotent stem cells. Nat. Protocols 5:371-382, 2010. 11. Shi-Lung Lin et al.; Mir-302 reprograms human skin cancer cells into a pluripotent ES-cell-like state. RNA 14:2115-2124, 2008. 12. Shi-Lung Lin et al.; Regulation of somatic cell reprogramming through inducible mir-302 expression. Nucleic Acids Res. 39:1054-1065, 2011. 13. Takahashi K and Yamanaka S; Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663-676, 2006. 14. Hillen et al.; Structure of replicating SARS-CoV-2 polymerase. Nature 584:154-159, 2020.

    SEQUENCE LISTING

    (29) TABLE-US-00001 (1)GENERALINFORMATION: (iii)NUMBEROFSEQUENCES:16 (2)INFORMATIONFORSEQIDNO:1: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:6basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:1: AUSUGW (2)INFORMATIONFORSEQIDNO:2: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:7basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:2: UCWCYWA (2)INFORMATIONFORSEQIDNO:3: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:6basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:3: WCASAU (2)INFORMATIONFORSEQIDNO:4: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:6basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:4: UWRGWR (2)INFORMATIONFORSEQIDNO:5: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:6basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:5: AUCUGU (2)INFORMATIONFORSEQIDNO:6: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:7basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:6: UCUCUAA (2)INFORMATIONFORSEQIDNO:7: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:7basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:7: UCUCCUA (2)INFORMATIONFORSEQIDNO:8: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:5basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:8: UUCAA (2)INFORMATIONFORSEQIDNO:9: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:6basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:9: ACAGAU (2)INFORMATIONFORSEQIDNO:10: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:7basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:10: UUAGAGA (2)INFORMATIONFORSEQIDNO:11: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:7basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:11: UAGGAGA (2)INFORMATIONFORSEQIDNO:12: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:5basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:RNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:12: UUGAA (2)INFORMATIONFORSEQIDNO:13: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:23basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:DNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:YES (xi)SEQUENCEDESCRIPTION:SEQIDNO:13: GACAACAGGTGCGCTCAGGTCCT (2)INFORMATIONFORSEQIDNO:14: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:48basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:DNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:14: GATATCTAATACGACTCACTATAGGGAGAGGTATGGTACT TGGTAGTT (2)INFORMATIONFORSEQIDNO:15: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:56basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:DNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:NO (xi)SEQUENCEDESCRIPTION:SEQIDNO:15: GATATCTAATACGACTCACTATAGGGAGATCTGTGGGAAC TAGTTCAGGAAGGTAA (2)INFORMATIONFORSEQIDNO:16: (i)SEQUENCECHARACTERISTICS: (A)LENGTH:32basepairs (B)TYPE:nucleicacid (C)STRANDEDNESS:single (D)TOPOLOGY:linear (ii)MOLECULETYPE:DNA (A)DESCRIPTION:/desc=synthetic (iii)HYPOTHETICAL:NO (iv)ANTI-SENSE:YES (xi)SEQUENCEDESCRIPTION:SEQIDNO:16: GTTCTCCTAAGCCTGTAGCCAAGAACTGCACA