Methods, culture medias and devices for generating embryos in vitro from stem cells
12618830 ยท 2026-05-05
Assignee
Inventors
- Magdalena D. Zernicka-Goetz (Pasadena, CA, US)
- Gianluca Amadei (Cambridge, GB)
- Charlotte Handford (Cambridge, GB)
Cpc classification
C12N2506/025
CHEMISTRY; METALLURGY
C12N2501/119
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
International classification
G01N33/50
PHYSICS
Abstract
Disclosed herein include methods and compositions for culture medias for in vitro culture of synthetic embryos from mammalian pluripotent stem cells and extra-embryonic stem cells. The methods and compositions described herein can generate synthetic embryos at different developmental stage reaching early organogenesis and beyond. Disclosed herein also include an embryo culturing system and methods of using same.
Claims
1. A method of generating a synthetic embryo in vitro, the method comprising: (a) co-culturing at least one mammalian pluripotent stem cell and an extra-embryonic stem cell in a first culture media under a static condition allowing the mammalian pluripotent stem cell and the extra-embryonic stem cell to self-assemble into a post-implantation embryo structure; (b) culturing the post-implantation embryo structure in a second culture media under a static condition allowing the post-implantation embryo structure embryo structure to develop into a neurulating embryo structure, wherein the second culture media comprises a basal culture medium, human cord serum, and bicarbonate or HEPES; and (c) culturing the neurulating embryo structure for at least one day in the second culture media under a dynamic condition in a culture chamber allowing the neurulating embryo structure to develop into a synthetic embryo of at least early organogenesis stage.
2. The method of claim 1, wherein the at least one mammalian pluripotent stem cell comprises a wild type mammalian embryonic stem cell and a mammalian embryonic stem cells modified to express an inducible GATA transcription factor upon induction.
3. The method of claim 1, wherein the at least one extra-embryonic stem cell comprises a trophoblast stem cell.
4. The method of claim 2, wherein the GATA transcription factor is GATA4.
5. The method of claim 1, wherein the mammalian pluripotent stem cell and the extra-embryonic stem cell are cultured in the first culture media for up to 4 days.
6. The method of claim 1, wherein step (a) is from embryonic day E0-E5.5 of a mouse embryo structure, step (b) is from embryonic day E5.5 to E8.0 of a mouse embryo structure, and/or step (c) is from embryonic day E8.0 to at least E8.5 of a mouse embryo structure.
7. The method of claim 1, wherein the post-implantation embryo structure is a post-implantation pre-gastrulation embryo structure.
8. The method of claim 1, wherein the post-implantation embryo structure resembles an E5.5 natural mouse embryo structure, the neurulating embryo structure resembles an E8.0 natural mouse embryo structure, and/or the generated synthetic embryo resembles an E8.5 natural mouse embryo structure, an E9.0 natural mouse embryo structure or beyond.
9. The method of claim 1, wherein the mammalian pluripotent stem cell and the extra-embryonic stem cell are cultured in a substrate, and wherein the substrate comprises a dish, a U-plate, a flask, a microwell plate, or inverted pyramidal microwells.
10. The method of claim 1, wherein step (a) comprises culturing the mammalian pluripotent stem cell and the extra-embryonic stem cell in a feeder cell (FC) media and culturing the mammalian pluripotent stem cell and the extra-embryonic stem cell in an in vitro culture (IVC) media following culturing the mammalian pluripotent stem cell and the extra-embryonic stem cell in the FC media, wherein the FC media and the IVC media comprise a basal culture medium and wherein the basal culture medium comprises Dulbecco's Modified Eagle Media (DMEM), DMEM Nutrient Mixture 12 (DMEM/F12), a non-human serum or serum substitute thereof, a reducing agent, an antibiotic, L-glutamine or an analogue thereof, or any combination thereof.
11. The method of claim 10, wherein the mammalian pluripotent stem cell and the extra-embryonic stem cell are cultured in the FC media for about 2 days and in the IVC media for about 2 days.
12. The method of claim 10, wherein the FC media comprises DMEM, fetal bovine serum, sodium pyruvate, L-glutamine or an analogue thereof, MEM non-essential amino acids, 2-mercaptoethanol, penicillin and/or streptomycin, or any combination thereof.
13. The method of claim 10, wherein the IVC media comprises: a) insulin, an insulin analogue, or an insulin receptor agonist; b) estrogen, an estrogen analogue, or an estrogen receptor agonist; and c) progesterone, a progesterone analogue, or a progesterone receptor agonist.
14. The method of claim 10, wherein the IVC media comprises DMEM/F12, fetal bovine serum, L-glutamine or an analogue thereof, ITS-X, -estradiol, progesterone, N-acetyl-L-cysteine, penicillin and/or streptomycin, or any combination thereof.
15. The method of claim 1, wherein the post-implantation embryo structure is cultured in the second culture media for up to 3 days.
16. The method of claim 1, wherein the second culture media comprises DMEM, rat serum, human cord serum, L-glutamine or an analogue thereof, penicillin and/or streptomycin, HEPES, or any combination thereof.
17. The method of claim 1, wherein step (b) comprising supplying the second culture media with at least 3 mg/ml glucose.
18. The method of claim 1, wherein step (b) comprises culturing the post-implantation embryo structure in a media comprising about 1 mg/ml glucose for two days and culturing the post-implantation embryo structure in a media comprising about 3 mg/ml glucose for one day.
19. The method of claim 1, wherein the second culture media in step (c) comprises at least 30% non-human serum.
20. The method of claim 1, wherein the dynamic condition comprises suspension agitation.
21. The method of claim 1, wherein the culturing the neurulating embryo comprises providing a plurality of gases to the culture chamber at a gas pressure of about 0.5 to 1 psi.
22. The method of claim 1, wherein the culture chamber has an atmosphere comprising an incremental increase of oxygen concentration from about 5% to about 25%.
23. The method of claim 1, wherein the synthetic embryo has established brain regions, a neural tube, a beating heart, a gut tube, developing somites, and/or primordial germ cells.
24. The method of claim 1, wherein the method does not comprise any in vivo step.
25. The method of claim 1, wherein the synthetic embryo is a mouse embryo.
26. A synthetic embryo obtained by the method of claim 1.
27. The method of claim 1, wherein oxygen is supplied to the culture chamber at a constant concentration.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
DETAILED DESCRIPTION
(22) In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, similar symbols typically identify similar components, unless context dictates otherwise. The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are explicitly contemplated herein and made part of the disclosure herein.
(23) All patents, published patent applications, other publications, and sequences from GenBank, and other databases referred to herein are incorporated by reference in their entirety with respect to the related technology.
Definitions
(24) Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs. See, e.g. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, NY 1994); Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press (Cold Spring Harbor, NY 1989). For purposes of the present disclosure, the following terms are defined below.
(25) The term about, as used herein when referring to a measurable value such as an amount of a compound, dose, time, temperature, and the like, is meant to encompass variations of 10%, 5%, 1%, 0.5%, or even 0.1% of a specified amount.
(26) As used herein, the term differentiation can refer to the process by which an unspecialized (uncommitted) or less specialized cell acquires the features of a specialized cell such as, for example, a neuronal cell. A differentiated cell is one that has taken on a more specialized (committed) position within the lineage of a cell. The term committed, when applied to the process of differentiation, refers to a cell that has proceeded in the differentiation pathway to a point where, under normal circumstances, it will continue to differentiate into a specific cell type or subset of cell types, and cannot, under normal circumstances, differentiate into a different cell type or revert to a less differentiated cell type. As used herein, the lineage of a cell defines the heredity of the cell, i.e., which cells it came from and to what cells it can give rise. The lineage of a cell places the cell within a hereditary scheme of development and differentiation. As used herein, a lineage-specific marker can refer to a characteristic specifically associated with the phenotype of cells of a lineage of interest and can be used to assess the differentiation of an uncommitted cell to the lineage of interest.
(27) As used herein, markers, lineage markers or, lineage-specific markers can refer to nucleic acid or polypeptide molecules that are differentially expressed in a cell of interest. Differential expression can mean an increased level for a positive marker and a decreased level for a negative marker as compared to an undifferentiated cell. The detectable level of the marker nucleic acid or polypeptide is sufficiently higher or lower in the cells of interest compared to other cells, such that the cell of interest can be identified and distinguished from other cells using any of a variety of methods known in the art. In some embodiments, a marker can be enriched. The term enriched, as used herein, shall have its ordinary meaning, and can also refer to a statistically significant increase in levels of a gene product (e.g., mRNA and/or protein) in one condition as compared to another condition (e.g., in one cell layer as compared to another cell layer).
(28) The term, concentration as used herein shall have its ordinary meaning, and can also refer to (a) mass concentration, molar concentration, volume concentration, mass fraction, molar fraction or volume fraction, or (b) a ratio of the mass or volume of one component in a mixture or solution to the mass or volume of another component in the mixture or solution (e.g., ng/ml). In some embodiments, the concentration can refer to fraction of activity units per volume (e.g., U/ml).
(29) The term analogue as used herein refers to a compound which may be structurally related to the relevant molecule. The term agonist as used herein can refer to a compound which might not be structurally related to the relevant molecule. For example, an agonist may activate the relevant receptor by altering the conformation of the receptor. Nevertheless, in both cases the terms are used in this specification to refer to compounds or molecules which can mimic, reproduce or otherwise generally substitute for the specific biological activity of the relevant molecule.
(30) As used herein the phrase culture medium refers to a liquid substance used to support the growth and development of stem cells and of an embryo. The culture medium used according to some embodiments of the invention can be a water-based medium which includes a combination of substances such as salts, nutrients, minerals, vitamins, amino acids, nucleic acids, and/or proteins such as cytokines, growth factors and hormones needed for cell growth and embryo development.
(31) Disclosed herein includes an in vitro method of generating a synthetic embryo from stem cells. In some embodiments, the method comprises culturing a mammalian pluripotent stem cell and an extra-embryonic stem cell in a first culture media under a first static condition allowing the mammalian pluripotent stem cell and the extra-embryonic stem cell to self-assemble into a post-implantation embryo structure, culturing the post-implantation embryo structure in a second culture media under a second static condition allowing the post-implantation embryo structure to develop into a neurulating embryo structure, and culturing the neurulating embryo structure for at least one day under a dynamic condition in a culture chamber allowing the neurulating embryo structure to develop into a synthetic embryo of at least early organogenesis stage. Disclosed herein also includes a synthetic embryo structure obtained by the method disclosed herein.
(32) Disclosed herein also includes an in vitro culture (IVC) media for generating a synthetic embryo in vitro according to the methods disclosed herein. The in vitro IVC media comprises a basal culture medium comprising at least 20% non-human serum, insulin, an insulin analogue, or an insulin receptor agonist, estrogen, an estrogen analogue, or an estrogen receptor agonist, and progesterone, a progesterone analogue, or a progesterone receptor agonist.
(33) Disclosed herein also includes a method of investigating mechanisms involved in embryogenesis according to the in vitro methods disclosed herein.
(34) Methods for Generating Synthetic Embryos In Vitro from Stem Cells
(35) Embryonic stem (ES) cells can undergo many aspects of mammalian embryogenesis in vitro, but their developmental potential can be substantially extended by interactions with extraembryonic stem cells including trophoblast stem (TS) cells, extraembryonic endoderm stem (XEN) cells, and/or inducible XEN (iXEN) cells. Signals originating from extraembryonic tissues play an important role in patterning the epiblast and drive the establishment of the anterior-posterior axis.
(36) Embryoids have been previously assembled by aggregating ES cells with TS cells derived from extraembryonic ectoderm (ExE) precursors and XEN cells derived from extraembryonic visceral endoderm (VE) precursors. Substituting XEN cells with ES cells that transiently express the VE master regulator GATA4 (iXEN cells) have shown to improve the efficiency and developmental potential of the resulting ETiX embryoids. ETiX embryoids specify an anterior organizer, the anterior visceral endoderm (AVE), which migrates to position the primitive streak to initiate gastrulation movements 10 that are essential for subsequent development.
(37) Provided herein include methods and culture media for assembling synthetic embryos in vitro from mammalian pluripotent stem cells and extraembryonic stem cells, including for example ES cells, TS cells and iXEN cells. In some embodiments, the stem cell-derived synthetic embryos obtained using the methods and culture media disclosed herein can develop beyond gastrulation and neurulation to the equivalent of natural embryos 8.5 days post-fertilization or beyond. In some embodiments, the stem cell derived synthetic embryos establish all brain regions, a neural tube, a beating heart and a gut tube. The neural tube is flanked by developing somites and primordial germ cells (PGCs) form in the tail region. This complete embryo model develops within an extraembryonic yolk sac that forms blood islands. In some embodiments, the self-organization abilities of ES cells and extraembryonic stem cells to reconstitute mammalian development through and beyond gastrulation to neurulation and early organogenesis are demonstrated. Gastrulating and neurulating embryoids generated using the methods and culture media disclosed herein can offer a powerful, physiologically relevant model of post-implantation embryogenesis. These complete embryoids are also powerful in vitro models for dissecting the roles of diverse cell lineages and genes in development. Some of the methods and compositions disclosed herein are also disclosed in Amadei et al. Embryo model completes gastrulation to neurulation and organogenesis. Nature 610, no. 7930 (2022): 143-153, the content of which is incorporated herein by reference in its entirety.
(38) Disclosed herein includes an in vitro method of generating a synthetic embryo from stem cells. In some embodiments, the method comprises culturing a mammalian pluripotent stem cell and an extra-embryonic stem cell in a first culture media under a first static condition allowing the mammalian pluripotent stem cell and the extra-embryonic stem cell to self-assemble into a post-implantation embryo structure (e.g., post-implantation pre-gastrulation embryo structure). The method can further comprise culturing the post-implantation embryo structure in a second culture media under a second static condition allowing the post-implantation embryo structure to develop into a neurulating embryo structure. The method can further comprise culturing the neurulating embryo structure for at least one day under a dynamic condition in a culture chamber allowing the neurulating embryo structure to develop into a synthetic embryo of at least early organogenesis stage. Disclosed herein also includes a synthetic embryo structure obtained by the method disclosed herein.
(39) In some embodiments, the methods disclosed herein do not comprise any in vivo step. In some embodiments, none of the mammalian pluripotent stem cell, the extra-embryonic stem cell, the post-implantation embryo structure and the neurulating embryo structure is present in an in vivo environment in any of the culturing steps disclosed herein. The in vivo environment can comprise a tissue, an organ, an organism, or a combination thereof.
(40) Stem Cells and Mammalian Development
(41) Disclosed herein are methods and compositions for, e.g., modelling mammalian early embryo development, by culturing mammalian pluripotent stem cells and at least one extra-embryonic stem cell (e.g., two types of extra-embryonic stem cells) in vitro. In some embodiments, the method comprises: (a) culturing a mammalian pluripotent stem cell and at least one extra-embryonic stem cell in a first culture media under a first static condition allowing the mammalian pluripotent stem cell and the extra-embryonic stem cell to self-assemble into a post-implantation structure, such as an early post-implantation structure (e.g., E5.5). In some embodiments, the mammalian pluripotent stem cell is an embryonic stem cell. In some embodiments, the mammalian pluripotent stem cell and the at least one extra-embryonic stem cell can self-assemble into a gastrulating embryo structure under the first static condition.
(42) While mammalian embryogenesis has some common features across all species, it will be appreciated that different mammalian species develop in different ways and at different rates. In general, though, the fertilized egg undergoes a number of cleavage steps (passing through two cell, four cell and eight cell stages) before undergoing compaction to form a solid ball of cells called a morula, in which the cells continue to divide. Ultimately the internal cells of the morula give rise to the inner cell mass and the outer cells to the trophectoderm. The morula in turn develops into the blastocyst, which is surrounded by trophectoderm and contains a fluid-filled vesicle, with the inner cell mass atone end.
(43) The term embryo as used herein refers to a mammalian organism from the single cell stage. The embryo described herein is generated from culturing in vitro from stem cells under appropriate conditions and resembles a natural embryo produced in vivo of a corresponding stage, such as having similar morphology, length, weight cell type compositions and expression of developmental marker genes.
(44) A developmental stage of an embryo can be defined by the development of specific structures and can be used to define equivalent stages in development of other species. In some embodiments, a developmental stage of an embryo can be defined according to Carnegie stages, which is a standardized system used to provide a unified developmental chronology of the vertebrate embryo. The earliest Carnegie stages are as follows in Table 1.
(45) TABLE-US-00001 TABLE 1 Carnegie Stages of Development Days since Carnegie ovulation stage (approx.) Characteristic events/structures 1 1 fertilization; polar bodies 2 2-3 cleavage; morula; compaction 3 4-5 blastocyst and blastocoele; trophoblast and embryoblast 4 6 syncytiotrophoblast; cytotrophoblast; anchoring to endometrium 5(a) 7-8 implantation; embryonic disc; bilaminar germ disc; primary yolk sac; 5(b) 9-10 formation of trophoblast lacunae; complete penetration into endometrium; amniotic cavity; primary umbilical vesicle 5(c) 11-16 pre-chordal plate; extra-embryonic mesoblast; secondary yolk sac 6 17 primitive streak, primitive node, primitive groove; secondary umbilical vesicle; primordial germ cells; body stalk; early gastrulation. 7 19 Gastrulation; neural plate; start of hematopoiesis. 8 23 Primitive pit 9 25 Neural groove; neural folds; septum transversum; placode; early heart.
(46) In some embodiments, the mammalian embryos generated herein are mouse embryos. Theiler has established numbered stages of murine development. The earliest stages, as applied to (C57BLxCBA)F1 mice, arc described in the emouse digital atlas (www.emouseatlas.org) as follows in Table 2.
(47) TABLE-US-00002 TABLE 2 Theiler Stages of Development Theiler Stage Dpc* (range) 1 0-0.9 (0-2.5) Cell number (C57BLxCBA)F1 mice 2 1 (1-2.5) 2-4 Dividing egg 3 2 (1-3.5) 4-16 (or 8-16) Morula 4 3 (2-4) 16-40 (or 16-32) Blastocyst, inner cell mass apparent 5 4 (3-5.5) Blastocyst (zona-free) 6 4.5 (4-5.5) Attachment of blastocyst; primary endoderm covers blastocoelic surface of inner cell mass 7 5 (4.5-6) Implantation and formation of egg cylinder; Ectopiacental cone appears, enlarged epiblast, primary endoderm lines mural trophectoderm 8 6 (5-6.5) Differentiation of egg cylinder. Implantation sites 2x3 mm. Ectopiacental cone region invaded by maternal blood, Reichert's membrane and proamniotic cavity form 9a 6.5 (6.25-7.25) Pre-streak(PS). advanced endometrial reaction, ecto lacental cone invaded by blood, extraembryonic ectoderm, embryonic axis visible 9b Early streak(ES), gastrulation starts, first evidence of mesoderm 10a 7 (6.5-7.75) Mid streak (MS), amniotic fold starts to form 10b Late streak, no bud (LSOB), exocoelom 10c Late streak, early bud (LSEB), allantoic bud first appears, node, amnion closing 11a 7.5 (7.25-8) Neural plate (NP), head process developing, amnion complete 11b Late neural plate (LNP), elongated allantoic bud 11c Early head fold (EHF) 11d Late head fold (LHF), foregut invagination 12a 8 (7.5-8.75) 1-4 somites, allantois extends, first branchial arch, heart starts to form, foregut pocket visible, preotic sulcus at 2-3 somite stage) 12b 5-7 somites, allantois contacts chorion at the end of TS12, Absent 2.sup.nd arch, >7 somites 13 8.5 (8-9.25) Turning of the embryo, 1.sup.st branchial arch has maxillary and mandibular components, 2.sup.nd arch present; Absent 3rd branchial arch 14 9 (8.5-9.75) Formation & closure of ant. neuropore, otic pit indented but not closed, 3.sup.rd branchial arch visible; Absent forelimb bud 15 9.5 (9-10.5) Formation of post, neuropore, forelimb bud, forebrain vesicle subdivides; Absent hindlimb bud, Rathke's pouch 16 10 (9.5-10.75) Posterior neuropore closes, Formation of hindlimb & tail buds, lens plate, Rathke's pouch; the indented nasal processes start to form; Absent thin & long tail 17 10.5 (10-11.25) Deep lens indentation, adv. devel. of brain tube, tail elongates and thins, umbilical hernia starts to form; Absent nasal pits 18 11 (10.5-11.25) Closure of lens vesicle, nasal pits, cervical somites no longer visible; Absent auditory hillocks, anterior footplate 19 11.5 (11-12.25) Lens vesicle completely separated from the surface epithelium, Anterior, but no posterior, footplate. Auditory hillocks first visible; Absent retinal pigmentation and sign of fingers 20 12 (11.5-13) Earliest sign of fingers, (splayedout), posterior footplate apparent, retina pigmentation apparent, tongue well-defined, brain vesicles clear; Absent 5 rows of whiskers, indented 21 13 (12.5-14) Anterior footplate indented, elbow and wrist identifiable, 5 rows of whiskers, umbilical hernia now clearly apparent; Absent hair follicles, fingers separate distally 22 14 (13.5-15) Fingers separate distally, only indentations between digits of the posterior footplate, long bones of limbs present, hair follicles in pectoral, pelvic and trunk regions; Absent open eyelids, hair follicles in cephalic region 23 15 Fingers & Toes separate, hair follicles also in cephalic region but not at periphery of vibrissae, eyelids open; Absent nail primordia, fingers 2-5 parallel 24 16 Reposition of umbilical hernia, eyelids closing, fingers 2-5 are parallel, nail primordia visible on Toes; Absent wrinkled skin, fingers & toes joined together 25 17 Skin is wrinkled, eyelids are closed, umbilical hernia is gone; Absent ear extending over auditory meatus, long whiskers 26 18 Long whiskers, eyes barely visible through closed eyelids, ear covers auditory meatus 27 19 Newborn Mouse *dpc indicates days post conception, with the morning after the vaginal plug is found being designated 0.5 dpc or EO.5.
(48) The developmental stage of a synthetic embryo generated herein can be defined according to its embryonic day. As used herein, the term embryonic day (E) in the context of a mammalian embryo (e.g., mouse embryo) refers to an embryo having developmental characteristic of an in vivo (in-uterine tube or in utero) mammalian embryo counterpart at the specified day following fertilization, wherein E0 is considered as the fertilized egg.
(49) In some embodiments, the methods and compositions described herein enable culture up to or through to post-implantation stages corresponding to Theiler stage 7, 8, 9(a), 9(b), 10(a), 10(b), 10(c), 11(a), 11(b), 11(c), 11(d), 12(a), 12(b), 13, 14, 15, 16 and beyond, Carnegei stage (a), 5(b), 5(c), 6, 7, 8, 9 and beyond, and corresponding stages in other species. In some embodiments, the synthetic embryo generated herein can reach post-implantation stages of E4, E4.5, ES, E5.5, E6, E6.5, E7, E7.5, E8, E8.5, E9, E9.5 and beyond.
(50) The methods and compositions herein described can be applied to embryos from any suitable mammalian species, such as: primates, including humans, great apes (e.g., gorillas, chimpanzees, orangutans), old world monkeys, new world monkeys; rodents (e.g., mice, rats, guinea, pigs, hamsters); cats; dogs; lagomorphs (e.g., rabbits); cows; sheep; goats; horses; pigs; and any other livestock, agricultural, laboratory or domestic mammals.
(51) The methods and compositions herein described can be applied to an embryo from any non-human mammal, including but not limited to those described above. Thus, any of the culture media embodiments defined herein may be capable of supporting development of a nonhuman mammalian embryo on a substrate from a pre-implantation stage of development to a post-implantation stage of development.
(52) The term pre-implantation stage can be used herein to refer to a stage of development earlier than the stage corresponding to Theiler stage 7, Carnegie stage 5(a), and corresponding stages in other species. As used herein, the term post-implantation stage can refer to a stage of development later than the stage corresponding to Theiler stage 7, Carnegie stage 5(a), and corresponding stages in other species. A post-implantation stage may be determined by detecting the up-regulation of one or more genes by the embryo. For example, such a stage may be determined by detecting one or more of the following changes: the epiblast up-regulates Fgf5; the primitive endoderm differentiates into visceral endoderm that up-regulates Cerl in a subpopulation of cells (the anterior visceral endoderm); the visceral endoderm up-regulates Eomes; and the trophectoderm up-regulate Hand1.
(53) Stem cells (e.g., mammalian pluripotent stem cells and extra-embryonic stem cells) can be cultured using the media, kits and methods described herein. The term stem cell as used herein can refer to a cell capable of retaining a constant potential for differentiation even after cell division. Examples of stem cells include: embryonic (ES) stem cells with pluripotency derived from a fertilized egg or clone embryo; epiblast stem cells; trophoblast stem cells; extraembryonic endoderm (XEN) stem cells; somatic stem cells and pluripotent stem cells that are present in tissues in a living organism e.g. hepatic stem cells, dermal stem cells, and reproductive stem cells that serve as the bases for respective tissues; pluripotent stem cells derived from reproductive stem cells; pluripotent stem cells obtained by nuclear reprogrammed somatic cells; totipotent stem cells and non-totipotent stem cells and the like. Also, partially committed stem cells e.g. progenitor cells may be cultured using the media and according to the methods described herein.
(54) The methods and compositions described herein may be applied to stem cells from any suitable mammalian species, such as: primates, including humans, great apes (e.g., gorillas, chimpanzees, orangutans), old world monkeys, new world monkeys; rodents (e.g., mice, rats, guinea pigs, hamsters); cats; dogs; lagomorphs (e.g., rabbits); cows; sheep; goats; horses; pigs; and any other livestock, agricultural, laboratory or domestic mammals. The methods and compositions described herein may be applied to stem cells from any non-human mammal, including but not limited to those described above. In some embodiments, the non-human mammals are rodents.
(55) The term pluripotent stem cell (PSC) as used herein refers to a stem cell permitting in vitro culture and having the potential for differentiating into all cells, but the placenta. The pluripotent stem cell has the potential to differentiate into any of the three germ layers: endoderm (which forms structures such as the gastrointestinal tract and the respiratory system), mesoderm (which forms structures such as the musculoskeletal system, the vascular system and the urogenital system), or ectoderm (which forms epidermal tissues and the nervous system).
(56) A PSC may be obtained from a fertilized egg, clone embryo, reproductive stem cell, or stem cell in tissue. Also included are cells having differentiation pluripotency similar to that of embryonic stem cells, conferred artificially by transferring several different genes to a somatic cell (also referred to as induced pluripotent stem cells or iPS cells). Induced pluripotent stem cells may be derived from any suitable source (e.g. hair follicles, skin cells, fibroblasts, etc.). Pluripotent stem cells can be prepared by known methods in the art. Any of the stem cells as defined herein may be derived from diseased or non-diseased tissue. Stem cells can be from any suitable mammalian species, such as: primates, including humans, great apes (e.g. gorillas, chimpanzees, orangutans), old world monkeys, new world monkeys; rodents (e.g. mice, rats, guinea pigs, hamsters); cats; dogs; lagomorphs (including rabbits); cows; sheep; goats; horses; pigs; and any other livestock, agricultural, laboratory or domestic mammals. The presently disclosed methods may be applied to stem cells from any non-human mammal, including but not limited to those described above.
(57) In some embodiments, the PSC cells disclosed herein are mammalian embryonic stem cells (ESCs). The term embryonic stem cell (ES cell) as used herein refers to a pluripotent stem cell derived from the inner cell mass of a blastocyst, which is an early-stage preimplantation embryo. It is envisaged that such cells may express genes involved in the naive pluripotency network (Oct4/Nanog, Sox2, Klf4 etc). Such cells may also have Oct4 proximal enhancer activity. They may contribute to all embryonic tissues in chimeras. The ES cells may be derived from mammalian embryos, obtained from iPS cells or obtained from appropriate cell lines. Non-limiting examples of said stem cells include embryonic stem cells of a mammal or the like established by culturing a pre-implantation early embryo, embryonic stem cells established by culturing an early embryo prepared by nuclear-transplanting the nucleus of a somatic cell, induced pluripotent stem cells (iPS cells) established by transferring several different transcriptional factors to a somatic cell, and pluripotent stem cells prepared by modifying a gene on a chromosome of embryonic stem cells or iPS cells using a gene engineering technique. More specifically, embryonic stem cells include embryonic stem cells established from an inner cell mass that constitutes an early embryo, embryonic stem cells established from a primordial germ cell, cells isolated from a cell population possessing the pluripotency of pre-implantation early embryos (for example, primordial ectoderm), and cells obtained by culturing these cells.
(58) As would be understood by a person of skill in the art, ES cells may be obtained from stem cell banks such as the UK stem cell bank from which you can acquire human stem cell lines for research. The Jackson Laboratory, US (who provide Jax mice) also stores and derives mouse ES cells which are available for purchase. It is preferred that the ES cells are obtained or are obtainable by a method that does not involve the destruction of human or non-human animal embryos.
(59) In some, embodiments, the at least one extra-embryonic stem cell comprises a trophoblast stem cell and an inducible extra-embryonic endoderm stem cell. The extra-embryonic stem cells in the methods described herein can be either genetically intact or genetically modified and capable of growth and self-renewal. In some embodiments, these cells may be derived from mouse embryos. These cells are preferably self-renewing stem cells which represent the extraembryonic stem cell compartment of the early embryo.
(60) The term trophoblast stem cell as used herein refers to stem cells derived from the trophoblast lineage of the embryo. The trophoblast stem cells are preferably not extra-embryonic cells derived from the two cell types which are precursors of the human placenta: the cytotrophoblast and the syncitiotrophoblast. These cells can be derived at late pre-implantation stages E4.5 or early post-implantation stages (E5.5) but the resulting cell lines are equivalent to the stem cell compartment existing in the extra-embryonic ectoderm of the post-implantation mouse egg cylinder. Transcription factors such as Elf5, Eomes, and Tfap2C mark this lineage. TS cells can also be considered as cells that are the precursors of the differentiated cells of the placenta. In the mouse, TS cells can be derived from outgrowths of either blastocyst polar trophectoderm or extraembryonic ectoderm, which originates from polar trophectoderm after implantation.
(61) The term extra-embryonic endoderm stem cell (XEN stem cell) as used herein refers to stem cells derived from the extraembryonic endoderm of an embryo (e.g., a mouse embryo). The extraembryonic endoderm is typically a derivative of the hypoblast cells that migrate into the blastocyst cavity (beginning on day 8 of human embryonic development), and line the cavity, giving rise to the primary and definitive yolk sacs. The extraembryonic endoderm fills the remaining cavity of the blastocyst. In some embodiments, the XEN stem cells used herein comprise an inducible XEN stem cell capable of expressing a GATA transcription factor upon induction (e.g., by doxycycline treatment). In some embodiments, the XEN cells also be induced from ESCs by overexpression of PrE-specific genes, GATA transcription factor (e.g., Gata4/6) or Sox17, or by treatment with growth factors. In some embodiments, the XEN stem cells used herein are inducible XEN stem cells capable of expressing GATA4 upon induction.
(62) In some embodiments, the mammalian pluripotent stem cell and the extra-embryonic stem cell are cultured in the first culture media for up to 4 to 5 days (e.g., 4 or 5 days). In some embodiments, step (a) is from embryonic day E0-E5.5. The PSCs can be mammalian embryonic stem cells (ESCs). The mammalian ESCs can be mouse ESCs. The ESCs and/or extra-embryonic stem cell can be genetically modified.
(63) Synthetic Embryos at Different Developmental Stages
(64) Provided herein include methods, compositions, and culture medias for modeling mammalian embryo development by culturing stem cells including pluripotent stem cells (e.g., embryonic stem cells) and extra-embryonic stem cells. The methods, compositions and culture media disclosed herein can generate synthetic embryos through various developmental stages.
(65) In some embodiments, the synthetic embryos generated using the methods and compositions described herein can reach a post-implantation (e.g., a post-implantation, pre-gastrulation stage). In some embodiments, the synthetic embryos generated herein can reach an early gastrulation stage. In some embodiments, the synthetic embryos generated herein can reach a late gastrulation stage. In some embodiments, the synthetic embryos generated herein can reach an early neurulation stage. In some embodiments, the synthetic embryos generated herein can reach a late neurulation stage. In some embodiments, the synthetic embryos generated herein can reach an early organogenesis stage or beyond.
(66) The embryo structures generated using the methods and culture medias described herein can comprise post-implantation embryos, e.g., post-implantation pre-gastrulation embryo structure. As used herein, the term post implantation pre gastrulation in the context of a mammalian embryo (e.g., a mouse embryo) refers to an embryo following the implanting blastocyst stage and prior to the early gastrulation stage and is characterized by an egg cylinder-shape prior to symmetry breaking. An embryo of a post implantation pre gastrulation stage can be defined as Theiler stages TS7-TS8 (see Table 2). In some embodiments, the post-implantation, pre-gastrulation stage refers to E4.5-6.5, optionally, E4.5-6, optionally E5-6.5, optionally E5-5.5. In some embodiments, the post-implantation, pre-gastrulation stage refers to E5.5.
(67) In some embodiments, the post-implantation, pre-gastrulation embryo structure is generated by co-culturing a mammalian pluripotent stem cell and at least one extra-embryonic stem cell in a culture media (e.g., FC and/or IVC culture media) under a static condition allowing the mammalian pluripotent stem cell and the extra-embryonic stem cell to self-assemble into a post-implantation, pre-gastrulation embryo structure. The co-culturing of the mammalian pluripotent stem cell and the at least one extra-embryonic stem cell can be up to 4 or 5 days. The co-culturing of the mammalian pluripotent stem cell and the at least one extra-embryonic stem cell can be from embryonic day E0-E5.5.
(68) Embryonic stage of a synthetic embryo structure generated using the methods and culture medias disclosed herein can be assessed by comparing to an in vivo natural embryo counterpart at the same developmental stage by multiple ways including, but not limited to, morphology, length, weight, cell type compositions and expression of developmental marker genes (e.g., Oct4, Nanog, Sox2, Klf4, Cdx2, Gata4, Gata6, Brachyury, Otx2, Fgf5 and others described in the Examples and known in the art) using specific antibodies or primers, or transcriptional profiling, single-cell RNA sequencing and other methods as further described in the Examples section. In some embodiments, the post-implantation pre-gastrulation embryo structure resembles an E5.5 natural embryo structure. In some embodiments, the post-implantation pre-gastrulation embryo structure and an E5.5 natural embryo structure have similar morphology, cell type compositions, and gene expression features. In some embodiments, the post-implantation pre-gastrulation embryo structure comprises cavitated epithelial embryonic stem (ES) cell and trophoblast stem (TS) cell compartments enveloped by a VE-like layer (see, for example,
(69) In some embodiments, the embryo structures generated using the methods and culture medias described herein comprise post-implantation embryos, e.g., early gastrulation embryo structure. As used herein, the term gastrulation in the context of an embryo refers to an embryo following the expanded blastocyst stage and prior to the somitogenesis stage and is characterized by the formation of the primitive streak and epithelial to mesenchymal transition forming three germinal layers. The gastrulation process is generally considered as the process through which the bilaminar embryonic disc is changed into a trilaminar disc as an intraembryonic mesoderm appears between the ectoderm and endoderm. As used herein, the term early gastrulation in the context of a mammalian embryo (e.g., mouse embryo) refers to an embryo following the post-implantation pre-gastrulation stage and prior to a late gastrulation stage and is characterized by egg cylinder shape with the primitive streak at the posterior side. An embryo of an early gastrulation stage can be defined as Theiler stages TS8-TS10 (see Table 2). In some embodiments, the early gastrulation stage refers to E5-7.75, optionally E5-6.5, optionally E6.25-7.25, optionally 6.5-7.75, optionally E6.5-E7.5. In some embodiments, the early gastrulation stage refers to E6.5-E7.
(70) In some embodiments, an early gastrulation embryo structure has a proamniotic cavity (resulting from the merger of cavities in the ES cell and TS cell compartments, a fully migrated AVE (as the boundary of the ES cell and TS cell compartments) and gastrulating. The gastrulation can be revealed by the epithelial-to-mesenchymal transition and formation of a cell layer between the ES cells and VE-like layers (see, for example,
(71) In some embodiments, culturing of an embryo structure from a post-implantation pre-gastrulation stage to an early gastrulation stage is achieved by culturing the embryo structure in a culture media (e.g., an IVC media, a post-implantation culture media, or both) for a suitable time period. In some embodiments, culturing of an embryo structure from a post-implantation pre-gastrulation stage to an early gastrulation stage is effected for at least one day (e.g., one, two or three days). In some embodiments, the culturing is from E5.5 to E6.6.
(72) In some embodiments, the gastrulating embryo structures generated using the methods and culture medias described herein resemble natural gastrulating embryos. In some embodiments, the synthetic gastrulating embryos and natural gastrulating embryos have similar morphology, cell type compositions, and gene expression features.
(73) In some embodiments, culturing of a post-implantation pre-gastrulation embryo structure to its early gastrulation stage is continued allowing the post-implantation embryo structure to develop into a late gastrulation stage or to complete gastrulation. As used herein, the term late gastrulation stage in the context of a mammalian embryo (e.g., a mouse embryo) refers to an embryo following the early gastrulation stage and prior to the early somite stage and is characterized by an egg cylinder-shaped embryo with differentiated definitive endoderm, mesoderm and ectoderm layers. An embryo of a late gastrulation stage can be defined as Theiler stages TS10-TS11 (see Table 2). In some embodiments, a late gastrulation stage can correspond to E6.5-8, optionally E6.5-7.75, optionally E7.25-8, optionally E7-8.
(74) In some embodiments, culturing of a post-implantation embryo structure is continued allowing the post-implantation embryo structure to develop through and beyond gastrulation to neurulation. Neurulation is typically considered as an embryo developmental process which begins when the notochord induces the formation of the central nervous system by signaling the ectoderm germ layer above it to form the thick and flat neural plate. The neural plate folds in upon itself to form the neural tube that will later differentiate into the brain and the spinal cord of the central nervous system. A neurulating embryo generated herein can be an embryo resembling any of a series of morphological phases during the neurulation process. A neurulating embryo generated herein can be at the early neurulation stage, in the middle of the neurulation stage, or at the late neurulation stage.
(75) In some embodiments, the neurulating embryo structure is generated by culturing a post-implantation embryo structure (e.g., a post-implantation pre-gastrulation embryo structure) in a culture media (e.g., a post-implantation culture media) under a condition (e.g., a static condition) allowing the post-implantation embryo structure to develop into a neurulating embryo structure. In some embodiments, culturing of the post-implantation embryo structure can be up to 3 days. In some embodiments, culturing of the post-implantation embryo structure can be from E5.5 to E8.0.
(76) In some embodiments, the neurulating embryo structures generated using the methods and culture medias described herein resemble natural neurulating embryos. In some embodiments, the synthetic neurulating embryos and natural neurulating embryos have similar morphology, cell type compositions, and gene expression features.
(77) In some embodiments, the neurulating embryo structure resembles an E7-9 natural embryo structure, optionally an E7.5-8.5 natural embryo structure, optionally an E7.5-8 natural embryo structure. In some embodiments, neurulating embryo structures generated herein display an anterior-posterior axis with bifurcating neural folds extending into a neural tube and culminating in a tail bud, a morphology that resembles the early headfold stage of an E8.0 natural embryo. Posterior to this, the tail bud joins with allantois tissue which connects to a developing chorion (see e.g.,
(78) In some embodiments, the neurulating embryo structure generated herein can express neuroectodermal and surface ectoderm markers including, but not limited to, Sox1, Sox2, Pax6, Pax3, Foxa2, Chordin, Shh, OTX2, FOXG1, PAX6, OLIG2, NKX2-2, SOX10, Brachyury, and others identifiable by a skilled person. The neurulating embryo can comprise a portion of SOX1-positive neural tube tissue culminated in two neural folds whereas the SOX1-negative, Brachyury-positive posterior exhibited a tail bud-like morphology. The neurulating embryo can have a Brachyury-positive notochord running below the neural tube.
(79) In some embodiments, the neurulating embryo structure generated herein comprises cells expressing markers of the hindbrain and spinal cord, prosencephalon, mesencephalon and midbrain-hindbrain boundary, including for example Ets1, Sox10, Fezf1, Lhx2, Sx3, En1 and Dmbx1.
(80) In some embodiments, the neurulating embryo structure can further develop into an embryo of somite stage or at a somitogenesis (e.g., from a late gastrulation and/or a neurulating stage to an early somite stage). As used herein, the term somitogenesis in the context of a mammalian embryo (e.g., mouse embryo) refers to an embryo following late gastrulation stage and prior to the early organogenesis stage and is characterized by the appearance of the first one to five somites distinguishable by bright field microscopy. An embryo of an early somite stage can be defined as Theiler stages TS12-TS13 (see Table 2). In some embodiments, early somitogenesis refers to E7.5-9.25, optionally E7.5-8.75, optionally E8-9.25, optionally E8-9. In some embodiments, early somite stage refers to E8.5.
(81) In some embodiments, the synthetic embryo structure described herein comprise cells expressing markers such as NKX2-5, GATA4, and/or MYH2, and/or having gene expression signatures leading to somite formation. The neurulating embryo structure can express cardiomyocyte markers such as troponin genes and myosin genes.
(82) In some embodiments, the method can comprise culturing a neurulating embryo structure for at least one day (e.g., one, two, three, four or more days) under a dynamic condition in a culture chamber allowing the neurulating embryo structure to develop into a synthetic embryo of an organogenesis stage. In some embodiments, the method comprises culturing an embryo (e.g., mouse embryo) at a somitogenesis to organogenesis stage in a dynamic condition under conditions that allow the embryo to develop into organogenesis stage and beyond. In some embodiments, the organogenesis stage is an early organogenesis stage. The term early organogenesis in the context of a mammalian embryo (e.g., mouse embryo) refers to an embryo following the somitogenesis stage and prior to the appearance of the heart beat stage and is characterized by formation of the neural tube and mesoderm migration. In some embodiments, the early organogenesis stage refers to E8-9, optionally E8-8.5, optionally E8.5 of a natural embryo. A synthetic embryo at the early organogenesis stage can demonstrate development of definitive endoderm, which gives rise to the gut and associated organs. The presence of foregut and hindgut pockets can be observed in a synthetic embryo at the early organogenesis stage. In some embodiments, the embryoid development described herein can proceed further beyond the early organogenesis stage in culture.
(83) In some embodiments, the synthetic embryo has developing somites and primordial germ cells. The synthetic embryo generated herein can have established brain regions, a neural tube, a beating heart, and/or a gut tube. The synthetic embryo generated herein can display one or more of the following features: headfolds with defined forebrain and midbrain regions, a beating heart-like structure, a trunk comprising a neural tube and somites, a tail bud containing neuromesodermal progenitors, a gut tube, and/or primordial germ cells.
(84) Culturing an embryo cell in vitro from stem cells (e.g., a mammalian pluripotent stem cell and at least one extra-embryonic stem cell) can be effected until reaching early organogenesis or any developmental stage therein-between. In some embodiments, culturing a synthetic embryo in vitro can be continued allowing the synthetic embryo at the early organogenesis to develop onwards.
(85) In some embodiments, the synthetic embryos generated using the methods and culture conditions described herein are mammalian embryos. In some embodiments, the mammalian embryos are non-human embryos, such as mouse embryos or rabbit embryos. In some embodiments, the mammalian embryos are human embryos.
(86) Culturing conditions mentioned above for generating synthetic embryos at different developmental stages, including media, type, pressure, oxygen concentrations and the like, are described in the sections below as well as in specific embodiments of mouse embryos in the Examples section.
(87) Embryonic stages of the synthetic embryos described herein can be assessed compared to an in vivo or natural embryo counterpart at the same developmental stage by multiple ways including, but not limited to, morphology, length, weight, weight, expression of developmental marker genes using specific antibodies or primers, transcriptional profiling and the like, as further described hereinbelow and in the Examples section.
(88) Morphology assessment of embryonic development can be performed by previously established morphological features such as described in Carnegie stages of development (see, for example, Table 1; Developmental stages in human embryos. R. O'Rahilly and F. Mller (eds), Carnegie Institution of Washington, Washington, DC, 1987), in Theiler stages of development (see, for example, Table 2; www.emouseatlas.org) or according to embryonic days.
(89) In some embodiments, one or more developmental markers as described herein can be used to assess the developmental stage of a synthetic embryo structure. Numerous methods exist in the art for detecting the presence, absence, or amount of a marker gene product (e.g., mRNA and/or protein), as well as its localization in an embryo structure or subcellular localization (e.g., nucleus and/or cytoplasm). Marker expression may be assessed by any of a wide variety of well-known methods for detecting expression of a transcribed molecule or a protein. Non-limiting examples of such methods include immunological methods for detection of secreted, cell-surface, cytoplasmic, or nuclear proteins, protein purification methods, protein function or activity assays, nucleic acid hybridization methods, nucleic acid reverse transcription methods, and nucleic acid amplification and sequencing methods.
(90) In some embodiments, activity of a particular gene is characterized by a measure of gene transcript (e.g., mRNA), by a measure of the quantity of translated protein, or by a measure of gene product activity. Marker expression can be monitored in a variety of ways, including by detecting mRNA levels, protein levels, or protein activity, any of which can be measured using standard techniques. Detection can involve quantification of the level of gene expression (e.g., genomic DNA, cDNA, mRNA, protein, or enzyme activity), or, alternatively, can be a qualitative assessment of the level of gene expression, in particular in comparison with a control level. The type of level being detected will be clear from the context.
(91) In another embodiment, detecting or determining expression levels of a marker and functionally similar homologs thereof, including a fragment or genetic alteration thereof (e.g., in regulatory or promoter regions thereof) comprises detecting or determining RNA levels for the marker of interest. In some embodiments, one or more cells from the synthetic embryo structure can be obtained and RNA is isolated from the cells. In some embodiments, RNA is obtained from a single cell. For example, a cell can be isolated from a tissue sample by laser capture microdissection (LCM). Using this technique, a cell can be isolated from a tissue section, including a stained tissue section, thereby assuring that the desired cell is isolated. It is also be possible to obtain cells from, e.g., the synthetic embryo cells and culture the cells in vitro, such as to obtain a larger population of cells from which RNA can be extracted. Methods for establishing cultures of non-transformed cells, i.e., primary cell cultures, are known in the art. In some embodiments, cells can be dissociated (e.g., by enzymatic or mechanical means), and isolated by methods known in the art (e.g., Fluorescence-Activated Cell Sorting, Microfluidics, etc.)
(92) When isolating RNA from, e.g., synthetic embryo structures at various developmental stages and/or cells comprising said synthetic embryo structures, it may be important to prevent any further changes in gene expression after the tissue or cells has been removed from the subject. Changes in expression levels are known to change rapidly following perturbations, e.g., heat shock or activation with lipopolysaccharide (LPS) or other reagents. In addition, the RNA in the tissue and cells may quickly become degraded. Accordingly, in a preferred embodiment, the tissue or cells obtained from a subject is snap frozen as soon as possible.
(93) RNA can be extracted from cells by a variety of methods, e.g., the guanidium thiocyanate lysis followed by CsCl centrifugation. Methods for obtaining RNA from single-cells are also known in the art. The RNA sample can then be enriched in particular species. In some embodiments, poly(A)+ RNA is isolated from the RNA sample. In general, such purification takes advantage of the poly-A tails on mRNA. In particular and as noted above, poly-T oligonucleotides may be immobilized within on a solid support to serve as affinity ligands for mRNA. Kits for this purpose are commercially available, e.g., the MessageMaker kit (Life Technologies, Grand Island, N.Y.). In some embodiments, the RNA population is enriched in marker sequences. Enrichment can be undertaken, e.g., by primer-specific cDNA synthesis, or multiple rounds of linear amplification based on cDNA synthesis and template-directed in vitro transcription.
(94) The population of RNA, enriched or not in particular species or sequences, can further be amplified. As defined herein, an amplification process increases the number of copies of a polynucleotide (e.g., RNA). For example, where RNA is mRNA, an amplification process such as RT-PCR can be utilized to amplify the mRNA, such that a signal is detectable or detection is enhanced. Such an amplification process is beneficial particularly when the biological, tissue, or tumor sample is of a small size or volume.
(95) Various amplification and detection methods can be used. For example, it is within the scope of the disclosed methods to reverse transcribe mRNA into cDNA followed by polymerase chain reaction (RT-PCR); or, to use a single enzyme for both steps as described in U.S. Pat. No. 5,322,770, or reverse transcribe mRNA into cDNA followed by symmetric gap ligase chain reaction (RT-AGLCR) as described by R. L. Marshall, et al., PCR Methods and Applications 4: 80-84 (1994). Real time PCR may also be used. Other known amplification methods which can be utilized herein include but are not limited to the so-called NASBA or 3SR technique described in PNAS USA 87: 1874-1878 (1990) and also described in Nature 350 (No. 6313): 91-92 (1991); Q-beta amplification as described in published European Patent Application (EPA) No. 4544610; strand displacement amplification (as described in G. T. Walker et al., Clin. Chem. 42: 9-13 (1996) and European Patent Application No. 684315; target mediated amplification, as described by PCT Publication WO9322461; PCR; ligase chain reaction (LCR) (see, e.g., Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)); self-sustained sequence replication (SSR) (see, e.g., Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990)); and transcription amplification (see, e.g., Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989)). Many techniques are known in the state of the art for determining absolute and relative levels of gene expression, commonly used techniques suitable for use in the disclosed methods include Northern analysis, RNase protection assays (RPA), microarrays and PCR-based techniques, such as quantitative PCR and differential display PCR. For example, Northern blotting involves running a preparation of RNA on a denaturing agarose gel, and transferring it to a suitable support, such as activated cellulose, nitrocellulose or glass or nylon membranes. Radiolabeled cDNA or RNA is then hybridized to the preparation, washed and analyzed by autoradiography.
(96) In situ hybridization visualization may also be employed, wherein a radioactively labeled antisense RNA probe is hybridized with a thin section of a sample, washed, cleaved with RNase and exposed to a sensitive emulsion for autoradiography. The samples may be stained with hematoxylin to demonstrate the histological composition of the sample, and dark field imaging with a suitable light filter shows the developed emulsion. Non-radioactive labels such as digoxigenin may also be used. In some embodiments, the probe is labeled with a fluorescence moiety.
(97) Alternatively, mRNA expression can be detected on a DNA array, chip or a microarray. Labeled nucleic acids of a test sample obtained from a subject may be hybridized to a solid surface comprising marker DNA. Positive hybridization signal is obtained with the sample containing marker transcripts. Methods of preparing DNA arrays and their use are well known in the art (see, e.g., U.S. Pat. Nos. 66,186,796; 6,379,897; 6,664,377; 6,451,536; 548,257; U.S. 20030157485). Serial Analysis of Gene Expression (SAGE) can also be performed (See for example U.S. Patent Application 20030215858). In some embodiments, next generation sequencing (e.g., RNA-seq) can be used to analyze total mRNA expression from one (e.g., single-cell RNA-seq) or more cells. A nucleic acid target molecule labeled with a barcode (for example, an origin-specific barcode) can be sequenced with the barcode to produce a single read and/or contig containing the sequence, or portions thereof, of both the target molecule and the barcode. Exemplary next generation sequencing technologies include, for example, Illumina sequencing, Ion Torrent sequencing, 454 sequencing, SOLiD sequencing, and nanopore sequencing amongst others. Methods for constructing sequencing libraries are known in the art.
(98) The single cell sequencing can be high-throughput single cell RNA sequencing. In certain embodiments, the single cell sequencing is a low cost high-throughput single cell RNA sequencing. Not being bound by any particular theory, the single cell RNA sequencing is capable of efficiently and cost effectively sequencing thousands to tens of thousands of single cells. In certain embodiments, single cell RNA sequencing comprises pairing single cells in droplets with oligonucleotides for reverse transcription, wherein the oligonucleotides are configured to provide cell-of-origin specific barcodes uniquely identifying transcripts from each cell and a unique molecular identifier (UMI) uniquely identifying each transcript. In certain embodiments, single cell RNA sequencing comprises pairing single cells in droplets with single microparticle beads coated with oligonucleotides for reverse transcription, wherein the oligonucleotides contain a bead-specific barcode uniquely identifying each bead and a unique molecular identifier (UMI) uniquely identifying each primer. In some aspects of the disclosure, unbiased classifying of cells in a biological sample comprises sequencing the transcriptomes of thousands of cells, preferably tens of thousands of cells (e.g., greater than 1000 cells, or greater than 10,000 cells).
(99) The activity or level of a lineage marker protein can be detected and/or quantified by detecting or quantifying the expressed polypeptide. The polypeptide can be detected and quantified by any of a number of means well known to those of skill in the art. Any method known in the art for detecting polypeptides can be used. Such methods include, but are not limited to, immunodiffusion, immunoelectrophoresis, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, Western blotting, binder-ligand assays, immunohistochemical techniques, agglutination, complement assays, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, and the like.
(100) Described below are non-limiting examples of techniques that may be used to detect marker protein according to a practitioner's preference based upon the present disclosure. One such technique is Western blotting (Towbin et at., Proc. Nat. Acad. Sci. 76:4350 (1979)), wherein a suitably treated sample is run on an SDS-PAGE gel before being transferred to a solid support, such as a nitrocellulose filter. Anti-marker protein antibodies (unlabeled) are then brought into contact with the support and assayed by a secondary immunological reagent, such as labeled protein A or anti-immunoglobulin (suitable labels including .sup.125I, horseradish peroxidase, alkaline phosphatase, fluorophore). Chromatographic detection may also be used.
(101) Immunohistochemistry may be used to detect expression of marker protein. A suitable antibody is brought into contact with, for example, a thin layer of cells, washed, and then contacted with a second, labeled antibody. Labeling may be by fluorescent markers, enzymes, such as peroxidase, avidin, or radiolabelling. The assay is scored visually, using microscopy. Anti-marker protein antibodies, such as intrabodies, can also be used for imaging purposes, for example, to detect the presence of marker protein in cells or, e.g., an embryo. Suitable labels include radioisotopes, iodine (.sup.125I, .sup.121I), carbon (.sup.14C), sulphur (.sup.35S), tritium (.sup.3H), indium (.sup.112In), and technetium (.sup.99mTc), fluorescent labels, such as fluorescein and rhodamine, and biotin. Antibodies that may be used to detect marker protein include any antibody, whether natural or synthetic, full length or a fragment thereof, monoclonal or polyclonal, that binds sufficiently strongly and specifically to the marker protein to be detected. An antibody may have a K.sub.d of at most about 10.sup.6M, 10.sup.7M, 10.sup.8M, 10.sup.9M, 10.sup.10M, 10.sup.11M, 10.sup.12M. The phrase specifically binds refers to binding of, for example, an antibody to an epitope or antigen or antigenic determinant in such a manner that binding can be displaced or competed with a second preparation of identical or similar epitope, antigen or antigenic determinant. An antibody may bind preferentially to the marker protein relative to other proteins, such as related proteins.
(102) Antibodies are commercially available or may be prepared according to methods known in the art. Antibodies and derivatives thereof that may be used encompass polyclonal or monoclonal antibodies, chimeric, human, humanized, primatized (CDR-grafted), veneered or single-chain antibodies as well as functional fragments, i.e., marker protein binding fragments, of antibodies. For example, antibody fragments capable of binding to a marker protein or portions thereof, including, but not limited to, Fv, Fab, Fab and F(ab) 2 fragments can be used. Such fragments can be produced by enzymatic cleavage or by recombinant techniques. For example, papain or pepsin cleavage can generate Fab or F(ab) 2 fragments, respectively. Other proteases with the requisite substrate specificity can also be used to generate Fab or F(ab) 2 fragments. Antibodies can also be produced in a variety of truncated forms using antibody genes in which one or more stop codons have been introduced upstream of the natural stop site. For example, a chimeric gene encoding a F(ab) 2 heavy chain portion can be designed to include DNA sequences encoding the CH, domain and hinge region of the heavy chain. In some embodiments, agents that specifically bind to a marker protein other than antibodies are used, such as peptides. Peptides that specifically bind to a marker protein can be identified by any means known in the art. For example, specific peptide binders of a marker protein can be screened for using peptide phage display libraries.
(103) Substrates for Culturing Synthetic Embryos
(104) In some embodiments, the mammalian pluripotent stem cell and the extra-embryonic stem cell, the post-implantation embryo, the gastrulating embryo, the neurulating embryo and/or other synthetic embryos described herein are cultured in a substrate. In some embodiments, the method comprises transferring the embryo from one substrate to another substrate. The substrates used in the methods disclosed herein can be the same or different. For example, the mammalian pluripotent stem cell and the extra-embryonic stem cell can be cultured in a first substrate to form a post-implantation pre-gastrulation embryo structure. The post-implantation pre-gastrulation embryo can be transferred to a second substrate to develop into a neurulating embryo. The neurulating embryo can be transferred to a third substrate to develop into a synthetic embryo of another developmental stage. The first substrate, second substrate and third substrate can be a same type or different types. In some embodiments, the first substrate, second substrate and third substrate are of different types. For example, the first substrate and the second substrate can be a microwell plate comprising inverted pyramidal microwells and the third substrate can be a rotating bottle culture unit such as a rotating incubator.
(105) The substrate as used herein can comprise a dish, a U-plate, a flask, or a microwell plate. The microwell plate can comprise inverted pyramidal microwells. The size (e.g., depth and/or diameter) of each of the inverted microwells can vary. Each of the inverted-pyramidal microwells can be about 400 m or about 800 m in size. Each of the inverted-pyramidal microwells can be about 400 m or about 800 m in diameter. In some embodiments, each of the inverted pyramidal microwells can be about 100, 200, 300, 400, 500, 600, 700, 800, 900 m, 1 mM in size and/or diameter, or a number or a range between any two of these values. Each microwell (e.g., receptacle) may have a depth of about 250 m to about 400 m, e.g. about 300 m to about 350 sm. Additionally or alternatively, said plurality of receptacles may have a mean depth of about 250 m to about 400 m, e.g. about 300 m to about 350 m. Especially when the receptacles are wells, they may be ordered on the substrate in an array, i.e. in a grid pattern having regular spacing in substantially orthogonal directions. Whatever the topography of the substrate, the substrate may carry one or more embryos. Where the substrate comprises one or more receptacles, each said receptacle may independently contain one or more embryos, e.g. 2, 3, 4 or 5 embryos, or more. In some embodiments, each embryo structure is located in a different respective well. In alternative embodiments, each receptacle comprises a plurality embryos, e.g. 2, 3, 4 or 5 embryos, or more.
(106) The methods disclosed herein can be applied in culture volumes of any appropriate size. For example, the culture volume per embryo may be about 50 l to about 10 ml, optionally about 100 l to about 5 ml, optionally about 250 l to about 5 ml, optionally about 1 ml to about 5 ml. The culture volume per embryo may be about 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000 l, or more.
(107) Conditions for Culturing Synthetic Embryos
(108) The stem cells and/or embryos can be cultured in a static condition or a dynamic condition. In some embodiments, the stem cells and/or embryos herein described are cultured in a static condition. As used herein, the term static condition refers to a cell culture condition that is carried out without agitation of the culture. For example, the mammalian pluripotent stem cell and the extra-embryonic stem cell can be cultured under a first static condition in a static incubator to form a post-implantation embryo (e.g., a post-implantation pre-gastrulation embryo) for a certain time period (e.g., 1, 2, 3, 4 or more days). The post-implantation embryo can be cultured under a second static condition in a static incubator to develop into a neurulating embryo for a certain time period (e.g., 1, 2, 3 or more days). The first static condition and the second static condition can be the same or different. For example, different culture medias may be used for the two (or more) static conditions. The stem cells and embryos can be cultured under static conditions for 1, 2, 3, 4, 5, 6, 7 or more days. In some embodiments, the stem cells and/or embryos are cultured under a static condition for up to 7 days. In some embodiments, the stem cells and/or embryos are cultured under a static condition from E0 to E8.0.
(109) In some embodiments, the methods comprise culturing in a static condition followed by a dynamic condition. Accordingly, the methods disclosed herein comprises culturing the embryos (e.g., neurulating embryos) under a dynamic condition in a culture chamber. As used herein, the term dynamic condition refers to a cell culture condition that is carried out with agitation (e.g., suspension agitation), including but not limited to rotating, rolling, shaking, inverting, of the culture. Non-limiting examples of dynamic cultures or dynamic culture conditions include a roller culture (a culture on a rolling device), a shaker culture (a culture on a shaker, e.g. orbital shaker), or other dynamic cultures identifiable to a person skilled in the art.
(110) In some embodiments, the dynamic condition comprises providing a plurality of gases to the culture chamber. The plurality of gases can comprise O.sub.2, N.sub.2, CO.sub.2, H.sub.2, H.sub.2O, or a combination thereof. In some embodiments, a mixture of gases is provided into a rotating culture chamber containing one or more embryos. In some embodiments, the dynamic condition comprises a gas pressure of about 0.5 to about 3 pounds per square inch (psi) in the culture chamber. In some embodiments, the gas pressure in the culture chamber is less than the sea level atmospheric pressure. For example, the gas pressure in the culture chamber is about 0.5 to less than 1 psi. In some embodiments, the gas mixture is delivered to the culture chamber at about 0.5 psi.
(111) In some embodiments, the dynamic condition comprises supplying oxygen at a constant concentration to the culture chamber. In some embodiments, the oxygen is supplied to the culture chamber at an increasing concentration. The oxygen concentrations can be increased throughout the culturing starting from 5% up to 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25% or higher at any suitable time interval (e.g., daily intervals). In some embodiments, the oxygen concentration is incrementally increased from about 5% to about 13% to about 18% to about 21% at daily intervals. In some embodiments, the culture chamber can have an atmosphere comprising an increasing oxygen concentration from about 5% to about 25% oxygen level, optionally from about 5% to about 13%, optionally from 13% to about 18%, optionally from about 18% to about 21%. In some embodiments, the increasing is effected by 1.5-2.5 fold or 1.5-2 fold in every step of the increasing. In some embodiments, the oxygen level in the culture chamber is less than 30%. In some embodiments, the dynamic condition used in culturing the neurulating embryos does not comprise decreasing the oxygen concentration throughout the culturing. In some embodiments, the increasing of oxygen concentration is effected every 0.5-2 days, every 0.5-1.5, every 1-2, or every 1-1.5 days of the culturing. In some embodiments, the increasing is effected every 20-28 hours of the culturing. In some embodiments, the increasing is effected at daily intervals.
(112) The neurulating embryo can be cultured under a dynamic condition described herein for at least one day (e.g., 1, 2, 3, 4 or more days). In some embodiments, the neurulating embryos are cultured under a dynamic condition from E8.0 to at least E8.5 (e.g., E8.5, E9, or higher). In some embodiments, the neurulating embryo can be cultured under a dynamic condition in a culture chamber for at least one day to develop into a synthetic embryo of at least early organogenesis stage.
(113) Culture Medias for Culturing Synthetic Embryos
(114) In some embodiments, the method comprises co-culturing the mammalian pluripotent stem cell and the extra-embryonic stem cell in a feeder cell (FC) media, optionally passaging the mammalian pluripotent stem cell and the extra-embryonic stem cell in the feeder cell media at least two times (e.g., 2, 3, 4 or more times). The mammalian pluripotent stem cell and the extra-embryonic stem cell can be cultured in the FC media for 1, 2, 3, or 4 days. In some embodiments, the mammalian pluripotent stem cell and the extra-embryonic stem cell are cultured in the FC media for about 2 days.
(115) In some embodiments, the method comprises co-culturing mammalian pluripotent stem cell and the extra-embryonic stem cell in an in vitro culture (IVC) media, optionally following culturing the mammalian pluripotent stem cell and the extra-embryonic stem cell in the FC media. The mammalian pluripotent stem cell and the extra-embryonic stem cell can be cultured in the IVC media for 1, 2, 3, or 4 days. In some embodiments, the mammalian pluripotent stem cell and the extra-embryonic stem cell are cultured in the IVC media for about 2 days, optionally following culturing in the FC media for about 2 days.
(116) In some embodiments, the method comprises partially replacing a quantity of a FC media (e.g., at least half of the media) with a refresh FC media or an IVC media. The replacement can occur every 20-28 hours of the culturing (e.g., every 24 hours). In some embodiments, the method comprises partially replacing a quantity of an IVC media (e.g., at least half of the media) with a refresh IVC media.
(117) In some embodiments, the method comprises culturing the post-implantation embryo structure in a second culture media under a second static condition allowing the post-implantation embryo structure embryo structure to develop into a neurulating embryo structure. The second culture media is a post-implantation culture media capable of supporting the development of an embryo ex utero. The post-implantation embryo structure can be cultured in the post-implantation culture media for up to 3 or more days (e.g., 1, 2, 3 or more days). The volume of the culture media can be increased every 20-28 hours (e.g., every 24 hours) by feeding the embryos with an amount of fresh culture media (e.g., 200-500 l per embryo). In some embodiments, the method comprises culturing the neurulating embryo structure under a dynamic condition in the same post-implantation culture media. In some embodiments, the post-implantation culture media contains human cord serum. In some embodiments, the post-implantation culture media contains bicarbonate or HEPES.
(118) The culture media disclosed herein can comprise a basal culture medium. The basal medium may comprise water, salts, amino acids, a carbon source, vitamins, lipids and a buffer. Suitable carbon sources may be assessed by one of skill in the art from compounds such as glucose, sucrose, sorbitol, galactose, mannose, fructose, mannitol, maltodextrin, trehalose dihydrate, and cyclodextrin. The basal culture medium can comprise Dulbecco's Modified Eagle Medium (DMEM), DMEM Nutrient Mixture 12 (DMEM/F12), a non-human serum or serum substitute thereof, an antibiotic, L-glutamine or an analogue thereof (e.g., GlutaMAX), or any combination thereof.
(119) The non-human serum or serum substitute can comprise fetal bovine serum, bovine serum albumin, rat serum, KnockOut Serum Replacement, or any combination thereof. The antibiotic can comprise Penicillin-streptomycin, Amphotericin B, Ampicillin, Erythromycin, Gentamycin, Kanamycin, Neomycin, Nystatin, Polymyxin B, Tetracycline, Thiabendazole, Tylosin, or any combination thereof. In some embodiments, the culture media (e.g., FC media and IVC media) comprises a reducing agent. The reducing agent can comprise beta-mercaptoethanol (BME), N-acetyl-L-cysteine, dithiothreitol (DTT), or any combination thereof.
(120) The concentration or amount of one or more of the components in a solution or media can vary. The amount of, e.g., the non-human serum or serum substitute thereof, antibiotic, reducing agent, and/or L-glutamine (e.g., GlutaMax) can vary, and, in some embodiments, can be adjusted as needed by one of skill in the art. In some embodiments, the amount of non-human serum or serum substitute thereof can comprise about 0.01% to about 40.sup.1% (e.g., about 0.01%, 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or a number or a range between any two of these values) volume per volume (% v/v), weight per volume (% w/v) or weight per weight (% w/w) of the medium. In some embodiments, the amount of antibiotic can comprise about 0.01% to about 10% (e.g., about 0.01%, 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% or a number or a range between any two of these values) volume per volume (% v/v), weight per volume (% w/v) or weight per weight (% w/w) of the medium. The amount of e.g., the reducing agent can vary. For example, in some embodiments, the concentration of the reducing agent in the composition can be about 0.1 M to about 1 mM (e.g., about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 10, 100, 200, 300, 400, 500, 600, 700, 800, 900 M, 1 mM, or a number or a range between any two of these values). The amount of L-glutamine (e.g., GlutaMAX) can vary. For example, in some embodiments, the concentration of L-glutamine in the culture media can be about 0.1 mM to about 40 mM, about 0.2 mM to about 20 mM, about 0.5 mM to about 10 mM, about 1 mM to about 5 mM or about 1.5 mM to about 2.5 mM e.g., about 2 mM. Where percentages are provided for agents, ingredients and compounds, they can be % w/w, % w/v or % v/v with respect to the formulation as a whole, unless otherwise indicated.
(121) Each component of the culture medium described herein may be present in an amount such that the culture medium is suitable for supporting the self-assembly of stem cells into a post-implantation embryo structure and/or further development of the post-implantation embryo structure. In some embodiments, the post-implantation embryo structure is a gastrulating embryo structure. In some embodiments, the post-implantation embryo structure is at a pre-gastrulation stage.
(122) In the in vitro culture medium embodiments defined herein, the culture medium may be free, substantially free or essentially free of one or more of an epidermal growth factor (EGF) receptor agonist or an analogue thereof, such as EGF or an EGF substitute; a fibroblast growth factor family (FGF) receptor agonist or an analogue thereof, such as FGF or an FGF substitute; a Leukemia Inhibitory Factor (LIF) receptor agonist or an analogue thereof, such as LIF or a LIF substitute; a Bone Morphogenic Protein (BMP) receptor agonist or an analogue thereof, such as a BMP, or a BMP substitute; a WNT receptor agonist or an analogue thereof, such as WNT or a WNT substitute. The culture medium further may be free, substantially free or essentially free of a TGF receptor agonist or an analogue thereof. Unless otherwise indicated, the culture medium further may be free, substantially free or essentially free of nodal, activin, stem cell factor or members of the hedgehog family of proteins.
(123) The stem cells described herein, e.g., the mammalian pluripotent stem cell and the at least one extra-embryonic stem cell, can be individually cultured prior to the co-culturing described herein in a suitable culture media described, for example, in U.S. Publication No. 2022/0308041, the content of which is incorporated herein by reference in its entirety.
(124) The culture medium described herein may contain other components, or analogues thereof. As used herein, the term analogue can refer to a biologically active analogue of any of the components of the culture medium. Such an analogue may be natural or synthetic.
(125) The specific biologically active ligands and compounds used in the media defined herein, such as insulin, progesterone, etc. are used for illustrative purposes. However, one of skill in the art will readily recognize that analogues of such ligands and compounds may equally be used as alternatives, provided that they retain the relevant biological activity. One of skill in the art will be able to identify, in a routine manner, other biologically active compounds that are suitable for use as substitutes. For instance, these may be naturally occurring compounds or compounds which can be made by synthetic or semi-synthetic methods.
(126) In some embodiments, a FC media can further comprise an effective amount of sodium pyruvate, such as, for example, at a concentration of about 0.05 mM to about 20 mM (e.g., about 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 mM or a number or a range between any two of these values). In some embodiments, the FC media comprises about 1 mM sodium pyruvate.
(127) The FC media can also comprise an effective amount of an amino acid selected from the group comprising L-glycine, L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid, L-proline and L-serine. The non-essential amino acids can have an effective amount of, for example, about 0.1% to about 2% (e.g., about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2%, or a number or a range between any two of these values) volume per volume (% v/v), weight per volume (% w/v) or weight per weight (% w/w) of the medium. In some embodiments, the FC media comprises about 1% non-essential amino acids. Non-essential amino acids may be included in the culture medium, for example, comprising glycine (about 1 mg/ml to about 25 mg/ml or about 5 mg/ml to about 10 mg/ml e.g., about 7.5 mg/ml), L-alanine (about 1 mg/ml to about 25 mg/ml or about 5 mg/ml to about 10 mg/ml e.g., about 9 mg/ml), L-asparagine (about 5 mg/ml to about 30 mg/ml or about 10 mg/ml to about 15 mg/ml e.g., about 13.2 mg/ml), L-aspartic acid (about 5 mg/ml to about 30 mg/ml or about 10 mg/ml to about 15 mg/ml e.g., about 13 mg/ml), L-glutamic acid (about 5 mg/ml to about 50 mg/ml or about 10 mg/ml to about 20 mg/ml e.g., about 15 mg/ml), L-proline (about 5 mg/ml to about 30 mg/ml or about 10 mg/ml to about 15 mg/ml e.g., about 11 mg/ml) and/or L-serine (about 5 mg/ml to about 30 mg/ml or about 10 mg/ml to about 15 mg/ml e.g., about 11 mg/ml). In some embodiments, culture medium may comprise L-glycine at a concentration of about 7.5 mg/ml, L-alanine at a concentration of about 9 mg/ml, L-asparagine at a concentration of about 13 mg/ml, L-aspartic acid at a concentration of about 13 mg/ml, L-glutamic acid at a concentration of about 14.5 mg/ml, L-proline at a concentration of about 11.5 mg/ml and L-serine at a concentration of about 10.5 mg/ml.
(128) The non-human serum in the FC media can vary. In some embodiments, the FC media can comprise a non-human serum (e.g., fetal bovine serum) at about 5% to about 40% (e.g., 5%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or a number or a range between any two of these values) volume per volume (% v/v), weight per volume (% w/v) or weight per weight (% w/w) of the medium. In some embodiments, the FC media comprises about 15% to about 20% non-human serum (e.g., fetal bovine serum). In some embodiments, the FC media comprises about 15% fetal bovine serum. In some embodiments, the FC media comprises about 20% fetal bovine serum.
(129) The FC media can comprise an effective amount of L-glutamine or an analogue thereof. L-glutamine may be included in the culture medium at a concentration of about 0.1 mM to about 40 mM, about 0.2 mM to about 20 mM, about 0.5 mM to about 10 mM, about 1 mM to about 5 mM or about 1.5 mM to about 2.5 mM e.g., about 2 mM. In some embodiments, L-glutamine is included in the FC medium at a concentration of about 2 mM.
(130) The FC media can comprise an effective amount of a reducing agent. In some embodiments, the concentration of the reducing agent in the FC media can be about 0.1 M to about 1 mM (e.g., about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 10, 100, 200, 300, 400, 500, 600, 700, 800, 900 M, 1 mM, or a number or a range between any two of these values). In some embodiments, the reducing agent is included in the FC media at a concentration of about 0.1 mM. In some embodiments, the FC media comprises P-mercaptoethanol (BME) at a concentration of about 0.1 mM.
(131) In some embodiment, the FC media comprises an effective amount of an inhibitor of rho-associated protein kinase (ROCK) (also referred to herein as ROCK inhibitor). Exemplary ROCK inhibitors include, but are not limited to N-[(1S)-2-Hydroxy-1-phenylethyl]-N-[4-(4-pyridinyl)phenyl]-urea (AS1892802), fasudil hydrochloride (also known as HA 1077), -[3-[[2-(4-Amino-1,2,5-oxadiazol-3-yl)-I-ethyl-1H-imidazo[4,5-c]pyridin-6-yl]oxy]phenyl]-4-[2-(4-morpholinyl)ethoxy]benzamide (GSK269962), 4-[4-(Trifluoromethyl)phenyl]-N-(6-Fluoro-1H-indazol-5-yl)-2-methyl-6-oxo-1,4,5,6-tetrahydro-3-pyridinecarboxamide (GSK 429286), (S)-(+)-2-Methyl-1-[(4-methyl-5-isoquinolinyl)sulfonyl]-hexahydro-1H-1,4-diazepine dihydrochloride (H 1152 dihydrochloride), (S)-(+)-4-Glycyl-2-methyl-1-[(4-methyl-5-isoquinolinyl)sulfonyl]-hexahydro-1H-1,4-diazepine dihydrochloride (glycyl-H 1152 dihydrochloride), N-[(3-Hydroxyphenyl)methyl]-N-[4-(4-pyridinyl)-2-thiazolyl]urea dihydrochloride (RKI 1447 dihydrochloride), (3S)-1-[[2-(4-Amino-1,2,5-oxadiazol-3-yl)-1-ethyl-1H-imidazo[4,5-c]pyridin-7-yl]carbonyl]-3-pyrrolidinamine dihydrochloride (SB772077B dihydrochloride), N-[2-[2-(Dimethylamino)ethoxy]-4-(1H-pyrazol-4-yl)phenyl-2,3-dihydro-1,4-benzodioxin-2-carboxamide dihydrochloride (SR 3677 dihydrochloride), and trans-4-[(R)-1-Aminoethyl]-N-4-pyridinylcyclohexanecarboxamide dihydrochloride (Y-27632 dihydrochloride), N-Benzyl-[2-(pyrimidin-4-yl)amino]thiazole-4-carboxamide (Thiazovivin), Rock Inhibitor, a isoquinolinesulfonamide compound (Rho Kinase Inhibitor), N-(4-Pyridyl)-N-(2,4,6-trichlorophenyl)urea (Rho Kinase Inhibitor II), 3-(4-Pyridyl)-1H-indole (Rho Kinase Inhibitor M, Rockout), and 4-pyrazoleboronic acid pinacol ester; a Rock antibody commercially available from Santa Cruz Biotechnology selected from the group consisting of Rock-1 (B 1), Rock-1 (C-19), Rock-1 (H-11), Rock-1 (G-6), Rock-1 (H-85), Rock-1 (K-18), Rock-2 (C-20), Rock-2 (D-2), Rock-2 (D-11), Rock-2 (N-19), Rock-2 (H-85), Rock-2 (30-J); a ROCK CRISPR/Cas9 knockout plasmid selected from the group consisting of Rock-1 CRISPR/Cas9 KO plasmid (h), Rock-2 CRISPR/Cas9 KO plasmid (h), Rock-1 CRISPR/Cas9 KO plasmid (m), Rock-2 CRISPR/Cas9 KO plasmid (m); a ROCK siRNA, shRNA plasmid and/or shRNA lentiviral particle gene silencer selected from the group consisting of Rock-1 siRNA (h): sc-29473, Rock-1 siRNA (m): sc-36432, Rock-1 siRNA (r): sc-72179, Rock-2 siRNA (h): sc-29474, Rock-2 siRNA (m): sc-36433, Rock-2 siRNA (r): sc-108088. In some embodiments, the ROCK inhibitor comprises Y-27632.
(132) The FC media can comprise an effective amount of ROCK inhibitor, such as, for example, at a concentration of about 0.1 nM to about 100 nM (e.g., about 0.1, 0.2, 0.3, 0.4, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 mM or a number or a range between any two of these values). In some embodiments, the FC media comprises a ROCK inhibitor at a concentration of about 7.5 nM. In some embodiments, the FC media comprises about 1 nM to about 100 nM Y-27632 (e.g., about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 nM or a number or a range between any two of these values). In some embodiments, the FC media comprises about 7.5 nM Y-27632. In some embodiments, the FC media does not comprise a ROCK inhibitor.
(133) In some embodiments, the FC media comprises DMEM, fetal bovine serum, sodium pyruvate, GlutaMax, MEM non-essential amino acids, 2-mercaptoethanol, penicillin and/or streptomycin, or any combination thereof. In some embodiments, the FC media comprises DMEM, about 15% fetal bovine serum, about 1 mM sodium pyruvate, about 2 mM GlutaMax, about 1% MEM non-essential amino acids, about 0.1 mM 2-mercaptoethanol, about 1% penicillin and/or streptomycin, or any combination thereof. In some embodiments, the FC medium comprises Dulbecco's modified essential medium (Gibco 41966052), about 15% fetal bovine serum (Cambridge Stem Cell Institute), about 1 mM sodium pyruvate (Gibco 11360039), about 2 mM GlutaMAX (Gibco 35050038), about 1% MEM non-essential amino acids (Gibco 11140035), about 0.1 mM 2-mercaptoethanol (Gibco 31350010) and about 1% penicillin/streptomycin (Gibco 15140122). The FC media can further comprise one or more anticoagulants, for example heparin and a fibroblast growth factor (FGF) (e.g., FGF2 and/or FGF4), or any combination thereof.
(134) IVC Media
(135) The IVC media contains a basal medium described herein. The basal medium can comprise water, salts, amino acids, a carbon source, vitamins, lipids and a buffer. Suitable carbon sources may be assessed by one of skill in the art from compounds such as glucose, sucrose, sorbitol, galactose, mannose, fructose, mannitol, maltodextrin, trehalose dihydrate, and cyclodextrin. Basal media are commercially available, for example, under the trade names Advanced DMEM/F12 (Gibco, 12634-010) and CMRL-1066 (Invitrogen or Sigma). The basal culture medium can comprise Dulbecco's Modified Eagle Medium (DMEM), DMEM Nutrient Mixture 12 (DMEM/F12), Roswell Park Memorial Institute (RPMI) medium 1640, Neurobasal, Neurobasal A, Connaught Medical Research Laboratory 1066 (CMRL-1066), or any combination thereof.
(136) An IVC media can further comprise (a) insulin, an insulin analogue, or an insulin receptor agonist; (b) estrogen, an estrogen analogue, or an estrogen receptor agonist; and (c) progesterone, a progesterone analogue, or a progesterone receptor agonist.
(137) The amount of the insulin, estrogen, progesterone, or analogues or receptor agonists thereof present in the IVC media can vary. For example, in some embodiments, the IVC media can comprise about 1 ng/ml to about 100 mg/ml (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500, 600, 700, 800, 900 ng/ml, 1 g/ml, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 g/ml, 1 mg/ml, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 mg/ml or a number or a range between any two of these values) of one or more hormones (e.g., progesterone) and/or one or more growth factors (e.g., insulin or an insulin-like growth factor). In some embodiments, the IVC media can comprise about 0.5 nM to about 1 mM (e.g., about 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5 5 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500, 600, 700, 800, 900 nM, 0.5 mM, 1 mM, or a number or a range between any two of these values) of a hormone (e.g., estrogen) and/or insulin or an insulin-like growth factor.
(138) In some embodiments, the insulin receptor agonist is selected from the group comprising IGF-I, IGF-II, analogues thereof, or any combination thereof. The estrogen receptor agonist can be selected from the group comprising A-estradiol, estrone, estriol and estetrol, or any analogue thereof. The IVC media can comprise transferrin, sodium selenium, ethanolamine, or any analogue thereof. The IVE media can comprise Insulin-Transferrin-Selenium-Ethanolamine (ITS-X). In some embodiments, the IVC media further comprises an agonist of the activin type 1 or type 2 receptors. The IVC media can comprise a reducing agent. In some embodiments, the reducing agent can comprise N-acetyl-L-cysteine, dithiothreitol (DTT), -mercaptoethanol (BME), or any combination thereof.
(139) The IVC media can comprise a non-human serum, the concentration of which can vary in different embodiments. In some embodiments, the IVC media can comprise a non-human serum (e.g., fetal bovine serum) at about 5% to about 40% (e.g., 5%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or a number or a range between any two of these values) volume per volume (% v/v), weight per volume (% w/v) or weight per weight (% w/w) of the medium. In some embodiments, the IVC media comprises about 20% to about 30% non-human serum (e.g., fetal bovine serum). In some embodiments, the IVC media comprises about 20% fetal bovine serum. In some embodiments, the IVC media comprises about 30% fetal bovine serum. In some embodiments, culturing the mammalian pluripotent stem cell and the extra-embryonic stem cell in the IVC media comprises increasing serum concentrations, optionally increasing the serum concentration from about 20% to about 30%.
(140) The IVC media can comprise L-glutamine. L-glutamine may be included in the culture medium at a concentration of about 0.1 mM to about 40 mM, about 0.2 mM to about 20 mM, about 0.5 mM to about 10 mM, about 1 mM to about 5 mM or about 1.5 mM to about 2.5 mM e.g., about 2 mM. In some embodiments, L-glutamine is included in the culture medium at a concentration of about 2 mM.
(141) The IVC media can comprise an effective amount of a reducing agent. In some embodiments, the concentration of the reducing agent in the IVC media can be about 0.1 M to about 1 mM (e.g., about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 10, 100, 200, 300, 400, 500, 600, 700, 800, 900 M, 1 mM, or a number or a range between any two of these values). In some embodiments, the reducing agent is included in the IVC media at a concentration of about 25 M. In some embodiments, the IVC media comprises N-acetyl-L-cysteine at a concentration of about 25 M.
(142) Penicillin may be included in the culture medium at a concentration of about 1 unit/ml to about 500 units/ml, about 2 units/ml to about 250 units/ml, about 5 units/ml to about 100 units/ml, about 10 units/ml to about 50 units/ml, or about 20 units/ml to about 30 units/ml e.g., about 25 units/ml. Streptomycin may be included in the culture medium at a concentration of about 1 g/ml to about 500 g/ml, about 2 g/ml to about 250 g/ml, about 5 g/ml to about 100 g/ml, about 10 g/ml to about 50 g/ml, 25 or about 20 g/ml to about 30 g/ml e.g., about 25 g/ml. The culture medium can comprise penicillin at a concentration of about 25 units/ml and/or streptomycin at a concentration of about 25 g/ml.
(143) The culture medium can comprise a basal medium, as described herein, (e.g., Advanced DMEM/F12) supplemented with, an insulin receptor agonist, e.g., Insulin (e.g., about 2 mg/ml to about 25 mg/ml), Transferrin (e.g., about 1 mg/ml to about 10 mg/ml), Selenium e.g., sodium selenite (e.g., about 0.001 mg/ml to about 0.01 mg/ml), Ethanolamine (e.g., about 0.5 mg/ml to about 10 mg/ml), an estrogen receptor agonist e.g., estradiol (e.g., about 5 nM to about 10 nM), a progesterone receptor agonist e.g., Progesterone (e.g., about 50 ng/ml to about 500 ng/ml) and a reducing agent e.g., N-acetyl-L-cysteine (e.g., about 17.5 M to about 40 M). In some embodiments, the IVC media is free or substantially free of sodium pyruvate.
(144) In some embodiments, the IVC media comprises DMEM/F12, fetal bovine serum, GlutaMax, ITS-X, -estradiol, progesterone, N-acetyl-L-cysteine, penicillin and/or streptomycin, or any combination thereof. In some embodiments, the IVC media comprises DMEM/F12, about 20% fetal bovine serum, about 2 mM GlutaMax, about 1ITS-X, about 8 nM -estradiol, about 200 ng/ml progesterone, about 25 M N-acetyl-L-cysteine, about 1% penicillin and/or streptomycin, or any combination thereof.
(145) Post-Implantation Media
(146) In some embodiments, the post-implantation embryo is cultured in a post-implantation media capable of supporting the development of embryos ex utero. The method described herein comprises culturing the post-implantation embryo structure in a post-implantation media under a static condition allowing the post-implantation embryo structure embryo structure to develop into a neurulating embryo structure. The method can also comprise culturing the neurulating embryo structure for at least one day in a post-implantation media under a dynamic condition in a culture chamber allowing the neurulating embryo structure to develop into a synthetic embryo of at least early organogenesis stage.
(147) In some embodiments, the post-implantation embryo comprises a basal medium described herein. The basal medium can comprise Dulbecco's Modified Eagle Medium (DMEM) or DMEM Nutrient Mixture 12 (DMEM/F12), non-human serum (e.g., rat and/or bovine serum), human cord serum, L-glutamine or an analogue thereof (e.g., GlutaMAX), antibiotics, or any combination thereof.
(148) The DMEM or DMEM/F12 can be present in the media at about 5% to about 40% (e.g., 5%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or a number or a range between any two of these values) volume per volume (% v/v), weight per volume (% w/v) or weight per weight (% w/w) of the medium. In some embodiments, the DMEM or DMEM/F12 is present in the media at about 25%. In some embodiments, the post-implantation media comprises DMEM at about 25%.
(149) The post-implantation media comprises an effective amount of non-human serum at about 5% to about 60% (e.g., 5%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, or a number or a range between any two of these values) volume per volume (% v/v), weight per volume (% w/v) or weight per weight (% w/w) of the medium. In some embodiments, the post-implantation media comprises about 50% non-human serum. In some embodiments, the post-implantation media comprises about 50% rat serum.
(150) The human cord serum in the post-implantation media can vary. In some embodiments, the post-implantation media comprises an effective amount of human cord serum at about 5% to about 40% (e.g., 5%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or a number or a range between any two of these values) volume per volume (% v/v), weight per volume (% w/v) or weight per weight (% w/w) of the medium. In some embodiments, the post-implantation media comprises about 25% human cord serum.
(151) In some embodiments, the post-implantation media comprises about 25% DMEM, about 50% rat serum, and about 25% human cord serum.
(152) In some embodiments, the post-implantation media further comprises an effective amount of bicarbonate. The bicarbonate can be present in the post-implantation media at a concentration from about 0.1 mM to about 30 mM, optionally from 1 mM to about 20 mM.
(153) In some embodiments, the post-implantation media comprises an effective amount of HEPES. The HEPES can be present in the post-implantation media at a concentration from about 0.1 mM to about 30 mM, optionally from 1 mM to about 20 mM.
(154) The post-implantation media can comprise an effective amount of L-glutamine or an analogue thereof (e.g., GlutaMAX). L-glutamine may be included in the culture medium at a concentration of about 0.1 mM to about 40 mM, about 0.2 mM to about 20 mM, about 0.5 mM to about 10 mM, about 1 mM to about 5 mM or about 1.5 mM to about 2.5 mM e.g., about 2 mM.
(155) The antibiotics can be include in the post-implantation media at a concentration of about 1 unit/ml to about 500 units/ml. For example, penicillin may be included in the culture medium at a concentration of about 1 unit/ml to about 500 units/ml, about 2 units/ml to about 250 units/ml, about 5 units/ml to about 100 units/ml, about 10 units/ml to about 50 units/ml, or about 20 units/ml to about 30 units/ml e.g., about 25 units/mi. Streptomycin may be included in the culture medium at a concentration of about 1 g/ml to about 500 g/ml, about 2 g/ml to about 250 g/ml, about 5 g/ml to about 100 g/ml, about 10 g/ml to about 50 g/ml, 25 or about 20 g/ml to about 30 g/ml e.g., about 25 g/ml. The post-implantation media can comprise penicillin at a concentration of about 100 units/ml and/or streptomycin at a concentration of about 100 g/ml.
(156) The post-implantation media can for example comprise DMEM, rat serum, human cord serum, GlutaMax, penicillin and/or streptomycin, HEPES, or any combination thereof. In some embodiments, the post-implantation media comprises about 25% DMEM, about 50% rat serum, and about 25% human cord serum. The post-implantation media is further supplied with 1 Glutamax (GIBCO, 35050061), 100 units/ml penicillin and 100 g/ml streptomycin and 11 mM HEPES (GIBCO 15630056).
(157) In some embodiments, culturing the post-implantation embryo comprises supplying the post-implantation media with glucose. The glucose can be provided in the post-implantation media or in the basal cultural medium in increasing concentrations throughput the culturing. The glucose concentration can be increased from at least about 3 mg/ml up to about 4-5 mg/ml. In some embodiments, the glucose is supplied to the post-implantation media from about 3 mg/ml up to about 3.5 mg/ml. The glucose can be supplied for at least once (e.g., one, two, three or more times) at a concentration of at least 3 mg/ml (e.g., 3, 3.5, 4, 4.5, 5, or higher). The post-implantation media can be supplied with a glucose of at least 3 mg/ml at about day three of culturing in the post-implantation media. In some embodiments, the media comprises at least about 3 mg/ml glucose when the embryo reaches the neurulating stage and onwards, followed by at least about 3.5 mg/ml glucose the following day.
(158) In some embodiments, the glucose is provided in the post-implantation media in increasing concentrations throughout the culturing. In some embodiments, the glucose is provided in the post-implantation media in a constant concentration followed by increasing concentrations. In some embodiments, the glucose is provided in the post-implantation media in a constant concentration throughout a static condition followed by increasing concentrations throughout a dynamic condition. In some embodiments, the glucose can be provided in the post-implantation media at a constant concentration under a static condition followed by increasing concentrations in the same or different static concentration. For example, culturing the post-implantation embryo can comprise culturing, under a static condition, the post-implantation embryo structure in a media comprising about 1 mg/ml glucose for about two days and culturing the post-implantation embryo structure in a media comprising about 3 mg/ml glucose for about one day.
(159) In some embodiments, the glucose is provided at increasing concentrations when transferring the embryos from a static condition to a dynamic condition. For example, the method can comprise culturing the post-implantation embryo structure in a media comprising about 3 mg/ml glucose for about one day under a static condition (e.g., when the embryo reaches a neurulating stage), followed by culturing in a media comprising about 3.5 mg/ml glucose for at least one day under a dynamic condition. In some embodiments, the glucose is provide in the media in increasing concentrations throughout the dynamic condition.
(160) Also disclosed herein includes embryo culturing systems (e.g., embryo culturing devices) suitable for generating a synthetic embryo in vitro using any of the methods disclosed herein.
(161) Applications
(162) Provided herein also includes a synthetic embryo obtainable by the in vitro method described herein for use in a method of diagnosing, preventing or treating a disease in a patient in need thereof. For example, embryo cells obtainable from the present invention may be used in stem cell therapies, such as treatments for cancers, replacement tissue, reconstructive surgery, tissue repair, wound healing, bone marrow transplantation, stroke, baldness, blindness, deafness, diabetes, heart disease, bowel disease, arthritis, skeletal injury, teeth replacement, neuronal disease and any other condition where replacement cells or tissues may be advantageous. The cells may also be utilized for screening therapeutic compounds for efficacy and safety, as would be understood by a person of skill in the art.
(163) In some embodiments, the synthetic embryo structure for use in a method of diagnosing, preventing or treating a disease in a patient in need thereof as described herein may be used for transplantation into the patient. It is envisaged that in certain embodiments, the pluripotent stem cell used to obtain the embryo may have been obtained from the patient originally, thus reducing the likelihood of rejection by the patient's immune system. Thus, a pluripotent stem cell, for example an embryonic stem cell, and extraembryonic stem cell obtained from a patient may be cultured using the methods described herein to provide material for transplantation back into that patient to prevent or treat a condition. For example, the embryo may be used to grow replacement organs or tissues for the patient to regain function of such organs or tissues in the patient following loss of function through degeneration, ageing and/or disease.
(164) Disclosed herein also includes a method of providing a transgenic non-human animal, comprising gestating an embryo derived from a cell cultured using an in vitro method described herein. Such transgenic non-human animals may be useful in drug screening or in the study of disease. For example, model animals may be produced to study specific conditions. It is envisaged that the methods provided herein could be used to more efficiently develop transgenic and chimeric embryos (which currently relies for example, on the labor-intensive process of harvesting blastocysts and manually replacing the inner cell mass).
(165) Disclosed herein include methods for investigating the effect of a test agent on embryonic development. In some embodiments, the method comprises: a) generating a synthetic embryo using the method described herein; b) contacting the synthetic embryo with a test agent; and c) determining the effect of the test agent on the synthetic embryo. In some embodiments, the determining comprises comparing a phenotype or a genotype of the synthetic embryo in the presence of the test agent with the phenotype or genotype of the synthetic embryo in the absence of the test agent. The method can comprise contacting the mammalian pluripotent stem cell and at least one extraembryonic stem cell with the test agent during or following step (a) and prior to step (b), during or following step (b) and prior to step (c), or during or following step (c).
(166) The method can comprise determining the subsequent effect on formation of a synthetic embryo at various developmental stages. The determining can be performed using any method known in the art. For example, the method can comprise recording one or more images of the embryo structure.
(167) Disclosed herein include methods for investigating mechanisms involved in embryogenesis. In some embodiments, the method comprises any of the in vitro methods for generating a synthetic embryo structure at various developmental stages described herein. Investigating mechanism involved in embryogenesis can comprise any method known in the art. For example, said investigating can comprise investigating the effect of a test agent on embryonic development as described above. In some embodiments, investigating mechanisms involved in embryogenesis can comprise determining the effect of genetic perturbation(s) in the embryo structure.
(168) The method may comprise recording a plurality of images of the synthetic embryo structure. The plurality of images may be recorded over a pre-determined period of time, thus illustrating the development of the embryonic structure over time. The imaging apparatus may comprise microscopy apparatus, suitable recording apparatus, and optionally image processing apparatus.
(169) Typically, fluorescent markers, such as fluorescent dyes or fluorescent marker proteins, are used in the imaging of embryonic development. Such markers may be added to the culture system. For example, fluorescent dyes may be added to visualize particular molecules or cellular structures. For example, DAPI may be used to stain DNA or MitoTracker (Invitrogen) may be used to stain the mitochondria. Additionally or alternatively, the embryo structure may produce such fluorescent markers endogenously, e.g., it may contain one or more cells which express a fluorescent marker protein. Such cells may have been genetically modified in order to confer the ability to express such a marker protein. Thus, fluorescence imaging apparatus may be particularly suitable for the methods described. The imaging apparatus may thus comprise a fluorescence microscope, such as a confocal microscope, that can include but is not limited to wide field, scanning and spinning disc confocal, and light sheet microscope.
(170) Confocal microscopes image a single point of a specimen at any given time but allow generation of two dimensional or three dimensional images by scanning different points in a specimen in a regular raster to provide image data which can be assembled into a two or three dimensional image. For example, scanning a specimen in a single plane enables generation of a two dimensional image of a slice through the specimen. A plurality or stack of such two dimensional images can be combined to yield a three dimensional image. Spinning disc confocal microscopy provides added advantages over confocal laser scanning microscopy. Additionally, light sheet microscopy can also provide good imaging of embryonic development.
(171) Disclosed herein also includes a method of elucidating the role of a gene in embryo development, the method comprising obtaining a pluripotent stem cell and/or an extra-embryonic stem cell where the gene has been modified or knocked out and culturing the pluripotent stem cell and the extra-embryonic stem cell using the in vitro method described herein. Thus, the methods may aid in the development of treatments for conditions relating to embryo development, such as fertility treatment.
(172) Disclosed herein also includes a method of imaging an embryo during development comprising culturing a mammalian pluripotent stem and an extra-embryonic stem cell or a mammalian synthetic embryo structure using the methods described herein, and recording an image of said embryo using an imaging apparatus. The image may be a two dimensional or three dimensional image. A plurality of images may be recorded of the same embryo. An imaging apparatus can comprise microscopy apparatus and suitable recording apparatus. An imaging apparatus may further comprise image processing apparatus. Additionally, an imaging apparatus may further comprise a fluorescent microscope. Additionally, or alternatively, an imaging apparatus may further comprise a confocal microscope.
EXAMPLES
(173) Some aspects of the embodiments discussed above are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the present disclosure.
Example 1
Materials and Methods
(174) This example provides general experimental materials and methods used for Examples 2-7 described below:
(175) Cell Lines and Culture Conditions
(176) All cell lines used hereby were mouse cell lines and include the following. CAG-GFP/tetO-mCherry mouse ES cells (constitutive GFP expression in the membrane; transient mCherry expression upon Dox treatment). The parent CAG-GFP/tetO-mCherry ES cell line was derived from an existing mouse line with constitutive CAG-GFP expression and Dox-induced transient mCherry expression. This line was generated by breeding CAG-GFP reporter mice and tetO-mCherry Histone mice. An independent Dox-inducible Gata4-expressing cassette was hereby introduced into the CAG-GFP/tetO-mCherry ES cell line by piggyBac-based transposition. Thus, mCherry and Gata4 were regulated by two, independent Dox-responsive promoters. CAG-GFP/tetO-mCherry/tetO-Gata4 ES cells were generated in-house. Cerl-GFP ES cells (GFP expression under the control of the Cerl-promoter) were derived from a published Cerl-GFP mouse line. Cerl-GFP/tetO-Gata4 ES cells were generated in-house. Wild-type CD1 TS cells were generated in-house. Wild-type CD1 ES cells were a gift. CD1/tetO-Gata4 ES cells were generated in-house. Sox2-Venus/Brachyury-mCherry/Oct4-ECFP ES cells, Blimp1-GFP ES cells and BVSC ES cells were gifts.
(177) For the experiments described herein, ETiX embryoids were successfully generated with the following ES cell lines: wild-type CD1 ES cells; Sox2-Venus/Brachyury-mCherry/Oct4-ECFP ES cells; CAG-GFP/tetO-mCherry ES cells; Blimp1-GFP ES cells; and BVSC ES cells.
(178) In addition to the lines indicated above, five more that could progress to day 5 and 6 but not beyond were also tried. These lines were: Lfng reporter (LuVeLu) ES cells; Msgn1-Venus ES cells; Hes7-Achilles ES cells; Sox1-GFP ES cells; mTmG ES cells (generated in-house). No results described hereby were generated with these five unsuccessful lines.
(179) The majority of the structures presented hereby were generated using wild-type CD1 ES cells, wild-type CD1 TS cells and CD1/tetO-Gata4 ES cells. The sex of the cell lines was not known because the cells were not genotyped to determine it. All cell lines were routinely tested every two weeks to ensure that they were not contaminated with mycoplasma. Mouse ES cells and TS cells were cultured as detailed in Inducible Stem-Cell-Derived Embryos Capture Mouse Morphogenetic Events In Vitro, Amadei et al., 2021, Developmental Cell 56, 366-382 (//doi.org/10.1016/j.devcel.2020.12.004) (Amadei 2021), the content of which is incorporated herein by reference in its entirety. Establishment of CD1 tetO-Gata4 Dox-inducible cell lines was performed as described elsewhere. Cell lines were not authenticated.
(180) Culturing Mouse ES Cells and TS Cells
(181) Mouse ES cells and TS cells were cultured as detailed in Amadei 2021. Briefly, mouse ES cells were cultured on gelatinized plates at 37 C., 5% CO.sub.2, 21% O.sub.2 in N2B27, which comprised of 50% Neurobasal-A (Gibco 10888022), 50% DMEM/F-12 (Gibco 21331020), 0.5% N-2 (in-house), 1% B-27 (Gibco 10889038), 2 mM GlutaMAX (Gibco 35050038), 0.1 mM 2-mercaptoethanol (Gibco 31350010) and 1% penicillin/streptomycin (Gibco 15140122). N2B27 was supplemented with 3 M CHIR99021 (Cambridge Stem Cell Institute), 1 M PD0325901 (Cambridge Stem Cell Institute) and 10 ng/ml leukemia inhibitory factor (Cambridge Stem Cell Institute). Mouse TS cells were cultured at 37 C. and 5% CO.sub.2, in RPMI 1640 (Sigma) with 20% fetal bovine serum (FBS), 2 mM 1-glutamine, 0.1 mM 2-ME, 1 mM sodium pyruvate, and 1% penicillin-streptomycin (TS cell media), supplemented with 25 ng/ml FGF4 (R&D Systems 7486-F4-025) and 1 g/ml heparin (Sigma-Aldrich H3149-25KU) (TSC/F4H) on mitotically inactivated mouse embryonic fibroblasts (MEFs, Insight Biotechnology, ASF-1201). MEFs were cultured in feeder cell (FC) medium, which contained Dulbecco's modified essential medium (Gibco 41966052), 15% FBS (Cambridge Stem Cell Institute), 1 mM sodium pyruvate (Gibco 11360039), 2 mM GlutaMAX (Gibco 35050038), 1% MEM non-essential amino acids (Gibco 11140035), 0.1 mM 2-mercaptoethanol (Gibco 31350010) and 1% penicillin/streptomycin (Gibco 15140122). Passaging of ES cells and TS cells was performed when they were at 70% confluency as follows: cells were washed once in 1PBS (Life Technologies 10010056) and trypsinized (Trypsin-EDTA 0.05% Life Technologies 25300054) for 3 min at 37 C. The reaction was stopped by adding 2 ml of FC or TS cell media respectively. Cells were dissociated by pipetting gently 4-5 times and centrifuged for 4 min at 200g. TS cells were then resuspended in TS cell/F4H culture media and plated onto MEF-coated plates in 1:20 or 1:10 dilution. ES cells were washed once with 1 ml of 1PBS, centrifuged again, resuspended in N2B27 2iLIF and plated in 1:10 or 1:20 dilution onto gelatin-coated plates.
(182) CRISPR-Cas9 Pax6 Knockout
(183) Pax6 was targeted in the region 104 bp immediately prior to the homeobox sequence on exon 6. Guide RNA (gRNA) oligonucleotides were designed using an online CRISPR design tool. Those least likely to have off-targets based on the prediction of the software were selected. gRNAs were annealed with their respective reverse oligonucleotides, cloned into PX459 and transformed into DH5ca cells as previously described. Minipreps were sent for Sanger sequencing with sequencing primer: 5-TGCATATACGATACAAGGCTGTTAG-3 (SEQ ID NO: 9). Wild-type ES cells (CD1 background) were transfected using Lipofectamine 3000 according to the manufacturers' instructions. In brief, a density of 25,000 cells per well was plated in a 24-well plate the day prior to transfection. The following day, pairs of gRNAs in PX459 were transfected into the cells (500 ng per plasmid). A PIP Fucci construct without an antibiotic resistance cassette in a separate well was used as a control for the transfection. A negative control (no DNA) was also performed in parallel. Following 2 days of selection with 1 g/ml antibiotics, the cells were washed in fresh medium and allowed to recover from the antibiotic. Individual clones were isolated and cultured in 96-well plates until colonies became visible. Of 46 wells, 18 were growing a single colony. Each of these was passaged and split into 3 new wells, each in a different 96-well plate. Two of these plates were trypsinized and frozen using FC medium+10% DMSO+25% FBS. Colonies in the remaining plates were grown until confluency. Genomic DNA from each single clone was extracted and genotyped using Platinum Taq DNA Polymerase (Invitrogen, 13001012) and the following primers: FW: 5-AAGAGACCTTGCGAGAGCAC-3 (SEQ ID NO: 7). RV: 5-GAACTTTCCCACCAGGAGCA-3 (SEQ ID NO: 8). A standard 25-l reaction was set up with 12.5 l Platinum Taq PCR Master Mix, 2 l template DNA, 0.5 l of 10 M stock from each primer and 9.5 l H.sub.2O. The PCR cycling conditions were as follows: Initial denaturation was performed at 94 C. for 2 min, followed by 35 cycles of: denaturation at 94 C. for 30 s, annealing at 56 C. for 30 s and extension at 72 C. for 40 s. The PCR product was then examined using gel electrophoresis. Promising clones that ran at sizes lower than the wild-type (lower than 715 bp) were sent for Sanger sequencing. Deletion was confirmed by immunofluorescence following a neural differentiation protocol.
(184) Formation of ETiX Embryoids
(185) Formation of ETiX embryoids was performed as previously described in Amadei 2021. In brief, to prepare the AggreWell plate (STEMCELL Technologies 34415), 500 l of anti-adherence rinsing solution (STEMCELL Technologies 07010) was added to each well. The plate was then centrifuged at 2,000g for 5 min and was incubated for 20 min at room temperature. Rinsing solution was then aspirated from the well. 1 ml of PBS was added to wash each well. 500 l of FC medium was added to each well after aspirating the PBS.
(186) To generate ETiX embryos, doxycycline (1 g/ml) (Sigma-Aldrich D9891-5G) was added to CAG-GFP tetO-Gata4 ES cells for 6 hours. TSCs were trypsinized and were added to a gelatinized plate to deplete the MEFs for 20 min at 37 C. CAG-GFP WT ES cells and CAG-GFP tetO-Gata4 ES cells were subsequently trypsinized. ES cells were washed once with 1PBS, and trypsinized with 0.05% trypsin-EDTA (ThermoFisher Scientific) for 3 min at 37 C. The reaction was stopped by adding 2 ml of FC medium. Cells were dissociated gently by pipetting for 4-5 times and centrifuged at 200g for 4 min. The cell pellets were washed once with 1PBS, centrifuged again and resuspended in 1-2 ml of FC medium. Cell suspensions with 19,200 TS cells, 6,000 CAG-GFP WT ES cells and 6,000 CAG-GFP tetO-Gata4 ES cells were mixed and pelleted by centrifugation. The cell pellets were resuspended in 1 ml of FC medium with 7.5 nM ROCK inhibitor (Y27632, STEMCELL Technologies 72304). After adding the cell mixture dropwise to the AggreWell, the plate was centrifuged at 100g for 3 min to have the cells plated in the AggreWell (day 0).
(187) On the next day (day 1), medium change was performed twice by removing 1 ml of medium from each well and adding 1 ml of fresh FC medium without ROCK inhibitor. On day 2, medium change was performed once to replace 1 ml of medium with 1 ml of fresh FC medium. On day 3, 1 ml of medium was removed from each well and 1.5 ml of In Vitro Culture Medium 1 (IVC1) (with FBS at 20% v/v) was added, after equilibrating for 20 min in the incubator. IVC1 is made of advanced DMEM/F12 (Gibco, 21331-020) supplemented with 20% (v/v) FBS, 2 mM GlutaMax, 1% v/v penicillin-streptomycin, 1ITS-X (Thermo Fisher Scientific, 51500-056), 8 nM p-estradiol, 200 ng/ml progesterone and 25 M N-acetyl-L-cysteine. On day 4, ETiX embryoids in the AggreWell were transferred to Cellstar 6-well multi-well plate for suspension culture (Greiner Bio-One 657185) with 5 ml of IVC1 (with FBS at 30% v/v) per well.
(188) Ex utero culture of mouse embryos was as previously described. DRH medium comprised 25% DMEM, 50% rat serum and 25% human cord serum, and permitted development to the somite stage in stationary culture and beyond, following transfer to the Precision rotating bottle culture apparatus (BTC Engineering). Glutamine and antibiotics (100 units/ml penicillin and 100 g/ml streptomycin) were added to bicarbonate-buffered DMEM without glutamine (Gibco 11054). As depletion of glucose has been described to be a major cause of malformations and growth retardation, the low glucose DMEM (1 mg/ml) was supplemented with 3 mg/ml glucose. As phenol red is fluorescent, embryos were routinely cultured in medium lacking phenol red. The medium had the same proportions of DMEM (Gibco 11880), rat serum and human cord serum as DRH, but was buffered with HEPES rather than bicarbonate (and was renamed ex utero culture medium (EUCM)). EUCM comprises 25% DMEM (GIBCO 11880) supplemented with 1 Glutamax (GIBCO, 35050061), 100 units/ml penicillin and 100 g/ml streptomycin and 11 mM HEPES (GIBCO 15630056), plus 50% rat serum and 25% human chord serum. Rat whole embryo culture serum was from Charles River. Human cord serum was provided by the Cambridge Blood and Stem Cell Biobank, which was supported by the Cambridge NIHR Biomedical Research Centre, Wellcome Trust-MRC Stem Cell Institute and the Cambridge Experimental Cancer Medicine Centre, UK. Human and rat serums were heat-inactivated for 35 min (from frozen) at 56 C. and sterilized by filtration.
(189) Routinely, on day 5, IVC1 was replaced with DRH or EUCM containing 1 Glutamax (GIBCO, 35050061), 100 units/ml penicillin and 100 g/ml streptomycin and 11 mM HEPES (GIBCO 15630056). Each ETiX embryoid was transferred to a single well of 24-well, non-adherent dish (Greiner 662102) with 250 l DRH or EUCM. On day 6, each ETiX embryoid was fed with an additional 250 l of DRH or EUCM. A supplement of 3.0 mg/ml D-glucose (Sigma G8644) was added to low glucose medium on day 7 when the samples were moved to the rotating bottle culture chamber apparatus. Each rotating bottle contained 2 ml medium and 3 ETiX embryoids. On day 8 the medium was further supplemented with 3.5 mg/ml D-glucose. In each rotating bottle, 2 ETiX embryoids were cultured with 3 ml medium.
(190) A device to regulate gas pressure and gas mixing on the roller bottles was previously described. The device was modified to enable pressure generation but not gas mixing. Therefore, only the pressure-generating component of this device was used to enable the development of embryoids to day 8. A device was built herein to deliver defined gas mixtures at 0.5 psi rather than 6.5 psi as previously described. This device was used to successfully culture embryoids and natural embryos for sequential smFISH. Delivery of gas mixtures at this lower pressure was effective in promoting development either when 21% oxygen was continuously supplied during culture or when the oxygen concentration was incrementally increased from 5% to 13% to 18% to 21% at daily intervals. DRH medium necessitated use of 5% C02.
(191) Mouse Model and Embryo Recovery
(192) Mice (six-week-old CD-1 males from Charles River and transgenic females bred in house) used in the experiments were kept in the animal house, following national and international guidelines. All experiments performed were under the regulation of the Animals (Scientific Procedures) Act 1986 Amendment Regulations 2012 and were reviewed by the University of Cambridge Animal Welfare and Ethical Review Body (AWERB). Experiments were also approved by the Home Office. Mice were maintained in the animal facility at 12:12 light cycle and provided with food and water and libitum.
(193) Natural mating was performed with six-week-old transgenic females and CD-1 males. Mouse embryos were recovered at embryonic days E5.5, E6.5 and E7.5 by dissecting them from the deciduae in M2 medium (Sigma M7167). Embryos at E6.5 were cultured in EUCM in stationary conditions until E8.5 as previously reported in the same way as the ETiX embryoids. At E8.5, embryos were moved to a rotating bottle in DRH or EUCM supplemented with 3.0 mg/ml of D-glucose. Each bottle contained 2 ml of DRH or EUCM medium and 3 embryos. Both male and female embryos were used. Embryos were randomly allocated. Researchers were not blinded for embryo allocation.
(194) Plasmids and Transfection
(195) Gata4 cDNA was PCR-amplified from pSAM2-mCherry-Gata4 using the Gata4/AttB primers (see Table 3). The primers were designed as outlined in the Gateway cloning manual. Because the plasmid already contained AttB sites, there was no need to incorporate parts of the Gata4 open reading frame in the primer design. pSAM2-mCherry-Gata4 was obtained as a gift (Addgene plasmid #72690; //n2t.net/addgene:72690; RRID:Addgene_72690). It was subsequently cloned into PB-tetO-hygromycin by Gateway technology (Thermo Fisher Scientific), according to the manufacturer's instructions. Clones were verified by sequencing. Transformations were performed using 5a-competent E. coli (New England Biolabs C29871). To generate ES cells with Doxycycline inducible Gata4, PB-tetO-hygro-Gata4, pBAse and rtTA-zcocyin (0.25 g/each/reaction) were transfected into 12,000 CAG-GFP ES cells using Lipofectamine 3000 Transfection Reagent (Invitrogen L3000001), followed by antibiotics selection for 7 days with hygromycin (1:250; Gibco 10687010) and zeocyin (1:1000; InvivoGen ant-zn-1). The PB-tetO-hygro, pBAse and rtTA-zeocyin were obtained as a gift from the Stem Cell Institute (Cambridge, UK).
(196) TABLE-US-00003 TABLE3 OLIGONUCLEOTIDETABLE SEQID NAME NO: PCRprimer:Gata4-AttBForward 1 GGGGACAAGTTTGTACAAAAAAGCAGGCT PCRprimer:Gata4-AttBReverse: 2 GGGGACCACTTTGTACAAGAAAGCTGGGT Pax6KOgRNA:gRNA1: 3 5-CACCGCTCCCCCTCCTTCCTGTTGC-3 Pax6KOgRNA:RV: 4 5-AAACGCAACAGGAAGGAGGGGGAGC-3 Pax6KOgRNA2: 5 5-CACCGAGATGCGACTTCAGCTGAAG-3 Pax6KOgRNA2:RV: 6 5-AAACCTTCAGCTGAAGTCGCATCTC-3 Pax6PCRprimer:Forward: 7 5-AAGAGACCTTGCGAGAGCAC-3 Pax6PCRprimer:Reverse: 8 5-GAACTTTCCCACCAGGAGCA-3
Immunofluorescence
(197) ETiX embryoids and natural embryos were processed for immunofluorescence as previously reported in Amadei 2021. Briefly, ETiX embryos and natural mouse embryos were fixed with 4% paraformaldehyde at room temperature for 20 min and washed with PBST (PBS with 0.1% Tween 20) for three times. They were then permeabilized in permeabilization buffer (0.1 M glycine and 0.3% Triton X-100 in PBST). For embryos up to E7.5 and ETiX embryos up to day 6, permeabilization was performed for 30 min at room temperature, followed by three washes with PBST of five min each. Natural embryos older than E7.5 and ETiX embryoids older than day 6 were permeabilized for 35 min. Samples were incubated with primary antibodies diluted in blocking buffer (10% FBS and 0.1% Tween 20 in PBS) at 4 C. overnight. After washing with PBST for three times, they were incubated with secondary antibodies and DAPI at 4 C. overnight or for 2 hours at room temperature followed by another three washes with PBST before imaging.
(198) Cryosectioning and Slide Immunofluorescence
(199) Natural embryo and ETiX embryoid samples after fixation were cryoprotected in 30% sucrose/PBS (w/v) overnight at 4 C. Samples were then transferred to a cryomold filled with optimal cutting temperature (OCT) compound (Agar Scientific) and frozen on a metal block cooled on dry ice. The samples were cut at a thickness of 12 m on a cryostat, collected on lysine-coated slides and stored at 80 C. until ready for immunofluorescence. Slides were washed in PBS to remove OCT compound for 5-10 min and then briefly allowed to air dry for 5-10 min. Samples were permeabilized for 10 min at room temperature with permeabilization buffer (0.1 M glycine and 0.3% Triton X-100 in PBST) and then blocked for 1 h at room temperature with blocking buffer (10% FBS and 0.1% Tween 20 in PBS). After permeabilization and blocking, samples were processed as described above. Slides were mounted with Vectashield, sealed with nail polish, and allowed to air dry overnight in the dark prior to imaging.
(200) inDrops scRNA-Seq Sample Preparation and Dissociation
(201) After recovery, natural embryos and ETiX embryoids were dissociated for single-cell sequencing as previously described in Amadei 2021. In brief, natural embryos and ETiX embryos were cut to pieces, transferred to a Falcon tube, centrifuged, washed in PBS and incubated in Tryple Express (Gibco 12604013) for 15 min, with vigorous pipetting for 20 times every 5 min to dissociate to single cells. If there were clumps left, the incubation was extended for an additional 5 min and the samples were pipetted further. Samples were filtered with a 40 m filter to remove large clumps, centrifuged at 200g for 5 min and resuspended in PBST (PBS with 0.02% Tween20). The suspension was quantified with Trypan Blue (Sigma T8154) in a 1:1 ratio to determine the proportion of live and dead cells and then processed for encapsulation (see below). Samples analyzed: n=29 for ETiX5, 10 for ETiX6, 7 for ETiX8, 12 for E6.5, 14 for E7.5 and 9 for E8.5.
(202) inDrops scRNA-Seq Library Preparation and Sequencing
(203) Libraries were prepared according to the inDrops v3 workflow with v3 barcoding scheme. In brief, polyacrylamide beads were generated and barcoded to obtain a diversity of 147,456 barcodes. Single-cell suspensions were diluted to a concentration of 100,000 cells per ml and co-encapsulated with the barcoded beads and reverse transcriptase and lysis mix. Fractions of 1,000 cells were collected in 1.5 ml Eppendorf tubes pre-filled with 200 l mineral oil, subjected to UV photocleavage And incubated at 50 C. for 2 h and 70 C. for 20 min. The droplets were then de-emulsified and further amplified using second-strand synthesis and in vitro transcription. The libraries were then fragmented and reverse transcribed. The final libraries were amplified using a unique 8-bp index and limited-cycle PCR and quantified using a Qubit High Sensitivity kit (Invitrogen) and Bioanalyzer High Sensitivity DNA kit (Agilent). Libraries were pooled at equimolar ratios and purified using a 1.5 volumetric ratio of AmpureXP beads. The libraries were sequenced on a Nextseq 75 cycle 400M read High Output kit with 5% PhiX spike-in as an internal control. The read cycle distribution was the following: read 1, 61 cycles; index 1, 8 cycles; index 2, 8 cycles; read 2, 14 cycles.
(204) scRNA-Seq Bioinformatic Analysis
(205) The BCL files were converted to Fastq files using Illumina's bcl2fastq software. The sequenced libraries were quality-inspected using the FastQC tool v0.11.9 (www.bioinformatics.babraham.ac.uk/projects/fastqc/) and de-multiplexed using the Pheniqs tool from biosails v2.1.0. The fastq files were further filtered, mapped to a mouse GRCm38.99 reference genome with GRCm38.99 gtf annotation and deduplicated using the zUMIs pipeline v2.9.7. The count matrices with exonic and intronic counts were then used as input for downstream analysis using Seurat version 3. Cells were filtered based on the number of genes detected (between 700 and 4,000), unique molecular identifiers (UMIs) detected (lower than 7,500), percentage of UMI counts mapping to mitochondrial genes (between 1 and 15%) and doublet scores computed using Scrublet v0.1 (lower than 0.3), which yielded a total of 26,748 cells overall. The natural and synthetic embryo datasets were integrated in Seurat. Shared embeddings were corrected for batch effect (both systems and time points collected) using Harmony v4.3.12. Louvain clustering was performed on the shared embeddings. Markers, computed using the FindAllMarkers function of Seurat, were used to annotate cell types. Pearson correlation coefficients between cell types for each system, single-cell velocity profiles and latent times were computed using the Scanpy v1.0 and scVelo v0.2.4 tools. Plots were generated using Scanpy (in Python for dot plots and velocity) and Seurat (in R for UMAP plots), as well as ggplot2 for the remainder of the plots (in R for bar plots and proportion scatter plots).
(206) Generating Single-Cell Sequencing Data Using Tiny-Sci-RNA-Seq
(207) A simplified version of sci-RNA-seq3 was performed, which is further optimized for tiny samples. In brief, to each tube, 100 l of a hypotonic, PBS-based lysis buffer was added with DEPC as an RNase inhibitor. The resulting nuclei were then fixed with four volumes of a mix of methanol and dithiobis (succinimidyl propionate) (DSP). After rehydrating and washing the nuclei carefully in a sucrose/PBS/triton/MgCl.sub.2 buffer (SPBSTM), the nuclei were distributed to two 96-well plates for reverse transcription, allocating 8 wells per embryo. After reverse transcription, nuclei were pooled, washed in SPBSTM and redistributed to a fresh plate for ligation of the second index primer with T4 DNA ligase. Nuclei were then again pooled, washed, and redistributed to three final plates for second-strand synthesis, extraction, tagmentation, and PCR amplification to add the third index plus a plate index. Products were pooled by PCR plate, size-selected and sequenced on two Illumina NextSeq runs (NextSeq-1 and NextSeq-2). Samples analyzed: n=8 natural embryos ranging from E7.5 to E9.5, n=3 for ETiX6, n=2 for failed ETiX6, 5 for ETiX8, 4 failed ETiX8 and 2 Pax6-knockout ETiX8.
(208) Processing of Sequencing Reads Oftiny-Sci-RNA-Seq Data
(209) For each NextSeq run of newly generated tiny-sci-RNA-seq data, read alignment and gene count matrix generation were performed using the pipeline developed for sci-RNA-seq3 with minor modifications: base calls were converted to fastq format using Illumina's bcl2fastq v2.20 and de-multiplexed based on PCR i5 and i7 barcodes using maximum likelihood demultiplexing package deML with default settings. Downstream sequence processing and single-cell digital expression matrix generation were similar to sci-RNA-seq except that the reverse transcription (RT) index was combined with hairpin adaptor index. Thus, the mapped reads were split into constituent cellular indices by demultiplexing reads using both the RT index and ligation index (Levenshtein edit distance (ED)<2, including insertions and deletions). In brief, de-multiplexed reads were filtered based on RT index and ligation index (ED<2, including insertions and deletions) and adaptor-clipped using trim_galore v0.6.5 with default settings. Trimmed reads were mapped to the mouse reference genome (mm10) for mouse embryo nuclei, using STAR v2.6.1d with default settings and gene annotations (Gencode VM12 for mouse). Uniquely mapped reads were extracted. Duplicates were removed using the UMI sequence (ED<2, including insertions and deletions), RT index, hairpin ligation adaptor index and read 2 end-coordinate (that is, reads with UMI sequence less than 2 edit distance. RT index, ligation adaptor index and tagmentation site were considered duplicates). Finally, mapped reads were split into constituent cellular indices by further demultiplexing reads using the RT index and ligation hairpin (ED<2, including insertions and deletions). To generate digital expression matrices, the number of strand-specific UMIs for each cell mapping to the exonic and intronic regions of each gene was calculated with Python v2.7.13 HTseq package. For multi-mapped reads, reads were assigned to the closest gene, except in cases where another intersected gene fell within 100 bp of the end of the closest gene, in which case the read was discarded. For most analysis, both expected-strand intronic and exonic UMIs in per gene single-cell expression matrices were included. After the single-cell gene count matrix was generated, doublets cells and potential low quality cells (by investigating the numbers of UMIs and the proportion of reads mapping to the exonic regions per cell) were filtered out, leaving 285,640 cells (n=130,611 cells for NextSeq-1, and n=155,029 cells for NextSeq-2;
(210) Subclustering
(211) Conventional scRNA-seq data processing was performed using Seurat v3: (1) normalizing the UMI counts by the total count per cell followed by log transformation; (2) selecting the 2,500 most highly variable genes and scaling the expression of each to zero mean and unit variance; (3) applying principal component analysis and then using the top 30 principal components to create a k-nearest neighbors graph, followed by Louvain clustering (resolution=1); (4) performing UMAP visualization in 2D space (dims (which dimensions to use as input features)=1:30, min_dist=0.3). Neighboring clusters were manually merged if there were a limited number of differential expressed genes between them. For subclustering, a subset of cells of interest (for example, cardiac mesoderm) was taken to identify more detailed cell populations following the above approach.
(212) Identification of Correlated Cell Types Between ETiX Embryoids and Natural Embryos Using NNLS Regression
(213) Transcriptional profiles for cells within each cell type were first aggregated for either ETiX embryoids or natural embryos in the newly generated tiny-sci-RNA-seq data. NNLS regression was applied to predict gene expression in target cell type (T.sub.a) in dataset A based on the gene expression of all cell types (M.sub.b) in dataset B: T.sub.a=.sub.0a+.sub.1aM.sub.b (where .sub.0a is the intercept of the regression and .sub.1a is the -coefficient of the regression), based on the union of the 3,000 most highly expressed genes and 3,000 most highly specific genes in the target cell type. The roles of datasets A and B was then switched. Thus, the gene expression of target cell type (T.sub.b) was predicted in dataset B from the gene expression of all cell types (M.sub.a) in dataset A: T.sub.b=.sub.0b+.sub.1bM.sub.a. Finally, for each cell type a in dataset A and each cell type b in dataset B, the two correlation coefficients were combined: =2(.sub.ab+0.01)(.sub.ba+0.01) to obtain a statistic, for which high values reflected reciprocal and specific predictivity.
(214) Inclusion Criteria of ETiX Embryoids
(215) All ETiX embryoids were collected from AggreWell for analysis at 4 days of development and analyzed under a stereomicroscope. ETiX embryoids with cylindrical morphology and two clearly defined cellular compartments (an ES cell compartment and TS cell compartment) surrounded by an outer cell layer, the VE-like layer, were selected. The ES cell compartment was expected to be epithelialized with a lumen. The TS cell compartment was more variable in appearance. Therefore, even though one would also want an epithelial-looking TS cell compartment similar to the ExE of natural embryos, a wider range of appearances for the TS cell compartment was selected. Since the majority of ETiX embryoids were generated by using wild-type, unlabelled stem cell lines, the selection was based on morphology alone. ETiX embryoids with the correct body plan of ES cell and TS cell compartments surrounded by a VE-like layer were then transferred to an equilibrated medium to continue their culture. During selection on day 5, however, additional criteria were included: (1) the lumens of the ES cell and TS cell compartments were expected to be merged; (2) ideally, the beginning of gastrulation on one side of the ETiX embryoids can be observed; (3) the AVE was expected to have migrated to the ES cell-TS cell boundary and be opposite to the forming streak; (4) ETiX embryoids with the AVE stuck at the tip of the structure or not at the boundary were excluded; and 5) when using the Triple reporter cells, one side showing higher Sox2-Venus expression was ensured. On day 4, 10%-15% of the structures formed in the pyramidal microwells were collected. From day 4 to day 5, 20% of the structures collected on day 4 were cultured.
(216) Image Acquisition, Processing and Analysis
(217) Images were acquired using Leica SP5 and SP8 confocal microscopes (Leica Microsystems) with 40 oil objective and 25 water objective, respectively. A 405-nm diode laser (DAPI), a 488-nm argon laser (Alexa Fluor 488), a 543-nm HeNe laser (Alexa Fluor 568) and a 633-nm HeNe laser (Alexa Fluor 647) were used to excite the fluorophores. Images were taken with a z-step of 1.2-5 m. FUI and NDSAFIR 3.0, the Smart Denoise (Gurdon Institute) were used to process and analyze the images. Area measurements used to generate the quantifications were also collected using Fiji. Figures were assembled with Adobe Illustrator v26.0.1.
(218) The images provided were representative of multiple experiments analyzed. As with natural embryos, the features of the ETiX embryoids described can be observed under a regular stereomicroscopefor example, the beating heart-like structure was clearly visible in 87% of the structures obtained. The headfolds and somites were also readily observable and recognizable. Observation of such morphology in bright-field microscopy was predictive of staining reproducibility. Furthermore, analysis by single-cell sequencing of individual ETiX embryoids showed great reproducibility among these structures. Quantifications suggested that, albeit greater size variability was observed across ETiX embryoids, the organs and regions analyzed were of comparable size to those of natural embryos. Finally, it is also likely that some of the variability observed in ETiX embryoids was caused by ex utero culture itself, since it caused variability in the development of natural embryos as well.
(219) Sequential smFISHPrimary Probe Design
(220) Gene-specific primary probe sets were designed as previously described with some modifications. In brief, probe sets of 35-nt binding sites were crafted for each gene using exonic sequences from the consensus regions for all spliced isoforms. For genes that did not yield enough targets (>40), the intronic and 5 untranslated region sequences were also used. The masked genome and annotation databases from University of California Santa Cruz (UCSC) were used to obtain the gene sequences and extract 35-bp sequences with 45-75% GC content and without a region of repeating 5-nt bases of the same kind. Each probe sequence was then run against a BLAST database constructed from GENCODE-reversed introns and mRNA sequences. All probes with BLAST hits on any sequence other than the target gene with at least a 15-nt match were considered off-target hits and dropped from the probe set. All probe sets for each gene were then trimmed to a maximum of 40 probes, removing all probes lying furthest from the targeted 55% GC content.
(221) Sequential smFISHReadout Probe Design.
(222) Readout probes were used as previously designed. In brief, a set of 20-nt probe sequences was generated randomly by combinations of A, T, G and C nucleotides. Sequences of 45-60% GC were selected and run against a BLAST database to eliminate any sequences that matched with any contiguous homology sequences longer than 14 nt to the mouse transcriptome. The reverse complements of these readout sequences were included in the primary probes with AA or TAAT linkers in a manner as follows: [readout]-AA-[readout]-AA-[readout]-TAAT-[probe binding sequence]-TAAT-[readout]-AA-[readout]-AA-[readout]. Thus, each probe was 141 nt long.
(223) Sequential smFISHPrimary Probe and Readout Probe Construction.
(224) Primary probes were ordered as IDT oligonucleotide pools with 50 mol per probe concentration and 5-phosphate modification. Readout probes were ordered from IDT as 250 nmol DNA oligonucleotides with HPLC purification and 5-fluorophore modifications (5 Alexa Fluor 647N, 5 Alexa Fluor 488N or 5 Alexa Fluor 546N).
(225) Sequential smFIsHCoverslip Functionalization.
(226) Coverslips were functionalized by 1 M HCl treatment at room temperature for 1 h, rinsing with water once, 1 M NaOH treatment at room temperature for 1 h, and then immersion in 1% bind-silane (GE-Healthcare, 17-1330-01) prepared in pH 3.5 10% (v/v) acidic ethanol solution for 30 min. The coverslips were then thoroughly rinsed in 100% ethanol 3 times and placed on glass slides for heat-curing in an oven at >90 C. for 30 min. The coverslips were allowed to cool down. The area of the coverslip intended for final tissue section placement was covered with 100 g/l of poly-D-lysine (Gibco, A3890401) for >1 h. The coverslips were then thoroughly rinsed with water three times and then allowed to dry in a tissue culture hood with UV-sanitation. For long-term storage, the coverslips were kept dry at 4 C. for <2 weeks before use.
(227) Sequential smFISHSequential smFISH Experiment on ETiX Embryoids.
(228) ETiX embryoids and natural embryos were fixed with 4% paraformaldehyde at 4 C. overnight. They were then washed with PBST (PBS with 0.1% Tween 20) twice at 4 C. and dehydrated into methanol gradually with a series of graded methanol/PBST washes for 10 min each at 4 C. Samples were stored at 20 C. overnight before they were rehydrated in a series of graded methanol/PBST washes and washed twice in PBST at 4 C. for 10 min. Embryo samples were then immersed in 30% sucrose/PBS (w/v) overnight at 4 C. or until the sample sank to the bottom of the tube. Samples were transferred to a cryomold, carefully positioned in OCT compound solution (Agar Scientific), and frozen in dry ice ethanol. Samples were stored at 80 C. before sectioning.
(229) The tissue blocks were cut at 20-m thickness using a micron cryostat and placed onto the functionalized coverslips. After drying out for >15 min, the coverslips were placed at 80 C. for long-term storage. After at least one day of storage at 20 C., the tissue sections were permeabilized in 70% ethanol at 4 C. for >1 h, and then dried and cleared with 1 ml of 8% SDS (Invitrogen, AM9822) in 1PBS at room temperature for 30 min. After rinsing with PBS two times and nuclease-free water one time, a custom-made flow cell (fluidic volume about 30 l), which were made from glass slide (2575 mm) with 1 mm thickness and 1 mm diameter holes and a PET film coated on both sides with an acrylic adhesive with total thickness of 0.25 mm (Grace Bio-Labs, RD481902) was attached to the coverslips. Using the 1 mm diameter holes, the tissue samples were incubated in 30% hybridization buffer (Molecular Instruments) containing 3.3 nM of each probe overnight at 37 C. The holes of the flow cells were covered using a sticker (Grace Bio-Labs, GBL629200) to prevent evaporation during incubation. The samples were then washed with 30% wash buffer (Molecular Instruments) for 4 times over 1 h, and then rinsed with 4 saline-sodium citrate buffer (SSC) (Thermo Fisher, 15557036) 5 times.
(230) Sequential smFISHSequential smFISH on Control Embryos.
(231) All steps for ETiX embryoid smFISH experiment were followed with the additional clearing steps to improve signal-to-noise ratio in the resulting images. In addition to the gene marker probes, a poly-30-T LNA oligonucleotide with 5-acrydite modification (IDT) was hybridized at 2 M. After 30% wash buffer washes, a sticker containing a circle cutout of 3 mm diameter and 100 m thickness was applied to the sample. A gel solution containing 4% acrylamide and 0.2% bis-acrylamide (Bio-Rad, 1610154) with 0.25% VA-044 (Fujifilm, LB-VA044-50GS) was assembled on ice and treated with nitrogen for >5 min. Twenty microliters of the solution was dropped onto the sample (contained inside the circle cutout within the sticker) and a 2222 mm coverslip was applied on top of the sample. The sample was then placed into a humidified airtight chamber and all the oxygen was removed by flowing in nitrogen for >10 min. To allow infiltration of the sample with the hydrogel, the sample was incubated at 4 C. overnight, and then placed at 37 C. for 3.5 h to allow the hydrogel to solidify. The small glass coverslip and sticker were then removed. The samples were treated with 1:100 Proteinase K (NEB, P8107S), 50 mM pH 8.0 Tris-HCl (Thermo Fisher, 15568025), 1 mM EDTA (Thermo Fisher, 15575020), 0.5% Triton X-100 (Sigma, 93443), 500 mM NaCl (Sigma, S5150), and 1% SDS (Invitrogen, AM9822) for 2.5 h at 37 C. in a humidified chamber. The sample was then washed with 2SSC for 15 min, and treated with Label-X as previously described (0.1 g/l of Acryoyl-X SE (Thermo Fisher A20770) and 0.1 g/l of Label-IT Reagent (Mirus, MIR3900)) for 45 min at 37 C. The sample was washed with 2SSC, and then re-embedded in a hydrogel as done above for further stabilization for long-term imaging.
(232) Sequential smFISHMicroscope Setup.
(233) All imaging experiments were performed with the imaging platform and fluidics delivery system like those previously described. The microscope (Ti Eclipse) was equipped with a confocal scanner unit (Yokogawa CSU-W1), a sCMOS camera (Andor Zyla 4.2), a 60 oil objective (Nikon Plan/Apo, NA 1.4, WD 0.13), a motorized stage (ASI MS-2000), and a 7-wavelength Nikon LUNF XL laser launch. The following filters were used: 435/26 bp (Chroma) for 405 nm, 525/36 bp (Chroma) for 488 nm, 588-700 bp (Chroma 59007 dual band pass) for 561 nm, and 705/72 bp (Chroma) for 647 nm. A custom-made automated sampler was used to move designated readout probes in hybridization buffer (10 nM per readout probe in 2SSC, 10% ethylene carbonate (Sigma, E26258), 10% dextran sulfate (Sigma, D4911), and 0.1 g/mL DAPI (Thermo Fisher, D1306)) from a 2.0 ml 96-well plate through a multichannel fluidic valve (IDEX Health and Science, EZ1213-820-4) to the custom-made flow cell using a syringe pump (Hamilton Company, 63133-01). Other buffers, like 2SSC, 10% wash buffer (2SSC, 10% formamide (Thermo Fisher, AM9342), 0.1% Triton X-100 in nuclease-free water), 55% wash buffer (2SSC, 55% formamide, 0.1% Triton X-100 in nuclease-free water), and anti-bleaching buffer (3 mM Trolox (Sigma, 238813), 1% w/v D-glucose (Sigma, G7528), 1:100 diluted catalase (Sigma, C3155), 1.0 mg/ml glucose oxidase (Sigma, G2133), and 50 mM pH 8.0 Tris-HCl) were also moved through the multichannel fluidic valve to the custom-made flow cell using the syringe pump. The integration of imaging and the automated fluidics delivery system was controlled by custom-written scripts in Manager and Python using Jupyter notebooks.
(234) Sequential smFISHImaging.
(235) The sequential hybridization and imaging routines were performed similarly to those previously described with some modifications. The sample with the custom-made flow cell was first connected to the automated fluidics system on the motorized stage on the microscope. The region of interest (88 tile scan with 25% overlap for ETiX embryoid, 89 tile scan with 20% overlap for control embryo) was identified and used for sequential rounds of hybridization and imaging as follows. The hybridization buffer with readouts and DAPI was flowed onto the sample and allowed to incubate for 60 min, then washed with 10% wash buffer for 1 min, and washed with 2SSC three times before applying anti-bleaching buffer for image acquisition. Z-stacks with sections of optical thickness of 0.65 m were acquired for each tile, using 500-2,000 ms exposure times for all lasers used. After image acquisition, the readout probes were washed off the sample with 3 washes of 55% wash buffer, with 5-min incubation periods between each wash, followed by one wash with 2SSC. This process was then repeated for all rounds of gene markers. For the last round of smFISH imaging, the sample was stripped of readout probes and incubated with 0.1 sg/ml DAPI in 2SSC for 30 min prior to imaging in all channels.
(236) Each readout probe hybridization and stripping routine took approximately 1.5 h. Imaging time per tile took around 8 min each. Thus, the entire tile scan took around 8.5 h. Therefore, it took approximately 5 days to complete the 11 rounds of hybridization and imaging routine for each experiment.
(237) Sequential smFISHImage Analysis.
(238) To increase signal-to-noise ratio in the ETiX embryoid images, the last round of imaging (DAPI only, without readout probes) was used to subtract away the sample background signal. This was not done for the control embryo FISH images because the background in that experiment was minimal due to the additional hydrogel clearing steps. Thus, for the ETiX embryoid images, each tile of the background round was registered using the phase_cross_correlation function (without normalization) from the skimage package in Python to the corresponding tile of each smFISH round using the DAPI channel as a reference to generate a shift vector. The shift vector was then applied to the rest of the channels (488 nm, 561 nm and 647 nm) for the background round and the registered sample background was subtracted against the corresponding channel for each tile of each smFISH ETiX embryoid round.
(239) For both the ETiX embryoid and control embryo FISH images, the background signal was further reduced for each tile by using the ImageJ rolling ball background subtraction algorithm with a radius of 50 pixels. Each DAPI tile was then max-projected and the tiles of each round were then stitched together using the ImageJ Grid/Collection stitching algorithm with regression threshold as 0.01, without overlapping computation, and standard settings otherwise. To stitch the other channels in the same manner as the DAPI channel, the rest of the channels were then max-projected. The tiles for each round were stitched together using the settings acquired from the tile configuration file generated from the DAPI tile stitching.
(240) An Ilastik classifier was then trained and used to classify the signal for each channel (405 nm, 488 nm, 561 nm and 647 nm) of each FISH round into foreground and background. The DAPI foreground mask was dilated using a disk structuring element with 10-pixel radius and used to mask out any erroneous foreground signal from the 488 nm, 561 nm and 647 nm channels that laid far outside of nuclei-positive imaging regions. The foreground for each of the 488 nm, 561 nm and 647 nm channels was distance transformed and used to find local minima, which were used to perform a watershed to obtain a final label image, in which each label represented one detected, unique transcript. To visualize gene expression across different imaging rounds, the stitched DAPI images were then registered across different rounds to obtain a shift vector for each round. This shift vector was then applied to the label positions corresponding to their respective round. For figure visualization, the center of each label was then plotted as a disk with 7-pixel radius.
(241) Gene Ontology Analysis
(242) Gene Ontology (GO) for the extraembryonic endoderm was performed using the online platform DAVID. Differentially expressed genes from pairwise comparisons were selected by choosing genes with an adjusted p-value <0.05 and enriched in one sample or the other of the pairwise comparison. The list was then uploaded in the DAVID user interface and analyzed with the Gene Functional Annotation Clustering tool and the Gene Functional Annotation Table. The first 20 clusters with the highest Enrichment Score (log P-value) were graphed. GO analysis was performed to explore the functional roles of differentially expressed mRNAs in terms of biological processes between natural embryos and ETiX embryoids, and between wild-type and Pax6-knockout ETiX embryoids using the GO Enrichment Analysis online tool (GO Ontology database). Differentially expressed genes for the pairwise comparison were selected as described above. GO terms were inputted into excel for graphing purposes.
(243) Statistical Analysis
(244) Data were tested for normality using the Shapiro-Wilk test. Normally distributed data was analyzed with unpaired t-test as indicated in the figure legends. Data that was not normally distributed was analyzed with a Mann-Whitney U-test. All tests were performed in Prism GraphPad software v9.2. Number of samples for the statistical test is indicated in the BRIEF DESCRIPTION OF THE DRAWINGS section above. All tests were performed as two-tailed. For each test, different samples were used with the exception of
Example 2
(245) Embryoid Development Through Neurulation
(246) This Example reports that ETiX embryoids cultured ex utero can develop through neurulation with high efficiency. As evidenced by the morphology and gene expression and cell type analysis, ETiX8 embryoids resembled those of natural embryos on E8.5, which is known to develop through neurulation.
(247) To examine anterior brain development in ETiX embryoids, ES cells, TS cells and iXEN cells were seeded and allowed to self-assemble. On day 4, the ETiX embryoids with correct post-implantation morphology were transferred to suspension culture (
(248) Gastrulating ETiX embryoids strongly resembled natural gastrulating embryos (
(249) To monitor development by examining changes in gene expression at single-cell resolution, ETiX embryoids were isolated on day 5, day 6 and day 8, and natural embryos dissected on E6.5, E7.5 and E8.5 (n=29 for ETiX5, 10 for ETiX6, 7 for ETiX8, 12 for E6.5, 14 for E7.5 and 9 for E8.5). The ETiX embryoids and natural embryos were dissociated into single cells and sequenced with single-cell RNA sequencing (scRNA-seq) using the inDrops method (see Example 1). UMAP analysis revealed a similar contribution of cells to the developing lineages in natural embryos and ETiX embryoids (
(250) Natural embryos and ETiX embryoids displayed a largely conserved distribution of cells among the different germ layers of the epiblast (ectoderm, mesoderm and endoderm) and among embryonic and extraembryonic lineages (epiblast, ExE, extraembryonic mesoderm and extraembryonic endoderm) (
(251) To further assess the reproducibility of neurulating embryoid formation, an additional round of single-cell sequencing was performed, in which individual ETiX embryoids of apparently correct morphology, as well as individual natural embryos cultured in vitro from E6.5 collected at different times in development were individually barcoded and analyzed by tiny-sci-RNA-seq (hereafter referred to as tiny-sci; Example 1 General Methods above), a combinatorial indexing-based method for single-nucleus RNA-sequencing profiling from small amounts of starting material. Furthermore, to understand why some ETiX embryoids did not develop well, individual examples of morphologically aberrant embryoid development on day 6 and day 8 (examples of failed embryoids, well-formed ETiX embryoids and natural embryos cultured in vitro (
(252) After data processing and quality control, this new dataset contained profiles of 285,640 cells and showed no discernible batch effect between sequencing rounds (
(253) Next, to identify global transcriptional differences between natural embryos and ETiX embryoids, GO analysis was performed. Natural embryos showed an enrichment of terms associated with uterine development, implantation and remodulation of the endothelial compartment, whereas ETiX embryoids showed terms associated with embryonic morphogenesis (Tables 2-5). GO analysis did not indicate an obvious stress signature or metabolic differences between natural embryos and ETiX embryoids.
(254) Table 4 lists the differentially expressed genes enriched in natural embryos cultured from E6.5 to E7.5 er utero and analyzed by tiny-sci, according to GO analysis.
(255) TABLE-US-00004 TABLE 4 GENE ONTOLOGY OF E7.5 EMBRYOS Terms enriched in E7.5 natural embryos Fold GO biological process complete Enrichment FDR protection from natural killer cell mediated cytotoxicity (GO: 0042270) 17.17 1.30E03 regulation of vascular associated smooth muscle contraction (GO: 0003056) 12.59 4.53E02 lipid phosphorylation (GO: 0046834) 12.59 4.51E02 positive regulation of lactation (GO: 1903489) 10.49 2.73E04 regulation of lactation (GO: 1903487) 10.12 3.25E04 trophoblast giant cell differentiation (GO: 0060707) 9.94 8.95E03 cell differentiation involved in embryonic placenta development (GO: 0060706) 7.87 3.28E03 negative regulation of natural killer cell mediated cytotoxicity (GO: 0045953) 7.87 2.11E02 negative regulation of natural killer cell mediated immunity (GO: 0002716) 7.55 2.39E02 regulation of actin cytoskeleton reorganization (GO: 2000249) 7.49 6.80E04 regulation of cardiac muscle cell action potential (GO: 0098901) 6.99 3.12E02 cell-substrate junction organization (GO: 0150115) 6.91 2.65E03 homotypic cell-cell adhesion (GO: 0034109) 6.7 1.38E03 establishment of endothelial barrier (GO: 0061028) 6.68 1.67E02 negative regulation of leukocyte mediated cytotoxicity (GO: 0001911) 6.29 4.68E02 cell-substrate junction assembly (GO: 0007044) 6.29 9.55E03 positive regulation of actin filament polymerization (GO: 0030838) 5.62 3.94E03 actin filament bundle assembly (GO: 0051017) 5.24 5.99E03 cell adhesion mediated by integrin (GO: 0033627) 5.24 4.52E02 regulation of T cell migration (GO: 2000404) 5.24 2.31E02 negative chemotaxis (GO: 0050919) 5.12 4.98E02 negative regulation of lymphocyte mediated immunity (GO: 0002707) 5.08 7.20E03 actin filament bundle organization (GO: 0061572) 5 7.91E03 leukocyte cell-cell adhesion (GO: 0007159) 4.72 2.08E02 positive regulation of receptor signaling pathway via STAT (GO: 1904894) 4.63 1.24E02 negative regulation of endothelial cell proliferation (GO: 0001937) 4.5 1.47E02 positive regulation of receptor signaling pathway via JAK-STAT (GO: 0046427) 4.5 2.64E02 regulation of lymphocyte migration (GO: 2000401) 4.43 2.84E02 positive regulation of smooth muscle cell migration (GO: 0014911) 4.43 2.82E02
(256) Table 5 lists the differentially expressed genes enriched in ETiX-embryoids analyzed at day 6 of development by tiny-sci, according to GO analysis.
(257) TABLE-US-00005 TABLE 5 GENE ONTOLOGY OF ETIX6-EMBRYOIDS Terms enriched in day 6 ETiX-embryoids Fold GO biological process complete Enrichment FDR positive regulation of hepatocyte differentiation (GO: 0070368) 61.44 4.88E03 regulation of hepatocyte differentiation (GO: 0070366) 46.08 7.41E03 ascending aorta morphogenesis (GO: 0035910) 46.08 7.39E03 ascending aorta development (GO: 0035905) 36.87 1.09E02 atrial septum primum morphogenesis (GO: 0003289) 36.87 1.09E02 septum primum development (GO: 0003284) 30.72 1.50E02 atrioventricular canal development (GO: 0036302) 27.93 3.79E04 regulation of heart morphogenesis (GO: 2000826) 23.04 2.57E02 regulation of cardioblast differentiation (GO: 0051890) 23.04 2.56E02 negative regulation of Wnt signaling pathway involved in heart development (GO: 0003308) 23.04 2.55E02 epithelial cell proliferation involved in liver morphogenesis (GO: 0072575) 23.04 2.55E02 hepatocyte proliferation (GO: 0072574) 23.04 2.54E02 negative regulation of protein sumoylation (GO: 0033234) 20.48 3.19E02 regulation of Wnt signaling pathway involved in heart development (GO: 0003307) 20.48 3.18E02 mammary gland formation (GO: 0060592) 20.48 3.17E02 liver morphogenesis (GO: 0072576) 18.43 3.84E02 regulation of glucocorticoid metabolic process (GO: 0031943) 16.76 4.61E02 ectodermal placode morphogenesis (GO: 0071697) 16.39 1.06E02 ectodermal placode formation (GO: 0060788) 16.39 1.06E02 ectodermal placode development (GO: 0071696) 15.36 1.26E02 catecholamine transport (GO: 0051937) 15.36 1.25E02 atrial septum morphogenesis (GO: 0060413) 14.46 1.49E02 regulation of cardiocyte differentiation (GO: 1905207) 13.87 2.28E04 ventricular cardiac muscle cell differentiation (GO: 0055012) 13.65 1.70E02 cardiac right ventricle morphogenesis (GO: 0003215) 12.94 1.98E02 cardiac atrium morphogenesis (GO: 0003209) 12.65 3.53E04 embryonic hindlimb morphogenesis (GO: 0035116) 12.29 4.03E04 atrial cardiac muscle tissue development (GO: 0003228) 11.7 2.59E02 signal transduction involved in regulation of gene expression (GO: 0023019) 11.38 7.80E03
(258) Table 6 lists the differentially expressed genes enriched in natural embryos cultured from E6.5 to E8.5 ex utero and analyzed by tiny-sci, according to GO analysis.
(259) TABLE-US-00006 TABLE 6 GENE ONTOLOGY OF E8.5 EMBRYOS Terms enriched in E8.5 natural embryos Fold GO biological process complete Enrichment FDR protection from natural killer cell mediated cytotoxicity (GO: 0042270) 51.54 9.36E05 positive regulation of lactation (GO: 1903489) 46.19 2.65E10 regulation of lactation (GO: 1903487) 44.54 1.83E10 plasminogen activation (GO: 0031639) 28.35 4.16E02 negative regulation of natural killer cell mediated cytotoxicity (GO: 0045953) 23.62 1.60E03 negative regulation of natural killer cell mediated immunity (GO: 0002716) 22.68 1.75E03 positive regulation of miRNA transcription (GO: 1902895) 20.47 1.12E09 positive regulation of receptor signaling pathway via JAK-STAT (GO: 0046427) 19.8 6.36E08 negative regulation of endothelial cell proliferation (GO: 0001937) 19.44 1.20E08 negative regulation of cell killing (GO: 0031342) 19.44 5.41E04 negative regulation of leukocyte mediated cytotoxicity (GO: 0001911) 18.9 3.40E03 positive regulation of receptor signaling pathway via STAT (GO: 1904894) 18.34 1.12E07 regulation of miRNA transcription (GO: 1902893) 18.04 9.08E10 positive regulation of bone resorption (GO: 0045780) 17.44 2.53E02 platelet aggregation (GO: 0070527) 16.8 2.78E02 negative regulation of blood coagulation (GO: 0030195) 15.12 1.73E03 platelet activation (GO: 0030168) 14.98 3.52E04 negative regulation of hemostasis (GO: 1900047) 14.79 1.76E03 negative regulation of endothelial cell apoptotic process (GO: 2000352) 14.63 3.78E02 negative regulation of coagulation (GO: 0050819) 14.47 1.90E03 cell differentiation involved in embryonic placenta development (GO: 0060706) 14.17 4.06E02 regulation of receptor signaling pathway via JAK-STAT (GO: 0046425) 12.73 2.74E06 female pregnancy (GO: 0007565) 12.51 1.83E09 homotypic cell-cell adhesion (GO: 0034109) 12.06 1.90E02 multi-organism reproductive process (GO: 0044703) 11.83 1.07E09 regulation of receptor signaling pathway via STAT (GO: 1904892) 11.77 4.99E06 multi-multicellular organism process (GO: 0044706) 11.53 4.74E10 mammary gland development (GO: 0030879) 11.26 3.07E08 regulation of blood coagulation (GO: 0030193) 11.18 1.69E03
(260) Table 7 lists the differentially expressed genes enriched in ETiX-embryoids analyzed at day 8 of development by tiny-sci, according to GO analysis.
(261) TABLE-US-00007 TABLE 7 GENE ONTOLOGY OF ETIX8-EMBRYOIDS Terms enriched in day 8 ETiX-embryoids Fold GO biological process complete Enrichment FDR regulation of cardioblast differentiation (GO: 0051890) 73 6.56E02 protein poly-ADP-ribosylation (GO: 0070212) 64.89 4.84E02 positive regulation of cytokine-mediated signaling pathway (GO: 0001961) 17.7 5.49E02 positive regulation of response to cytokine stimulus (GO: 0060760) 15.96 5.84E02 defense response to virus (GO: 0051607) 6.66 4.59E02 defense response to symbiont (GO: 0140546) 6.63 4.36E02 regulation of response to biotic stimulus (GO: 0002831) 6.4 8.42E03 response to virus (GO: 0009615) 5.94 5.26E02 blood vessel development (GO: 0001568) 4.26 4.30E02 regulation of defense response (GO: 0031347) 3.98 4.37E02 circulatory system development (GO: 0072359) 3.73 1.33E02 regulation of response to external stimulus (GO: 0032101) 3.6 1.47E02 regulation of biological process (GO: 0050789) 1.35 5.39E02
Example 3
Embryoid Development of Fore- and Midbrain Regions
(262) This example reports the examination of neural development in the synthetic embryoids described herein.
(263) In natural development, the anterior side of the epiblast retains its epithelial character, up-regulates the neuroectodermal marker Sox1 from E8.0, and begins the formation of the nervous system. The neuroectodermal lineage gives rise to the forebrain, midbrain, hindbrain and the spinal cord.
(264) To examine neural development in embryoids, the expression of well-established neuroectodermal markers was analyzed by immunofluorescence. SOX1 and SOX2 were expressed in the neuroepithelial cell population, along the entire anteroposterior axis of neurulating embryoids on day 7 in a pattern similar to the natural E8.0 embryo (
(265) Next, the scRNA-seq data for the expression of key markers of neuroectoderm, surface ectoderm that gave rise to most epithelial tissues, notochord that was important for patterning of the neuroectoderm and neural tube, and epiblast that was the precursor to all these tissues were examined. In the ETiX embryoids and natural embryos, similar expression of Foxa2, Chordin and Shh were observed, marking the notochord (
(266) The transcription factor OTX2, which contributes to patterning of the midbrain and forebrain showed restricted expression in the anterior-most third of the headfolds of neurulating day 8 ETiX embryoids (
(267) The tiny-sci dataset was further used to explore the different neural cell types present in neurulating ETiX embryoids. Assignment of these subclusters to specific neural identities was performed using well-established markers (
(268) To test whether the neural tube of neurulating embryoids responded to a developmental challenge in the same way as the neural tube of natural embryos, embryoids were generated from a transgenic ES cell line that does not express PAX6. PAX6 is a transcription factor required for neural tube patterning as well as brain and eye development. Pax6-knockout ETiX embryoids had similar cell-type proportions as control structures (
(269) Defects associated with nervous system are the second most frequent developmental abnormality in humans, including brain defects such as anencephaly and spine defects such as spina bifida. In certain batches of serum, 75-80% of developing ETiX embryos displayed an abnormal twisting or kinking of the neural tube (
(270) Taken together, the results in this example demonstrate that neurulating embryoids undertook morphogenesis of headfold structures in a manner that closely resembles the natural embryo and can serve as relevant disease models.
Example 4
(271) Somitogenesis and Heart Development in Embryoids
(272) This example reports that neurulating embryoids can undergo somitogenesis to the stage that a beating heart develops. A morphology similar to the natural embryos and the expression of markers associated with somites and heart development were observed.
(273) During natural embryogenesis, neuro-mesodermal progenitors (NMPs) contribute to derivatives of the neural tube and the paraxial mesoderm. To determine whether neurulating ETiX embryoids form NMPs, immunofluorescence was performed to detect the expression of the NMP markers SOX2 and Brachyury in a domain spanning the posterior region of the tail bud of neurulating day 8 ETiX embryoids (
(274) The paraxial mesoderm in turn gave rise to somites, which were paired blocks of cells that formed along the anterior-posterior axis of the embryo and were required for segmental formation of skeletal muscle, blood vessels and skin. Pairs of somites expressing the homeobox protein HOXB4 were observed on either side of the SOX1 and SOX2-positive neural tube population in both day 7 ETiX embryoids and natural E8.0 embryos (
(275) A distinct set of cells destined to form the heart also emerged from the primitive streak at gastrulation. In the natural embryo, this developmental event took place around E8.0. Heartbeat was established as the cardiac mesoderm differentiated into cardiomyocytes. The formation of a beating structure below the encephalon region in day 8 neurulating embryoids was observed. This beating region of the neurulating embryoids expressed myosin heavy chain II (MYH2) and the transcription factor GATA4 (
(276) The scRNA-seq data from mesoderm and its derivatives corroborated and extended the findings from immunofluorescence (
(277) Using the tiny-sci dataset, the cardiac tissue was further analyzed to determine whether additional cell populations could be identified. Subclustering of the cardiac lineage (
(278) The results in this example demonstrate that the ETiX embryoids described herein can proceed to neurulation with the formation of the neural tube, initiation of somitogenesis, and the generation of mesodermal structures including a heart-like structure.
Example 5
(279) Initiation of Gut Development in Synthetic Embryoids
(280) This example reports that the synthetic embryoids described herein can develop definitive endoderm producing gut and associated organs.
(281) Having observed extensive development and morphogenesis of ectoderm and mesoderm, the extent, to which neurulating embryoids showed development of definitive endoderm that gives rise to the gut and associated organs, was also determined. Sox17 is required for gut endoderm development. Whole mount immunofluorescence of ETiX day 8 embryoids revealed a Sox17-positive region below the heart, indicative of a primitive gut tube population (
(282) To characterize the gut and associated endodermal tissue further, scRNA-seq datasets were further analyzed. The inDrops scRNA-seq data from natural embryos and ETiX embryoids revealed gene expression signatures corresponding to definitive endoderm (Cer1.sup.+Sox17.sup.+Gata6.sup.+) and VE gut progenitors (Rhox5.sup.+Cldn6.sup.+Apoa1.sup.+) (
(283) The development beyond the establishment of the endodermal progenitors for the gut and its associated organs has not been studied, despite observation showing the establishment of the endodermal progenitors for the gut. It may be necessary to optimize culture conditions to achieve this. It is expected that given appropriate culture conditions, ETiX embryoid development would not proceed further in culture.
Example 6
(284) Development of POCs in Synthetic Embryoids
(285) This example reports that PGCs can emerge in the proximo-posterior region of the epiblast, around the same time as Brachyury expression commences in the E6.5 mouse embryo.
(286) Committed PGCs were characterized by the expression of STELLA, which was detected at the ES cell-TS cell boundary in ETiX embryoids on day 6, similar to the E7.5 natural embryo (
Example 7
(287) Yolk Sac and Blood Island Development in Synthetic Embryoids
(288) This example reports the establishment of yolk sac and blood island around the ETiX embryoids described herein. The development of yolk sac and blood island was also confirmed by the expression of amnion and amniotic mesoderm markers.
(289) ETiX embryoids developed inside membranes that resemble the amnion and yolk sac, which provided nourishment to the embryo until the establishment of the fetal-maternal circulation. Both cultured embryos and ETiX embryoids had to be dissected from their yolk sacs (
(290) During development, the yolk sac originated from cells derived from parietal endoderm and VE, respectively. These populations were both present in the datasets disclosed herein (
(291) Table 8 lists the genes enriched in Early YE cell populations in the extraembryonic endoderm subcluster of ETiX-embryoids, according to GO analysis.
(292) TABLE-US-00008 TABLE 8 Gene Ontology of Extraembryonic endoderm Early Visceral Endoderm Enrichment Cluster Term Score 1 GO: 0005764~lysosome 6.6 2 GO: 0005768~endosome 5.81 3 GO: 0030054~cell junction 4.55 4 GO: 0005905~clathrin-coated pit 4.53 5 GO: 0016020-membrane 3.03 6 GO: 0022857~transmembrane transporter activity 2.89 7 GO: 0003333~amino acid transmembrane transport 2.53 8 GO: 0005783~endoplasmic reticulum 2.5 9 CROSSLNK: Glycyl lysine isopeptide (Lys-Gly) 2.4 (interchain with G-Cter in SUMO2) 10 GO: 0008092~cytoskeletal protein binding 2.38 11 GO: 0033344~cholesterol efflux 2.38 12 GO: 0051603~proteolysis involved in cellular 2.31 protein catabolic process 13 GO: 0042393~histone binding 2.09 14 GO: 0005524~ATP binding 1.74 15 GO: 0050750~low-density lipoprotein particle 1.49 receptor binding 16 IPR005829: Sugar transporter, conserved site 1.48 17 GO: 0070411~I-SMAD binding 1.45 18 IPR000408: Regulator of chromosome condensation, 1.41 RCC1 19 GO: 0006397~mRNA processing 1.35 20 GO: 0007275~multicellular organism development 1.33
(293) Table 9 lists the genes enriched in Differentiated yolk sac cell populations of ETiX-embryoids, according to (30 analysis.
(294) TABLE-US-00009 TABLE 9 Gene Ontology of older cell clusters in Extraembryonic endoderm Differentiated yolk sac Enrichment Category Term Score 1 GO: 0005764~lysosome 16.13 2 GO: 0005783~endoplasmic reticulum 11.79 3 GO: 0006629~lipid metabolic process 9.19 4 GO: 0016020-membrane 6.85 5 CARBOHYD: N-linked (GlcNAc . . . ) asparagine 6.3 6 GO: 0008203~cholesterol metabolic process 5.71 7 KW-0009~Actin-binding 4.18 8 GO: 0030301~cholesterol transport 3.54 9 GO: 0034362~low-density lipoprotein particle 3.43 10 GO: 0042632-cholesterol homeostasis 3.25 11 GO: 0051651~maintenance of location in cell 2.81 12 GO: 0032532~regulation of microvillus length 2.81 13 DOMAIN: PDZ 2.64 14 KW-0117~Actin capping 2.6 15 GO: 0005576~extracellular region 2.58 16 DOMAIN: Calponin-homology (CH) 1 2.5 17 GO: 0006801~superoxide metabolic process 2.45 18 REPEAT: Spectrin 4 2.45 19 GO: 0005975~carbohydrate metabolic process 2.41 20 GO: 0006695~cholesterol biosynthetic process 2.28
(295) The extraembryonic portion of the yolk sac that developed in ETiX embryoids was attached to a structure resembling the chorion and allantois (
(296) Finally, the trophoblast compartment in natural embryos was characterized to determine whether ETiX embryoids could also develop the cell populations required to form the functional placenta. During development, the proximal portion of the ExE differentiates into the ECP, precursor of trophoblast giant cells and spongiotrophoblasts. The portion of the ExE retaining a stem cell character differentiates into chorion and eventually forms the syncytiotrophoblast layers of the labyrinth, whose surface mediates gas and nutrient exchange between fetus and mother. The ExE subclustered UMAP (
(297) The continued presence of trophoblast precursors that split into the ECP and chorionic lineages was observed in ETiX embryoids, similar to that in natural embryos. However, the chorionic lineages in the ETiX embryoids did not perfectly cluster with the chorionic lineages of the natural embryo (
(298) The results in this example demonstrate that the embryonic lineages of ETiX embryoids captured natural development quite closely with deviation observed in the extraembryonic lineages. The deviation might reflect the lack of contact with the maternal environment (natural embryos were recovered when the ECP had already begun developing).
(299) Terminology
(300) In at least some of the previously described embodiments, one or more elements used in an embodiment can interchangeably be used in another embodiment unless such a replacement is not technically feasible. It will be appreciated by those skilled in the art that various other omissions, additions and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to fall within the scope of the subject matter, as defined by the appended claims.
(301) With respect to the use of substantially any plural and/or singular terms herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for sake of clarity. As used in this specification and the appended claims, the singular forms a, an, and the include plural references unless the context clearly dictates otherwise. Any reference to or herein is intended to encompass and/or unless otherwise stated.
(302) It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (e.g., bodies of the appended claims) are generally intended as open terms (e.g., the term including should be interpreted as including but not limited to, the term having should be interpreted as having at least, the term includes should be interpreted as includes but is not limited to, etc.). It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases at least one and one or more to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles a or an limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even when the same claim includes the introductory phrases one or more or at least one and indefinite articles such as a or an (e.g., a and/or an should be interpreted to mean at least one or one or more); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (e.g., the bare recitation of two recitations, without other modifiers, means at least two recitations, or two or more recitations). Furthermore, in those instances where a convention analogous to at least one of A, B, and C, etc. is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., a system having at least one of A, B, and C would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). In those instances where a convention analogous to at least one of A, B, or C, etc. is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., a system having at least one of A, B, or C would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and/or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms.
(303) In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
(304) As will be understood by one skilled in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as up to, at least, greater than, less than, and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.
(305) While various aspects and embodiments have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.