LUCIFERASE LINKED IMMUNOSORBENT ASSAY

20230145894 · 2023-05-11

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a fusion protein comprising: —a N-terminal domain which comprises an antibody which is a variable domain of a camelid heavy-chain antibody (VHH) or a single chain variable fragment (scFV) and which is directed against an immunoglobulin and —a C-terminal domain which comprises a polypeptide with a luciferase activity: —having the amino acid sequence SEQ ID NO: 1 or —having at least 80% amino acid sequence identity to the amino acid sequence SEQ ID NO: 1.

    Claims

    1. A fusion protein comprising: a N-terminal domain which comprises an antibody which is a variable domain of a camelid heavy-chain antibody (VHH) or a single chain variable fragment (scFV) and which is directed against an immunoglobulin and a C-terminal domain which comprises a polypeptide with a luciferase activity: having the amino acid sequence SEQ ID NO: 1 or having at least 80% amino acid sequence identity to the amino acid sequence SEQ ID NO: 1.

    2. The fusion protein according to claim 1 wherein the polypeptide with a luciferase activity has an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO 17.

    3. The fusion protein according to claim 1 wherein the VHH is directed against the constant fragment (Fc) of the immunoglobulin.

    4. The fusion protein according to claim 1 wherein the antibody is a VHH.

    5. The fusion protein according to claim 1 wherein the immunoglobulin is an IgE directed against an allergen.

    6. The fusion protein according to claim 1 wherein the immunoglobulin is an IgM or an IgG directed against the protein N or S of severe acute respiratory syndrome coronavirus 2.

    7. A kit comprising: the fusion protein according to claim 1 and a substrate for the polypeptide with a luciferase activity.

    8. Use of the fusion protein according to claim 1 for detecting and/or quantifying the immunoglobulin in a sample.

    9. A method for detecting the presence of an immunoglobulin in a sample comprising the steps of: (a) contacting the sample with the fusion protein according to claim 1 (b) adding a substrate for the polypeptide with a luciferase activity, (c) detecting the luminescence.

    10. A method for quantifying the level of an immunoglobulin in a sample comprising the steps of: (a) contacting the sample with the fusion protein according to claim 1, (b) adding a substrate for the polypeptide with a luciferase activity, (c) quantifying the luminescence.

    11. A method for quantifying the level of a immunoglobulin per affinity interval in a sample for evaluating the affinity range of a polyclonal immunoglobulin mixture comprising the steps of: (a) contacting the sample with an antigen in the presence of dilution series of the free antigen, (b) contacting the sample with the fusion protein according to claim 1, (c) adding a substrate for the polypeptide with a luciferase activity and (d) quantifying the luminescence and plot light intensity versus antigen concentration.

    12. A luciferase having at least 80% amino acid sequence identity to the amino acid sequence SEQ ID NO: 1 and comprising at least one amino acid substitution selected from the group consisting of: substitution of the tyrosine (Y) at a position corresponding to the position 18 of SEQ ID NO: 1 with an arginine (R), substitution of the leucine (L) at a position corresponding to the position 48 of SEQ ID NO: 1 with a lysine (K), substitution of the isoleucine (I) at a position corresponding to the position 56 of SEQ ID NO: 1 with an alanine (A), substitution of the tyrosine (Y) at a position corresponding to the position 116 of SEQ ID NO: 1 with a phenylalanine (F), substitution of the tryptophan (W) at a position corresponding to the position 134 of SEQ ID NO: 1 with an amino acid selected from the group consisting of a threonine (T) and glutamate (E), substitution of the tryptophan (W) at a position corresponding to the position 163 of SEQ ID NO: 1 with an amino acid selected from the group consisting of a threonine (T) and glutamate (E), and substitution of the cysteine (C) at a position corresponding to the position 166 of SEQ ID NO: 1 with a serine (S).

    13. A luciferase having an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO 17.

    14. Use of the luciferase according to claim 12 in a luminescence reaction.

    15. A method comprising the steps of: (a) exposing the luciferase according to claim 12 to a substrate and (b) detecting luminescence.

    16. A kit comprising the luciferase according to claim 12 and a substrate for the luciferase.

    17. The kit according to claim 7 wherein the substrate is 8-(2,3-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one.

    Description

    FIGURES

    [0300] FIG. 1 is a cartoon representation showing the anti-IgE nanobody-luciferase tandem (sdAb026-nanoKAZ) bound to the Fc portion of IgE;

    [0301] FIG. 2 shows an analysis using IgE LuLISA of dilution series in PBS of recombinant IgE, IgG1 or IgG4 directed against the house dust mite allergen Der p 2. RLU: relative light unit.

    [0302] FIG. 3 shows an analysis using IgE LuLISA of dilution series in PBS of recombinant human anti-ovalbumin (OVA) IgE.

    [0303] FIG. 4 shows a comparison of sensitivity between IgE LuLISA and IgE ELISA using recombinant anti-ovalbumin (OVA) IgE.

    [0304] FIG. 5 shows a comparison of the dynamic range and sensitivity of IgE LuLISA versus standard ImmunoCAP, using recombinant OVA sIgE.

    [0305] FIG. 6 shows a comparison of the dynamic range and sensitivity of IgE LuLISA versus standard ImmunoCAP, using plasma sample from a highly peanut allergic subject.

    [0306] FIG. 7 shows the influence of the concentration of the anti-IgE nanobody-luciferase fusion protein on bioluminescent detection of IgE by LuLISA. Area in grey shows values obtained at the sdAb026-nanoKAZ concentration used for all other experiments in this study.

    [0307] FIG. 8 shows the detection of peanut sIgE by LuLISA using dilution series of plasma from six peanut allergic subjects were diluted in PBS at the indicated concentration and incubated with plate-bound peanut extract. Bioluminescent detection of peanut sIgE levels was performed by LuLISA. Arrows indicate plasma dilution used in FIG. 9. Grey areas show the linear range of detection of the peanut sIgE LuLISA.

    [0308] FIG. 9 shows measuring sIgE against total peanut extract using 1 μL of plasma from healthy donors and peanut-allergic subjects.

    [0309] FIG. 10 shows measuring sIgE against the peanut allergen Ara h 1 using 1 μL of plasma from healthy donors and peanut-allergic subjects.

    [0310] FIG. 11 shows measuring sIgE against the peanut allergens Ara h 2 using 1 μL of plasma from healthy donors and peanut-allergic subjects.

    [0311] FIG. 12 shows comparison between LuLISA and ImmunoCAP for peanut sIgE in allergic patients.

    [0312] FIG. 13 shows comparison between LuLISA and ImmunoCAP for Ara h 1 sIgE in allergic patients.

    [0313] FIG. 14 shows a comparison between LuLISA and ImmunoCAP for Ara h 2 sIgE in allergic patients.

    [0314] FIG. 15 shows IgE LuLISA on strip (A), a correlation IgE LuLISA on strip vs ImmunoCAP (B), a correlation between IgE LuLISA on strip vs plate (C).

    [0315] FIG. 16 shows a whisker-plot of LuLISA on IgG specific of protein N of SARS-CoV2 (Whiskers min max; boxes: 2nd and 3rd quartiles separated by a median).

    [0316] FIG. 17 shows a whisker-plot of LuLISA on IgG specific of protein S of SARS-CoV2.

    [0317] FIG. 18 shows the correlation between the titration of IgG specific of protein N of SARS-CoV2 versus IgG specific of protein S of SARS-CoV2 in serum from APHP-Cochin (n=20) and EFS (n=4).

    [0318] FIG. 19 shows the correlation between the titration of IgG specific of protein N of SARS-COV1 versus IgG specific of protein N of SARS-CoV2 in serum from APHP-Cochin (n=20) and EFS (n=4).

    [0319] FIG. 20 shows the correlation between the titration of IgG specific of protein S of SARS-CoV1 versus IgG specific of protein S of SARS-CoV2 in serum from APHP-Cochin (n=20) and EFS (n=4).

    [0320] FIG. 21 shows the correlation between the titration of IgG specific of protein N of SARS-CoV2 in the quick test (5 min) versus the routine test (120 min)—mean of the values in duplicate.

    [0321] FIG. 22 is a schema of three embodiments of the method of the invention (immobilization of the antigen on the support by adsorption, covalent linkage, non-covalent linkage).

    EXAMPLES

    Example 1: Mutated Luciferase with Improved Properties

    [0322] NanoKAZ/nanoLuc results of an intensive mutagenesis for optimizing enzyme production and light intensity with the smallest length from the catalytic domain of the luciferase from Oplophorus gracilirostris. However beyond improvement of the catalytic activity of the enzyme, four observations invite finding mutations overcoming 1) enzyme inactivation by reaction products, 2) reaction inhibition by high substrate concentration, 3) low quantum yield of the oxidation reaction, 4) propensity of the enzyme to be adsorbed by material surface (tube, well, membrane . . . ).

    [0323] Material and Methods:

    [0324] nanoKAZ (SEQ NO:1) is an optimized sequence of the catalytic domain of the luciferase from Oplophorus gracilirostris. (WO2012/061530).

    [0325] The gene nanoKAZ (SEQ NO:33 [jaz526]) has been synthetized by Eurofins (Germany) with carboxy-end His6-tag and flanking region corresponding to the pET23 sequence (Novagen). PCR purified pET23 vector and the synthetic gene were assembled according to the Gibson method assembling complementary fragments using the NEBuilder HiFi assembly master mix (New England BioLabs). Single or dual mutations have been introduced by PCR in SEQ ID NO: 2 [jaz544], 3 [jaz583], 4 [jaz584], 5 [jaz560], 6 [jaz585], 7 [jaz619]. The gene of SEQ NO:40 [jaz536]) has been synthetized by Eurofins (Germany) with carboxy-end His6-tag and flanking region corresponding to the pET23 sequence (Novagen). Single or dual mutations SEQ NO 41 [jaz570], 42 [jaz572], 43 [jaz573] have been introduced by PCR. in Multiple mutations have been introduced by the Gibson method assembling complementary fragments of the gene carrying specific mutations using NEBuilder HiFi assembly master mix (New-England Biolabs).

    [0326] Genes SEQ ID NO: 42 [JAZ621] with duplication of SEQ ID NO: 1, SEQ ID NO: 43 [JAZ622] with double substitution of the tyrosine (Y) at a position 116 by a phenylalanine (F) in the duplication of SEQ ID NO: 1, SEQ ID NO: 44 [JAZ476] with triplication of SEQ ID NO: 1, SEQ ID NO: 45 [JAZ620] with triple substitution of the tyrosine (Y) at a position 116 by a phenylalanine (F) in the triplication of SEQ ID NO: 1 and SEQ ID NO: 46 [Scoprii68] substitutions of the tyrosine (Y) at a position 116 by a phenylalanine (F) of Antares sequence encompassing SEQ ID NO: 1 were all synthesized by Eurofins (Germany) with carboxy-end His6-tag and flanking region corresponding to the pET23 sequence (Novagen).

    [0327] The products (5 mL) were used to transform NEB 5-alpha competent E. coli and grown overnight on LB/Agar/ampicillin in Petri dish. Isolated colonies were grown in liquid medium, plasmids were isolated and nucleotide sequence was performed to confirm the presence of the mutations at the correct positions.

    [0328] Results:

    [0329] The mutation of the residue tyrosine at position 116 by a phenylalanine (SEQ ID NO: 2 [JAZ544]) increased by 250% the catalytic activity of the nanoKAZ with the furimazine and 1400% with Q108 by reference with nanoKAZ/furimazine. Duplication (SEQ ID NO: 45) or triplication of the mutated catalytic domain (SEQ ID NO: 45) increase the catalytic activity by 2600% and 3500% respectively. Substrate diffusion rate is limiting the 2- or 3-fold expected improvement of the activity of the single domain (1400%). We have shown that luciferase activity is decreasing with time with a rate depending on the substrate nature (Coutant et al 1999). Decreasing activity is fast with Q80 and slow with Q103. Unfortunately, higher is the light emission, fastest is the enzyme inactivation. There is a compromise between light intensity (flash) or long (glow) lifetime. We have shown that decreasing is due to the enzyme inactivation. Mutation of cysteine 166 by a residue serine (SEQ ID NO: 7 [JAZ619]) reduces the rate of inactivation.

    [0330] Mutation of tryptophan at position 134 by a threonine (SEQ ID NO: 3 [JAZ583]) in the vicinity of the hydrophobic back pocket mildly reduces the inhibition by high concentration of substrate. We counted 1 photon every 1460 molecules of furimazine catalyzed by a molecule of nanoKAZ (SEQ ID NO: 1) at room temperature at furimazine concentration at the maximal reaction rate (54 microM). The choice of substrate modulate this quantum yield from very low to moderate. Lower is the substrate concentration, higher is the quantum yield but unfortunately lower is the reaction rate and lower is the photon emission. Mutation of the residue tyrosine at position 116 by a phenylalanine (SEQ ID NO: 2 [JAZ544]) improves moderately the photon emission count. Mutations of tryptophans at position 134 (SEQ ID NO: 3 [JAZ583]) and 163 (SEQ ID NO: 4 [JAZ584]) pointing out at the protein surface, are the most effective for improving the solubility of the enzyme and reducing surface adsorption affecting assays with higher noise.

    [0331] Combination of mutations is giving improved properties in terms of light intensity, lifetime, and solubility. Best compromises are selected according to the specific properties required by the application: light intensity/expected sensibility, lifetime/experiment duration, solubility/experimental conditions. [0332] SEQ ID NO: 1 [nanoKAZ, JAZ526] Catalytic activity 100% with furimazine, 250% with Q108. [0333] SEQ ID NO: 2 [JAZ544] substitution of the tyrosine (Y) at position 116 of SEQ ID NO: 1. Catalytic activity 200% of SEQ ID NO: 1 with furimazine, 1450% with Q108. [0334] SEQ ID NO: 3 [JAZ583] substitution of the tryptophan (W) at position position 134 of SEQ ID NO: 1 by a threonine (T). Catalytic activity 100% of SEQ ID NO: 1 with furimazine [0335] SEQ ID NO: 4 [JAZ584] substitution of the tryptophan (W) at position 163 of SEQ ID NO: 1 by a threonine (T). Catalytic activity 50% of SEQ ID NO: 1 with furimazine. [0336] SEQ ID NO: 5 [JAZ560] substitution of the isoleucine (I) at position 56 of SEQ ID NO: 1 by an alanine (A). Catalytic activity of 120% SEQ ID NO: 1 with furimazine, 600% with Q108. [0337] SEQ ID NO: 6 [JAZ585] substitutions of the tyrosine (Y) at position 116 by a phenylalanine (F) and the tryptophan (W) at position 134 by a threonine (T) of SEQ ID NO: 1. Catalytic activity 200% of SEQ ID NO: 1 with furimazine, 1400% with Q108. [0338] SEQ ID NO: 7 [JAZ619] substitutions of the tyrosine (Y) at position 116 by a phenylalanine (F) and the cysteine (C) at position 166 by a serine (S) of SEQ ID NO: 1. Catalytic activity 200% of SEQ ID NO: 1 with furimazine. [0339] SEQ ID NO: 8 [JAZ536] substitutions of the tyrosine (Y) at position 18 by an arginine (R), the leucine (L) at position 48 by a lysine (K), the tryptophan (W) at position 134 by a glutamate (E) and the tryptophan 163 (W) at position 163 by a glutamate (R) of SEQ ID NO: 1. Catalytic activity 80% of SEQ ID NO: 1 with furimazine. [0340] SEQ ID NO: 9 [JAZ570] substitutions of the tyrosine (Y) at position 18 by an arginine (R), the leucine (L) at position 48 by a lysine (K), the tryptophan (W) at position 134 by a glutamate (E), the tryptophan 163 (W) at position 163 by a glutamate (E), and the cysteine (C) at position 166 by a serine (S) of SEQ ID NO: 1. Catalytic activity 150% of SEQ ID NO: 1 with furimazine. [0341] SEQ ID NO: 10 [JAZ572] substitutions of the tyrosine (Y) at position 18 by an arginine (R), the leucine (L) at position 48 by a lysine (K), the tryptophan (W) at position 134 by a glutamate (E), the tryptophan 163 (W) at position 163 by a glutamate (E), and the tyrosine (Y) at a position 116 by a phenylalanine (F) of SEQ ID NO: 1. Catalytic activity of 180% SEQ ID NO: 1 with furimazine. [0342] SEQ ID NO: 11 [JAZ573] substitutions of the tyrosine (Y) at position 18 by an arginine (R), the leucine (L) at position 48 by a lysine (K), the tryptophan (W) at position 134 by a glutamate (E), the tryptophan (W) at position 163 by a glutamate (E), the tyrosine (Y) at a position 116 by a phenylalanine (F) and the cysteine (C) at a position 166 by a serine (S) of SEQ ID NO: 1. Catalytic activity 150% of SEQ ID NO: 1 with furimazine.

    [0343] Several sequences allow an increased signal by duplication or triplication of the catalytic domain. They are mainly used for in vitro or in vivo imaging application requiring light intensity for live imaging, fast kinetics or deep tissue observation. For diagnosis their application in assays are not useful as they increase the signal and the noise. Noticeably diffusion rate of substrate to active site are limiting activity if the substrate concentration is low. [0344] SEQ ID NO: 42 [JAZ621] duplication of SEQ ID NO: 1. Catalytic activity 150% of SEQ ID NO: 1 with furimazine. [0345] SEQ ID NO: 43 [JAZ622] double substitution of the tyrosine (Y) at a position 116 by a phenylalanine (F) in the duplication of SEQ ID NO: 1. Catalytic activity 560% of SEQ ID NO: 1 with furimazine, 2600% with Q108. [0346] SEQ ID NO: 44 [JAZ476] triplication of SEQ ID NO: 1. Catalytic activity 250% of SEQ ID NO: 1 with furimazine. [0347] SEQ ID NO: 45 [JAZ620] triple substitution of the tyrosine (Y) at a position 116 by a phenylalanine (F) in the triplication of SEQ ID NO: 1. Catalytic activity 2500% of SEQ ID NO: 1 with furimazine, 3500% with Q108.

    [0348] Two color applications with a single substrate but two luciferases as reporter can be performed by using one of sequences from 1 to 15 and the Antares or Scorpii (SEQ NO: 48) which emits redshifted photons through energy resonance transfer from the nanoKAZ to the mOrange derived from Discosoma sp. red fluorescent protein (Shaner Nc, Campbell Re, Steinbach Pa, Giepmans Bng, Palmer Ae, Tsien Ry (2004). Nature Biotechnology, 22(12), 1567-1572). [0349] SEQ ID NO: 46 [Scorpii68] substitutions of the tyrosine (Y) at a position 116 by a phenylalanine (F) of SEQ ID NO: 1 in the Antares chimera (Chu J, Oh Y, Sens A, Ataie N, Dana H, Macklin J J, Laviv T, Welf E S, Dean K M, Zhang F, Kim B B, Tang C T, Hu M, Baird M A, Davidson M W, Kay M A, Fiolka R, Yasuda R, Kim D S, Ng H L, Lin M Z. Nat Biotechnol. 2016 July; 34(7):760-7). Activity is 800% with Q108 but at 562 nm whereas nanoKAZ emits photons at 460 nm. Beyond two colors applications with a single substrate, Scorpii used as reporter is efficient for in vivo imaging with redshifted light going through thicker tissues.

    Example 2: Bioluminescent Method for Measuring Allergen-Specific IgE

    [0350] Materials and Method

    [0351] Human Plasma

    [0352] Plasma samples from patients with peanut allergy were obtained as part of their enrolment into an institutional review board—approved clinical trial of oral immunotherapy in children and adults with peanut allergy (peanut oral immunotherapy study: safety, efficacy and discovery; ClinicalTrials.gov Identifier: NCT02103270, US). Peanut allergy was defined as having a reaction to a double-blind, placebo-controlled food challenge to peanut (with reactions elicited with 500 mg of peanut protein) and a positive skin prick test response to peanut (wheal 5 mm). Plasma samples from healthy donors were obtained from the French blood bank (Etablissement Francais du Sang, EFS).

    [0353] Fusion Protein Anti-IgE sdAb026-nanoKAZ

    [0354] Design and Synthesis of Plasmid Encoding the Anti-IgE Nanobody-Luciferase Fusion Protein (pET23-sdAb026-Nanokaz)

    [0355] nanoKAZ is an optimized sequence of the catalytic domain of the luciferase from Oplophorus gracilirostris (WO2012/061530).

    [0356] The gene nanoKAZ has been synthetized by Eurofins (Germany) with carboxy-end

    [0357] His6-tag and flanking region corresponding to the pET23 sequence (Novagen). pET23 plasmid has been amplified with the forward and reverse oligonucleotides (Fwd:5′CTCGAGCACCACCACCACCACCAC3′ (SEQ ID NO: 47); Rvr:5′GGTATATCTCCTTCTTAAAGTTAAAC3′ (SEQ ID NO: 48), Eurofins) using a Q5 DNA polymerase, dNTP mix (New England BioLabs). PCR product was purified by electrophoresis on agarose gel (1%, Macherey Nagel). Purified pET23 vector and the synthetic gene were assembly (pET23-nanoKAZ) using NEBuilder HiFi assembly master mix (New England BioLabs).

    [0358] The slgE—binding moiety is issued from a humanized heavy chain antibody of alpaca selected against sIgE (single-domain antibody, sdAb026) (Jabs F, Plum M, Laursen N S, Jensen R K, Molgaard B, Miehe M, et al. Trapping IgE in a closed conformation by mimicking CD23 binding prevents and disrupts FcepsilonRI interaction. Nat Commun 2018; 9:7, WO2014/087010 A1). sdAb026 recognizes the constant Cc3 region of human IgE. sdAb026 has an affinity for IgE similar to that of the therapeutic anti-IgE antibody omalizumab (KD 1.4 nM vs. 2.6 nM, respectively3,5), and was reported to inhibit interactions between IgE and the two receptors FcεRI and CD23.

    [0359] The gene sdab026 has been synthetized by Eurofins with flanking regions corresponding to the pET23-nanoKAZ sequence. Synthetic gene sdab026 has been amplified with the corresponding forward and reverse oligonucleotides (Fwd: 5′ATGGTCTTCACACTCGAAGATTTC3′ (SEQ ID NO: 49); Rvr: 5′CATGGTATATCTCCTTCTTAAAGTTAAA3′(SEQ ID NO: 50); Eurofins) using a Q5 DNA polymerase and dNTP mix.

    [0360] PCR products were purified by electrophoresis on agarose gel. Purified pET23-nanoKAZ vector and the synthetic gene sdAb026 were assembled using NEBuilder HiFi assembly master mix (New-England Biolabs).

    [0361] The assembled products (5 mL) were used to transform NEB 5-alpha competent E. coli and grown overnight on LB/Agar/ampicillin in Petri dish. Isolated colonies were grown in liquid medium, plasmids were isolated and nucleotide sequence was performed to confirm the presence of the sdabs026-nanoKAZ insert.

    [0362] The full sequence of anti-IgE nanobody luciferase tandem sdAb026-nanoKAZ ([nanobody anti-IgE]-[nanoKAZ]-[His6]) is shown in the table below:

    TABLE-US-00008 Nucleotide ATGGCGGAGGTCCAGTTGCT sequence of TGAGAGTGGTGGGGGTCTTG sdAb026- TTCAGCCAGGGGGCTCCCTT nanoKAZ CGTCTTAGTTGTGCCGCATC (SEQ CGGTTTCACATTCGGCAATT ID NO: 51) ACGACATGGCGTGGGTCCGA sdAb026 in CAAGCTCCCGGCAAACGCCC underlined TGAGTGGGTATCGTCTATTG nanoKAZ ATACGGGGGGAGATATAACA in bold CACTACGCAGACAGTGTGAA GGGGAGGTTCACAATCTCTC GGGACAACGCAAAGAACACC TTATACTTGCAGATGAATAG CCTGAGACCGGAGGACACTG CTGTGTATTGGTGCGCTACC GATGAAGAATATGCCCTCGG CCCAAACGAATTTGATTATT ACGGACAGGGAACTCTGGTG ACTGTGTCATCAGCTGCCGC CCTGGAGATGGTCTTCACAC TCGAAGATTTCGTTGGGGAC TGGCGACAGACAGCCGGCTA CAACCTGGACCAAGTCCTTG AACAGGGAGGTGTGTCCAGT TTGTTTCAGAATCTCGGGGT GTCCGTAACTCCGATCCAAA GGATTGTCCTGAGCGGTGAA AATGGGCTGAAGATCGACAT CCATGTCATCATCCCGTATG AAGGTCTGAGCGGCGACCAA ATGGGCCAGATCGAAAAAAT TTTTAAGGTGGTGTACCCTG TGGATGATCATCACTTTAAG GTGATCCTGCACTATGGCAC ACTGGTAATCGACGGGGTTA CGCCGAACATGATCGACTAT TTCGGACGGCCGTATGAAGG CATCGCCGTGTTCGACGGCA AAAAGATCACTGTAACAGGG ACCCTGTGGAACGGCAACAA AATTATCGACGAGCGCCTGA TCAACCCCGACGGCTCCCTG CTGTTCCGAGTAACCATCAA CGGAGTGACCGGCTGGCGGC TGTGCGAACGCATTCTGGCG CTCGAGCACCACCACCACCA CCAC TGA Amino acid MAEVQLLESGGGLVQPGGSL sequence of RLSCAASGFTFGNYDMAWVR sdAb026- QAPGKRPEWVSSIDTGGDIT nanoKAZ (SEQ HYADSVKGRFTISRDNAKNT ID NO: 52) LYLQMNSLRPEDTAVYWCAT sdAb026 DEEYALGPNEFDYYGQGTLV underlined TVSSAAALEMVFTLEDFVGD nanoKAZ in WRQTAGYNLDQVLEQGGVSS bold LFQNLGVSVTPIQRIVLSGE NGLKIDIHVIIPYEGLSGDQ MGQIEKIFKVVYPVDDHHFK VILHYGTLVIDGVTPNMIDY FGRPYEGIAVFDGKKITVTG TLWNGNKIIDERLINPDGSL LFRVTINGVTGWRLCERILA LEHHHHHH

    [0363] The estimated molecular weight (MW) of sdAb026-nanoKAZ calculated from sequence is 34.1 kD.

    [0364] Expression, Purification and Validation of Anti-IgE Nanobody-Luciferase Fusion Protein (sdAb026-nanoKAZ)

    [0365] pET23-sdab026-nanokaz was used to transform E. coli BL21 (DE3, New-England Biolabs) to achieve high expression in E. coli. Cells were grown at 18° C. and IPTG (Sigma-Aldrich) was added to induce sdAb026-nanoKAZ production. After harvesting the cells by centrifugation (1.5 L), the pellet was resuspended in 50 mM Tris-HCl pH 8.0, 50 mM NaCl with protease inhibitor (Sigma-Aldrich) and lysozyme (0.1 mg/mL, Sigma-Aldrich). Cells were disrupted by freezing-thawing cycle lysis method. DNase I (Sigma-Aldrich) was then added to remove DNA from the sample.

    [0366] The crude extract was centrifuged 30 min at 1250 g. The supernatant was collected and NaCl (500 mM), Imidazole (20 mM, Sigma-Aldrich) and Triton X-100 (0.1%, Sigma-Aldrich) were added. The cleared lysate was loaded on an equilibrated Hi-Trap 5 mL-column (GE-Healthcare) at 4 mL/min using an AKTA pure chromatography system (GE-Healthcare). The column was washed with 20 volumes of column with a running buffer (50 mM Tris-HCl pH 8.0, NaCl 50 mM, 20 mM imidazole) at 5 mL/min. The sdAb026-nanoKAZ was eluted with a gradient of imidazole from 20 mM to 200 mM in 50 mM Tris-HCl pH 8.0, 50 mM NaCl at 5 mL/min and fractions of 1 mL were collected in 96-deepwell plate (GE-Healthcare). Catalytic activity of fractions was profiled using a luminometer Hydex by diluting 107 fold the fraction in PBS with 27 μM of furimazine. The fractions of high activity were pooled, and loaded on a 1 mL HiTrap Q column (GE-Healthcare) equilibrated in 50 mM Tris-HCl pH 8.0, NaCl 50 mM. The protein was eluted in 50 mM MES pH 6.5, 50 mM NaCl at 1 mL/min at 18° C. using the AKTA pure chromatography system. The fractions of 500 μL were collected in 96-deepwell plate and their activities were assayed as described above. The fractions of high activity were pooled. The quality of the purified protein was assessed by loading an aliquot (10 μL) on a stain-free SDS gel (4-15% Mini-PROTEAN® TGX Stain-Free™ Protein Gels, Bio-Rad).

    [0367] The gel was activated by UV trans-illumination for 5 min (Bio-Gel Doc XR Imaging System). Tryptophan residues undergo an UV-induced reaction with trihalo compounds and produce a fluorescence signal imaged. An UV-spectrum (240-300 nm) was acquired for evaluating the concentration of sdAb026-nanoKAZ from the solution absorption at 280 nm. The specific activity is about 10.sup.15 acquired photons/second/mg of sdAb026-nanoKAZ with furimazine in PBS at 23° C. The optimal activity is reached for a substrate (furimazine) concentration from 10 to 30 μM (plateau at about 10 times the KM=2 μM). Beyond 30 μM the dipolar moments of the substrates out of the nanoKAZ catalytic site are quenching the photon emission of the catalyzed substrate in the active site. Quenching efficiency depends on dipolar moment of substrates. Substrate catalysis inactivates stochastically the nanoKAZ and the life time of enzyme depends on substrates and catalysis rate. Light emission intensity has been optimized by using optimal conditions according to kinetics parameters according to specific substrates from a thorough enzymatic study of nanoKAZ and its 30 mutants and the catalysis of 172 distinct substrates.

    [0368] IgE Luciferase Immunosorbent Assay (Lu LISA) Protocol

    [0369] White 96-well plates with flat bottom (Fluoronunc C96 Maxisorp, Nunc) were coated by adsorption with either 10 μg/mL of peanut extract (F171, Greer laboratories), 10 μg/mL of Ara H1 (NA-AH1-1, Indoor Technology), 10 μg/mL of Ara H2 (RP-AH2-1, Indoor Technology), 5 μg/mL of ovalbumin (OVA, Sigma-Aldrich) or 1 μg/mL of dust mite DER p2 (2B12NA-DP2-1, Indoor Technology) in 50 μL/well of NaHCO.sub.3 50 mM buffer pH 9.5 (Sigma) for 2 hours at room temperature. Target immobilization is the main factor of success or failure of the method as the maximum of target should be immobilized while presenting the allergenic domain accessible to sIgE for binding. Adsorption on Maxisorp® plates favours charge interaction. Alternatives to adsorption are covalent binding of targets through carboxylic, amine or sulfhydryl moieties or glycosylation at the functionalized well surface. Wells were emptied and the coating was saturated with bovine serum albumin (Sigma) at 100 μg/mL in NaHCO.sub.3 for 1 hour at room temperature. Wells were washed four times with 100 μL of PBS/Tween 20 0.1%. Recombinant anti-OVA human chimeric IgE (clone X4A4D12/G9/H8, a kind gift from Arkab), anti-dust mite p2 human chimeric IgE (clone CH1, a kind gift from Arkab), or plasma from peanut allergic subjects were diluted in PBS or in a pool of plasma from healthy donors, as indicated. Sample dilutions were incubated 1 hour at room temperature in their respective allergen-coated wells, 50 μL/well. Wells were washed four times with 100 μL PBS/Tween 20 0.1%. Purified sdAb026-nanoKAZ 1 ng/mL (1.Math.10.sup.9 RLU.Math.s.sup.−1.Math.mL.sup.−1) in PBS was loaded (50 μL/well) and incubated 30 min at room temperature. Wells were washed four times with 100 μL of PBS/Tween 20 0.1%. Plates can be stored at this step in PBS until measurements. Just before reading, each wells were emptied and loaded with 50 μL of furimazine (8-benzyl-2-(furan ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one) at 27 μM (about 10 times the KM of nanoKAZ, 2 μM). The plate was orbitally shaked for 5 seconds and the light emission intensity was integrated 1 sec per well using a multi-well plate luminometer (LB960 Centro, Berthold).

    [0370] For processing an affinity spectra from LuLISA competition assay, mixtures of the same concentration of serum or plasma sample, 0.5 μL in 50 μL, with 3 by 3 dilution series of the free allergen from 10 μM to 0.7 μM in PBS along 16 allergen-coated wells of a 384-well plate or with 10 by 10 dilution series of the free allergen from 10 μM to 1 μM along 8 allergen-coated wells of a 96-well plate. Values should be adapted to IgE affinities. 1 to 3 hours of incubation for reaching equilibrium or at the nearest. Wells were washed four times with 100 μL PBS/Tween 20 0.1%. Purified sdAb026-JAZ572 (1 ng/mL) is preferred to sdAb026-nanoKAZ for higher signal and lower background especially for high concentration of free allergen while IgE binding to immobilized allergen is low in so long incubation time. Eventually Tween 20 0.1%, BSA 0.1 mg/mL, or gelatine 0.1 mg/mL might be used for reducing background. Milk should be avoided for IgE assays in potentially allergic patients. Wells were washed four times with 100 μL PBS/Tween 20 0.1%. Just before reading, each wells were emptied and loaded with 50 μL of hikazine-108 (8-benzyl-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one) at 13.5 μM. The plate was orbitally shaked for 1 seconds and the light emission intensity was integrated 0.5 sec per well using a multi-well plate luminometer (LB960 Centro, Berthold). Bioluminescence intensity is displayed versus target concentration as a bar graph.

    [0371] IgE Immunocap

    [0372] ImmunoCAP analysis was performed on shipped samples by Phadia, Thermo Fisher.

    [0373] IgE ELISA Protocol

    [0374] Clear, flat bottom 96- or 384-well plates (Maxisorp, Nunc) were coated as described above, 2 hours at room temperature. Wells were emptied and the coating was saturated with 50 μL of bovine serum albumin (Sigma) at 100 μg/mL in PBS for 1 hour at room temperature. Wells were washed four times with 100 μL of PBS/Tween 20 0.1% (Sigma). Recombinant anti-OVA human chimeric IgE (clone X4A4D12/G9/H8, a kind gift from Arkab), anti-dust mite p2 human chimeric IgE (clone CH1, a kind gift from Arkab), or plasma from peanut allergic subjects were diluted in PBS and incubated 1 hour at room temperature in their respective allergen-coated wells, 50 mL/well. Wells were washed four times with 100 μL of PBS/Tween 20 0.1%. 50 μL of goat IgG anti-human IgE conjugated with alkaline phosphatase diluted (1:700 in PBS, Sigma-Aldrich) were loaded in each well and incubated 1 hour at room temperature. Wells were washed four times with 100 μL of PBS/Tween 20 0.1%. All wells were emptied, 50 μL of phosphatase substrate pNPP 1 mg/mL (4-Nitrophenyl phosphate disodium salt, Sigma-Aldrich) were added per well, incubated 3 hours at room temperature or overnight at 4° C. Absorbance was measured at 405 nm with a multi-well plate spectrophotometer (Sapphire, Tecan) and compared with LuLISA results.

    [0375] Statistical Analysis

    [0376] Differences in IgE levels between plasma samples from healthy donors and peanut allergic subjects were compared using an unpaired Mann-Whitney U test. P values <0.05 are considered statistically significant.

    [0377] Blood Samples from Fingertip

    [0378] Tests have been performed with a healthy volunteer to set up a project application for blood sampling from a reduced cohort of allergic patients at the Trousseau Hospital for an IgE LuLISA assay in parallel with ImmunoCAP and ELISA.

    [0379] The tests have been performed after decontamination of the fingertip with alcohol using a lancing device with sterile disposable lancets usually performed for glucose assay for diabetic patient auto-survey. One μL is pipetted and mixed to 50 μL of a solution of PBS, BSA (50 μg/mL), heparin (10 Ul/mL), sdAb026-nanoKAZ (1 ng) preloaded inside a 1000 μL tip (single use) ended by a paper filter framed by to polyethylene filter plugs. The diluted blood is filtered through the tip end and loaded in a 96-well plate pre-coated with the specific allergen and incubated at room temperature for 5 min. The well is washed with PBS and 100 μL of luciferase substrate (furimazine analogs) is added and bioluminescence is immediately measured during 1 second using a plate-luminometer (LB960 centro, Berthold). Measurements are performed in parallel with negative and positive controls for internal calibration.

    [0380] Results

    [0381] Sensitive and Specific Detection of Allergen-Specific IgE by Luciferase-Linked Immunosorbent Assay (LuLISA)

    [0382] To establish a proof-of-concept for the specific detection of sIgE using LuLISA, dilution series in PBS of recombinant IgE, IgG1 (the major IgG subclass) or IgG4 (the main IgG subclass overproduced during allergen-specific immunotherapy) directed against the house dust mite allergen Der p 2 were prepared. The 3 groups of samples were analyzed using IgE LuLISA.

    [0383] As expected, a concentration-dependent signal arose only for the sample containing anti-Der p 2 sIgE, with a detection limit of ˜5×10.sup.−13 M sIgE (˜1 pg/mL; ˜0.0004 kUA/L) (FIG. 2).

    [0384] A similar experiment was performed on recombinant human anti-ovalbumin IgE. Recombinant human anti-ovalbumin (OVA) IgE were diluted in PBS at the indicated concentration and incubated with plate-bound OVA. Bioluminescent detection of antibody levels was performed by LuLISA using the anti-IgE sdAb026-nanoKAZ.

    [0385] It was also obtained high sensitivity with recombinant anti-ovalbumin (OVA) IgE, which was detectable by LuLISA at concentrations as low as 5 pg/mL (0.002 kUA/L) (FIGS. 3 and 4).

    [0386] Recombinant anti-ovalbumin (OVA) IgE was diluted in PBS at the indicated concentrations. Levels of OVA sIgE were assessed in aliquots from the same dilution sample using LuLISA or ELISA. The sensitivity of LuLISA was also much higher than that of standard ELISA for the detection of sIgE (FIG. 4).

    [0387] Next, it was compared the dynamic range and sensitivity of IgE LuLISA versus standard ImmunoCAP, using recombinant OVA sIgE diluted in plasma pooled from 30 healthy donors (FIG. 5). This head-to-head comparison revealed a markedly increased (˜250-fold) analytical sensitivity of LuLISA compared with ImmunoCAP (FIG. 5).

    [0388] It was performed similar experiments with dilution series of a plasma sample from a highly peanut allergic subject, which was again diluted in a pool of plasma from 30 healthy donors (FIG. 6). ImmunoCAP allowed detection of peanut sIgE in plasma diluted up to 4,050 times, while peanut sIgE was still detected by LuLISA in allergic plasma diluted 100,000 to 300,000 times (FIG. 6).

    [0389] It was then studied the influence of the concentration of the anti-IgE nanobody-luciferase fusion protein on bioluminescent detection of IgE by Lu LISA. 1 μL of plasma from a peanut allergic subjects (peanut-specific IgE ImmunoCAP values: 2186 kU/L) was diluted in 50 μL of PBS and incubated with plate-bound peanut extract (PBS alone was used as a control). Bioluminescent detection of peanut-specific IgE levels was performed by LuLISA at the indicated concentration of anti-IgE nanobody-luciferase tandem (sdAb026-nanoKAZ). Dilution series of the anti-IgE nanobody-luciferase fusion protein gave a concentration-dependent signal at a fixed (1:50) dilution of this peanut allergic plasma sample, and confirmed the very low bioluminescent background signal of the IgE LuLISA (FIG. 7).

    [0390] Altogether, these results indicate that the IgE LuLISA has a very high sensitivity and specificity, and could thus potentially be used to quantify IgE in samples from patients with very low sIgE. The main advantage of the IgE LuLISA over ImmunoCAP is that it requires extremely low volume of sample. In the case of the sample from the peanut-allergic patient used in FIG. 6, peanut sIgE could still be detected using less than 1 nanoliter of the initial patient's sample. Thus, very large screens of sIgE against arrays of potential allergens can be envisioned using IgE LuLISA, even when patient's sample sizes are limited.

    [0391] It was then sought to further validate this approach by measuring sIgE against total peanut extract, or against the major peanut allergens Ara h 1 and Ara h 2 using 1 μL of plasma from 31 healthy donors (obtained from the French blood bank EFS with unknown allergic status) and 82-105 peanut-allergic subjects (collected upon their enrolment into the institutional review board—approved peanut oral immunotherapy study: safety, efficacy and discovery trial; ClinicalTrials.gov identifier: NCT02103270). Dilution series from reference samples with titrated high peanut sIgE were used for assay calibration, to ensure that all plasma samples were analysed within the linear range of detection of our method (FIG. 8).

    [0392] As expected, significantly higher levels of peanut sIgE, Ara h 1 sIgE and Ara h 2 sIgE were detected in plasma samples from peanut allergic subjects as compared to healthy donors (FIGS. 9, 10 and 11).

    [0393] Head-to-head comparison between LuLISA and ImmunoCAP in allergic patients showed a high correlation between both methods (R.sup.2=0.89, 0.84 and 0.83 for peanut sIgE, Ara h 1 sIgE and Ara h 2 sIgE, respectively) (FIGS. 12, 13 and 14). These correlations were calculated using all plasma samples for which sIgE levels were above the detection cut-off of ImmunoCAP (0.1 kUA/L). This was the case for all samples for peanut sIgE. However, 17 out of 82 samples (19.7%) for Ara h 1 sIgE and 3 out of 96 samples (3.1%) for Ara h 2 sIgE were below the detection limit of ImmunoCAP (FIGS. 12, 13 and 14). However, all these subjects had clear clinical reactivity to peanut, as assessed by performing double-blind, placebo-controlled food challenge (DBPCFC) and skin prick tests (Table 4).

    TABLE-US-00009 TABLE 4 Peanut DBCFC ImmunoCAP cumulated Skin prick ImmunoCAP peanut ImmunoCAP ImmunoCAP Patient's tolerated test peanut wheal Total IgE specific IgE Ara h 1 Ara h 2 ID dose (mg) diameter (mm) (IUA/L) (IUA/L) sIgE (IUA/L) sIgE (IUA/L) P003 75 7.5 985 4.27 <0.1 2.72 P004 175 15.5 470 3.82 <0.1 3.63 P006 375 19 243 7.67 <0.1 5.25 P013 275 8.5 274 30.4 <0.1 0.37 P025 75 20 410 4.18 <0.1 3.03 P030 275 8.5 35 6.49 <0.1 3.54 P033 375 4 550 1.65 <0.1 <0.1 P055 25 11 333 3.58 <0.1 1.54 P059 5 16.5 449 1.46 <0.1 1.29 P060 75 8 240 0.41 <0.1 0.2 P067 5 10.5 73 0.79 0.5 <0.1 P070 5 19.5 443 13.6 <0.1 10.3 P085 25 12 316 2.89 <0.1 1.71 P097 5 14.5 281 5.43 <0.1 1.72 P102 5 5 87 0.62 <0.1 <0.1 P103 5 17.5 102 0.95 <0.1 0.79 P109 0 6 242 25 <0.1 0.24 P111 0 23 1529 1.1 <0.1 1.25

    [0394] Altogether, these results demonstrate that the IgE LuLISA is highly sensitive and accurate for the clinical detection of sIgE, and requires very low volumes of plasma.

    [0395] Besides ImmunoCAP, several other methods have been reported for the detection of sIgE, including IMMULITE and, more recently, isotype-specific agglutination-PCR (ISAP) (Hamilton R G et al. 2008, Tsai C T et al., 2018). IMMULITE appears to be the closest method to LuLISA as it uses a chemiluminescent approach to detect sIgE. However, the reported detection limit for sIgE with IMMULITE is the same as for ImmunoCAP (0.1 kUA/L). Similarly to LuLISA, detection of sIgE by ISAP can be performed using 1 μl of clinical sample. However, the two tests are based on different approaches as ISAP requires chemically-synthesized allergen-DNA (for each type of allergen) and secondary anti-IgE antibody-DNA conjugate for the detection of sIgE by quantitative PCR.

    [0396] IgE LuLISA was used in a strip test (lateral flow) for a serum IgE testing on baby allergic to milk. Result is shown in FIG. 15.

    [0397] Such test aims proofing the application of LuLISA in emergency conditions for detecting IgE specific for curare (anaesthetics), amoxicillin (antibiotics) and latex (gloves) in patients attending surgery or for detection of allergy to milk compounds in new born babies in paediatric emergency.

    [0398] The blood sampling from fingertip is adapted for a sIgE LuLISA of patients treated by omaluzimab in a routinely and timely manner for adjusting the injected doses with the amount of the detected free sIgE.

    [0399] The low amount of sample required and the extended performance of LuLISA versus ELISA allow extended application as the plotting of affinity profile or spectra for serum with potentially more than one molecular species of IgE. LuLISA competition is performed using a series of allergen dilution mixed with a constant concentration of serum. IgE detected amount is correlated to light intensity. IgE detected amount per allergen concentration interval is a way to evaluate the presence of very high (sub-picomolar), high (nanomolar), medium (10 to 100's nanomolar) or low (micromolar and beyond) affinity immunoglobulin for the allergen. Higher affinity, stronger saturation and aggregation of IgE receptors at the surface of mastocytes, basophiles and macrophages, higher histaminic and cytokinic response with higher risk of anaphylactic shock. Affinity spectra are a relevant tool for the follow up of patient under desensibilizing treatment for orienting the therapeutic strategy from stopping the challenge with increasing amounts of allergen, controlling the short term response with anti-histaminic or clearing the high affinity IgE with competitor of the IgG Fc receptor binding site (Omaluzimab).

    [0400] In summary, the IgE LuLISA is a new method for the detection of sIgE of ultra-high sensitivity requiring only very small (1 μL or less) plasma sample volumes. The use of bioluminescence offers markedly increased sensitivity over classical colorimetric (ELISA) or fluorescent (ImmunoCAP) IgE detection methods with an extended dynamic range of concentration. The method is fully automatable and uses commercialized plates and a standard luminometer for the bioluminescent detection of IgE. Thus, IgE LuLISA should be very cost-effective over conventional ImmunoCAP.

    Example 3: Luciferase Immuno-Absorbent Assay for SARS COv-2 Serology

    [0401] Material and Methods:

    [0402] Human Plasmas and Serums

    [0403] The samples were obtained from serums of the CORSER cohort (n=164; IcareB), from serums of the observation and monitoring protocol of the Intensive Medicine and Resuscitation service of Assistance Publique des Hopitaux de Paris (APHP) Cochin (n=20) in longitudinal follow-up and from healthy donors of Etablissement Francais du Sang (EFS) sampled in December 2019 (frozen plasmas n=20, frozen serums n=20). Prepandemic frozen sera from 664 healthy donors were obtained from the French blood bank (Etablissement Francais du Sang, EFS).

    [0404] Fusion Protein Anti-IgG Nanobody-Luciferase

    [0405] Design and Synthesis of Plasmid Encoding the Anti-IgG Nanobody-Luciferase Fusion Protein (pET23-Fc1-nanoKAZ or pET23-Fc10-nanoKAZ, with Fc1 Coding for SEQ ID NO: 62 and Fc10 Coding for SEQ ID NO: 63 and Jaz572 for SEQ ID NO: 10 Respectively or pET23-Fc1-Jaz572 or pET23-Fc10-Jaz572, with Fc1 Coding for SEQ ID NO: 62 and Fc10 Coding for SEQ ID NO: 63 and Jaz572 for SEQ ID NO: 10 Respectively)

    [0406] nanoKAZ is an optimized sequence of the catalytic domain of the luciferase from Oplophorus gracilirostris (WO2012/061530). Jaz572 (SEQ ID NO: 10 is derived from the nanoKAZ with an improved catalytic activity increasing photo emission and signal and a reduced aggregation and surface adsorption behavior reducing noise contributing for a better signal noise ratio.

    [0407] The gene nanoKAZ and JAZ572 have been synthetized by Eurofins (Germany) with carboxy-end His6-tag and flanking region corresponding to the pET23 sequence (Novagen). pET23 plasmid has been amplified with the forward and reverse oligonucleotides (Fwd:5′CTCGAGCACCACCACCACCACCAC3′ (SEQ ID NO:47); Rvr:5′GGTATATCTCCTTCTTAAAGTTAAAC3′ (SEQ ID NO: 48), Eurofins) using a Q5 DNA polymerase, dNTP mix (New England BioLabs). PCR product was purified by electrophoresis on agarose gel (1%, Macherey Nagel). Purified pET23 vector and the synthetic gene were assembly (pET23-nanoKAZ or pET23-jaz572) using NEBuilder HiFi assembly master mix (New England BioLabs).

    [0408] The IgG-binding moiety is issued from a humanized heavy chain antibody of alpaca selected against IgG (single-domain antibody) (U.S. Pat. No. 10,259,886 B2). FC1 recognizes the constant fragment region of human IgG1, IgG2, IgG3 and IgG4 with the following dissociation constants at equilibrium: KD 0.57 nM, 1.73 nM, 47.8 nM, 0.30 nM respectively with a KD for all IgG of 3.25 nM (U.S. Pat. No. 10,259,886 B2). FC10 recognizes the constant fragment region of human IgG1, IgG2, IgG3 and IgG4 with the following dissociation constants at equilibrium: KD 2.62 nM, 7.29 nM, 8.99 nM, 12.3 nM respectively with a KD for all IgG of 3.25 nM (U.S. Pat. No. 10,259,886 B2). The gene fc1 and fc10 has been synthetized by Eurofins with flanking regions corresponding to the pET23-nanoKAZ sequence. Synthetic gene fc1 or fc10 have been amplified with the corresponding forward and reverse oligonucleotides using a Q5 DNA polymerase and dNTP mix.

    [0409] PCR products were purified by electrophoresis on agarose gel. Purified pET23-nanoKAZ and pET23-jaz572 vectors and the synthetic gene fc1 or fc10 were assembled using NEBuilder HiFi assembly master mix (New-England Biolabs).

    [0410] The assembled products (5 mL) were used to transform NEB 5-alpha competent E. coli and grown overnight on LB/Agar/ampicillin in Petri dish. Isolated colonies were grown in liquid medium, plasmids were isolated and nucleotide sequence was performed to confirm the presence of the fc1-nanoKAZ or fc10-nanoKAZ-fc1-jaz573, fc10-jaz573 inserts.

    [0411] The full sequence of anti-IgG nanobody luciferase tandem FC1-nanoKAZ or FC10-nanoKAZ ([nanobody anti-IgG]-[nanoKAZ-]-[His6]) are shown as examples in the table below:

    TABLE-US-00010 Nucleotide ATGCAGGTCCAATTGCAAGA sequence GTCAGGGGGCGGCCTGGTCC of fc1- AACCAGGCGGTAGCCTCCGC nanoKAZ CTGTCGTGCGCGGCCTCCGG (SEQ GGGTACATCTATTCGTATCG ID NO: 53) GTTCGATTAATGCACTGGCT Fc1 in TGGTACCGGCAGGCTTTAGG underlined CAATCAGCGCGAACTGGTTG nanoKAZ CAGCGGTGACCGAAGGCGGT in bold AGCACGAACTATGCCGATTT TGTAAAAGGACGTTTCACCA TCAGCCGCGATAACGCGCAG AACATGATGTATCTTCAGAT GAATTCCCTGAAACCGGAAG ATACGGCAGTTTATTATTGT AATGCGGACAAGGTACTGTA CTCTCGTGGCGGATACTATA GCGTGGCCAACGACCTATGG GGTCAGGGCACCCAGGTGAC TGTGAGTAGTATGGTTTTCA CCCTTGAAGACTTCGTGGGC GACTGGCGCCAGACGGCGGG TTACAATCTCGATCAGGTGC TCGAACAAGGAGGTGTAAGT TCCCTGTTCCAAAACTTGGG GGTTTCTGTCACTCCAATCC AGCGGATCGTGTTGAGCGGG GAAAATGGTTTAAAAATCGA TATCCACGTGATTATCCCGT ATGAAGGCCTGTCAGGCGAC CAGATGGGACAGATAGAAAA AATCTTTAAAGTTGTATATC CGGTTGACGATCACCATTTT AAAGTAATCCTGCATTACGG CACCCTGGTGATTGATGGGG TGACTCCTAACATGATTGAT TATTTTGGCCGTCCCTACGA AGGCATCGCAGTCTTTGATG GTAAAAAGATTACAGTGACG GGTACGCTATGGAACGGCAA TAAGATTATTGATGAGCGTT TAATTAATCCGGATGGTTCG CTGCTGTTTCGCGTCACCAT TAACGGTGTCACCGGCTGGC GCCTGTGCGAGCGTATTCTG GCCCTCGAGCACCACCACCA CCACCAC Amino acid MQVQLQESGGGLVQPGGSLR sequence of LSCAASGGTSIRIGSINALA FC1- WYRQALGNQRELVAAVTEGG nanoKAZ STNYADFVKGRFTISRDNAQ (SEQ ID NMMYLQMNSLKPEDTAVYYC NO: 54) NADKVLYSRGGYYSVANDLW Fc1 GQGTQVTVSSMVFTLEDFVG underlined DWRQTAGYNLDQVLEQGGVS nanoKAZ SLFQNLGVSVTPIQRIVLSG in bold ENGLKIDIHVIIPYEGLSGD QMGQIEKIFKVVYPVDDHHF KVILHYGTLVIDGVTPNMID YFGRPYEGIAVFDGKKITVT GTLWNGNKIIDERLINPDGS LLFRVTINGVTGWRLCERIL ALEHHHHHH Nucleotide ATGCAAGTACAGTTGCAGGA sequence of GAGTGGAGGCGGATTAGTAC fc10-nanoKAZ AAGCTGGCGATTCTCTTCGG (SEQ ID ATTTCGTGTCGCGCATCGGG NO: 55) TCTGACTGTGAACGATCTGT Fc10in ATATGGGTTGGTTTCGACAG underlined GCGCCGGGCAAGGAACGCGA nanoKAZ ATTTGTCGGTCGTGTTACTC in bold CAGGGGACAACACGGACTAT ACATATTACGTGGACAGCGT GAAAGGGCGTTTCACCATCA GCCGTGATTCCGCCAAAAAT ACCGTGTATCTCCAGATGAA TTCTCTGAAACTGGAAGATA CCGCCGTCTACCTGTGCGCG GGCCGCCGCTTCGGTAGTTC CGAGTGGGATTACTGGGGTC AGGGCACCCAAGTTACGGTT AGCTCAATGGTTTTCACCCT TGAAGACTTCGTGGGCGACT GGCGCCAGACGGCGGGTTAC AATCTCGATCAGGTGCTCGA ACAAGGAGGTGTAAGTTCCC TGTTCCAAAACTTGGGGGTT TCTGTCACTCCAATCCAGCG GATCGTGTTGAGCGGGGAAA ATGGTTTAAAAATCGATATC CACGTGATTATCCCGTATGA AGGCCTGTCAGGCGACCAGA TGGGACAGATAGAAAAAATC TTTAAAGTTGTATATCCGGT TGACGATCACCATTTTAAAG TAATCCTGCATTACGGCACC CTGGTGATTGATGGGGTGAC TCCTAACATGATTGATTATT TTGGCCGTCCCTACGAAGGC ATCGCAGTCTTTGATGGTAA AAAGATTACAGTGACGGGTA CGCTATGGAACGGCAATAAG ATTATTGATGAGCGTTTAAT TAATCCGGATGGTTCGCTGC TGTTTCGCGTCACCATTAAC GGTGTCACCGGCTGGCGCCT GTGCGAGCGTATTCTGGCCC TCGAGCACCACCACCACCAC CAC Amino acid MQVQLQESGGGLVQAGDSLR sequence ISCRASGLTVNDLYMGWFRQ of APGKEREFVGRVTPGDNTDY FC10- TYYVDSVKGRFTISRDSAKN nanoKAZ TVYLQMNSLKLEDTAVYLCA (SEQ ID GRRFGSSEWDYWGQGTQVTV NO: 56) SSMVFTLEDFVGDWRQTAGY Fc10 NLDQVLEQGGVSSLFQNLGV underlined SVTPIQRIVLSGENGLKIDI nanoKAZ HVIIPYEGLSGDQMGQIEKI in bold FKVVYPVDDHHFKVILHYGT LVIDGVTPNMIDYFGRPYEG IAVFDGKKITVTGTLWNGNK IIDERLINPDGSLLFRVTIN GVTGWRLCERILALEHHHHH

    [0412] The estimated molecular weight (MW) of FC1-nanoKAZ and FC10-nanoKAZ calculated from sequence are 34115 and 33588 Daltons respectively.

    [0413] Expression, Purification and Validation of Anti-IgG Nanobody-Luciferase Fusion Proteins were Identical to Those of Anti IgE Nanobody-nanoKAZ (sdAb026-nanoKAZ)

    [0414] Protocol of Detection of IgG Specific of Proteins N and S of SARS-COV2 by Luciferase Linked-Immunosorbent Assay (LuLISA)

    [0415] IgG Luciferase Immunosorbent Assay (LuLISA) Protocol

    [0416] White 96- or 384-well plates with flat bottom (Fluoronunc C96 Maxisorp, Nunc) were coated by adsorption with either 1 μg/mL of Nucleoprotein, Spike or their fragments, in 50 μL/well of phosphate buffer saline pH 7.4 (Sigma) for 2 hours at room temperature or overnight at 4° C. Adsorption on Maxisorp® plates favours charge interaction. Alternatives to adsorption are covalent binding of targets through carboxylic, amine or sulfhydryl moieties or glycosylation at the functionalized well surface or coating with poly-lysine. Wells were emptied eventually but not necessarily neutralize with BSA (1 mg/mL) or skimmed milk 3%. Wells were washed 3 to 6 times with 100 μL of PBS/Tween 20 0.1%. Dilutions of serum (typically 1/200), plasma or body fluid were incubated from 30 min to 1 hour at room temperature in their respective antigen-coated wells, 50 μL/well in phosphate buffer saline with eventually skimmed milk 3%, bovine serum albumin 1 mg/mL, bovine serum 1-3% and/or Tween 20 0.1%. Wells were washed three to six times with 100 μL PBS/Tween 20 0.1%. Purified VHH-nanoKAZ 1 ng/mL (5.Math.10.sup.7 RLU.Math.s.sup.−1.Math.mL.sup.−1) in phosphate buffer saline with eventually skimmed milk 3%, bovine serum albumin 1 mg/mL or bovine serum 1-3% and/or Tween 20 0.1%, was loaded (50 μL/well) and incubated 20-30 min at room temperature. Wells were washed four times with 100 μL of PBS/Tween 20 0.1%. Plates can be stored at this step in PBS until measurements. Just before reading, each wells were emptied and loaded with 50 μL of furimazine (8-benzyl-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one) at 27 μM of furmazine or 13 μM of Q108. The plate was orbitally shaked for 5 seconds and the light emission intensity was integrated 0.5-1 sec per well using a multi-well plate luminometer (LB960 Centro, Berthold).

    [0417] Results

    [0418] IgGs specific of protein N of SARS-CoV2 have been titrated by luciferase linked immunosorbent assay (LuLISA) in serums of the CORSER cohort (n=164; IcareB), in serums of the observation and monitoring protocol of the Intensive Medicine and Resuscitation service of Assistance Publique des Hopitaux de Paris (APHP) Cochin (n=20) in longitudinal follow-up and in serums and plasma of healthy donors of

    [0419] Establishment Français du Sang (EFS) sampled in December 2019 (frozen plasmas n=20, frozen serums n=20).

    [0420] Results are shown in FIG. 16.

    [0421] IgGs specific of protein Spike (S) of SARS-CoV2 have been titrated by LuLISA in serums from the observation and monitoring protocol of the Intensive Medicine and Resuscitation service of Assistance Publique des Hopitaux de Paris (APHP) Cochin (n=20) and in frozen serums from healthy donors of EFS (n=4).

    [0422] Results are shown in FIG. 17.

    [0423] The correlation between the titration of IgG specific of protein N of SARS-CoV2 and IgG specific of protein S of SARS-CoV2 in serum from APHP-Cochin (n=20) and EFS (n=4) is shown in FIG. 18.

    [0424] Then it was compared the IgG of serums from patients (APHP-Cochin n=20) and frozen serums of healthy donors (EFS n=4) which were specific for SARS-CoV1 protein N and SARS CoV2 protein N as well as SARS CoV1 protein S and SARS-CoV2 protein S.

    [0425] Results are shown in FIGS. 19 and 20.

    [0426] An emergency test on a 96 well-plate which may be performed in 5 minutes has been assayed on serum from APHP-Cochin (n=20) and EFS (n=4) in duplicate by reducing the incubations time: 3 minutes for the incubation of sera at room temperature or even better at 37° C., 17 seconds per washing step (plate washer Zoom HT, Berthold) and 1 minute for the incubation of the anti-IgG VHH-nanoKAZ. The coefficient of determination R.sup.2 was 0.75. Results are shown in FIG. 21.

    REFERENCES

    [0427] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present application. [0428] Coutant E P, Gagnot G, Hervin V, Baatallah R, Goyard S, Jacob Y, Rose T, Janin Y L. Bioluminescence Profiling of NanoKAZ/NanoLuc Luciferase Using a Chemical Library of Coelenterazine Analogues. Chemistry. 2020 Jan. 16; 26(4):948-958. [0429] Jabs F, Plum M, Laursen N S, Jensen R K, Molgaard B, Miehe M, et al. Trapping IgE in a closed conformation by mimicking CD23 binding prevents and disrupts FcepsilonRI interaction. Nat Commun 2018; 9:7. [0430] Canonica G W, Ansotegui I J, Pawankar R, et al. A WAO-ARIA—GA(2)LEN consensus document on molecular-based allergy diagnostics. World Allergy Organ J. van Hage M, Hamsten C, Valenta R. ImmunoCAP assays: Pros and cons in allergology. J Allergy Clin Immunol. 2017; 140(4):974-977. [0431] Inouye S, Sato J, Sahara-Miura Y, Yoshida S, Hosoya T. Luminescence enhancement of the catalytic 19 kDa protein (KAZ) of Oplophorus luciferase by three amino acid substitutions. Biochem Biophys Res Commun. 2014; 445(1):157-162. [0432] Gasser P, Tarchevskaya S S, Guntern P, et al. The mechanistic and functional profile of the therapeutic anti-IgE antibody ligelizumab differs from omalizumab. Nat Commun. 2020; 11(1):165. [0433] Mukai K, Gaudenzio N, Gupta S, et al. Assessing basophil activation by using flow cytometry and mass cytometry in blood stored 24 hours before analysis. J Allergy Clin Immunol. 2017; 139(3):889-899 e811. [0434] Hamilton R G, Franklin Adkinson N, Jr. In vitro assays for the diagnosis of IgE-mediated disorders. J Allergy Clin Immunol. 2004; 114(2):213-225; quiz 226. [0435] Tsai C T, Mukai K, Robinson P V, et al. Isotype-specific agglutination-PCR (ISAP): A sensitive and multiplex method for measuring allergen-specific IgE. J Allergy Clin Immunol. 2018; 141(5):1901-1904 e1915. [0436] Li T M, Chuang T, Tse S, Hovanec-Burns D, El Shami A S. Development and validation of a third generation allergen-specific IgE assay on the continuous random access IMMULITE 2000 analyzer. Ann Clin Lab Sci. 2004; 34(1):67-74. [0437] Tomabechi Y, Hosoya T, Ehara H, Sekine S I, Shirouzu M, Inouye S. Crystal structure of nanoKAZ: The mutated 19 kDa component of Oplophorus luciferase catalyzing the bioluminescent reaction with coelenterazine. Biochem Biophys Res Commun. 2016; 470(1):88-93. [0438] Shimomura O, Masugi T, Johnson F H, Haneda Y., Properties and reaction mechanism of the bioluminescence system of the deep-sea shrimp Oplophorus gracilirostris. Biochemistry. 1978 Mar. 21; 17(6):994-8. [0439] Hall M P, Unch J, Binkowski B F, Valley M P, Butler B L, Wood M G, Otto P, Zimmerman K, Vidugiris G, Machleidt T, Robers M B, Benink H A, Eggers C T, Slater M R, Meisenheimer P L, Klaubert D H, Fan F, Encell L P, Wood K V. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol. 2012 Nov. 16; 7(11):1848-57.