TREATMENT OF COVID-19 WITH REVERSE MICELLE SYSTEM COMPRISING UNMODIFIED OLIGONUCLEOTIDES
20230144739 · 2023-05-11
Inventors
- Jean-Claude MAUREL (Baillargues, FR)
- Abdelkader MOURI (Montpellier, FR)
- Hervé SEITZ (Grabels, FR)
- Sophie MOCKLY (Saint Amand Montrond, FR)
Cpc classification
C12N2320/32
CHEMISTRY; METALLURGY
A61K47/10
HUMAN NECESSITIES
A61K47/28
HUMAN NECESSITIES
A61K9/006
HUMAN NECESSITIES
A61K9/1075
HUMAN NECESSITIES
A61K47/24
HUMAN NECESSITIES
C12N2320/51
CHEMISTRY; METALLURGY
International classification
A61K47/10
HUMAN NECESSITIES
A61K47/24
HUMAN NECESSITIES
A61K47/26
HUMAN NECESSITIES
A61K47/28
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to specific reverse micelle system of the invention which allows the administration and intracellular delivery of unmodified oligonucleotide, such as siRNA, targeting one or more genes of the SARS-CoV-2 virus. The reverse micelle system of the invention is thus particularly useful for the treatment of the viral pathology linked to the SARS-CoV-2 virus.
Claims
1. A reverse micelle system comprising at least one sterol, acylglycerol, phospholipid, an alcohol, water and at least one unmodified oligonucleotide targeting one or more genes of SARS-CoV-2 virus.
2. The reverse micelle system according to claim 1, wherein the micelles present aqueous cores of around 4 nm.
3. The reverse micelle system according to claim 1, wherein acylglycerol presents the following formula (I): ##STR00002## wherein R.sub.1 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 14 and 24 carbon atoms, a hydrogen atom, or a mono-, di- or tri-galactose or glucose; R.sub.2 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 2 and 18 carbon atoms; and R.sub.3 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 14 and 24 carbon atoms, or a hydrogen atom.
4. The reverse micelle system according to claim 1, wherein the at least one sterol is sitosterol, and/or phospholipid is lecithin, and/or alcohol is ethanol, and/or acylglycerol is glycerol monooleate.
5. The reverse micelle system according to claim 1, wherein the unmodified oligonucleotides are selected in the group consisting of antisense oligonucleotides, short interfering nucleic acid (siNA), short interfering RNA (siRNA), short interfering nucleic acid molecule, short interfering oligonucleotide molecule, miRNA, micro RNA, guide RNA (gRNA), short guide RNA (sgRNA) of a CRISPR system, short hairpin RNA (shRNA) and mixtures thereof.
6. The reverse micelle system according to claim 1, wherein the unmodified oligonucleotides are at least 10, 15, 20 or 25 nucleotides (nt) long.
7. The reverse micelle system according to claim 1, wherein the unmodified oligonucleotides are synthetic RNA duplexes comprising or consisting of two unmodified 21-mer oligonucleotides annealed together to form siRNAs.
8. The reverse micelle system according to claim 8, wherein the siRNA presents a guide strand which comprises, or consists of, one of the following sequences: TABLE-US-00007 SEQ ID NO: 1: 5′ P-UGAUAGUAGUCAUAAUCGCUA 3′; SEQ ID NO: 3: 5′ P-UGACUUAAAGUUCUUUAUGCG 3′; SEQ ID NO: 5: 5′ P-UUAGCUAAAGACACGAACCGG 3′. SEQ ID NO: 8: 5′ P-UGACUUAAAGUUCUUUAUGCUC 3′; SEQ ID NO: 10: 5′ P-UAUAGCUAAAGACACGAACCC 3′; SEQ ID NO: 11: 5′ P-AUAGCUAAAGACACGAACCGG 3′; SEQ ID NO: 12: 5′ P-UUGAGUGCAUCAUUAUCCAAG 3′; SEQ ID NO: 13: 5′ P-CUUGACUGCCGCCUCUGCUCG 3′; SEQ ID NO: 14: 5′ P-GUUGAGUGCAUCAUUAUCCAC 3′; or SEQ ID NO: 15: 5′ P-UCCUGAUUAUGUACAACACCG 3′.[[;]]
9. The reverse micelle system according to claim 8, wherein the siRNA presents a guide strand comprising, or consisting of, SEO ID NO: 1.
10. A method for the preparation of the reverse micelle system according to claim 1, comprising the following steps of: (a) contacting (i) sterol, (ii) acylglycerol, preferably diacylglycerol of fatty acids, (iii) phospholipid, preferably phosphatidylcholine, (iv) alcohol, (v) water, preferably purified water, and (vi) at least one unmodified oligonucleotide capable of targeting one or more genes of SARS-CoV-2 virus to form a mixture, and (b) stirring the mixture obtained in step (a), at 40° C. or less, and for a time sufficient to obtain formation of reverse micelles, said stirring being carried out mechanically or by sonication.
11. A pharmaceutical composition comprising a reverse micelle system according to claim 1, and at least a pharmaceutically acceptable carrier, excipient or support.
12. A method for the treatment of COVID-19 comprising administering a therapeutically effective amount of the composition according to claim 11 to a subject in need thereof.
13. A method for the treatment of COVID-19 associated pneumonia or multi-organ failure comprising administering a therapeutically effective amount of the composition according to claim 11 to a subject in need thereof.
14. The method according to claim 12, wherein the composition is administered by oral route or rectal route, with a buccal mucosa or rectal mucosa absorption, respectively.
15. A siRNA presenting a guide strand which comprises, or consists of, one of the following sequences: TABLE-US-00008 SEQ ID NO: 1: guide strand: 5′ P-UGAUAGUAGUCAUAAUCGCUA 3′; SEQ ID NO: 3: guide strand: 5′ P-UGACUUAAAGUUCUUUAUGCG 3′; SEQ ID NO: 5: guide strand: 5′ P-UUAGCUAAAGACACGAACCGG 3′;[[.]] SEQ ID NO: 8: guide strand: 5′ P-UGACUUAAAGUUCUUUAUGCUC 3′; SEQ ID NO: 10: guide strand: 5′ P-UAUAGCUAAAGACACGAACCC 3′; SEQ ID NO: 11: guide strand: 5′ P-AUAGCUAAAGACACGAACCGG 3′; SEQ ID NO: 12: guide strand: 5′ P-UUGAGUGCAUCAUUAUCCAAG 3′; SEQ ID NO: 13: guide strand: 5′ P-CUUGACUGCCGCCUCUGCUCG 3′; SEQ ID NO: 14: guide strand: 5′ P-GUUGAGUGCAUCAUUAUCCAC 3′; or SEQ ID NO: 15: guide strand: 5′ P-UCCUGAUUAUGUACAACACCG 3′.[[;]]
16. A siRNA duplex, with guide strand and passenger strand, which comprises, or consists of, one of the following duplex sequences: TABLE-US-00009 siRNA no 1 SEQ ID NO: 1: guide strand: 5′ P-UGAUAGUAGUCAUAAUCGCUA 3′; SEQ ID NO: 2: passenger strand: 5′ GCGAUUAUGACUACUAUUUUA 3′;[[.]] siRNA no 2 SEQ ID NO: 3: guide strand: 5′ P-UGACUUAAAGUUCUUUAUGCC 3′; SEQ ID NO: 4: passenger strand: 5′ CAUAAAGAACUUUAAGUCCUC 3′;[[.]] siRNA no 3 SEQ ID NO: 5: guide strand: 5′ P-UUAGCUAAAGACACGAACCGG 3′; SEQ ID NO: 6: passenger strand: 5′ GGUUCGUGUCUUUAGCUACUC 3′;[[.]] or siRNA no 4 SEQ ID NO: 8: guide strand: 5′ P-UGACUUAAAGUUCUUUAUGCUC 3′; SEQ ID NO: 9: passenger strand: 5′ GCAUAAAGAACUUUAAGUUUCU 3′.
17. A pharmaceutical composition comprising at least one the siRNAs according to claim 15, and a pharmaceutically acceptable carrier or excipient.
18. The reverse micelle system according to claim 1, wherein the micelles present aqueous cores is from 3 to 5 nm.
19. The reverse micelle system according to claim 6, wherein the unmodified oligonucleotides are in the range of 19 to 25 nucleotides long.
20. A pharmaceutical composition comprising at least one the siRNAs according to claim 16, and a pharmaceutically acceptable carrier or excipient.
Description
DETAILED DESCRIPTION OF THE INVENTION
[0023] The following description is of preferred embodiments by way of examples only and without limitation to the combination of features necessary for implementing the invention.
[0024] Reverse Micelles
[0025] The reverse micelle system according to the invention is characterized as a micro-emulsion comprising a dispersion of water-nanodroplets in oil. The dispersion is stabilised by two surfactants (acylglycerol, more preferably a diacylglycerol of fatty acids and a phospholipid, more preferably phosphatidylcholine) and a co-surfactant (alcohol) that are most likely at the water/oil interface. The reverse micelle phase can be defined as a system wherein water forms the internal phase and the hydrophobic tails of the lipids form the continuous phase. Reverse micelles containing oil(s), surfactant(s), co-surfactant(s), and an aqueous phase are also characterized as water-in-oil micro-emulsions.
[0026] Generally, the size of micelles according to the invention is very small, more particularly, it is less than 10 nm; more specifically it is less than 8 nm and more preferably less than 5 nm. The size may vary with the quantity of added water and phospholipid. The present invention relates more particularly to reverse micelles with an aqueous core of 3 to 5 nm, preferably from 3.5 to 5 nm, in particular from 3.7 to 4.5 nm.
[0027] The reverse micelles and the size of their aqueous core can be characterized by various methods, including: [0028] Small Angle X-Ray Scattering (SAXS) [0029] Neutrons Scattering [0030] Transmission Electron Microscopy (TEM) [0031] Dynamic Light Scattering (DLS)
[0032] The ratios of the lipidic constituents (including sterol, acylglycerol and phospholipid) in the reverse-micelle system according to the invention can vary. For instance, the weight ratio sterol/acylglycerol can range from 0.015 to 0.05, more particularly from 0.03 to 0.04. The weight ratio phospholipid/acylglycerol is from 0.06 to 0.25. For the calculation of these ratios, the weight of phospholipid corresponds to the total weight of the mixture of phospholipids, for instance the weight of lecithin, used in the formulation.
[0033] The compounds of the reverse-micelle system can be analysed by appropriate means. More specifically, sterols can be identified by gas chromatographic analysis and acylglycerol by high-performance liquid chromatography (HPLC), in particular with a light scattering detector, on a silica column (kromasil C18), in the presence of an eluent, e.g. isocratic acetonitrile. Gas chromatography can also be used to analyse diacylglycerols. Phospholipids can be analysed by high-performance liquid chromatography (HPLC), with a diol column with a light scattering detector.
[0034] Reverse micelles are dynamic systems. Brownian motion causes perpetual collisions of micelles, which lead to coalescence of micelles and exchange of the aqueous cores. Separation and regeneration of micelles occur and allow chemical reactions between different solutions. The exchange rate between micelles increases in particular with temperature, the length of hydrocarbon chains of the surfactant, and the water/surfactant ratio. Within the context of the invention and contrary to what is expected in nanotechnology, aqueous cores of micelles must have a specific size allowing one or more molecules of unmodified oligonucleotide, in particular nucleic acid capable of mediating RNA interference, to be stabilised in the prepared micelles. As mentioned above, the size of the aqueous core is around 4 nm, preferably from 3 to 5 nm, more preferably from 3.5 to 5 nm, in particular from 3.7 to 4.5 nm.
[0035] Without being bound to any theory, it seems that inclusion of a phospholipid in the reverse micelle system allows formation of micelles with greater diameter and volume, thus allowing vectorization of greater quantities of oligonucleotide.
[0036] In addition, it seems that, when applied to mucosa tissue, the reverse micelle system triggers formation of lipoproteins which after a lymphatic transport then in the blood circulation cross the cellular membrane and allow delivery of the oligonucleotide, in particular the nucleic acid capable of modulating gene expression of SARS-CoV-2 virus into the cells.
[0037] After the deposition of the micro emulsion on the buccal mucosa (or rectal mucosa) in the subject, the Brownian dynamics of the reverse micelles promotes intramucosal penetration into the intercellular spaces, and in contact with the apoproteins present physiologically in the mucosa, there takes place a structure in lipoproteins vHDL and HDL.
[0038] Oligonucleotides must be soluble in water, so as not to interfere with the water/oil interface of the reverse micelles according to the invention.
[0039] An amphiphilic molecule modifies the water solubility in the nano micelles, interferes with the interface and removes the fluidity of the permanent Brownian-like motions of the micelles which is necessary for their passage in the mucosa and their absorption through the structuration in lipoproteins.
[0040] The oligonucleotides described in the present invention are necessarily unmodified in order to be water-soluble.
[0041] Accordingly, the invention ensures absorption of the compounds to be delivered across mucosa, preferably across mouth, nasal and/or rectal mucosa, more preferably across mouth mucosa. Also, reverse micelles of the present invention provide an important bioavailability with low variability of absorption.
[0042] Method for Preparing Reverse Micelles
[0043] In a particular embodiment, the invention relates to a method for preparing reverse micelles as defined above (involving more specifically at least one unmodified oligonucleotide targeting one or more genes of SARS-CoV-2 virus, a sterol, an acylglycerol, a phospholipid, an alcohol, and water), wherein said method comprises the following steps: [0044] (a) Contacting (i) sterol, (ii) acylglycerol, preferably diacylglycerol of fatty acids, (iii) phospholipid, preferably phosphatidylcholine, (iv) alcohol, (v) water, preferably purified water, and (vi) at least one unmodified oligonucleotide capable of targeting one or more genes of SARS-CoV-2 virus, [0045] (b) Stirring mixture obtained in step (a), at 40° C. or less, and for a time sufficient to obtain formation of reverse micelles, said stirring being carried out mechanically or by sonication.
[0046] The obtained and recovered reverse micelles are then particularly useful as a delivery system for unmodified oligonucleotides. Step (b) of the process is of particular importance since it allows reverse micelles to be obtained, said reverse micelles being then useful as a transport system to deliver unmodified oligonucleotides directly into the cytoplasm of all cells in all tissues and organs, through the cell membrane lipoprotein receptors.
[0047] In a particular embodiment, the unmodified oligonucleotide is first solubilised in water (preferably purified water) to form an aqueous phase. Said aqueous phase is then introduced into the oily phase (according to step(a)). The oily phase preferably comprises at least a sterol, an acylglycerol, a phospholipid and an alcohol.
[0048] The compounds involved in step (a) will be described in more details below.
[0049] Stirring of the mixture obtained by step (a) is carried out at a temperature less than or equal to 40° C., preferably ranging from 30° C. to 38° C., more preferably from 30° C. to 35° C., for a time sufficient to form of reverse micelles. The time sufficient can vary in particular upon the used stirring techniques, i.e., mechanical stirring or sonication. The time of mechanical stirring or sonication is more specifically the time needed to convert the initial mixture into a visually transparent reverse micelle solution.
[0050] One skilled in the art knows how to select excipients or components that may be used along with the composition according to the present invention in order to keep their beneficial properties. In particular, the presence of glycerol can, when introduced in large amount, prevent the formation of reverse micelles or break the reverse micelle system. More specifically, no more than 2.5%, and preferably no glycerol (percent expressed by weight of glycerol/weight of acylglycerol) is used for the preparation of the reverse micelles of the present invention.
[0051] Other compounds can be introduced in step (a). One can cite for instance colouring agents and/or flavouring substances.
[0052] In an advantageous manner, the compounds cited above or the commercially available mixtures containing them are the only ingredients introduced to prepare the micelle system and consequently the only ones present in the micelle system of the invention.
[0053] Physical parameters, in particular time—for instance comprised between 3 and 5 minutes, in one or several times-, are dependent on the used material, volumes of the mixture and viscosity thereof. One skilled in the art can readily define such parameters. Temperature of the mixture is less than 40° C. Such a temperature avoids degradation of the reactants. Temperature is preferably ranging from 30° C. to 38° C., more preferably from 30° C. to 35° C.
[0054] The usual materials use propellers whose fast movements generate turbulences and swirls allowing interpenetration of particles and formation of reverse micelles within the mixture.
[0055] Stirring speed is preferably ranging from 200 to 2 000 r/minute, more preferably from 300 to 700 r/minute. The implemented volumes, device, and stirring speed depend on and should be adapted with the reactants and amounts thereof.
[0056] As described above, temperature of the mixture must not exceed 40° C. Temperature is preferably ranging from 30° C. to 38° C., more preferably from 30° C. to 35° C.
[0057] Reverse Micelles Compounds
[0058] Acylglycerol
[0059] Acylglycerols, more particularly acylglycerols of fatty acids, useful for the preparation of the reverse-micelle system according to the invention can be isolated from the majority of animals and more preferably plants.
[0060] Acylglycerols can be mono- and/or diacylglycerols. In a particular embodiment, mono- or diacylglycerols preferentially used in the present invention present the following formula (I):
##STR00001##
in which: [0061] R.sub.1 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 14 and 24 carbon atoms, a hydrogen atom, or a mono-, di- or tri-galactose or glucose; [0062] R.sub.2 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 2 and 18 carbon atoms; [0063] R.sub.3 is an acyl residue of a linear or branched, saturated or unsaturated fatty acid having between 14 and 24 carbon atoms, or a hydrogen atom.
[0064] According to a particular embodiment, R.sub.1 or R.sub.3, preferably only one of R.sub.1 and R.sub.3, in particular only R.sub.1, represents an acyl residue of oleic acid (C18: 1[cis]-9), including in particular glycerol monooleate.
[0065] According to a particular aspect, R.sub.2 has one unsaturated bond (e.g; ethylenic bond) and has advantageously 18 carbon atoms, preferably R.sub.2 is an oleic acid residue (oleoyl group), one of its positional isomers with respect to the double bond (cis-6,7,9,11 and 13) or one of its iso-branched isomers.
[0066] According to another particular aspect, R.sub.1 represents an oleoyl group.
[0067] According to another particular aspect, R.sub.2 represents an acetyl group.
[0068] According to another particular aspect, R.sub.3 is a hydrogen atom.
[0069] As a general rule, oil containing a high concentration of oleic acid will be chosen as a useful source of acylglycerols according to the invention. Such oil usually contains a high proportion of acylglycerols useful according to the invention.
[0070] According to a particular aspect of the invention, the preferred diglycerols of fatty acids are selected in the group consisting of 1,2-diolein and 1-oleoyl-2-acetyl glycerol.
[0071] A certain number of them, and more particularly those which are found to be the most active in the applications sought after, are also available commercially. This is the case particularly for 1-oleoyl-2-acetylglycerol and 1,2-dioleoylglycerol, which exist as commercial products with a high purity content. In particular, glycerol monooleate containing about 44% of dioleic glycerol, from which about 14% is 1,2-diolein. Such a compound is pharmaceutically accepted (European Pharmacopeia (4.sup.th Edition), USP 25/NF20, and Japanese Standard of food Additives). Such product is for instance commercially available by Gattefossé Company under the name PECEOL®.
[0072] The acylglycerols are preferably incorporated or comprised in the composition or reverse-micelle system in an amount by weight ranging from 55 g to 90 g with respect to 100 g of the total weight of the composition or reverse-micelle system according to the invention.
[0073] Sterols
[0074] The sterols useful for the preparation of the reverse-micelle system according to the invention are preferably natural sterols, such as cholesterol or phytosterols (vegetable sterols). Sitosterol or cholesterol are the preferred sterols useful for the reverse-micelle system according to the invention.
[0075] Sitosterol and cholesterol are commercially available. More particularly, commercial sitosterol which is extracted from soya can be used. In such a product, the sitosterol generally represents from 50 to 70% by weight of the product and is generally found in a mixture with campesterol and sitostanol in respective proportions in the order of 15% each. Commercial sitosterol which is extracted from a variety of pine called tall oil can also be used. In general, it will be possible to use sitosterol in mixture with sitostanol. Preferably, said mixture comprises at least 50% sitosterol by weight of the mixture.
[0076] As mentioned above, the ratios of the lipidic constituents (sterols, acylglycerol and phospholipids) in the reverse-micelle system according to the invention can vary in a wide range, for instance the weight ratio sterols/acylglycerol can range from 0.015 to 0.05, more particularly from 0.03 to 0.04.
[0077] Phospholipids
[0078] Phospholipids are formed of a glycerol linked to 2 fatty acids and to a phosphate group. The variability of phospholipids relies on the fatty acids that are attached to the glycerol and on the chemical groups that are susceptible to link to the phosphate group. Phospholipids are the major lipidic constituents of biological membranes.
[0079] Among phospholipids useful in the present invention may be cited phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylinositol, and phosphatidylcholine.
[0080] In a particular embodiment, the phospholipid is phosphatidylcholine. Phosphatidylcholine is also known as 1,2-diacyl-glycero-3-phosphocholine or PtdCho.
[0081] Phosphatidylcholine is formed from a choline, a phosphate group, a glycerol and two fatty acids. It is actually a group of molecules, wherein the fatty acid compositions vary from one molecule to another. Phosphatidylcholine may be obtained from commercial lecithin that contains phosphatidylcholine in concentrations of 20 to 98%. The lecithin preferably used for the preparation of the reverse micelles according to the invention is Epikuron 200® and contains phosphatidylcholine at a concentration of more than 90%.
[0082] The weight ratio phospholipid/acylglycerol in compositions or reverse-micelle systems according to the invention is from 0.06 to 0.30.
[0083] Alcohols
[0084] The alcohols useful for the preparation of the reverse-micelle system according to the invention are preferably linear or branched mono-alcohols from C2 to C6. Examples of alcohols are ethanol, 1-butanol, 2-butanol, 3-methyl-1-butanol, 2-methyl-1-propanol, 1-pentanol, 1-propanol, 2-propanol and any mixture thereof. In a particular embodiment of the invention, alcohol is ethanol.
[0085] The alcohol is preferably incorporated or comprised in the composition or reverse-micelle system in an amount by weight ranging from 5 g to 17 g with respect to 100 g of the total weight of the composition or reverse-micelle system according to the invention.
[0086] Oligonucleotides
[0087] The unmodified oligonucleotides targeting SARS-CoV-2 RNAs or targeting one or more genes of SARS-CoV-2 virus can be any nucleic acid molecule capable of modulating gene expression by down regulating or knocking down the expression of a target nucleic acid sequence of SARS-CoV-2 virus.
[0088] Down regulating or knocking down the expression of a target nucleic acid sequence can be commonly accomplished via RNA interference (RNAi). RNAi generally designates a phenomenon by which dsRNA specifically reduces expression of a target gene at post-translational level. In normal conditions. RNA interference is initiated by double-stranded RNA molecules (dsRNA) of various length, for example ranging from 15 to 30 base pair length. In vivo, dsRNA introduced into a cell is cleaved into a mixture of short dsRNA molecules.
[0089] Nucleic acid molecules capable of modulating gene expression by down regulating or knocking down the expression of a target nucleic acid sequence SARS-CoV-2 virus can thus include “antisense oligonucleotides”, “short interfering nucleic acid” (siNA), “short interfering RNA” (siRNA), “short interfering nucleic acid molecule”, “short interfering oligonucleotide molecule”, “miRNA”, “micro RNA”, guide RNA (gRNA), short guide RNA (sgRNA) of a CRISPR system, “short hairpin RNA” (shRNA) or a mixture thereof.
[0090] Unmodified oligonucleotides as defined above, such as unmodified siRNAs, are prone to rapid degradation by ubiquitous endo- and exonucleases and they are generally undetectable in the blood already 10 min after administration.
[0091] The oligonucleotides used in the present invention are necessarily chemically unmodified in order to be perfectly water-soluble. More specifically, unmodified oligonucleotides refer to oligonucleotides without any structural modifications at the ribose level (e.g. 2′-fluoro, 2′-methyl, and/or 2′-methoxy), at the base level and at the backbone level (e.g. phosphodiester, phosphorithioate).
[0092] According to a preferred embodiment, oligonucleotides of the present invention are at least 10, 15, 20 or 25 nucleotides (nt) long, more preferably in the range of 19 to 25 nucleotides long, or typically 19, 20, 21, 22, 23, 24 or 25 nt long.
[0093] According to a preferred embodiment, oligonucleotides of the present invention are designed to have complementarity to the target sequence. In the context of the present invention, they are more specifically designed to have complementarity to a target nucleic acid sequence of the SARS-CoV-2 virus genome. Said viral genome is for instance as described by SEQ ID NO 7.
[0094] The term RNA interference (RNAi) is used to describe gene silencing or knocking down at the mRNA level guided by small complementary non-coding RNA species. There are several classes of RNAi mediators, one of which, namely small interfering RNAs (siRNAs). The source of siRNAs during infection is viral double-stranded RNA (dsRNA), which is cleaved by cytoplasmic RNAse III family enzyme Dicer into 19-27 base pair (bp) long molecules with a perfectly complementary middle region and 2-nt overhangs on both 3′ ends. These siRNAs are incorporated into a multiprotein RNA-induced silencing complex (RISC). Following the strand separation, the antisense strand (i.e. guide strand) guides the RISC to recognize and cut target RNA transcripts (the other strand is called passenger strand).
[0095] Unmodified oligonucleotides as defined above, such as unmodified siRNAs, are aimed at inhibiting or reducing contagiousness of SARS-CoV-2 virus, more specifically, by protecting host from viral infection, inhibiting the expression of viral antigen or accessory genes, controlling the transcription, retro transcription or replication of viral genome, hindering the assembly of viral particles, or displaying influences in virus-host interactions.
[0096] Unmodified oligonucleotides as defined above, such as unmodified siRNAs, can thus be used to protect host from viral infection, inhibit the expression of viral antigen and accessory genes, control the transcription, retro transcription or replication of viral genome, hinder the assembly of viral particles, or display influences in virus-host interactions.
[0097] Whether RNAi is a functional antiviral pathway in mammals is still contentious, since production of siRNA molecules from long dsRNAs cannot be explicitly demonstrated in mammalian cells due to the fact that dsRNA longer than 30 bp triggers activation of interferon (IFN) response which shuts down the natural RNAi. However, mammalian cells do possess all the components of evolutionary conserved RNAi machinery that can be harnessed to inhibit the expression of cognate mRNA by exogenous siRNA molecules. The antiviral potential of siRNAs was first demonstrated against respiratory syncytial virus and thereafter numerous studies describing antiviral activity of siRNAs against viruses with DNA and RNA genomes in vitro and in vivo have been published. RNAi-based drugs thus appear to be a viable option to treat severe viral infections, against which effective vaccines or specific cure is not available yet, such as Ebola virus or emerging viruses, in particular SARS-CoV-2 virus.
[0098] The first step in production of antiviral siRNAs is in silico selection of highly conservative sequences in the targeted virus genome in order to achieve strong antiviral activity and avoid off-target effects.
[0099] After internalization of siRNA duplexes in treated cells, the duplexes are loaded on proteins of the “Ago” family, forming a molecular complex named “RISC” (RNA-induced silencing complex). There are 4 Ago proteins in mouse and in human, but only one (called “Ago2”) is able to degrade target RNAs by endonucleolytic cleavage. That reaction generally occurs when the guide strand and the target are highly complementary (a perfect match to the “seed” [preferably nucleotides 2-7 of the guide strand] is important for target binding; and a perfect match to the central part [preferably nucleotides 8-14] of the guide strand is important for target cleavage).
[0100] According to a preferred embodiment, oligonucleotides of the present invention are designed to have complementarity to a target nucleic acid sequence of SARS-CoV-2 virus genome (such as SEQ ID NO 7). This complementarity involves at least 13 bases, typically between 13 and 25 bases, preferably at least 14 bases, even more preferably at least 18 bases of the oligonucleotides of the present invention.
[0101] The term “complementary” or “complementarity” refers herein to the ability of oligonucleotides to form base pairs with another nucleotide molecule. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. However, when a U is denoted in the context of the present invention, the ability to substitute a T is implied, unless otherwise stated. Perfect complementarity or 100 percent complementarity refers to the situation in which each nucleotide unit of the oligonucleotide strand of the invention can bind to a nucleotide unit of a second oligonucleotide strand. Less than perfect complementarity refers to the situation in which some, but not all, nucleotide units of two strands can bind with each other. For example, for two 20-mers, if only two base pairs on one strand of the invention (e.g. guide strand) can bind with the other, the oligonucleotide strand of the invention exhibits 10 percent complementarity. In the same way, if 20 base units of one 20 nt strand (e.g. guide strand) can be bond with 20 other base units of the target gene, the oligonucleotide strands of the invention exhibit 100 percent complementarity.
[0102] In a particular aspect, the oligonucleotides of the present invention is a RNA, typically a double-stranded RNA (or RNA duplexes), in particular a small interfering RNA (siRNA), with a guide strand and a passenger strand.
[0103] According to a more particular embodiment, the oligonucleotides of the present invention are synthetic RNA duplexes comprising or consisting of two unmodified 21-mer oligonucleotides annealed together to form short/small interfering RNAs (siRNAs).
[0104] The main limitation of anti-viral RNAi is the great mutability of viruses. It can be anticipated that siRNA-resistant virus variants will emerge rapidly. In order to delay as much as possible, the emergence of such variants, it is better to target constant regions of the virus genome (i.e.: regions that are exactly identical among the sequenced variants of the virus).
[0105] According to a particular embodiment, the unmodified oligonucleotide targeting one or more genes of the virus SARS-CoV-2 targets constant regions of the virus genome.
[0106] mRNA accessibility to RISC can be hindered by RNA-binding proteins, whose binding pattern is not known. But the 5′ UTR and coding sequence of mRNAs are cleaned by ribosome scanning making them more sensitive to RISC than the 3′ UTR: while scoring predicted off-targets, it is advisable to focus on those with a seed match in their 3′ UTR.
[0107] According to a particular embodiment, the unmodified oligonucleotide targeting one or more genes of the virus SARS-CoV-2 targets the 5′ UTR and coding sequence of the virus genome.
[0108] mRNA accessibility to RISC can also be inhibited by mRNA secondary structures, especially short-term interactions, which are likely to re-form rapidly after ribosome scanning.
[0109] According to a particular embodiment, the unmodified oligonucleotide targeting one or more genes of the virus SARS-CoV-2 targets poorly-structured regions of the mRNA of SARS-CoV-2 virus.
[0110] Natural human miRNAs frequently have a 5′ uridine, which may be due to an intrinsically higher affinity of the Ago protein or its loading machinery (at least Ago2 binds preferentially 5′ uridines and 5′ adenosines).
[0111] According to a particular embodiment, the unmodified oligonucleotide targeting one or more genes of SARS-CoV-2 virus, and in particular its guide strand, has a 5′ uridine base.
[0112] In addition to the intended target, introduced siRNAs might bind additional mRNAs (“off-targets”). The main determinant of target recognition is a perfect match between nucleotides 2-7 of the guide strand (the “seed” of the guide strand) and the off-target RNA. If there are many off-targets, the siRNA is likely to be partially titrated, hence less efficient. And because off-targets might be (moderately) repressed by the siRNA, they could trigger unwanted secondary effects. It is thus preferable to choose siRNAs that minimize the number of off-targets, and to minimize the number of off-targets whose modest down-regulation is most susceptible to trigger phenotypic consequences in humans.
[0113] The SARS-CoV-2 virus has an RNA genome, so it is theoretically possible to target both the genomic RNA (which is about 30 kb long) and individual mRNAs (there are 9 annotated ORFs—open reading frames—in the SARS-CoV-2 genome). mRNAs are more likely to be accessible to siRNAs, because genomic RNA is largely protected by encapsidation.
[0114] According to a particular embodiment, the unmodified oligonucleotide targeting one or more genes of SARS-CoV-2 targets one or more viral sequences that belong to mature mRNAs of SARS-CoV-2.
[0115] According to a particular embodiment, the unmodified oligonucleotide of the invention targets the mRNA of the longest protein produced by the virus. The function of this protein is not yet known with precision; in the viral genome, its gene is called “ORFlab”. Said gene extends from position 266 to position 21555 of the viral genome shown in SEQ ID NO 7, and siRNA of the invention more preferably targets the region between positions 14790 to 14810 of said genome.
[0116] Up to date, these positions of the viral genome are, at the same time, 100% conserved between all the sequenced variants of the virus genome (more than one thousand variants described to date) and they are particularly accessible to siRNAs. (little folded in on themselves).
[0117] According to a particular embodiment, the siRNA of the invention presents a guide strand which comprises, or consists of, one of the following sequences:
TABLE-US-00001 SEQ ID NO 1: 5′ P-UGAUAGUAGUCAUAAUCGCUA 3′; SEQ ID NO 3: 5′ P-UGACUUAAAGUUCUUUAUGCG 3′; SEQ ID NO 5: 5′ P-UUAGCUAAAGACACGAACCGG 3′; SEQ ID NO 8: 5′ P-UGACUUAAAGUUCUUUAUGCUC 3′; SEQ ID NO 10: 5′ P-UAUAGCUAAAGACACGAACCC 3′; SEQ ID NO 11: 5′ P-AUAGCUAAAGACACGAACCGG 3′; SEQ ID NO 12: 5′ P-UUGAGUGCAUCAUUAUCCAAG 3′; SEQ ID NO 13: 5′ P-CUUGACUGCCGCCUCUGCUCG 3′; SEQ ID NO 14: 5′ P-GUUGAGUGCAUCAUUAUCCAC 3′; SEQ ID NO 15: 5′ P-UCCUGAUUAUGUACAACACCG 3′.
[0118] Preferably, the siRNA of the invention presents a guide strand which comprises, or consists of, SEQ ID NO 1.
[0119] According to a preferred embodiment, the siRNA duplexes of the invention, with guide strand and passenger strand, comprises, or consists of, one of the following duplex sequences: siRNA n° 1
TABLE-US-00002 SEQ ID NO 1: guide strand: 5′ P-UGAUAGUAGUCAUAAUCGCUA 3′; SEQ ID NO 2: passenger strand: 5′ GCGAUUAUGACUACUAUUUUA 3′. siRNA no 2 SEQ ID NO 3: guide strand: 5′ P-UGACUUAAAGUUCUUUAUGCG 3′; SEQ ID NO 4: passenger strand: 5′ CAUAAAGAACUUUAAGUCCUC 3′. siRNA no 3 SEQ ID NO 5: guide strand: 5′ P-UUAGCUAAAGACACGAACCGG 3′; SEQ ID NO 6: passenger strand: 5′ GGUUCGUGUCUUUAGCUACUC 3′. siRNA no 4 SEQ ID NO 8: guide strand: 5′ P-UGACUUAAAGUUCUUUAUGCUC 3′; SEQ ID NO 9: passenger strand: 5′ GCAUAAAGAACUUUAAGUUUCU 3′.
[0120] Preferably, the siRNA of the invention comprises, or consists of, the duplex sequences of SEQ ID NO 1 and 2 (siRNA n° 1).
[0121] The siRNA with guide stands corresponding to SEQ ID 10-15 also comprise passenger strands as to form effective siRNAs duplexes, as described above.
[0122] Schematic of said siRNA structures are dispatched in
[0123] According to a particular aspect, the invention relates to the siRNAS as identified above.
[0124] According to another aspect, the invention relates a pharmaceutical composition comprising at least one the siRNAs as defined above, in a pharmaceutically acceptable carrier or excipient.
[0125] Use of Reverse Micelles to Deliver Unmodified Nucleotides Targeting Virus SARS-Cov-2 Genes
[0126] The pharmaceutical composition of the present invention describes unmodified oligonucleotides, such as siRNAs, targeting one or more genes of the SARS-CoV-2 Coronavirus virus, formulated in the microemulsion (or reverse micelles) as described herein and intended for the treatment of patients contaminated by this virus.
[0127] The unmodified oligonucleotides, such as siRNAs, targeting one or more genes of the SARS-CoV-2 are present in the aqueous core of the reverse micelles.
[0128] The amount of unmodified oligonucleotides, such as siRNAs, targeting one or more genes of SARS-CoV-2 incorporated into the reverse micelle system is determined by their solubility in the hydrophilic phase (aqueous core). Preferably, the amount of unmodified oligonucleotides, such as siRNAs, targeting one or more genes of SARS-CoV-2 included in the reverse micelle system depends on their size.
[0129] The reverse micelles of the invention allow the oligonucleotide included therein to be administered and transported to cells with a high degree of protection in lipoprotein HDL and vHDL, in particular without affecting its stability.
[0130] It is known today that a reverse-micelle system can be used for the preparation of nanomaterials, which act as micro reactors. The activity and stability of bio molecules can be controlled, mainly by the concentration of water in this medium.
[0131] An object of the invention concerns a pharmaceutical composition comprising reverse micelles as defined above and at least a pharmaceutically acceptable carrier, excipient or support, more specifically for use in the treatment of COVID-19.
[0132] According to a particular embodiment, the pharmaceutical composition is in the form of airless bottle, a capsule, a caplet, an aerosol, a spray, a solution or a soft elastic gelatin capsule.
[0133] A further object of the invention concerns the use of reverse micelles as defined above for preparing a pharmaceutical composition intended for the treatment of COVID-19.
[0134] The present invention further concerns a method for the treatment of COVID-19, wherein the method comprises the step of administering into a subject in need of such treatment a therapeutically efficient amount of one or more unmodified oligonucleotides as defined above.
[0135] More specifically, administration of one or more unmodified oligonucleotides in reverse micelle system as defined herein or pharmaceutical composition comprising the same is a mucosal delivery.
[0136] As pharmaceutically acceptable excipient, vehicle or carrier, any excipient, vehicle or carrier well-known to the person skilled in the art may be used. Other additives well-known to the person skilled in the art such as stabilisers, drying agents, binders or pH buffers may also be used. Preferred excipients in accordance with the invention promote adherence of the finished product to the mucosa.
[0137] The compositions of the invention can be administered in different ways, in particular via the oral, nasal, vaginal or rectal route, with a buccal, nasal, vaginal or digestive absorption, or more generally via mucosal tissue absorption. The composition of the invention is preferably administered by buccal route or rectal route, with a buccal mucosa or rectal mucosa absorption, respectively.
[0138] Within the context of the invention, the term treatment denotes curative, symptomatic, and preventive treatment. As used herein, the term “treatment” of COVID-19 refers to any act intended to extend life span of subjects (or patients) such as therapy and retardation of the disease progression. The treatment can be designed to eradicate the disease, to stop the progression of the disease, and/or to promote the regression of the disease. The term “treatment” of a disease also refers to any act intended to decrease one or more mild symptoms associated with the disease, including fever, cough, shortness of breath, muscle pain, sputum production and/or sore throat. The term “treatment” of the disease also refers to any act intended to decrease one or more severe symptoms associated with the disease, including pneumonia and/or multi-organ failure. More specifically, the treatment according to the invention is intended to delay the appearance of, alleviate, or hinder, the mild symptoms and more particularly the severe symptoms of COVID-19, such as COVID-19 associated pneumonia or multi-organ failure.
[0139] As used herein, the term “therapeutically effective amount” is intended an amount of unmodified oligonucleotides as defined above, administered to a patient that is sufficient to constitute a treatment of COVID-19 as defined above. In a particular embodiment, the therapeutically effective amount to be administered is an amount sufficient to down regulate or knock down the expression of a target nucleic acid of SARS-CoV-2 virus. The amount of unmodified oligonucleotides as defined above to be administered can be determined by standard procedure well known by those of ordinary skill in the art. Physiological data of the patient (e.g. age, size, and weight), the routes of administration and the disease to be treated have to be taken into account to determine the appropriate dosage. One skilled in the art will recognize that the amount of unmodified oligonucleotides to be administered will be an amount that is sufficient to induce reduction of COVID-19 symptoms or to induce alleviation of one or more symptoms of COVID-19.
[0140] The subject (or patient) to treat is any mammal, preferably a human being. Preferably, the subject is a human patient, whatever its age or sex. New-borns, infants, children are included as well. More preferably, the patient or subject according to the invention is suspected to be infected by SARS-CoV-2 or has been diagnosed to have CoVID-19 or has been diagnosed as infected by SARS-CoV-2. The standard method of diagnosis is by reverse transcription polymerase chain reaction (rRT-PCR) from a nasopharyngeal swab or throat swab. The infection can also be diagnosed from a combination of symptoms, risk factors and a chest CT scan (Computer Tomography scan) showing features of pneumonia.
[0141] As used herein, the terms “mucosa” and “mucosal” refer to a mucous tissue such as of the respiratory, digestive, or genital tissue. “Mucosal delivery”, “mucosal administration” and analogous terms as used herein refer to the administration of a composition through a mucosal tissue. “Mucosal delivery”, “mucosal administration” and analogous terms include, but are not limited to, the delivery of a composition through preferably buccal administration, bronchi, gingival, lingual, nasal, buccal, vaginal, rectal, and gastro-intestinal mucosal tissue. Administration according to the invention is more preferably carried out via buccal mucosa or rectal mucosa.
EXAMPLES
[0142] The following examples are intended to exemplify the operation of the present invention but not to limit its scope.
Example 1: Manufacture of a Drug for the Treatment of Infectious Pathologies Linked to SARS-CoV-2 Coronavirus—siRNA #1
[0143] The aim of this study was to evaluate by visual determination the formulation and the stability of the siRNA #1 targeting SARS-CoV-2 in the reverse microemulsion.
[0144] 8.5 g of lecithin were dissolved in 6.8 g of absolute ethanol by magnetic stirring at 300 r/min for 15 minutes at room temperature. 1.4 g of sitosterol were added to the mixture and stirred in the same conditions. 32.6 g of glycerol monooleate was added thereto and magnetic stirring was carried out at 500 r/min for 45 minutes at 37° C.
[0145] 168 mg of a siRNA aqueous solution containing 1.06 mg of siRNA #1 were added to 1148.0 mg of the oil mixture as prepared above and then stirred at room temperature by magnetic stirring at 700 r/min for 30 minutes.
[0146] The microemulsion was limpid, monophasic and thermodynamically stable. These experiments show that the siRNA #1 is well formulated in the reverse micelle at 800 sg/ml and has no impact on the stability of the system.
[0147] Other microemulsions with close contents are also prepared and result in similar reverse micelle with a stable system.
Example 2: Manufacture of a Drug for the Treatment of Infectious Pathologies Linked to SARS-CoV-2 Coronavirus—siRNA #2, siRNA #3, siRNA #4
[0148] The aim of this study was to evaluate by visual determination the formulation and the stability of the siRNA #2, #3 et #4 targeting SARS-CoV-2 in the reverse microemulsion.
[0149] 8.5 g of lecithin were dissolved in 6.8 g of absolute ethanol by magnetic stirring at 300 r/min for 15 minutes at room temperature. 1.4 g of sitosterol were added to the mixture and stirred in the same conditions. 32.6 g of glycerol monooleate was added thereto and magnetic stirring was carried out at 500 r/min for 45 minutes at 37° C.
[0150] 168 mg of a siRNA aqueous solution were added to 1148.0 mg of the oil mixture as prepared above and then stirred at room temperature by magnetic stirring at 700 r/min for 30 minutes. The composition of each tested siRNA aqueous solution is in following table 1:
TABLE-US-00003 TABLE 1 tested siRNA aqueous solutions #2 #3 #4 siRNA aqueous siRNA aqueous siRNA aqueous solution solution solution containing 1.06 mg containing 1.06 mg of containing 1.06 mg of siRNA #2 siRNA #3 of siRNA #4
[0151] Each microemulsion obtained was limpid, monophasic and thermodynamically stable. These experiments show that the siRNA #2, siRNA #3 and siRNA #4 are well formulated in the reverse micelles at 800 sg/ml and have no impact on the stability of the systems.
Example 3: Efficacy Study by Rectal Mucosa Route in SG Hamster Model of SARS-COV-2
[0152] Objective:
[0153] Evaluation of 2 reverse micelle systems according to the invention (with siRNA #1 and with siRNA #2) in hamster model of SARS-COV-2 after 4-day treatment.
[0154] Test Items:
TABLE-US-00004 Name NanosiRNA ®#1 NanosiRNA ®#2 NanosiRNA ®#SCR Medesis Batch N° 210006 N.sup.o: 210007 N.sup.o: 210009 Com- water in oil water in oil water in oil position microemulsion microemulsion microemulsion containing containing containing 1.0 mg/mL 1.0 mg/mL 1.0 mg/mL of siRNA#1, of siRNA#2, of scrambled targeting targeting siRNA. the SARS-Cov-2 the SARS-Cov-2 coronavirus. coronavirus. Description Homogeneous yellow oily liquid Viscosity approx. 80-100 mPa .Math. s at +25° C. and approx 40-60 mPa .Math. s at +37° C.. Storage conditions at room temperature (approximately +15 to +25° C.). Expiry date January 2022 Quantity 6 mL (3 vials of 2 mL) Clear glass vials containing 2 mL of drug product
[0155] Administration:
[0156] A constant dosage-volume of 1 mL/kg/day is used for all groups of animals. The quantity of dosage form administered to each animal is adjusted according to the bodyweight.
[0157] The dosage form is administrated by rectal deposit without anesthesia, using a pipet tip with automatic pipetman.
[0158] Food and water will be removed before product administration and will be given 30 minutes after administration.
[0159] Animals:
[0160] Strain: Golden Syrian hamster model of SARS-COV-2
[0161] Number: 24 female SG hamsters
[0162] 6-8 weeks old female SG hamsters of 90-120 g are ear-tagged and randomized in the different treatment groups.
TABLE-US-00005 P 6 virus TCID.sub.50 Frequency Group hamsters inoculum/50 μL Treatment Dose dosing MOA Group 1 6 WT 1.89E+06 siRNA 1 1.0 mg/mL once Rectal deposit Group 2 6 WT 1.89E+06 siRNA 2 1.0 mg/mL once Rectal deposit Group 3 6 WT 1.89E+06 Scramble 1.0 mg/mL once Rectal deposit 18 hamsters
[0163] Duration:
[0164] The dose formulations will be administrated once daily for a period of 4 days.
[0165] Collection and Analysing of Samples:
[0166] Animals are sacrificed: lung and blood collection
[0167] Lung: 1) Quantification of viral load by real-time quantitative RT-qPCR
[0168] 2) Quantification of infectious viral content by (end-point) titration
[0169] 3) Histological examination for evaluation of inflammation in lung tissues.
TABLE-US-00006 SEQ ID NO 7: 1 attaaaggtt tataccttcc caggtaacaa accaaccaac tttcgatctc ttgtagatct 61 gttctctaaa cgaactttaa aatctgtgtg gctgtcactc ggctgcatgc ttagtgcact 121 cacgcagtat aattaataac taattactgt cgttgacagg acacgagtaa ctcgtctatc 181 ttctgcaggc tgcttacggt ttcgtccgtg ttgcagccga tcatcagcac atctaggttt 241 cgtccgggtg tgaccgaaag gtaagatgga gagccttgtc cctggtttca acgagaaaac 301 acacgtccaa ctcagtttgc ctgttttaca ggttcgcgac gtgctcgtac gtggctttgg 361 agactccgtg gaggaggtct tatcagaggc acgtcaacat cttaaagatg gcacttgtgg 421 cttagtagaa gttgaaaaag gcgttttgcc tcaacttgaa cagccctatg tgttcatcaa 481 acgttcggat gctcgaactg cacctcatgg tcatgttatg gttgagctgg tagcagaact 541 cgaaggcatt cagtacggtc gtagtggtga gacacttggt gtccttgtcc ctcatgtggg 601 cgaaatacca gtggcttacc gcaaggttct tcttcgtaag aacggtaata aaggagctgg 661 tggccatagt tacggcgccg atctaaagtc atttgactta ggcgacgagc ttggcactga 721 tccttatgaa gattttcaag aaaactggaa cactaaacat agcagtggtg ttacccgtga 781 actcatgcgt gagcttaacg gaggggcata cactcgctat gtcgataaca acttctgtgg 841 ccctgatggc taccctcttg agtgcattaa agaccttcta gcacgtgctg gtaaagcttc 901 atgcactttg tccgaacaac tggactttat tgacactaag aggggtgtat actgctgccg 961 tgaacatgag catgaaattg cttggtacac ggaacgttct gaaaagagct atgaattgca 1021 gacacctttt gaaattaaat tggcaaagaa atttgacacc ttcaatgggg aatgtccaaa 1081 ttttgtattt cccttaaatt ccataatcaa gactattcaa ccaagggttg aaaagaaaaa 1141 gcttgatggc tttatgggta gaattcgatc tgtctatcca gttgcgtcac caaatgaatg 1201 caaccaaatg tgcctttcaa ctctcatgaa gtgtgatcat tgtggtgaaa cttcatggca 1261 gacgggcgat tttgttaaag ccacttgcga attttgtggc actgagaatt tgactaaaga 1321 aggtgccact acttgtggtt acttacccca aaatgctgtt gttaaaattt attgtccagc 1381 atgtcacaat tcagaagtag gacctgagca tagtcttgcc gaataccata atgaatctgg 1441 cttgaaaacc attcttcgta agggtggtcg cactattgcc tttggaggct gtgtgttctc 1501 ttatgttggt tgccataaca agtgtgccta ttgggttcca cgtgctagcg ctaacatagg 1561 ttgtaaccat acaggtgttg ttggagaagg ttccgaaggt cttaatgaca accttcttga 1621 aatactccaa aaagagaaag tcaacatcaa tattgttggt gactttaaac ttaatgaaga 1681 gatcgccatt attttggcat ctttttctgc ttccacaagt gcttttgtgg aaactgtgaa 1741 aggtttggat tataaagcat tcaaacaaat tgttgaatcc tgtggtaatt ttaaagttac 1801 aaaaggaaaa gctaaaaaag gtgcctggaa tattggtgaa cagaaatcaa tactgagtcc 1861 tctttatgca tttgcatcag aggctgctcg tgttgtacga tcaattttct cccgcactct 1921 tgaaactgct caaaattctg tgcgtgtttt acagaaggcc gctataacaa tactagatgg 1981 aatttcacag tattcactga gactcattga tgctatgatg ttcacatctg atttggctac 2041 taacaatcta gttgtaatgg cctacattac aggtggtgtt gttcagttga cttcgcagtg 2101 gctaactaac atctttggca ctgtttatga aaaactcaaa cccgtccttg attggcttga 2161 agagaagttt aaggaaggtg tagagtttct tagagacggt tgggaaattg ttaaatttat 2221 ctcaacctgt gcttgtgaaa ttgtcggtgg acaaattgtc acctgtgcaa aggaaattaa 2281 ggagagtgtt cagacattct ttaagcttgt aaataaattt ttggctttgt gtgctgactc 2341 tatcattatt ggtggagcta aacttaaagc cttgaattta ggtgaaacat ttgtcacgca 2401 ctcaaaggga ttgtacagaa agtgtgttaa atccagagaa gaaactggcc tactcatgcc 2461 tctaaaagcc ccaaaagaaa ttatcttctt agagggagaa acacttccca cagaagtgtt 2521 aacagaggaa gttgtcttga aaactggtga tttacaacca ttagaacaac ctactagtga 2581 agctgttgaa gctccattgg ttggtacacc agtttgtatt aacgggctta tgttgctcga 2641 aatcaaagac acagaaaagt actgtgccct tgcacctaat atgatggtaa caaacaatac 2701 cttcacactc aaaggcggtg caccaacaaa ggttactttt ggtgatgaca ctgtgataga 2761 agtgcaaggt tacaagagtg tgaatatcac ttttgaactt gatgaaagga ttgataaagt 2821 acttaatgag aagtgctctg cctatacagt tgaactcggt acagaagtaa atgagttcgc 2881 ctgtgttgtg gcagatgctg tcataaaaac tttgcaacca gtatctgaat tacttacacc 2941 actgggcatt gatttagatg agtggagtat ggctacatac tacttatttg atgagtctgg 3001 tgagtttaaa ttggcttcac atatgtattg ttctttctac cctccagatg aggatgaaga 3061 agaaggtgat tgtgaagaag aagagtttga gccatcaact caatatgagt atggtactga 3121 agatgattac caaggtaaac ctttggaatt tggtgccact tctgctgctc ttcaacctga 3181 agaagagcaa gaagaagatt ggttagatga tgatagtcaa caaactgttg gtcaacaaga 3241 cggcagtgag gacaatcaga caactactat tcaaacaatt gttgaggttc aacctcaatt 3301 agagatggaa cttacaccag ttgttcagac tattgaagtg aatagtttta gtggttattt 3361 aaaacttact gacaatgtat acattaaaaa tgcagacatt gtggaagaag ctaaaaaggt 3421 aaaaccaaca gtggttgtta atgcagccaa tgtttacctt aaacatggag gaggtgttgc 3481 aggagcctta aataaggcta ctaacaatgc catgcaagtt gaatetgatg attacatagc 3541 tactaatgga ccacttaaag tgggtggtag ttgtgtttta agcggacaca atcttgctaa 3601 acactgtctt catgttgtcg gcccaaatgt taacaaaggt gaagacattc aacttcttaa 3661 gagtgcttat gaaaatttta atcagcacga agttctactt gcaccattat tatcagctgg 3721 tatttttggt gctgacccta tacattcttt aagagtttgt gtagatactg ttcgcacaaa 3781 tgtctactta gctgtctttg ataaaaatct ctatgacaaa cttgtttcaa gctttttgga 3841 aatgaagagt gaaaagcaag ttgaacaaaa gatcgctgag attcctaaag aggaagttaa 3901 gccatttata actgaaagta aaccttcagt tgaacagaga aaacaagatg ataagaaaat 3961 caaagcttgt gttgaagaag ttacaacaac tctggaagaa actaagttcc tcacagaaaa 4021 cttgttactt tatattgaca ttaatggcaa tcttcatcca gattctgcca ctcttgttag 4081 tgacattgac atcactttct taaagaaaga tgctccatat atagtgggtg atgttgttca 4141 agagggtgtt ttaactgctg tggttatacc tactaaaaag gctggtggca ctactgaaat 4201 gctagcgaaa gctttgagaa aagtgccaac agacaattat ataaccactt acccgggtca 4261 gggtttaaat ggttacactg tagaggaggc aaagacagtg cttaaaaagt gtaaaagtgc 4321 cttttacatt ctaccatcta ttatctctaa tgagaagcaa gaaattcttg gaactgtttc 4381 ttggaatttg cgagaaatgc ttgcacatgc agaagaaaca cgcaaattaa tgcctgtctg 4441 tgtggaaact aaagccatag tttcaactat acagcgtaaa tataagggta ttaaaataca 4501 agagggtgtg gttgattatg gtgctagatt ttacttttac accagtaaaa caactgtagc 4561 gtcacttatc aacacactta acgatctaaa tgaaactctt gttacaatgc cacttggcta 4621 tgtaacacat ggcttaaatt tggaagaagc tgctcggtat atgagatctc tcaaagtgcc 4681 agctacagtt tctgtttctt cacctgatgc tgttacagcg tataatggtt atcttacttc 4741 ttcttctaaa acacctgaag aacattttat tgaaaccatc tcacttgctg gttcctataa 4801 agattggtcc tattctggac aatctacaca actaggtata gaatttctta agagaggtga 4861 taaaagtgta tattacacta gtaatcctac cacattccac ctagatggtg aagttatcac 4921 ctttgacaat cttaagacac ttctttcttt gagagaagtg aggactatta aggtgtttac 4981 aacagtagac aacattaacc tccacacgca agttgtggac atgtcaatga catatggaca 5041 acagtttggt ccaacttatt tggatggagc tgatgttact aaaataaaac ctcataattc 5101 acatgaaggt aaaacatttt atgttttacc taatgatgac actctacgtg ttgaggcttt 5161 tgagtactac cacacaactg atcctagttt tctgggtagg tacatgtcag cattaaatca 5221 cactaaaaag tggaaatacc cacaagttaa tggtttaact tctattaaat gggcagataa 5281 caactgttat cttgccactg cattgttaac actccaacaa atagagttga agtttaatcc 5341 acctgctcta caagatgctt attacagagc aagggctggt gaagctgcta acttttgtgc 5401 acttatctta gcctactgta ataagacagt aggtgagtta ggtgatgtta gagaaacaat 5461 gagttacttg tttcaacatg ccaatttaga ttcttgcaaa agagtcttga acgtggtgtg 5521 taaaacttgt ggacaacagc agacaaccct taagggtgta gaagctgtta tgtacatggg 5581 cacactttct tatgaacaat ttaagaaagg tgttcagata ccttgtacgt gtggtaaaca 5641 agctacaaaa tatctagtac aacaggagtc accttttgtt atgatgtcag caccacctgc 5701 tcagtatgaa cttaagcatg gtacatttac ttgtgctagt gagtacactg gtaattacca 5761 gtgtggtcac tataaacata taacttctaa agaaactttg tattgcatag acggtgcttt 5821 acttacaaag tcctcagaat acaaaggtcc tattacggat gttttctaca aagaaaacag 5881 ttacacaaca accataaaac cagttactta taaattggat ggtgttgttt gtacagaaat 5941 tgaccctaag ttggacaatt attataagaa agacaattct tatttcacag agcaaccaat 6001 tgatcttgta ccaaaccaac catatccaaa cgcaagcttc gataatttta agtttgtatg 6061 tgataatatc aaatttgctg atgatttaaa ccagttaact ggttataaga aacctgcttc 6121 aagagagctt aaagttacat ttttccctga cttaaatggt gatgtggtgg ctattgatta 6181 taaacactac acaccctctt ttaagaaagg agctaaattg ttacataaac ctattgtttg 6241 gcatgttaac aatgcaacta ataaagccac gtataaacca aatacctggt gtatacgttg 6301 tctttggagc acaaaaccag ttgaaacatc aaattcgttt gatgtactga agtcagagga 6361 cgcgcaggga atggataatc ttgcctgcga agatctaaaa ccagtctctg aagaagtagt 6421 ggaaaatcct accatacaga aagacgttct tgagtgtaat gtgaaaacta ccgaagttgt 6481 aggagacatt atacttaaac cagcaaataa tagtttaaaa attacagaag aggttggcca 6541 cacagatcta atggctgctt atgtagacaa ttctagtctt actattaaga aacctaatga 6601 attatctaga gtattaggtt tgaaaaccct tgctactcat ggtttagctg ctgttaatag 6661 tgtcccttgg gatactatag ctaattatgc taagcctttt cttaacaaag ttgttagtac 6721 aactactaac atagttacac ggtgtttaaa ccgtgtttgt actaattata tgccttattt 6781 ctttacttta ttgctacaat tgtgtacttt tactagaagt acaaattcta gaattaaagc 6841 atctatgccg actactatag caaagaatac tgttaagagt gtcggtaaat tttgtctaga 6901 ggcttcattt aattatttga agtcacctaa tttttctaaa ctgataaata ttataatttg 6961 gtttttacta ttaagtgttt gcctaggttc tttaatctac tcaaccgctg ctttaggtgt 7021 tttaatgtct aatttaggca tgccttctta ctgtactggt tacagagaag gctatttgaa 7081 ctctactaat gtcactattg caacctactg tactggttct ataccttgta gtgtttgtct 7141 tagtggttta gattctttag acacctatcc ttctttagaa actatacaaa ttaccatttc 7201 atcttttaaa tgggatttaa ctgcttttgg cttagttgca gagtggtttt tggcatatat 7261 tcttttcact aggtttttct atgtacttgg attggctgca atcatgcaat tgtttttcag 7321 ctattttgca gtacatttta ttagtaattc ttggcttatg tggttaataa ttaatcttgt 7381 acaaatggcc ccgatttcag ctatggttag aatgtacatc ttctttgcat cattttatta 7441 tgtatggaaa agttatgtgc atgttgtaga cggttgtaat tcatcaactt gtatgatgtg 7501 ttacaaacgt aatagagcaa caagagtcga atgtacaact attgttaatg gtgttagaag 7561 gtccttttat gtctatgcta atggaggtaa aggcttttgc aaactacaca attggaattg 7621 tgttaattgt gatacattct gtgctggtag tacatttatt agtgatgaag ttgcgagaga 7681 cttgtcacta cagtttaaaa gaccaataaa tcctactgac cagtcttctt acatcgttga 7741 tagtgttaca gtgaagaatg gttccatcca tctttacttt gataaagctg gtcaaaagac 7801 ttatgaaaga cattctctct ctcattttgt taacttagac aacctgagag ctaataacac 7861 taaaggttca ttgcctatta atgttatagt ttttgatggt aaatcaaaat gtgaagaatc 7921 atctgcaaaa tcagcgtctg tttactacag tcagcttatg tgtcaaccta tactgttact 7981 agatcaggca ttagtgtctg atgttggtga tagtgcggaa gttgcagtta aaatgtttga 8041 tgcttacgtt aatacgtttt catcaacttt taacgtacca atggaaaaac tcaaaacact 8101 agttgcaact gcagaagctg aacttgcaaa gaatgtgtcc ttagacaatg tcttatctac 8161 ttttatttca gcagctcggc aagggtttgt tgattcagat gtagaaacta aagatgttgt 8221 tgaatgtctt aaattgtcac atcaatctga catagaagtt actggcgata gttgtaataa 8281 ctatatgctc acctataaca aagttgaaaa catgacaccc cgtgaccttg gtgcttgtat 8341 tgactgtagt gcgcgtcata ttaatgcgca ggtagcaaaa agtcacaaca ttgctttgat 8401 atggaacgtt aaagatttca tgtcattgtc tgaacaacta cgaaaacaaa tacgtagtgc 8461 tgctaaaaag aataacttac cttttaagtt gacatgtgca actactagac aagttgttaa 8521 tgttgtaaca acaaagatag cacttaaggg tggtaaaatt gttaataatt ggttgaagca 8581 gttaattaaa gttacacttg tgttcctttt tgttgctgct attttctatt taataacacc 8641 tgttcatgtc atgtctaaac atactgactt ttcaagtgaa atcataggat acaaggctat 8701 tgatggtggt gtcactcgtg acatagcatc tacagatact tgttttgcta acaaacatgc 8761 tgattttgac acatggttta gccagcgtgg tggtagttat actaatgaca aagcttgccc 8821 attgattgct gcagtcataa caagagaagt gggttttgtc gtgcctggtt tgcctggcac 8881 gatattacgc acaactaatg gtgacttttt gcatttctta cctagagttt ttagtgcagt 8941 tggtaacatc tgttacacac catcaaaact tatagagtac actgactttg caacatcagc 9001 ttgtgttttg gctgctgaat gtacaatttt taaagatgct tctggtaagc cagtaccata 9061 ttgttatgat accaatgtac tagaaggttc tgttgcttat gaaagtttac gccctgacac 9121 acgttatgtg ctcatggatg gctctattat tcaatttcct aacacctacc ttgaaggttc 9181 tgttagagtg gtaacaactt ttgattctga gtactgtagg cacggcactt gtgaaagatc 9241 agaagctggt gtttgtgtat ctactagtgg tagatgggta cttaacaatg attattacag 9301 atctttacca ggagttttct gtggtgtaga tgctgtaaat ttacttacta atatgtttac 9361 accactaatt caacctattg gtgctttgga catatcagca tctatagtag ctggtggtat 9421 tgtagctatc gtagtaacat gccttgccta ctattttatg aggtttagaa gagcttttgg 9481 tgaatacagt catgtagttg cctttaatac tttactattc cttatgtcat tcactgtact 9541 ctgtttaaca ccagtttact cattcttacc tggtgtttat tctgttattt acttgtactt 9601 gacattttat cttactaatg atgtttcttt tttagcacat attcagtgga tggttatgtt 9661 cacaccttta gtacctttct ggataacaat tgcttatatc atttgtattt ccacaaagca 9721 tttctattgg ttctttagta attacctaaa gagacgtgta gtctttaatg gtgtttcctt 9781 tagtactttt gaagaagctg cgctgtgcac ctttttgtta aataaagaaa tgtatctaaa 9841 gttgcgtagt gatgtgctat tacctcttac gcaatataat agatacttag ctctttataa 9901 taagtacaag tattttagtg gagcaatgga tacaactagc tacagagaag ctgcttgttg 9961 tcatctcgca aaggctctca atgacttcag taactcaggt tctgatgttc tttaccaacc 10021 accacaaacc tctatcacct cagctgtttt gcagagtggt tttagaaaaa tggcattccc 10081 atctggtaaa gttgagggtt gtatggtaca agtaacttgt ggtacaacta cacttaacgg 10141 tctttggctt gatgacgtag tttactgtcc aagacatgtg atctgcacct ctgaagacat 10201 gcttaaccct aattatgaag atttactcat tcgtaagtct aatcataatt tcttggtaca 10261 ggctggtaat gttcaactca gggttattgg acattctatg caaaattgtg tacttaagct 10321 taaggttgat acagccaatc ctaagacacc taagtataag tttgttcgca ttcaaccagg 10381 acagactttt tcagtgttag cttgttacaa tggttcacca tctggtgttt accaatgtgc 10441 tatgaggccc aatttcacta ttaagggttc attccttaat ggttcatgtg gtagtgttgg 10501 ttttaacata gattatgact gtgtctcttt ttgttacatg caccatatgg aattaccaac 10561 tggagttcat gctggcacag acttagaagg taacttttat ggaccttttg ttgacaggca 10621 aacagcacaa gcagctggta cggacacaac tattacagtt aatgttttag cttggttgta 10681 cgctgctgtt ataaatggag acaggtggtt tctcaatcga tttaccacaa ctcttaatga 10741 ctttaacctt gtggctatga agtacaatta tgaacctcta acacaagacc atgttgacat 10801 actaggacct ctttctgctc aaactggaat tgccgtttta gatatgtgtg cttcattaaa 10861 agaattactg caaaatggta tgaatggacg taccatattg ggtagtgctt tattagaaga 10921 tgaatttaca ccttttgatg ttgttagaca atgctcaggt gttactttcc aaagtgcagt 10981 gaaaagaaca atcaagggta cacaccactg gttgttactc acaattttga cttcactttt 11041 agttttagtc cagagtactc aatggtcttt gttctttttt ttgtatgaaa atgccttttt 11101 accttttgct atgggtatta ttgctatgtc tgcttttgca atgatgtttg tcaaacataa 11161 gcatgcattt ctctgtttgt ttttgttacc ttctcttgcc actgtagctt attttaatat 11221 ggtctatatg cctgctagtt gggtgatgcg tattatgaca tggttggata tggttgatac 11281 tagtttgtct ggttttaagc taaaagactg tgttatgtat gcatcagctg tagtgttact 11341 aatccttatg acagcaagaa ctgtgtatga tgatggtgct aggagagtgt ggacacttat 11401 gaatgtcttg acactcgttt ataaagttta ttatggtaat gctttagatc aagccatttc 11461 catgtgggct cttataatct ctgttacttc taactactca ggtgtagtta caactgtcat 11521 gtttttggcc agaggtattg tttttatgtg tgttgagtat tgccctattt tcttcataac 11581 tggtaataca cttcagtgta taatgctagt ttattgtttc ttaggctatt tttgtacttg 11641 ttactttggc ctcttttgtt tactcaaccg ctactttaga ctgactcttg gtgtttatga 11701 ttacttagtt tctacacagg agtttagata tatgaattca cagggactac tcccacccaa 11761 gaatagcata gatgccttca aactcaacat taaattgttg ggtgttggtg gcaaaccttg 11821 tatcaaagta gccactgtac agtctaaaat gtcagatgta aagtgcacat cagtagtctt 11881 actctcagtt ttgcaacaac tcagagtaga atcatcatct aaattgtggg ctcaatgtgt 11941 ccagttacac aatgacattc tcttagctaa agatactact gaagcctttg aaaaaatggt 12001 ttcactactt tctgttttgc tttccatgca gggtgctgta gacataaaca agctttgtga 12061 agaaatgctg gacaacaggg caaccttaca agctatagcc tcagagttta gttcccttcc 12121 atcatatgca gcttttgcta ctgctcaaga agcttatgag caggctgttg ctaatggtga 12181 ttctgaagtt gttcttaaaa agttgaagaa gtctttgaat gtggctaaat ctgaatttga 12241 ccgtgatgca gccatgcaac gtaagttgga aaagatggct gatcaagcta tgacccaaat 12301 gtataaacag gctagatctg aggacaagag ggcaaaagtt actagtgcta tgcagacaat 12361 gcttttcact atgcttagaa agttggataa tgatgcactc aacaacatta tcaacaatgc 12421 aagagatggt tgtgttccct tgaacataat acctcttaca acagcagcca aactaatggt 12481 tgtcatacca gactataaca catataaaaa tacgtgtgat ggtacaacat ttacttatgc 12541 atcagcattg tgggaaatcc aacaggttgt agatgcagat agtaaaattg ttcaacttag 12601 tgaaattagt atggacaatt cacctaattt agcatggcct cttattgtaa cagctttaag 12661 ggccaattct gctgtcaaat tacagaataa tgagcttagt cctgttgcac tacgacagat 12721 gtcttgtgct gccggtacta cacaaactgc ttgcactgat gacaatgcgt tagcttacta 12781 caacacaaca aagggaggta ggtttgtact tgcactgtta tccgatttac aggatttgaa 12841 atgggctaga ttccctaaga gtgatggaac tggtactatc tatacagaac tggaaccacc 12901 ttgtaggttt gttacagaca cacctaaagg tcctaaagtg aagtatttat actttattaa 12961 aggattaaac aacctaaata gaggtatggt acttggtagt ttagctgcca cagtacgtct 13021 acaagctggt aatgcaacag aagtgcctgc caattcaact gtattatctt tctgtgcttt 13081 tgctgtagat gctgctaaag cttacaaaga ttatctagct agtgggggac aaccaatcac 13141 taattgtgtt aagatgttgt gtacacacac tggtactggt caggcaataa cagttacacc 13201 ggaagccaat atggatcaag aatcctttgg tggtgcatcg tgttgtctgt actgccgttg 13261 ccacatagat catccaaatc ctaaaggatt ttgtgactta aaaggtaagt atgtacaaat 13321 acctacaact tgtgctaatg accctgtggg ttttacactt aaaaacacag tctgtaccgt 13381 ctgcggtatg tggaaaggtt atggctgtag ttgtgatcaa ctccgcgaac ccatgcttca 13441 gtcagctgat gcacaatcgt ttttaaacgg gtttgcggtg taagtgcagc ccgtcttaca 13501 ccgtgcggca caggcactag tactgatgtc gtatacaggg cttttgacat ctacaatgat 13561 aaagtagctg gttttgctaa attcctaaaa actaattgtt gtcgcttcca agaaaaggac 13621 gaagatgaca atttaattga ttcttacttt gtagttaaga gacacacttt ctctaactac 13681 caacatgaag aaacaattta taatttactt aaggattgtc cagctgttgc taaacatgac 13741 ttctttaagt ttagaataga cggtgacatg gtaccacata tatcacgtca acgtcttact 13801 aaatacacaa tggcagacct cgtctatgct ttaaggcatt ttgatgaagg taattgtgac 13861 acattaaaag aaatacttgt cacatacaat tgttgtgatg atgattattt caataaaaag 13921 gactggtatg attttgtaga aaacccagat atattacgcg tatacgccaa ettaggtgaa 13981 cgtgtacgcc aagctttgtt aaaaacagta caattctgtg atgccatgcg aaatgctggt 14041 attgttggtg tactgacatt agataatcaa gatctcaatg gtaactggta tgatttcggt 14101 gatttcatac aaaccacgcc aggtagtgga gttcctgttg tagattctta ttattcattg 14161 ttaatgccta tattaacctt gaccagggct ttaactgcag agtcacatgt tgacactgac 14221 ttaacaaagc cttacattaa gtgggatttg ttaaaatatg acttcacgga agagaggtta 14281 aaactctttg accgttattt taaatattgg gatcagacat accacccaaa ttgtgttaac 14341 tgtttggatg acagatgcat tctgcattgt gcaaacttta atgttttatt ctctacagtg 14401 ttcccaccta caagttttgg accactagtg agaaaaatat ttgttgatgg tgttccattt 14461 gtagtttcaa ctggatacca cttcagagag ctaggtgttg tacataatca ggatgtaaac 14521 ttacatagct ctagacttag ttttaaggaa ttacttgtgt atgctgctga ccctgctatg 14581 cacgctgctt ctggtaatct attactagat aaacgcacta cgtgcttttc agtagctgca 14641 cttactaaca atgttgcttt tcaaactgtc aaacccggta attttaacaa agacttctat 14701 gactttgctg tgtctaaggg tttctttaag gaaggaagtt ctgttgaatt aaaacacttc 14761 ttctttgctc aggatggtaa tgctgctatc agcgattatg actactatcg ttataatcta 14821 ccaacaatgt gtgatatcag acaactacta tttgtagttg aagttgttga taagtacttt 14881 gattgttacg atggtggctg tattaatgct aaccaagtca tcgtcaacaa cctagacaaa 14941 tcagctggtt ttccatttaa taaatggggt aaggctagac tttattatga ttcaatgagt 15001 tatgaggatc aagatgcact tttcgcatat acaaaacgta atgtcatccc tactataact 15061 caaatgaatc ttaagtatgc cattagtgca aagaatagag ctcgcaccgt agctggtgtc 15121 tctatctgta gtactatgac caatagacag tttcatcaaa aattattgaa atcaatagcc 15181 gccactagag gagctactgt agtaattgga acaagcaaat tctatggtgg ttggcacaac 15241 atgttaaaaa ctgtttatag tgatgtagaa aaccctcacc ttatgggttg ggattatcct 15301 aaatgtgata gagccatgcc taacatgctt agaattatgg cctcacttgt tcttgctcgc 15361 aaacatacaa cgtgttgtag cttgtcacac cgtttctata gattagctaa tgagtgtgct 15421 caagtattga gtgaaatggt catgtgtggc ggttcactat atgttaaacc aggtggaacc 15481 tcatcaggag atgccacaac tgcttatgct aatagtgttt ttaacatttg tcaagctgtc 15541 acggccaatg ttaatgcact tttatctact gatggtaaca aaattgccga taagtatgtc 15601 cgcaatttac aacacagact ttatgagtgt ctctatagaa atagagatgt tgacacagac 15661 tttgtgaatg agttttacgc atatttgcgt aaacatttct caatgatgat actctctgac 15721 gatgctgttg tgtgtttcaa tagcacttat gcatctcaag gtctagtggc tagcataaag 15781 aactttaagt cagttcttta ttatcaaaac aatgttttta tgtctgaagc aaaatgttgg 15841 actgagactg accttactaa aggacctcat gaattttgct ctcaacatac aatgctagtt 15901 aaacagggtg atgattatgt gtaccttcct tacccagatc catcaagaat cctaggggcc 15961 ggctgttttg tagatgatat cgtaaaaaca gatggtacac ttatgattga acggttcgtg 16021 tctttagcta tagatgctta cccacttact aaacatccta atcaggagta tgctgatgtc 16081 tttcatttgt acttacaata cataagaaag ctacatgatg agttaacagg acacatgtta 16141 gacatgtatt ctgttatgct tactaatgat aacacttcaa ggtattggga acctgagttt 16201 tatgaggcta tgtacacacc gcatacagtc ttacaggctg ttggggcttg tgttctttgc 16261 aattcacaga cttcattaag atgtggtgct tgcatacgta gaccattctt atgttgtaaa 16321 tgctgttacg accatgtcat atcaacatca cataaattag tcttgtctgt taatccgtat 16381 gtttgcaatg ctccaggttg tgatgtcaca gatgtgactc aactttactt aggaggtatg 16441 agctattatt gtaaatcaca taaaccaccc attagttttc cattgtgtgc taatggacaa 16501 gtttttggtt tatataaaaa tacatgtgtt ggtagcgata atgttactga ctttaatgca 16561 attgcaacat gtgactggac aaatgctggt gattacattt tagctaacac ctgtactgaa 16621 agactcaagc tttttgcagc agaaacgctc aaagctactg aggagacatt taaactgtct 16681 tatggtattg ctactgtacg tgaagtgctg tctgacagag aattacatct ttcatgggaa 16741 gttggtaaac ctagaccacc acttaaccga aattatgtct ttactggtta tcgtgtaact 16801 aaaaacagta aagtacaaat aggagagtac acctttgaaa aaggtgacta tggtgatgct 16861 gttgtttacc gaggtacaac aacttacaaa ttaaatgttg gtgattattt tgtgctgaca 16921 tcacatacag taatgccatt aagtgcacct acactagtgc cacaagagca ctatgttaga 16981 attactggct tatacccaac actcaatatc tcagatgagt tttctagcaa tgttgcaaat 17041 tatcaaaagg ttggtatgca aaagtattct acactccagg gaccacctgg tactggtaag 17101 agtcattttg ctattggcct agctctctac tacccttctg ctcgcatagt gtatacagct 17161 tgctctcatg ccgctgttga tgcactatgt gagaaggcat taaaatattt gcctatagat 17221 aaatgtagta gaattatacc tgcacgtgct cgtgtagagt gttttgataa attcaaagtg 17281 aattcaacat tagaacagta tgtcttttgt actgtaaatg cattgcctga gacgacagca 17341 gatatagttg tctttgatga aatttcaatg gccacaaatt atgatttgag tgttgtcaat 17401 gccagattac gtgctaagca ctatgtgtac attggcgacc ctgctcaatt acctgcacca 17461 cgcacattgc taactaaggg cacactagaa ccagaatatt tcaattcagt gtgtagactt 17521 atgaaaacta taggtccaga catgttcctc ggaacttgtc ggcgttgtcc tgctgaaatt 17581 gttgacactg tgagtgcttt ggtttatgat aataagctta aagcacataa agacaaatca 17641 gctcaatgct ttaaaatgtt ttataagggt gttatcacgc atgatgtttc atctgcaatt 17701 aacaggccac aaataggcgt ggtaagagaa ttccttacac gtaaccctgc ttggagaaaa 17761 gctgtcttta tttcacctta taattcacag aatgctgtag cctcaaagat tttgggacta 17821 ccaactcaaa ctgttgattc atcacagggc tcagaatatg actatgtcat attcactcaa 17881 accactgaaa cagctcactc ttgtaatgta aacagattta atgttgctat taccagagca 17941 aaagtaggca tactttgcat aatgtctgat agagaccttt atgacaagtt gcaatttaca 18001 agtcttgaaa ttccacgtag gaatgtggca actttacaag ctgaaaatgt aacaggactc 18061 tttaaagatt gtagtaaggt aatcactggg ttacatccta cacaggcacc tacacacctc 18121 agtgttgaca ctaaattcaa aactgaaggt ttatgtgttg acatacctgg catacctaag 18181 gacatgacct atagaagact catctctatg atgggtttta aaatgaatta tcaagttaat 18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt 18301 ggcttcgatg tcgaggggtg tcatgctact agagaagctg ttggtaccaa tttaccttta 18361 cagctaggtt tttctacagg tgttaaccta gttgctgtac ctacaggtta tgttgataca 18421 cctaataata cagatttttc cagagttagt gctaaaccac cgcctggaga tcaatttaaa 18481 cacctcatac cacttatgta caaaggactt ccttggaatg tagtgcgtat aaagattgta 18541 caaatgttaa gtgacacact taaaaatctc tctgacagag tcgtatttgt cttatgggca 18601 catggctttg agttgacatc tatgaagtat tttgtgaaaa taggacctga gcgcacctgt 18661 tgtctatgtg atagacgtgc cacatgcttt tccactgctt cagacactta tgcctgttgg 18721 catcattcta ttggatttga ttacgtctat aatccgttta tgattgatgt tcaacaatgg 18781 ggttttacag gtaacctaca aagcaaccat gatctgtatt gtcaagtcca tggtaatgca 18841 catgtagcta gttgtgatgc aatcatgact aggtgtctag ctgtccacga gtgctttgtt 18901 aagcgtgttg actggactat tgaatatcct ataattggtg atgaactgaa gattaatgcg 18961 gcttgtagaa aggttcaaca catggttgtt aaagctgcat tattagcaga caaattccca 19021 gttcttcacg acattggtaa ccctaaagct attaagtgtg tacctcaagc tgatgtagaa 19081 tggaagttct atgatgcaca gccttgtagt gacaaagctt ataaaataga agaattattc 19141 tattcttatg ccacacattc tgacaaattc acagatggtg tatgcctatt ttggaattgc 19201 aatgtcgata gatatcctgc taattccatt gtttgtagat ttgacactag agtgctatct 19261 aaccttaact tgcctggttg tgatggtggc agtttgtatg taaataaaca tgcattccac 19321 acaccagctt ttgataaaag tgcttttgtt aatttaaaac aattaccatt tttctattac 19381 tctgacagtc catgtgagtc tcatggaaaa caagtagtgt cagatataga ttatgtacca 19441 ctaaagtctg ctacgtgtat aacacgttgc aatttaggtg gtgctgtctg tagacatcat 19501 gctaatgagt acagattgta tctcgatgct tataacatga tgatctcagc tggctttagc 19561 ttgtgggttt acaaacaatt tgatacttat aacctctgga acacttttac aagacttcag 19621 agtttagaaa atgtggcttt taatgttgta aataagggac actttgatgg acaacagggt 19681 gaagtaccag tttctatcat taataacact gtttacacaa aagttgatgg tgttgatgta 19741 gaattgtttg aaaataaaac aacattacct gttaatgtag catttgagct ttgggctaag 19801 cgcaacatta aaccagtacc agaggtgaaa atactcaata atttgggtgt ggacattgct 19861 gctaatactg tgatctggga ctacaaaaga gatgctccag cacatatatc tactattggt 19921 gtttgttcta tgactgacat agccaagaaa ccaactgaaa cgatttgtgc accactcact 19981 gtcttttttg atggtagagt tgatggtcaa gtagacttat ttagaaatgc ccgtaatggt 20041 gttcttatta cagaaggtag tgttaaaggt ttacaaccat ctgtaggtcc caaacaagct 20101 agtcttaatg gagtcacatt aattggagaa gccgtaaaaa cacagttcaa ttattataag 20161 aaagttgatg gtgttgtcca acaattacct gaaacttact ttactcagag tagaaattta 20221 caagaattta aacccaggag tcaaatggaa attgatttct tagaattagc tatggatgaa 20281 ttcattgaac ggtataaatt agaaggctat gccttcgaac atatcgttta tggagatttt 20341 agtcatagtc agttaggtgg tttacatcta ctgattggac tagctaaacg ttttaaggaa 20401 tcaccttttg aattagaaga ttttattcct atggacagta cagttaaaaa ctatttcata 20461 acagatgcgc aaacaggttc atctaagtgt gtgtgttctg ttattgattt attacttgat 20521 gattttgttg aaataataaa atcccaagat ttatctgtag tttctaaggt tgtcaaagtg 20581 actattgact atacagaaat ttcatttatg ctttggtgta aagatggcca tgtagaaaca 20641 ttttacccaa aattacaatc tagtcaagcg tggcaaccgg gtgttgctat gcctaatctt 20701 tacaaaatgc aaagaatgct attagaaaag tgtgaccttc aaaattatgg tgatagtgca 20761 acattaccta aaggcataat gatgaatgtc gcaaaatata ctcaactgtg tcaatattta 20821 aacacattaa cattagctgt accctataat atgagagtta tacattttgg tgctggttct 20881 gataaaggag ttgcaccagg tacagctgtt ttaagacagt ggttgcctac gggtacgctg 20941 cttgtcgatt cagatcttaa tgactttgtc tctgatgcag attcaacttt gattggtgat 21001 tgtgcaactg tacatacagc taataaatgg gatctcatta ttagtgatat gtacgaccct 21061 aagactaaaa atgttacaaa agaaaatgac tctaaagagg gttttttcac ttacatttgt 21121 gggtttatac aacaaaagct agctcttgga ggttccgtgg ctataaagat aacagaacat 21181 tcttggaatg ctgatcttta taagctcatg ggacacttcg catggtggac agcctttgtt 21241 actaatgtga atgcgtcatc atctgaagca tttttaattg gatgtaatta tcttggcaaa 21301 ccacgcgaac aaatagatgg ttatgtcatg catgcaaatt acatattttg gaggaataca 21361 aatccaattc agttgtcttc ctattcttta tttgacatga gtaaatttcc ccttaaatta 21421 aggggtactg ctgttatgtc tttaaaagaa ggtcaaatca atgatatgat tttatctctt 21481 cttagtaaag gtagacttat aattagagaa aacaacagag ttgttatttc tagtgatgtt 21541 cttgttaaca actaaacgaa caatgtttgt ttttcttgtt ttattgccac tagtctctag 21601 tcagtgtgtt aatcttacaa ccagaactca attaccccct gcatacacta attctttcac 21661 acgtggtgtt tattaccctg acaaagtttt cagatcctca gttttacatt caactcagga 21721 cttgttctta cctttctttt ccaatgttac ttggttccat gctatacatg tctctgggac 21781 caatggtact aagaggtttg ataaccctgt cctaccattt aatgatggtg tttattttgc 21841 ttccactgag aagtctaaca taataagagg ctggattttt ggtactactt tagattcgaa 21901 gacccagtcc ctacttattg ttaataacgc tactaatgtt gttattaaag tctgtgaatt 21961 tcaattttgt aatgatccat ttttgggtgt ttattaccac aaaaacaaca aaagttggat 22021 ggaaagtgag ttcagagttt attctagtgc gaataattgc acttttgaat atgtctctca 22081 gccttttctt atggaccttg aaggaaaaca gggtaatttc aaaaatctta gggaatttgt 22141 gtttaagaat attgatggtt attttaaaat atattctaag cacacgccta ttaatttagt 22201 gcgtgatctc cctcagggtt tttcggcttt agaaccattg gtagatttgc caataggtat 22261 taacatcact aggtttcaaa ctttacttgc tttacataga agttatttga ctcctggtga 22321 ttcttcttca ggttggacag ctggtgctgc agcttattat gtgggttatc ttcaacctag 22381 gacttttcta ttaaaatata atgaaaatgg aaccattaca gatgctgtag actgtgcact 22441 tgaccctctc tcagaaacaa agtgtacgtt gaaatccttc actgtagaaa aaggaatcta 22501 tcaaacttct aactttagag tccaaccaac agaatctatt gttagatttc ctaatattac 22561 aaacttgtgc ccttttggtg aagtttttaa cgccaccaga tttgcatctg tttatgcttg 22621 gaacaggaag agaatcagca actgtgttgc tgattattct gtcctatata attccgcatc 22681 attttccact tttaagtgtt atggagtgtc tcctactaaa ttaaatgatc tctgctttac 22741 taatgtctat gcagattcat ttgtaattag aggtgatgaa gtcagacaaa tcgctccagg 22801 gcaaactgga aagattgctg attataatta taaattacca gatgatttta caggctgcgt 22861 tatagcttgg aattctaaca atcttgattc taaggttggt ggtaattata attacctgta 22921 tagattgttt aggaagtcta atctcaaacc ttttgagaga gatatttcaa ctgaaatcta 22981 tcaggccggt agcacacctt gtaatggtgt tgaaggtttt aattgttact ttcctttaca 23041 atcatatggt ttccaaccca ctaatggtgt tggttaccaa ccatacagag tagtagtact 23101 ttcttttgaa cttctacatg caccagcaac tgtttgtgga cctaaaaagt ctactaattt 23161 ggttaaaaac aaatgtgtca atttcaactt caatggttta acaggcacag gtgttcttac 23221 tgagtctaac aaaaagtttc tgcctttcca acaatttggc agagacattg ctgacactac 23281 tgatgctgtc cgtgatccac agacacttga gattcttgac attacaccat gttcttttgg 23341 tggtgtcagt gttataacac caggaacaaa tacttctaac caggttgctg ttctttatca 23401 ggatgttaac tgcacagaag tccctgttgc tattcatgca gatcaactta ctcctacttg 23461 gcgtgtttat tctacaggtt ctaatgtttt tcaaacacgt gcaggctgtt taataggggc 23521 tgaacatgtc aacaactcat atgagtgtga catacccatt ggtgcaggta tatgcgctag 23581 ttatcagact cagactaatt ctcctcggcg ggcacgtagt gtagctagtc aatccatcat 23641 tgcctacact atgtcacttg gtgcagaaaa ttcagttgct tactctaata actctattgc 23701 catacccaca aattttacta ttagtgttac cacagaaatt ctaccagtgt ctatgaccaa 23761 gacatcagta gattgtacaa tgtacatttg tggtgattca actgaatgca gcaatctttt 23821 gttgcaatat ggcagttttt gtacacaatt aaaccgtgct ttaactggaa tagctgttga 23881 acaagacaaa aacacccaag aagtttttgc acaagtcaaa caaatttaca aaacaccacc 23941 aattaaagat tttggtggtt ttaatttttc acaaatatta ccagatccat caaaaccaag 24001 caagaggtca tttattgaag atctactttt caacaaagtg acacttgcag atgctggctt 24061 catcaaacaa tatggtgatt gccttggtga tattgctgct agagacctca tttgtgcaca 24121 aaagtttaac ggccttactg ttttgccacc tttgctcaca gatgaaatga ttgctcaata 24181 cacttctgca ctgttagcgg gtacaatcac ttctggttgg acctttggtg caggtgctgc 24241 attacaaata ccatttgcta tgcaaatggc ttataggttt aatggtattg gagttacaca 24301 gaatgttctc tatgagaacc aaaaattgat tgccaaccaa tttaatagtg ctattggcaa 24361 aattcaagac tcactttctt ccacagcaag tgcacttgga aaacttcaag atgtggtcaa 24421 ccaaaatgca caagctttaa acacgcttgt taaacaactt agctccaatt ttggtgcaat 24481 ttcaagtgtt ttaaatgata tcctttcacg tcttgacaaa gttgaggctg aagtgcaaat 24541 tgataggttg atcacaggca gacttcaaag tttgcagaca tatgtgactc aacaattaat 24601 tagagctgca gaaatcagag cttctgctaa tcttgctgct actaaaatgt cagagtgtgt 24661 acttggacaa tcaaaaagag ttgatttttg tggaaagggc tatcatctta tgtccttccc 24721 tcagtcagca cctcatggtg tagtcttctt gcatgtgact tatgtccctg cacaagaaaa 24781 gaacttcaca actgctcctg ccatttgtca tgatggaaaa gcacactttc ctcgtgaagg 24841 tgtctttgtt tcaaatggca cacactggtt tgtaacacaa aggaattttt atgaaccaca 24901 aatcattact acagacaaca catttgtgtc tggtaactgt gatgttgtaa taggaattgt 24961 caacaacaca gtttatgatc ctttgcaacc tgaattagac tcattcaagg aggagttaga 25021 taaatatttt aagaatcata catcaccaga tgttgattta ggtgacatct ctggcattaa 25081 tgcttcagtt gtaaacattc aaaaagaaat tgaccgcctc aatgaggttg ccaagaattt 25141 aaatgaatct ctcatcgatc tccaagaact tggaaagtat gagcagtata taaaatggcc 25201 atggtacatt tggctaggtt ttatagctgg cttgattgcc atagtaatgg tgacaattat 25261 gctttgctgt atgaccagtt gctgtagttg tctcaagggc tgttgttctt gtggatcctg 25321 ctgcaaattt gatgaagacg actctgagcc agtgctcaaa ggagtcaaat tacattacac 25381 ataaacgaac ttatggattt gtttatgaga atcttcacaa ttggaactgt aactttgaag 25441 caaggtgaaa tcaaggatgc tactccttca gattttgttc gcgctactgc aacgataccg 25501 atacaagcct cactcccttt cggatggctt attgttggcg ttgcacttct tgctgttttt 25561 cagagcgctt ccaaaatcat aaccctcaaa aagagatggc aactagcact ctccaagggt 25621 gttcactttg tttgcaactt gctgttgttg tttgtaacag tttactcaca ccttttgctc 25681 gttgctgctg gccttgaagc cccttttctc tatctttatg ctttagtcta cttcttgcag 25741 agtataaact ttgtaagaat aataatgagg ctttggcttt gctggaaatg ccgttccaaa 25801 aacccattac tttatgatgc caactatttt ctttgctggc atactaattg ttacgactat 25861 tgtatacctt acaatagtgt aacttcttca attgtcatta cttcaggtga tggcacaaca 25921 agtcctattt ctgaacatga ctaccagatt ggtggttata ctgaaaaatg ggaatctgga 25981 gtaaaagact gtgttgtatt acacagttac ttcacttcag actattacca gctgtactca 26041 actcaattga gtacagacac tggtgttgaa catgttacct tcttcatcta caataaaatt 26101 gttgatgagc ctgaagaaca tgtccaaatt cacacaatcg acggttcatc cggagttgtt 26161 aatccagtaa tggaaccaat ttatgatgaa ccgacgacga ctactagcgt gcctttgtaa 26221 gcacaagctg atgagtacga acttatgtac tcattcgttt cggaagagac aggtacgtta 26281 atagttaata gcgtacttct ttttcttgct ttcgtggtat tcttgctagt tacactagcc 26341 atccttactg cgcttcgatt gtgtgcgtac tgctgcaata ttgttaacgt gagtcttgta 26401 aaaccttctt tttacgttta ctctcgtgtt aaaaatctga attcttctag agttcctgat 26461 cttctggtct aaacgaacta aatattatat tagtttttct gtttggaact ttaattttag 26521 ccatggcaga ttccaacggt actattaccg ttgaagagct taaaaagctc cttgaacaat 26581 ggaacctagt aataggtttc ctattcctta catggatttg tcttctacaa tttgcctatg 26641 ccaacaggaa taggtttttg tatataatta agttaatttt cctctggctg ttatggccag 26701 taactttagc ttgttttgtg cttgctgctg tttacagaat aaattggatc accggtggaa 26761 ttgctatcgc aatggcttgt cttgtaggct tgatgtggct cagctacttc attgcttctt 26821 tcagactgtt tgcgcgtacg cgttccatgt ggtcattcaa tccagaaact aacattcttc 26881 tcaacgtgcc actccatggc actattctga ccagaccgct tctagaaagt gaactcgtaa 26941 tcggagctgt gatccttcgt ggacatcttc gtattgctgg acaccatcta ggacgctgtg 27001 acatcaagga cctgcctaaa gaaatcactg ttgctacatc acgaacgctt tcttattaca 27061 aattgggagc ttcgcagcgt gtagcaggtg actcaggttt tgctgcatac agtcgctaca 27121 ggattggcaa ctataaatta aacacagacc attccagtag cagtgacaat attgctttgc 27181 ttgtacagta agtgacaaca gatgtttcat ctcgttgact ttcaggttac tatagcagag 27241 atattactaa ttattatgag gacttttaaa gtttccattt ggaatcttga ttacatcata 27301 aacctcataa ttaaaaattt atctaagtca ctaactgaga ataaatattc tcaattagat 27361 gaagagcaac caatggagat tgattaaacg aacatgaaaa ttattctttt cttggcactg 27421 ataacactcg ctacttgtga gctttatcac taccaagagt gtgttagagg tacaacagta 27481 cttttaaaag aaccttgctc ttctggaaca tacgagggca attcaccatt tcatcctcta 27541 gctgataaca aatttgcact gacttgcttt agcactcaat ttgcttttgc ttgtcctgac 27601 ggcgtaaaac acgtctatca gttacgtgcc agatcagttt cacctaaact gttcatcaga 27661 caagaggaag ttcaagaact ttactctcca atttttctta ttgttgcggc aatagtgttt 27721 ataacacttt gcttcacact caaaagaaag acagaatgat tgaactttca ttaattgact 27781 tctatttgtg ctttttagcc tttctgctat tccttgtttt aattatgctt attatctttt 27841 ggttctcact tgaactgcaa gatcataatg aaacttgtca cgcctaaacg aacatgaaat 27901 ttcttgtttt cttaggaatc atcacaactg tagctgcatt tcaccaagaa tgtagtttac 27961 agtcatgtac tcaacatcaa ccatatgtag ttgatgaccc gtgtcctatt cacttctatt 28021 ctaaatggta tattagagta ggagctagaa aatcagcacc tttaattgaa ttgtgcgtgg 28081 atgaggctgg ttctaaatca cccattcagt acatcgatat cggtaattat acagtttcct 28141 gtttaccttt tacaattaat tgccaggaac ctaaattggg tagtcttgta gtgcgttgtt 28201 cgttctatga agacttttta gagtatcatg acgttcgtgt tgttttagat ttcatctaaa 28261 cgaacaaact aaaatgtctg ataatggacc ccaaaatcag cgaaatgcac cccgcattac 28321 gtttggtgga ccctcagatt caactggcag taaccagaat ggagaacgca gtggggcgcg 28381 atcaaaacaa cgtcggcccc aaggtttacc caataatact gcgtcttggt tcaccgctct 28441 cactcaacat ggcaaggaag accttaaatt ccctcgagga caaggcgttc caattaacac 28501 caatagcagt ccagatgacc aaattggcta ctaccgaaga gctaccagac gaattcgtgg 28561 tggtgacggt aaaatgaaag atctcagtcc aagatggtat ttctactacc taggaactgg 28621 gccagaagct ggacttccct atggtgctaa caaagacggc atcatatggg ttgcaactga 28681 gggagccttg aatacaccaa aagatcacat tggcacccgc aatcctgcta acaatgctgc 28741 aatcgtgcta caacttcctc aaggaacaac attgccaaaa ggcttctacg cagaagggag 28801 cagaggcggc agtcaagcct cttctcgttc ctcatcacgt agtcgcaaca gttcaagaaa 28861 ttcaactcca ggcagcagta ggggaacttc tcctgctaga atggctggca atggcggtga 28921 tgctgctctt gctttgctgc tgcttgacag attgaaccag cttgagagca aaatgtctgg 28981 taaaggccaa caacaacaag gccaaactgt cactaagaaa tctgctgctg aggcttctaa 29041 gaagcctcgg caaaaacgta ctgccactaa agcatacaat gtaacacaag ctttcggcag 29101 acgtggtcca gaacaaaccc aaggaaattt tggggaccag gaactaatca gacaaggaac 29161 tgattacaaa cattggccgc aaattgcaca atttgccccc agcgcttcag cgttcttcgg 29221 aatgtcgcgc attggcatgg aagtcacacc ttcgggaacg tggttgacct acacaggtgc 29281 catcaaattg gatgacaaag atccaaattt caaagatcaa gtcattttgc tgaataagca 29341 tattgacgca tacaaaacat tcccaccaac agagcctaaa aaggacaaaa agaagaaggc 29401 tgatgaaact caagccttac cgcagagaca gaagaaacag caaactgtga ctcttcttcc 29461 tgctgcagat ttggatgatt tctccaaaca attgcaacaa tccatgagca gtgctgactc 29521 aactcaggcc taaactcatg cagaccacac aaggcagatg ggctatataa acgttttcgc 29581 ttttccgttt acgatatata gtctactctt gtgcagaatg aattctcgta actacatagc 29641 acaagtagat gtagttaact ttaatctcac atagcaatct ttaatcagtg tgtaacatta 29701 gggaggactt gaaagagcca ccacattttc accgaggcca cgcggagtac gatcgagtgt 29761 acagtgaaca atgctaggga gagctgccta tatggaagag ccctaatgtg taaaattaat 29821 tttagtagtg ctatccccat gtgattttaa tagcttctta ggagaatgac aaaaaaaaaa 29881 aaaaaaaaaa aaaaaaaaaa aaa