Multiplex PCR method for the detection of SARS-CoV-2
11649511 · 2023-05-16
Assignee
Inventors
- Xiwen JIANG (Guangdong, CN)
- Jian Fan (Guangdong, CN)
- Hailong Peng (Guangdong, CN)
- Rongyu Peng (Guangdong, CN)
Cpc classification
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Q2537/143
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a novel coronavirus duplex detection kit. Specifically, the present invention discloses a kit and method for multiplex detection of novel coronavirus 2019-nCoV nucleic acid, which can simultaneously detect two nucleic acid targets of the novel coronavirus 2019-nCoV and possess extremely high sensitivity and specificity, and significantly improve the accuracy of virus identification.
Claims
1. A kit for multiplex detection of SARS-CoV-2 nucleic acid, which comprises: (1) a first primer pair for the detection of ORF1ab nucleic acid comprising an ORF1ab-F1 primer consisting of SEQ ID NO: 1 and an ORF1ab-R1 primer consisting of SEQ ID NO: 2; (2) a second primer pair for the detection of N nucleic acid comprising a N-F1 primer consisting of SEQ ID NO: 4 and a N-R1 primer consisting of SEQ ID NO: 5; (3) a first probe (ORF1ab-P) for the detection of ORF1ab nucleic acid consisting of SEQ ID NO: 3; and (4) a second probe (N-P) for the detection of N nucleic acid consisting of SEQ ID NO: 6; wherein the first and the second probe each contains a fluorescent reporter group that is different from each other at the 5′ end and a fluorescence quenching group at the 3′ end.
2. The kit of claim 1, wherein the fluorescent reporter group is selected from the group consisting of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5, and the fluorescence quenching group is selected from the group consisting of MGB, BHQ-1, BHQ-2, and BHQ-3.
3. The kit of claim 1, wherein the kit further comprises an internal standard primer pair comprising an internal standard-F1 primer consisting of SEQ ID NO: 7 and an internal standard-R1 primer consisting of SEQ ID NO: 8; and an internal standard-P probe consisting of SEQ ID NO: 9, wherein the first probe, the second probe, and the internal standard-P probe each contains a fluorescent reporter group that is different from each other at the 5′ end and a fluorescence quenching group at the 3′ end.
4. The kit of claim 1, wherein the kit comprises a first container, and the first container contains a primer and probe mix, and the primer and probe mix contains polynucleotides having sequences shown in SEQ ID NOs: 1 to 6.
5. The kit of claim 4, wherein the primer and probe mix further contains polynucleotides having sequences shown in SEQ ID NOs: 7 to 9.
6. The kit of claim 4, wherein the kit further comprises a second container, the second container contains a PCR enzyme system, and the PCR enzyme system includes a hot-start enzyme and a reverse transcriptase C-MMLV.
7. The kit of claim 6, wherein the second container further contains an RNA enzyme inhibitor.
8. The kit of claim 4, wherein the kit further comprises a third container, and the third container contains a positive control.
9. The kit of claim 4, wherein the kit further comprises a fourth container, and the fourth container contains a negative control.
10. The kit of claim 4, wherein the primer and probe mix further contains dNTPs.
11. A multiplex PCR method for the detection of SARS-CoV-2 nucleic acids comprising: 1) extracting a nucleic acid template from a subject test sample; 2) mixing the nucleic acid template with a PCR reaction system comprising the following components: a first primer pair for the detection of ORF1ab nucleic acid comprising an ORF1ab-F1 primer consisting of SEQ ID NO: 1 and an ORF1ab-R1 primer consisting of SEQ ID NO: 2; a second primer pair for the detection of N nucleic acid comprising a N-F1 primer consisting of SEQ ID NO: 4 and a N-R1 primer consisting of SEQ ID NO: 5; an internal standard-F1 primer consisting of SEQ ID NO: 7 and an internal standard-R1 primer consisting of SEQ ID NO: 8; a first probe (ORF1ab-P) for the detection of ORF1ab nucleic acid consisting of SEQ ID NO: 3; a second probe (N-P) for the detection of N nucleic acid consisting of SEQ ID NO: 6; and an internal standard-P probe consisting of SEQ ID NO: 9; wherein the first probe, the second probe, and the internal standard-P probe each contains a fluorescent reporter group that is different from each other at the 5′ end and a fluorescence quenching group at the 3′ end; 3) performing a real-time fluorescent PCR; and 4) detecting an amplified DNA using different fluorescent channel curves.
12. The method of claim 11, wherein the subject test sample is a pharyngeal swab sample, an alveolar lavage fluid sample, a blood sample, a sputum sample, or an environmental sample.
13. The method of claim 11, wherein the fluorescent reporter group is selected from the group consisting of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5, and the fluorescence quenching group is selected from the group consisting of MGB, BHQ-1, BHQ-2, and BHQ-3.
Description
DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
DETAILED DESCRIPTION OF INVENTION
(15) Through extensive and intensive research, the present inventor has obtained a kit and method for multiple detection of the novel coronavirus 2019-nCoV nucleic acid, which can simultaneously detect the two nucleic acid targets of the novel coronavirus 2019-nCoV and mutual verification between different targets can be used to prevent false positives and to confirm missed detections that may be caused by mutations, which significantly improves the accuracy of virus identification.
(16) Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions as described, due to such methods and conditions may vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, and the scope of the present invention will be limited only by the appended claims.
(17) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention belongs. As used herein, when used in reference to specifically recited values, the term “about” means that the value may vary from the recited value by no more than 1%. For example, as used herein, the expression “about 100” includes all values between 99 and 101 and (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
(18) Although any methods and materials similar or equivalent to those described in the present invention can be used in the practice or testing of the present invention, the preferred methods and materials are exemplified herein.
(19) Multiplex PCR
(20) Multiplex PCR, also known as multiple primers PCR or complex PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments. The reaction principle, reaction reagents and operation process are the same as general PCR.
(21) There are many factors that affect multiplex PCR reactions, such as:
(22) (1) The imbalance of the reaction system. The imbalance of the reaction system leads to the rapid amplification of certain dominant primers and their templates in the previous rounds of reactions, and a large number of amplification products are obtained, and these amplification products are also good inhibitors of DNA polymerase. Therefore, as a large number of amplification products appear, the polymerization ability of the polymerase is more and more strongly inhibited. Therefore, the primers and their templates that are at a disadvantage in the early stage are more difficult to react, resulting in a very small amount of amplification product that cannot be detected.
(23) (2) Primer specificity. If the primer has stronger binding ability with other non-target gene fragments in the system, the ability of the target gene to bind to the primer will be contested, resulting in a decrease in amplification efficiency.
(24) (3) The optimal annealing temperature is inconsistent. Multiple pairs of primers are put into a system for amplification. Since the annealing temperature for PCR reaction is the same, the optimal annealing temperature of each pair of primers is required to be close.
(25) (4) Primer dimers, including the dimers between primers and the hairpin structure formed by the primers themselves, and there is also a third-party DNA-mediated polymer. Like non-specific primers, these dimers will interfere with the competition between the primer and the target binding site, affecting the amplification efficiency.
(26) Although several factors affecting the efficiency of amplification are mentioned as above, more factors are unclear. So far, there is no effective method that can clearly predict the amplification efficiency.
(27) According to the diagnosis and treatment guidelines for novel coronavirus, nucleic acid detection of novel coronavirus is the gold standard for diagnosis. The present invention develops a detection kit for simultaneously detecting the ORF1ab gene and N gene of the novel coronavirus. The kit also includes an endogenous internal standard detection system, which is used to monitor specimen collection, nucleic acid extraction process and PCR amplification process, to reduce the occurrence of false negative results. The kit is a dual fluorescence detection kit, which has the characteristics of high sensitivity, strong specificity and good repeatability.
(28) The present invention provides a primer/probe combination for specifically detecting the ORF1ab gene and N gene in a sample and a kit containing the primer combination, wherein the primer sequences for detecting the ORF1ab gene are:
(29) TABLE-US-00001 SEQ ID NO. 1: TCAAAGTAGCCACTGTACAGTC and SEQ ID NO. 2: TTAGCTAAGAGAATGTCAT,
(30) The corresponding detection probe sequence is SEQ ID NO. 3: AGTGCACATCAGTAGTCTTACTCTCAG;
(31) The primer sequences used to detect the N gene are:
(32) TABLE-US-00002 SEQ ID NO. 4: TCTTACAACCAGAACTCA and SEQ ID NO. 5: AGGTAAGAACAAGTCCTGAG,
(33) The corresponding detection probe sequence is: SEQ ID NO. 6 TAATTCTTTCACACGTGGTGTTTATTAC.
(34) The probe labels of the pathogens of the present invention are not limited to the single labels listed at the same wavelength, and include multiple detection reagents in different combinations of different labels.
(35) In one embodiment, the kit further includes internal standard quality control and amplification primers and detection probes; the internal standard quality control amplification primer sequences are:
(36) TABLE-US-00003 SEQ ID NO. 7: AGTATTGGAGCACCGTGCG and SEQ ID NO. 8: GTGGCGGACTCGCCAGTTCT,
(37) The corresponding detection probe sequence is SEQ ID NO. 9: ATCGTACCTAGGACTCTAGCGCG.
(38) The internal standard can monitor the sample collection and the sample extraction process to prevent false negatives due to the failure of sample nucleic acid extraction.
(39) In a preferred embodiment of the present invention, the nucleic acid sequence of the internal standard fragment is as follows:
(40) TABLE-US-00004 (SEQ ID NO: 14) AGTATTGGAGCACCGTGCGGTCAACGTAAGGGAGCAGAGGCGGCAG TCAAATAACTTCCTCAAGGAACAACACGTACCTAGGACTCTAGCGCGGA CTAGAACTGGCGAGTCCGCCAC.
(41) In one embodiment, the kit includes a positive control containing the ORF1ab gene fragment and/or N gene fragment, and a negative control (sterilized physiological saline).
(42) In a preferred embodiment of the present invention, the nucleic acid sequence of the ORF1ab gene fragment in the positive control is as follows:
(43) TABLE-US-00005 (SEQ ID NO.: 15) TCAAAGTAGCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACA TCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCAT CTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGC TAA.
(44) In a preferred embodiment of the present invention, the nucleic acid sequence of the N gene fragment in the positive control is as follows:
(45) TABLE-US-00006 (SEQ ID NO.: 16) TCTTACAACCAGAACTCAATTACCCCGGACTCGCCAGTCTGCATACA CTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTCTAGGAC TCTATTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACC T.
(46) In one embodiment, the kit includes PCR reaction solution containing primers and probes targeting ORF1ab gene and N gene and internal standard gene, dNTPs (dATP:dCTP:dGTP:dTTP=1:1:1:1) and PCR buffer, and PCR enzyme system containing hot start Hot.Taq enzyme and C-MMLV enzyme, in which the concentration of primers and probes is 0.1-1 μM, the concentration of dNTPs is 0.2-0.4 mM, the concentration of MgCl.sub.2 is 2-5 mM, C-MMLV enzyme is 1-3U and the hot start Hot.taq is 2.5-10U.
(47) The invention also provides a method for using the ORF1ab gene and N gene double detection kit, which includes the following steps: extracting a sample to be tested (extraction reagent adopts nucleic acid extraction or purification reagent produced by Daan Gene Co., Ltd. of Sun Yat-sen University (Yuehuixiebei No. 20170583) to obtain nucleic acid samples (positive quality control and negative control participate in the extraction at the same time); taking 5 μL into the above PCR reaction solution (17 μL) and enzyme (3 μL) mixture, and the amplification reaction in a real-time fluorescent PCR instrument is performed, selecting the fluorescence channel in order of VIC, FAM, and Cy5. The PCR amplification procedure is as follows;
(48) 50° C., 15 min, 95° C., 15 min; 1 cycle
(49) 94° C., 15 sec, 55° C., 45 sec (collecting fluorescence); 45 cycles.
(50) After PCR is completed, different fluorescent channel curves and Ct values are used to determine the negative or positive of the corresponding pathogen DNA. The test results can be used for the auxiliary diagnosis of novel coronavirus infection and the observation of drug efficacy, providing a reliable basis for the research.
(51) For the gene sequence of the novel coronavirus 2019-nCoV in the present invention, please refer to GISAID: BetaCov/Wuhan/WH01/2019|EPI_ISL_406798; for the oligonucleotide sequence information of its N, ORF1ab and E genes, please refer to the literature (Roujian Lu, Xiang Zhao, Juan Li, et. al, Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020 Jan. 30).
(52) The composition of this kit is detailed in Table 1 and Table 2. It can detect two target genes of the novel coronavirus 2019-nCoV at the same time, and can verify each other through different targets to prevent false positives and to confirm the missed detection that may be caused by mutation, which can significantly improve the accuracy of virus identification
(53) TABLE-US-00007 TABLE 1 Kit composition Composition Main component PCR reaction solution Specific primers and fluorescent probes (SEQ ID NO.: 1-9), dNTPs, PCR buffer PCR enzyme system Hot start Hot.Taq enzyme, reverse transcriptase C-MMLV Positive quality control Pseudovirus containing ORF1ab gene fragment, Pseudovirus containing N gene fragment, Pseudovirus containing internal standard fragment Negative quality control Pseudovirus containing internal standard fragments
(54) The primer and probe sequences required by the kit are shown in Table 2:
(55) TABLE-US-00008 TABLE 2 Primers, probes and serial numbers Primer/probe name Primer/probe sequence SEQ ID NO. ORF1ab-F1 TCAAAGTAGCCACTGTACAGTC 1 ORF1ab-R1 TTAGCTAAGAGAATGTCAT 2 ORF1ab-P 5′VIC-AGTGCACATCAGTAGTCTTACTCTCAG BHO1-3′ 3 N-F1 TCTTACAACCAGAACTCA 4 N-R1 AGGTAAGAACAAGTCCTGAG 5 N-P 5′FAM-TAATTCTTTCACACGTGGTGTTTATTAC BHQ1-3′ 6 Internal standard-F1 AGTATTGGAGCACCGTGCG 7 Internal standard-R1 GTGGCGGACTCGCCAGTTCT 8 Internal standard-P 5′Cy5-ATCGTACCTAGGACTCTAGCGCG-BHQ2-3′ 9
(56) Preferably, the fluorescent group is selected from the group consisting of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, CY5.
(57) Preferably, the quenching group is selected from the group consisting of MGB, BHQ-1, BHQ-2, BHQ-3.
(58) In the primer design of the present invention, specific primers and probes are screened through a large number of tests, and combined, optimized, and verified. The optimal combination of primers and probes for multiple detection that does not interfere with each other, has high amplification efficiency and good specificity is finally selected.
(59) The criteria used by the kit of the present invention to determine the effectiveness of the detection are:
(60) Negative quality control and positive quality control are simultaneously detected in each test. When the test result of the positive quality controls positive and the test result of the negative quality control is negative, the test result is valid.
(61) The method for using the kit of the present invention includes the following steps:
(62) (1) Extracting the total nucleic acid in the test sample to obtain a nucleic acid sample.
(63) (2) Mixing the nucleic acid sample with the PCR reaction solution and PCR enzyme system to prepare a PCR reaction system.
(64) (3) Performing Real-time fluorescence PCR reaction, and the procedure is as follows:
(65) the first stage: 50° C. 2-15 min, 95° C. 10-15 min, 1 cycle;
(66) the second stage: 94° C. 10-15 s, 55-60° C. 45 s, 45 cycles.
(67) After the PCR is completed, the negative and positive of the corresponding pathogen nucleic acid are judged by different fluorescence channel curves and Ct values, to obtain the test result.
(68) The Beneficial Effects of the Present Invention Include:
(69) Most of the current detection reagents are single-target detection reagents. The two targets of the novel coronavirus 2019-nCoV are tested at the same time, so they can be mutually verified between different targets to prevent false positives and significantly improve the accuracy and specificity of virus identification. At the same time, the system contains an endogenous internal standard quality control system, which can monitor the entire process of sampling, sample storage, nucleic acid extraction and PCR amplification to prevent the occurrence of false negatives.
(70) The present invention is suitable for the detection of the novel coronavirus 2019-nCoV nucleic acid, and can provide a reliable basis for virus identification and prevention and control, and is worthy of popularization and application. In addition, the method of the present invention is also suitable for non-diagnostic purposes. For example, in the epidemic prevention and control process, the detection method of the present invention can be used to detect viral nucleic acids in the environment, and these viral nucleic acid information can be used for public health management.
(71) The present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without detailed conditions in the following examples are generally in accordance with the conditions described in the conventional conditions such as Sambrook. J et al. “Guide to Molecular Cloning Laboratory” (translation by Huang Peitang et al., Beijing: Science Press, 2002), Or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. Unless otherwise specified, the experimental materials and reagents used in the following examples can be obtained from commercially available channels.
Example 1. Detection Limit Test of ORF1ab Gene and N Gene Duplex Detection Kit
(72) The quantified pseudovirus containing ORF1ab gene and N gene were used as the initial samples and were diluted to a concentration of 10.sup.5 copies/ml, and then sequentially diluted to 10.sup.4, 10.sup.3, 500, 250, 100 copies/ml, and the plasmid bacteria containing the internal standard amplified fragments were added into each samples to a final concentration of 10.sup.4 copies/ml as the samples to be tested to test the sensitivity of the dual detection reagent.
(73) Refer to
(74)
(75)
(76)
(77) The test results showed that the lowest concentration that can be detected for the positive control of ORF1ab gene and N gene at different concentrations was 250 copies/ml.
Example 2. Specificity Test of ORF1ab Gene and N Gene Duplex Detection Kit
(78) Using saline, SARS virus, rhinovirus, adenovirus, influenza A virus, influenza B virus, parainfluenza virus, coronavirus OC43, respiratory syncytial virus, human coronavirus NL63, human coronavirus HKU1 as specificity references, the specificity of the ORF1ab gene and N gene duplex detection kits was tested.
(79) Refer to
(80)
(81)
(82) The test results showed that the test results of specificity references (physiological saline, SARS virus, rhinovirus, adenovirus, influenza A virus, influenza B virus, parainfluenza virus, coronavirus OC43, respiratory syncytial virus, human coronavirus NL63, Human coronavirus HKU1) are all negative, and the test results of internal standard quality control are all positive.
Example 3. Precision Test of ORF1ab Gene and N Gene Duplex Detection Kit
(83) Pseudovirus containing ORF1ab gene and N gene was diluted into 10.sup.5 and 10.sup.3 copies/ml as precision references. Test was repeated 10 times to calculate the variable coefficient of each concentration of precision reference.
(84) Refer to
(85)
(86)
(87) After testing, the variable coefficient of the precision reference with high concentration and low concentration of ORF1ab gene pseudovirus were 0.55% and 0.65%, respectively. the variable coefficient of the precision reference with high concentration and low concentration of N gene were 0.44% and 0.96%, respectively. The variable coefficients of the precision reference with different concentrations of the two gene were less than 5%.
Example 4. Accuracy Test of ORF1ab Gene and N Gene Duplex Detection Kit
(88) Five different concentrations of ORF1ab gene and N gene pseudovirus were respectively prepared as positive references. After extraction, the ORF1ab gene and N gene duplex detection kits were used to test and verify the accuracy of the kits.
(89) Refer to
(90)
(91)
(92) The results showed that the positive references of each pathogen were positive and did not cross-react with other pathogens.
Example 5. Interfering Substance Test of ORF1ab Gene and N Gene Duplex Detection Kit
(93) Whole blood (5%), mucus (5%), spectinomycin (100 mg/L), penicillin (0.5 mg/ml), tetracycline (5 mg/L), ofloxacin (3.06 mg/L), and azithromycin (0.45 mg/L) were separately added into 10.sup.3 copies/ml of ORF1ab gene and N gene pseudovirus as interfering substance in the test, and samples without interfering substances were used as controls to test the effect of interfering substances on the amplification of primer and probes.
(94) Refer to
(95)
(96)
(97) Whole blood (5%), mucus (5%), spectinomycin (100 mg/L), penicillin (0.5 mg/ml), tetracycline (5 mg/L), ofloxacin (3.06 mg/L), azithromycin (0.45 mg/L) were added to the sample to be tested. The results showed that there were no obvious interference to the test results, and the interpretation of the results were not affected.
Example 6. Clinical Sample Testing
(98) Extraction of Test Sample Nucleic Acids:
(99) (1) Extraction of Nucleic Acid Template of Clinical Samples
(100) 22 clinical samples of suspected pharyngeal swabs were collected, and the samples to be tested were extracted (the extraction reagent adopts the nucleic acid extraction or purification reagent produced by Daan Gene Co., Ltd. of Sun Yat-sen University (Yuehuixiebei No. 20170583) to obtain nucleic acid samples (the positive quality control and the negative control were involved in the extraction simultaneously). 5 μL of nucleic acid samples was added to the above PCR reaction solution (17 μL) and the enzyme (3 μL) mixture, and the amplification reaction was performed in the real-time fluorescent PCR instrument, and the fluorescent channels were selected in order of VIC, FAM, and Cy5. The PCR amplification procedure was as follows:
(101) 50° C., 15 min, 95° C., 15 min; 1 cycle
(102) 94° C., 15 sec, 55° C., 45 sec (collection of fluorescence); 45 cycles.
(103) After the PCR was completed, the negative and positive of the corresponding pathogen DNA were determined by different fluorescence channel curves and Ct values.
(104) In the tested 22 suspected clinical samples, a total of 17 novel coronavirus 2019-nCoV nucleic acid positive clinical samples were detected. Typical test results were shown in
(105) Sequencing verification results showed that the detection accuracy of the detection system of the present invention reached 100%, which further proved the accuracy of clinical detection of the system of the present invention.
Comparative Example 1
(106) In the research process, the present inventor screened dozens of PCR primers and probes for the novel coronavirus 2019-nCoV target nucleic acid sequence. After extensive testing, a combination of primers and probes with sensitivity and specificity that can meet the needs of clinical testing and can perform multiple tests were finally obtained.
(107) For the detection target of the N, ORF1ab gene of the novel coronavirus 2019-nCoV, the present inventor had undergone a lot of screening and combination. For example, for the ORF1ab gene, some typical primer sequences designed were as follows:
(108) TABLE-US-00009 ORF1ab gene control upstream primer ORF1ab-F2: (SEQ ID NO. 10) CTAAAATGTCAGATGTAAAG ORF1ab gene control downstream primer ORF1ab-R2: (SEQ ID NO. 11) TGTAACTGGACACATTGAGC ORF1ab gene control upstream primer ORF1ab-F3: (SEQ ID NO. 12) TTGTATCAAAGTAGCCAC ORF1ab gene control downstream primer ORF1ab-R3: (SEQ ID NO. 13) ATTGAGCCCACAATTTAG
(109) The specific detection steps, detection conditions, and probe sequences were same as the above embodiments, and PCR detection tests are performed.
(110) The detection results using ORF1ab-F2 and ORF1ab-R2 were shown in
(111) All literatures mentioned in the present application are incorporated herein by reference, as though each one is individually incorporated by reference. In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications, equivalents of which falls in the scope of claims as defined in the appended claims.