PHARMACEUTICAL FORMULATION COMPRISING A COMBINATION OF RECOMBINANT NEWCASTLE DISEASE VIRUSES FOR THE TREATMENT OF CANCER

Abstract

The invention relates to a pharmaceutical formulation comprising at least three recombinant transgene expressing Newcastle Disease Virus (NDV) strains, which have been demonstrated to possess significant oncolytic activity against mammalian cancers and an improved safety profile, a non-recombinant NDV strain, a reovirus type-3 and optionally a vaccinia virus. At least one of the recombinant NDV strains comprises in its viral genome a nucleic acid sequence comprising at least one foreign gene, the at least one foreign gene encoding a checkpoint modulator, and at least one of the recombinant NDV strains comprises in its viral genome a nucleic acid sequence comprising at least one foreign gene, the at least one foreign gene encoding an angiogenesis inhibitor. The viral genome of each of the at least three recombinant NDV strains comprises a mutation in the HN gene, said mutation allowing replication of said rgNDV in a cancer cell to a higher level than replication of an otherwise identical NDV not having said mutation in the HN gene. The pharmaceutical formulation provides an improved treatment of cancer, because instead of a monotherapy, a mixture of oncolytic viruses is applied.

Claims

1. (canceled)

2. The pharmaceutical formulation according to claim 19, wherein the components are mixed in equal volume ratio.

3. The pharmaceutical formulation according to claim 19, wherein the non-recombinant NDV strain comprises a nucleic acid which is at least 70% identical to a nucleic acid sequence according to SEQ ID No. 1 to SEQ ID No. 7 of the sequence listing.

4. (canceled)

5. The pharmaceutical formulation according to claim 19, further comprising or more recombinant NDV strains comprising in their viral genome a nucleic acid sequence encoding as a foreign gene one or more selected from: Lirilumab, an antigen-binding part of Lirilumab, a variant of Lirilumab or a variant of an antigen-binding part of Lirilumab; Relatlimab, an antigen-binding part of Relatlimab, a variant of Relatlimab or a variant of an antigen-binding part of Relatlimab; Monalizumab, an antigen-binding part of Monalizumab, a variant of Monalizumab or a variant of an antigen-binding part of Monalizumab; TRX518, an antigen-binding part of TRX518, a variant of TRX518 or a variant of an antigen-binding part of TRX518; and BMS 986178, an antigen-binding part of BMS 986178, a variant of BMS 986178 or a variant of an antigen-binding part of BMS 986178.

6. The pharmaceutical formulation according to claim 19, further comprising a recombinant NDV strains comprising in its viral genome a nucleic acid sequence encoding as a foreign gene Ramucirumab, a variant of Ramucirumab or a variant of an antigen-binding part of Ramucirumab.

7. The pharmaceutical formulation according to claim 19, wherein the formulation comprises a recombinant NDV strain comprising a nucleic acid sequence encoding interleukin-12 (IL-12), a part of interleukin-12, a variant of interleukin-12 or a variant of a part of interleukin-12.

8. The pharmaceutical formulation according to claim 19, further comprising at least one recombinant NDV strain comprising in its viral genome a nucleic acid sequence comprising at least one foreign gene, the at least one foreign gene being selected from the group consisting of: a gene encoding the protein CD40 (cluster of differentiation 40), a part of CD40, a variant of CD40 or a variant of a part of CD40, a gene encoding CD80, a part of CD80, a variant of CD80 or a variant of a part of CD80 a gene encoding Theralizumab, an antigen-binding part of Theralizumab, a variant of Theralizumab or a variant of an antigen-binding part of Theralizumab; a gene encoding Gemtuzumab, an antigen-binding part of Gemtuzumab, a variant of Gemtuzumab or a variant of an antigen-binding part of Gemtuzumab; a gene encoding an antibody, directed to CD39 or an antigen-binding part directed to CD39 (anti-CD39), having a sequence identity of at least 70% to SEQ. ID. No. 27; a gene encoding an antibody directed to CA 15-3 or an antigen-binding part directed to CA 15-3 (anti-CA 15-3), having a sequence identity of at least 70% to SEQ. ID. No. 28; a gene encoding an antibody directed to CA 19-9 or an antigen-binding part directed to CA 19-9 (anti-CA 19-9), having a sequence identity of at least 70% to SEQ. ID. No. 29; a gene encoding Sofituzumab, an antigen-binding part of Sofituzumab, a variant of Sofituzumab or a variant of an antigen-binding part of Sofituzumab; a gene encoding Cetuximab, an antigen-binding part of Cetuximab, a variant of Cetuximab or a variant of an antigen-binding part of Cetuximab, a gene encoding a Trastuzumab, an antigen-binding part of Trastuzumab, a variant of Trastuzumab or a variant of an antigen-binding part of Trastuzumab, a gene encoding BIL=3s, an antigen-binding part of BIL=3s, a variant of BIL=3s or a variant of an antigen-binding part of BIL=3s, P (anti a gene encoding J591, an antigen-binding part of J591, a variant of J591 or a variant of an antigen-binding part of J591; a gene encoding a to a death TRAIL, a part of TRAIL, a variant of TRAIL or a variant of a part of TRAIL; a gene encoding a green fluorescent protein or a part of a green fluorescent protein; and any combination of these genes.

9. The pharmaceutical formulation according to claim 19, wherein the viral genome of at least one or each of the recombinant NDV strains further comprises a nucleic acid comprising a nucleic acid sequence encoding a matrix protein (M protein) with an amino acid substitution at position 165, where glycine (G) is substituted to tryptophane (W).

10. The pharmaceutical formulation according to claim 19 wherein the viral genome of at least one or each of the recombinant NDV strains further comprises a nucleic acid sequence encoding a fusion protein (F protein) with an amino acid substitution at position 117 where phenylalanine (F) is substituted to serine (S), and/or with an amino acid substitution at position 190, where phenylalanine (F) is substituted to leucine (L).

11. The pharmaceutical formulation according to claim 10, wherein the nucleic acid sequence encoding the fusion protein (F protein) further encodes an amino acid substitution at position 289 of the F protein, where leucine (L) is substituted to alanine (A) at position 289.

12. The pharmaceutical formulation according to claim 10, wherein the viral genome of at least one or each of the recombinant NDV strains further comprises a nucleic acid comprising a nucleic acid sequence encoding a large polymerase protein (L protein) having an amino acid substitution at position 757, valine (V) is substituted to isoleucine (I), and/or an amino acid substitution at position 1551 where phenylalanine (F) is substituted to serine (S), and/or an amino acid substitution at position 1700, where arginine (R) is substituted to leucine (L).

13. The pharmaceutical formulation according to claim 12, wherein the nucleic acid sequence encoding the large polymerase protein (L protein) having further an amino acid substitution at position 1717, where tyrosine (Y) is substituted to histidine (H), and/or an amino acid substitution at position 1910, where glutamic acid (E) is substituted to lysine (K).

14. The pharmaceutical formulation according to claim 19, wherein the parent NDV for each of the recombinant NDV strains comprises a nucleic acid which is at least 70% identical to a nucleic acid sequence according to any one of SEQ ID No. 1 to SEQ ID No. 7 of the sequence listing.

15. The pharmaceutical formulation according to claim 19, wherein the HN protein of at least one or each of the recombinant NDV strains comprises or consists of the amino acid sequence according to SEQ ID No. 36 of the sequence listing, and/or wherein the F protein comprises or consists of the amino acid sequence according to SEQ ID No. 38 of the sequence listing, and/or wherein the M protein comprises or consists of the amino acid sequence according to SEQ ID No. 37 of the sequence listing, and/or wherein the L protein comprises or consists of the amino acid sequence according to SEQ ID No. 39 of the sequence listing.

16. The pharmaceutical formulation according to claim 19, wherein the pharmaceutical formulation comprises virus particles of each of the recombinant NDV strains an amount 10.sup.7 to 10.sup.9 of each of the recombinant NDV strains per 20 mL dose.

17. The pharmaceutical formulation according to claim 19, wherein the viral genome of the non-recombinant NDV strain: comprises a nucleic acid sequence encoding a matrix protein (M protein) with an amino acid substitution at position 165, where glycine (G) is substituted to tryptophane (W); and/or encodes a fusion protein (F protein) with an amino acid substitution at position 117, where phenylalanine (F) is substituted to serine (S), and/or with an amino acid substitution at position 190, where phenylalanine (F) is substituted to leucine (L), optionally further encoding i) an amino acid substitution at position 289 of the F protein, where leucine (L) is substituted to alanine (A) and/or ii) a large polymerase protein (L protein) having: a) an amino acid substitution at position 757, where valine (V) is substituted to isoleucine (I), and/or b) an amino acid substitution at position 1551, where phenylalanine (F) is substituted to serine (S), and/or c) an amino acid substitution at position 1700, where arginine (R) is substituted to leucine (L), the encoded large polymerase protein (L protein) optionally further having an amino acid substitution at position 1717, where tyrosine (Y) is substituted to histidine (H), and/or an amino acid substitution at position 1910, where glutamic acid (E) is substituted to lysine (K); and/or encodes for the HN protein, which encoded HN protein comprises or consists of the amino acid sequence according to SEQ ID No. 36 of the sequence listing; and/or encodes for the F protein, which encoded F protein comprises or consists of the amino acid sequence according to SEQ ID No. 38 of the sequence listing; and/or encodes for the M protein, which encoded M protein comprises or consists of the amino acid sequence according to SEQ ID No. 37 of the sequence listing; and/or encodes for the L protein, which encoded L protein comprises or consists of the amino acid sequence according to SEQ ID No. 39 of the sequence listing.

18. The pharmaceutical formulation according to claim 19, wherein the pharmaceutical formulation comprises virus particles of the reovirus type 3 in an amount of 6×10.sup.7 to 6×10.sup.9 per 20 mL dose, and/or wherein the pharmaceutical formulation comprises virus particles of the vaccinia virus in an amount of 4×10.sup.5 to 4×10.sup.7 per 20 mL dose.

19. A pharmaceutical formulation comprising: a recombinant Newcastle Disease Virus (NDV) strain comprising a nucleic acid sequence encoding Atezolizumab, an antigen-binding part of Atezolizumab, a variant of Atezolizumab or a variant of an antigen-binding part of Atezolizumab; a recombinant Newcastle Disease Virus (NDV) strain comprising a nucleic acid sequence encoding Ipilimumab, an antigen-binding part of Ipilimumab, a variant of Ipilimumab or a variant of an antigen-binding part of Ipilimumab; a recombinant Newcastle Disease Virus (NDV) strain comprising a nucleic acid sequence encoding Nivolumab, an antigen-binding part of Nivolumab, a variant of Nivolumab or a variant of an antigen-binding part of Nivolumab; a recombinant Newcastle Disease Virus (NDV) strain comprising a nucleic acid sequence encoding Bevacizumab, an antigen-binding part of Bevacizumab, a variant of Bevacizumab or a variant of an antigen-binding part of Bevacizumab; a recombinant Newcastle Disease Virus (NDV) strain comprising a nucleic acid sequence encoding the non-structural protein NS1 of influenza A virus, a part of the non-structural protein NS1 of influenza A virus, a variant of the non-structural protein NS1 of influenza A virus or a variant of a part of the non-structural protein NS1 of influenza A virus; a non-recombinant Newcastle Disease Virus (NDV) strain, wherein the viral genome of the non-recombinant NDV strain comprises a nucleic acid comprising a nucleic acid sequence encoding a hemagglutinin-neuramidase protein (HN protein) with an amino acid substitution at position 277, where phenylalanine (F) is substituted to an amino acid with a hydrophobic side chain; a reovirus type 3; and optionally a vaccinia virus.

20. A method of treating cancer in a subject of one or more indications selected from the group consisting of brain tumors, bone tumors, soft tissue tumors, gynecological tumors, gastrointestinal tumors, prostate tumors, lung tumors, ear, nose, throat tumors, tongue tumors, and skin tumors, the method comprising administering to the subject the pharmaceutical formulation according to claim 19.

21. The pharmaceutical formulation according to claim 19, wherein in the HN protein encoded by the viral genome of the non-recombinant NDV strain, phenylalanine at position 277 is substituted to leucine (L).

22. The pharmaceutical formulation according to claim 12, wherein the mutated L-gene of the at least one or each of the recombinant NDV strains encodes the L protein with the amino acid substitution at position 757, position 1551, and position 1700.

Description

FIGURES

[0466] For a better understanding of the present invention, reference is made to the following description of an exemplary embodiment thereof, and the accompanying drawing, wherein:

[0467] FIG. 1 shows a schematic presentation of the NDV reverse genetics system. The upper part shows the composition of the full-length cDNA plasmid which contains the full-length NDV cDNA (encoding the nucleocapsid protein (NP), the phosphoprotein (P), the matrix protein (M), the fusion protein (F), the hemagglutinin-neuraminidase (HN), and the RNA-dependent RNA polymerase (L)) cloned behind the bacteriophage T7 RNA Polymerase promoter (T7P; yellow triangle) and followed by a ribozyme sequence (Rz) and T7 transcription termination signal (T7T).

[0468] A suitable host cell (shaded round-cornered box) is infected with a recombinant Fowlpox virus that expresses T7 DNA-dependent RNA polymerase (Fowlpox-T7) and subsequently co-transfected with the full-length cDNA plasmid and three helper plasmids containing the genes encoding the NDV NP, P and L proteins, respectively. Transcription of the full-length cDNA results in the generation of the NDV antigenome RNA which is encapsidated by NP protein then transcribed and replicated by the RNA-leading to the generation of infectious NDV.

[0469] FIG. 2 is a schematic presentation of the genome of exemplary rgNDV-mutants which can be comprised in a pharmaceutical formulation according to the present invention. The figure shows the position of the respective foreign gene which is inserted as extra transcription unit into the rgNDV-mutant genome between the P and M genes. Instead of the shown foreign genes any one of the other foreign genes mentioned in line with the disclosure of the present invention can be used, respectively be located at the respective position.

[0470] FIG. 3 shows growth kinetics of NDV in HeLa cells. HeLa cells were infected at a multiplicity of infection (MOI) of 0.01 with the indicated viruses. At 0 h, 8 h, 24 h and 48 h after infection, the amount of infectious virus in the supernatant was determined by end-point titration on QM5 cells. MTH68: NDV strain MTH-68/H; MutHu: NDV-Mut HN(F277L)/M(G165W); rgMTH68: NDV strain MTH-68/H derived by reverse genetics from cloned full-length cDNA; rgMutHu: NDV strain NDV-Mut HN(F277L)/M(G165W) derived by reverse genetics from cloned full-length cDNA; rgMutHu(HNL277F): rgMutHu in which the amino acid mutation at position 277 in the HN gene was converted from L back to F; rgMutHu(MW165G): rgMutHu in which the amino acid mutation at position 165 in the M gene was converted from W back to G.

[0471] FIG. 4 shows the expression of CD80 in a recombinant Nothabene-2a-strain. FIG. 4a shows the recombinant strain, FIG. 4b is the negative control. For detection an anti-CD80 antibody was used.

[0472] FIG. 5 shows syncytium formation due to the F(L289A) mutation. FIG. 5a is rgNothabene-2-F2L3+F(L289A) (i.e. F3L3) according to the present invention, FIG. 5b is rgNothabene-2-F2L3.

EXAMPLES

Example 1. Nucleotide Sequence Analysis of Mutant NDV-Mut HN(F277L)/M(G165W)

[0473] We identified a spontaneous mutant of an oncolytic NDV strain MTH-68/H (Csatary et al., 1999, Anticancer Res. 19:635-638.; further called MTH68). The replication capacity of the mutant strain (designated NDV-Mut HN(F277L)/M(G165W) in a variety of human neoplastic cell lines, as well as autologous primary tumors, is greatly enhanced as compared to the original MTH-68/H strain (also referred to as MTH68 strain). We analyzed its nucleotide sequence and found that, compared to MTH68, NDV-HN(F277L)/M(G165W) has two nucleotide mutations, one leading to an amino acid substitution in the M protein (G165W) and the other in the HN protein (F277L).

Example 2. A Reverse Genetics System that Allows Genetic Modification of NDV-Strains

[0474] 2.1 Reverse Genetics

[0475] In order to be able to genetically modify the genome of an RNA virus such as NDV, a manipulatable genetic system must be developed that uses a copy of the full viral RNA (vRNA) genome in the form of DNA. This full-length cDNA is amenable to genetic modification by using recombinant DNA techniques. The authentic or modified cDNA can be converted back into vRNA in cells, which in the presence of the viral replication proteins results in the production of a new modified infectious virus. Such ‘reverse genetics systems’ have been developed in the last few decades for different classes of RNA viruses. This system enables the rapid and facile introduction of mutations and deletions and the insertion of a transgene transcriptional unit, thereby enabling the changing of the biological properties of the virus.

[0476] Reverse genetics systems for several NDV strains, including lentogenic as well as velogenic strains, were developed by the Central Veterinary Institute (CVI), part of Wageningen University and Research, currently Wageningen Bioveterinary Research (WBVR) under the supervision of Dr. Ben Peeters (Peeters et al., 1999, J. Virol. 73:5001-9; de Leeuw et al., 2005, J. Gen. Virol. 86:1759-69; Dortmans et al., 2009, J. Gen. Virol. 90:2746-50). In order to generate a reverse genetics system for providing the NDV nucleic acids and strains according to the present invention, a similar approach was used. Details of the procedure can be found in the above cited papers and in the paragraphs below. Briefly, the system consists of 4 components, i.e., a transcription plasmid containing the full-length (either authentic or genetically modified) cDNA of the virus, which is used to generate the vRNA, and 3 expression plasmids (‘helper plasmids’) containing the NP, P and L genes of NDV respectively, which are used to generate the vRNA-replication complex (consisting of NP, P and L proteins). Transcription of the cDNA (i.e. conversion of the cDNA into vRNA) and expression of the NP, P and L genes by the helper plasmids is driven by a T7 promoter. The corresponding T7 DNA-dependent RNA polymerase (T7-RNAPol) is provided by a helper-virus (Fowlpox-T7).

[0477] In order to rescue virus, the 4 plasmids are co-transfected into Fowlpox-T7 infected cells (FIG. 1). Three to five days after transfection, the supernatant is inoculated into specific-pathogen-free embryonated chicken eggs (ECE) and incubated for 3 days. Infectious virus that is produced by transfected cells will replicate in the ECE and progeny virus can be harvested from the allantois fluid.

[0478] In order to develop a reverse genetics system for NDV the following steps were followed: [0479] Generation of sub-genomic NDV and foreign gene cDNA's by RT-PCR [0480] Assembly of full-length cDNA in a transcription vector [0481] Cloning of each of the NP, P and L genes into an expression vector [0482] Verify nucleotide sequence of full-length cDNA and helper-plasmids [0483] Repair nucleotide differences resulting from the cloning procedure, if necessary [0484] Rescue of infectious virus from cDNA using co-transfection (FIG. 1)

[0485] 2.2 Construction of Full-Length NDV-Mut HN(F277L)/M(G165W) cDNA, NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L) and helper plasmids

[0486] NDV-Mut HN(F277L)/M(G165W) and NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L) (passage 28 HeLa cells) were used for the isolation of vRNA using standard procedures. The vRNA was used to generate first-strand cDNA by means of Reverse Transcriptase followed by PCR to generate 4 sub-genomic cDNA fragments (designated C1, C2, C3 and C8). The full-length cDNA of NDV-MutHu was assembled from these fragments and cloned in the transcription vector pOLTV5 (Peeters et al., 1999, J. Virol. 73:5001-5009) by a combination of In-Fusion® cloning and classical cloning using restriction enzymes. An overview of the procedure is shown in FIG. 2, and further details can be found in Appendix 1 of this reference. The NP, P and L-genes of NDV-MutHu were obtained by RT-PCR (Appendix 1) and cloned in the expression plasmid pCVI which was derived by deletion of a ClaI restriction fragment from pCI-neo (Promega).

[0487] 2.3 Nucleotide Sequence Analysis

[0488] Nucleotide sequence analysis was used to verify that the sequence of pFL-NDV Mut HN(F277L)/M(G165W) and pFL-NDV Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L) were correct. A few nucleotides which differed from the Reference sequence were repaired. Silent mutations (i.e., not leading to an amino acid change) may be left unchanged.

[0489] 2.4 Rescue of Infectious Virus from pFL-NDV Mut HN(F277L)/M(G165W)

[0490] In order to generate infectious virus, we used the co-transfection system described above (and illustrated in FIG. 1) to transfect QM5 cells (derived from Quail) using plasmid pFL-NDV_Mut HN(F277L)/M(G165W) and the helper plasmids pCVI-NP.sup.MutHN(F277L)/M(G165W), pCVI-PMut.sup.HN(F277L)/M(G165W) and pCVI-L.sup.MutHN(F277L)/M(G165W) Rescue of infectious virus was successful as demonstrated by the presence of infectious virus in the allantoic fluid of ECE that were inoculated with the transfection supernatant (data not shown). The identity of the rescued virus was determined by RT-PCR followed by sequencing. The rescued virus was designated rgMut HN(F277L)/M(G165W). NDV-Mut HN(F277L)/M(G165W) and rgMut HN(F277L)/M(G165W) have similar growth kinetics in HeLa cells.

[0491] 2.5 Rescue of Infectious Virus from pFL-NDV Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)

[0492] In order to generate infectious virus, we used the co-transfection system described above (and illustrated in FIG. 1) to transfect QM5 cells (derived from Quail) using plasmid pFL-NDV_Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L) and the helper plasmids pCVI-NP.sup.MutHN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L), pCVI-P.sup.MutHN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L) and pCVI-L.sup.Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L). Rescue of infectious virus was successful as demonstrated by the presence of infectious virus in the allantoic fluid of ECE that were inoculated with the transfection supernatant (data not shown). The identity of the rescued virus was determined by RT-PCR followed by sequencing. The rescued virus was designated rgMut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L).

Example 3. Identify Whether One or Both of the Amino Acid Substitutions in Mut HN(F277L)/M(G165W) are Responsible for the Difference in Growth Kinetics Between Mut HN(F277L)/M(G165W) and the Parent Strain MTH68

[0493] 3.1 Growth Kinetics in HeLa Cells

[0494] The rescued rg-viruses (Table 1) as well as the original Mut HN(F277L)/M(G165W) and MTH68 viruses were used to determine their growth-kinetics in HeLa cells. Briefly, 4×10.sup.6 HeLa cells were seeded in 25 cm.sup.2 cell culture flasks and grown overnight. The cells were infected using a MOI of 0.01 (i.e., 1 infectious virus particle per 100 cells), and at 8, 24 and 48 hours after infection the virus titer in the supernatant was determined by end-point titration on QM5 cells.

[0495] The data (FIG. 3) indicate that strains Mut HN(F277L)/M(G165W) and rgMut HN(F277L)/M(G165W) yield at least 10-fold higher virus titers than MTH68. Furthermore, the data indicate that the mutation at amino acid position 277 in the HN gene is responsible for this effect. The M mutation does not seem to have an effect. This can be best seen when looking at the virus titers 24 h after infection, or even better when comparing the increase in virus titer between 8 h and 24 h (the exponential growth phase). The virus titer shows an increase of 3.5 (log 10) for Mut HN(F277L)/M(G165W), rgMut HN(F277L)/M(G165W) and rgMut HN(F277L)/M(W165G), whereas this is 2.5 for MTH68, 2.7 for rgMut HN(L277F) and 3.0 for rgMTH68 (Table 3).

[0496] rgMut HN(F277L)/M(W165G) is a strain in which the mutation in the M gene has been restored in accordance with the NDV MTH-68/H.

TABLE-US-00005 TABLE 1 Virus titers (log10 TCID50/ml) Time after infection (h) Virus 0 h 8 h 24 h 48 h MTH68 4.8 4.5 7.0 7.0 Mut HN(F277L)/M(G165W) 5.0 4.3 7.8 8.3 rgMTH68 5.0 4.0 7.0 7.5 rgMut HN(L277F) 5.0 4.3 7.0 7.3 rgMut M(W165G) 4.8 4.3 7.8 7.5 rgMutHu 5.3 4.5 8.0 8.0

Example 4. Generation of Recombinant NDV-Strains with Enhanced Oncolytic and Immune Stimulating Properties Due to the Expression of Different Therapeutic Proteins

[0497] The recombinant NDV-strains expressing one of the foreign genes of the present invention can be generated by means of the previously established reverse genetics system described above. The respective gene is to be inserted into the full-length cDNA of e.g. NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L) between the P and the M genes. To this end the open reading frames of the foreign genes may be fused via a 2A sequence. The genes were provided with the necessary NDV gene-start and gene-end sequences in order to allow transcription by the vRNA polymerase. FIG. 2 shows the final constellation of the recombinant viruses.

[0498] Infectious virus can be rescued, and virus stocks can be prepared by two passages in HeLa cells. Expression of the respective foreign gene can be determined and quantified by using a total human IgG ELISA (Invitrogen).

Example 5. Production of Viruses and Virus Mixtures

[0499] 5.1 Cell Lines and Reagents

[0500] Hela and LLC MK2 cells were grown in Medium 199 with Earle's salts and stable L-Glutamine (0.1 g/l) (Gibco) supplemented with 10% fetal bovine serum (Gibco) and Penicillin/Streptomycin (50 μg/ml) (Gibco). Cells were kept in an incubator at 37° C.

[0501] Stable glutamine is a dipeptide (Ala-Gln) that is can be used as a substitute for L-glutamine. It is much less labile in solution, is stable to heat sterilization, and is less ammoniagenic than L-glutamine.

[0502] 5.2 Production of Viruses

[0503] HeLa cells were used to produce NDV mutant variants, and Vaccinia viruses. Reovirus serotype 3 was produced in LLC MK2 cells.

[0504] In order to produce viruses, cells were grown in complete medium to 90% confluence in 850 cm.sup.2-smooth roller bottles (Nunc). Cells were washed three times with PBS (Gibco) and infected with virus at multiplicity of infection (MOI) of 0.1 for 1 hour. Each roller bottle was incubated with 50 ml of minimum essential medium (MEM) (Gibco) containing indicated viruses. The inoculums were then aspirated out and cells were washed again with PBS. 80 ml of new media (minimum essential medium) supplemented with 2% human AB serum (Sigma Aldrich) were added and the infected cells were kept at 37° C. in an incubator.

[0505] The cytopathic effect (CPE) of infected cells caused by oncolytic viruses was observed every 24 hours. The infecting viruses cause the lysis of the host cells. Medium supernatants from the cultures of infected cells were collected in 50 ml Falcon tubes when all the cells died released viruses into the media. The supernatants were then kept at 4° C. for 30 minutes and stored at −80° C.

[0506] 5.3 Filtration and Storage of Virus Stocks

[0507] The medium supernatants which stored at −80° C. were thawed at room temperature and centrifuged at 4000 rpm for 20 minutes at 4° C. The pellets from the centrifugation were discarded and the supernatant fractions containing viruses were filtered through 0.4 m filters (Millipore). The virus is now ready to use or can be stored at −80° C.

[0508] 5.4 Production of Virus Mixtures

[0509] Each oncolytic virus was produced and filtered separately. After filtration, if desired, virus mixtures were created by the combination of different viruses with equal or different volume ratio and stored at −80° C.

Example 6. Pharmaceutical Formulation

[0510] A New Castle Disease Virus mixture comprising [0511] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Bevacizumab, [0512] NDV-Mut HN(F277L)/M(G165W)-Ipilimumab, [0513] NDV-Mut HN(F277L)/M(G165W)-Nivolumab, [0514] NDV-Mut HN(F277L)/M(G165W)-NS1, [0515] NDV-Mut HN(F277L)/M(G165W), [0516] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L), and [0517] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/F(L289A)/L(V757I)/L(F1551S)/L(R1700L)

[0518] each with equal volume ratio was prepared. The viruses and the 10 ml mixture were prepared as set forth in Example 5. The virus contents before the mixture, given as TCID.sub.50 per ml, for each virus were 10′. The 10 ml formulation was administered intratumoral.

Example 7. Pharmaceutical Formulation

[0519] A virus mixture comprising [0520] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Atezolizumab, [0521] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Bevacizumab, [0522] NDV-Mut HN(F277L)/M(G165W)-Ipilimumab, [0523] NDV-Mut HN(F277L)/M(G165W)-Nivolumab, [0524] NDV-Mut HN(F277L)/M(G165W)-NS1, [0525] NDV-Mut HN(F277L)/M(G165W), and [0526] Vaccina

[0527] each with equal volume ratio was prepared. The viruses and the mixture were prepared as set forth in Example 5.

[0528] In addition, a reovirus serotype 3 solution was provided in accordance with Example 5.

[0529] 10 ml of the virus mixture and 10 ml of the reovirus solution were mixed. The virus contents before the mixture given as TCID.sub.50 per ml were:

[0530] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Atezolizumab: 10.sup.8

[0531] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Bevacizumab: 10.sup.8

[0532] NDV-Mut HN(F277L)/M(G165W)-Ipilimumab: 10.sup.8

[0533] NDV-Mut HN(F277L)/M(G165W)-Nivolumab: 10.sup.8

[0534] NDV-Mut HN(F277L)/M(G165W)-NS1: 10.sup.8

[0535] NDV-Mut HN(F277L)/M(G165W): 10.sup.8

[0536] Vaccina: 10.sup.6.5

[0537] Reovirus serotype 3: 10.sup.7.8

[0538] Accordingly, in the 20 ml formulation each NDV strain was comprised in an amount of 1.4×10.sup.8, given as TCID.sub.50, Vaccinia was comprised in an amount of 4.5×10.sup.6, given as TCID.sub.50, and Reovirus serotype 3 was comprised in an amount of 6.3×10.sup.8, given as TCID.sub.50.

[0539] The 20 ml formulation was administered intratumoral.

Example 8. Pharmaceutical Formulation

[0540] A New Castle Disease Virus mixture comprising [0541] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Atezolizumab, [0542] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Bevacizumab, [0543] NDV-Mut HN(F277L)/M(G165W)-Ipilimumab, [0544] NDV-Mut HN(F277L)/M(G165W)-Nivolumab, [0545] NDV-Mut HN(F277L)/M(G165W)-NS1, [0546] NDV-Mut HN(F277L)/M(G165W), [0547] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L), and [0548] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/F(L289A)/L(V757I)/L(F1551S)/L(R1700L)

[0549] each with equal volume ratio was prepared. The viruses and the 10 ml mixture were prepared as set forth in Example 5. The virus contents before the mixture, given as TCID.sub.50 per ml, for each virus were 10′. The 10 ml formulation was administered intratumoral.

Example 9. Pharmaceutical Formulation

[0550] A virus mixture comprising [0551] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Atezolizumab, [0552] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Bevacizumab, [0553] NDV-Mut HN(F277L)/M(G165W)-Ipilimumab, [0554] NDV-Mut HN(F277L)/M(G165W)-Nivolumab, [0555] NDV-Mut HN(F277L)/M(G165W)-NS1, [0556] NDV-Mut HN(F277L)/M(G165W), [0557] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L), [0558] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/F(L289A)/L(V757I)/L(F1551S)/L(R1700L), and [0559] Vaccina

[0560] each with equal volume ratio was prepared. The viruses and the mixture were prepared as set forth in Example 5.

[0561] In addition, a reovirus serotype 3 solution was provided in accordance with Example 5.

[0562] 10 ml of the virus mixture and 10 ml of the reovirus solution were mixed. The virus contents before the mixture given as TCID.sub.50 per ml were:

[0563] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Atezolizumab: 10.sup.8

[0564] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)-Bevacizumab: 10.sup.8

[0565] NDV-Mut HN(F277L)/M(G165W)-Ipilimumab: 10.sup.8

[0566] NDV-Mut HN(F277L)/M(G165W)-Nivolumab: 10.sup.8

[0567] NDV-Mut HN(F277L)/M(G165W)-NS1: 10.sup.8

[0568] NDV-Mut HN(F277L)/M(G165W): 10.sup.8

[0569] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L): 10.sup.8

[0570] NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/F(L289A)/L(V757I)/L(F1551S)/L(R1700L): 10.sup.8

[0571] Vaccina: 10.sup.6.5

[0572] Reovirus serotype 3: 10.sup.7.8

[0573] Accordingly, in the 20 ml formulation each NDV strain was comprised in an amount of 1.4×10.sup.8, Vaccinia was comprised in an amount of 4.5×10.sup.6 and Reovirus serotype 3 was comprised in an amount of 6.3×10.sup.8.

[0574] The 20 ml formulation was administered intratumoral.

Example 10. Successful Treatment of Renal Cell Carcinoma (RCC) Stage IV

[0575] A patient was diagnosed with renal cell carcinoma (RCC) stage IV and treated with a pharmaceutical composition according to the present invention. As can be seen from table 2 below, 3 months after the treatment a decreased size, thickness and uptake, shown as the standardized uptake value (SUV) of fluorodeoxyglucose, of the tumour was detected. Thus, the patient beneficially responded to the treatment. The increase in size and uptake of the lymph nodes is believed to be the consequence of a regional hyper-immune response.

TABLE-US-00006 TABLE 2 Pre-treatment (at Post 3-months Tumor load diagnosis) treatment From 100% Left renal mass Size: 3908 cm.sup.3 Size: 2165 cm.sup.3  55% SUV: 9.098 SUV: 5.265  58% Left adrenal 0.8 cm 0.6 cm  75% thickness SUV: 5.457 SUV: 3.783  69% Left retroperitoneal Size: 15.5 cm.sup.3 Size: 55 cm.sup.3 355% node SUV: 9.969 SUV: 15.02 151% Right retrocrural Size: 2.5 cm.sup.3 Size: 11.5 cm.sup.3 460% node SUV: 4.915 SUV: 6.862 140% Paraesophageal Size: 23 cm.sup.3 Size: 31 cm.sup.3 135% node SUV: 5.625 SUV: 7.815 139% Left supraclavicular Size: 3.3 cm.sup.3 Size: 5.2 cm.sup.3 158% node SUV: 4.488 SUV: 5.694 128% Total Size: 3.993 cm.sup.3 Size: 2.313 cm.sup.3  58%

[0576] In table 3 below the treatment scheme for renal cell carcinoma stage IV can be observed. The patient was born in 1965 and initially diagnosed with renal cell carcinoma stage IV on Feb. 13, 2020. The first treatment with oncolytic viruses started on Feb. 14, 2020.

TABLE-US-00007 TABLE 3 treatment scheme for renal cell carcinoma stage IV. Virus concentration in TCID50. patient born in 1965 NDV NDV- mixture REO-3 Vaccinia NDV-1 NDV-2b Nivo Initial 2020 Feb. 13 diagnosis OV1 2020 Feb. 14 Mixture of 7 6.31U + 08 4.52U + 06 1.43U + 08 1.43U + 08 with NS1 1. PET/CT 2020 Feb. 20 biopsy 2020 Mar. 2 OV2 2020 Mar. 2 Mixture of 7 6.31U + 08 4.52U + 06 1.43U + 08 1.43U + 08 with NS1 OV3 2020 Mar. 17 Mixture of 7 6.31U + 08 4.52U + 06 1.43U + 08 1.43U + 08 with NS1 OV4 2020 Apr. 2 Mixture of 7 6.31U + 08 4.52U + 06 1.43U + 08 1.43U + 08 with NS1 OV5 2020 Apr. 21 Mixture of 7 6.31U + 08 4.52U + 06 1.43U + 08 1.43U + 08 with NS1 OV6 2020 May 5 Mixture of 7 6.31U + 08 4.52U + 06 1.43U + 08 1.43U + 08 with NS1 2. PET/CT 2020 May 25 OV7 2020 May 26 Mixture of 6.31U + 07 3.16U + 06 1.00U + 08 1.00U + 08 101.00U + 08 OV8 2020 Jun. 12 Mixture of 6.31U + 07 3.16U + 06 1.00U + 08 1.00U + 08 10 OV9 2020 Jun. 30 Mixture of 6.31U + 07 3.16U + 06 1.00U + 08 1.00U + 08 10 OVIO 2020 Jul. 24 Mixture of 6.31U + 07 3.16U + 06 1.00U + 08 1.00U + 08 10 3. PET/CT 2020 Sep. 2 OV11 2020 Oct. 8 Mixture of 6.31U + 07 3.16U + 06 1.00U + 08 1.00U + 08 10 4. PET/CT 2020 Nov. 23 NDV- NDV- NDV- NDV- NDV- NDV- Atez Bevac Ipi Apoptin B18R IL-12 Initial diagnosis OV1 1.00U + 09 1.00U + 09 1.43U + 08 1.43U + 08 1.43U + 08 1. PET/CT biopsy OV2 1.00U + 09 1.00U + 09 1.43U + 08 1.43U + 08 1.43U + 08 OV3 1.00U + 09 1.00U + 09 1.43U + 08 1.43U + 08 1.43U + 08 1.00U + 05 OV4 1.00U + 09 1.00U + 09 1.43U + 08 1.43U + 08 1.43U + 08 1.00U + 05 OV5 1.00U + 09 1.00U + 09 1.43U + 08 1.43U + 08 1.43U + 08 1.00U + 05 OV6 1.00U + 09 1.00U + 09 1.43U + 08 1.43U + 08 1.43U + 08 2.00U + 05 2. PET/CT OV7 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 07 OV8 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 OV9 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 5.00U + 07 OVIO 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 5.00U + 07 3. PET/CT OV11 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 5.00U + 07 4. PET/CT

Example 11. Successful Treatment of Metastatic Breast Cancer

[0577] A patient was diagnosed with metastatic breast cancer and treated with a pharmaceutical composition according to the present invention. As can be seen from table 3 below, in the first 4 months after treatment an initial increase in size and uptake, shown as the standardized uptake value (SUV) of fluorodeoxyglucose, can be observed, as response to an active immune response to the oncolytic viruses. But 8 months after the treatment a decreased size, thickness and uptake of the tumor was detected. These results demonstrate that the patient beneficially respond to the treatment. The CT/PET demonstrates a complete response with a disintegrating/resolving scar and no uptake in the right upper chest wall lesion, confirming the absence of cancer.

TABLE-US-00008 TABLE 4 Post 4 Post 8 Post 14 Pre- Post 3 months and months and months and Post 19 Tumor treatment months 12 days 17 days 21 days months load (at diagnosis) treatment treatment treatment treatment treatment Right Size: 2.8 cm.sup.3 Size: 3.1 cm.sup.3 Size: 6.1 cm.sup.3 Size: 3.3 cm.sup.3 Size: 2.04 cm.sup.3 Size: 1.1cm.sup.3 upper SUV: 5.219 SUV: 7.671 SUV: 11.06 SUV: 7.67 SUV: 4.565 SUV: 1.603 chest wall lesion Right Size: 0.94 cm.sup.3 Size: 1.4 cm.sup.3 Size: 2.1 cm.sup.3 Size: 1.2 cm.sup.3 Size: 0.88 cm.sup.3 Size: 0.63 cm.sup.3 axillary lymph SUV: 2.423 SUV: 4.492 SUV: 5.908 SUV: 2.044 SUV: 2.349 SUV: 1.437 node Lung Size: 20.5 mm.sup.3 Size: 63.2 mm.sup.3 Size: 157 mm.sup.3 Size: 44.5 mm.sup.3 Size: 36.2 mm.sup.3 Size: 24.8 mm.sup.3 node 1 Lung Size: 37.2 mm.sup.3 Size: 100.8 mm.sup.3 Size: 151 mm.sup.3 Size: 44.9 mm.sup.3 Size: 24.8 mm.sup.3 Size: 18.6 mm.sup.3 node 2

[0578] In table 5(a+b) below the treatment scheme for breast cancer stage IV can be observed. The patient was born in 1977 and the first treatment with oncolytic viruses started on Nov. 5, 2018.

TABLE-US-00009 TABLE 5 a: medical examination and treatment scheme of a patient diagnosed with metastatic breast cancer (OV = oncolytic virus) Virus mixtures in ml Mixture Mixture Medical examination of 7 with of 7 with 7 Mixture Mixture Mixture and treatment NS1 Parvo strains of 10 of 4 of 5 PET/ 24 Oct. 2018 CT1 OV1 5 Nov. 2018 OV2 29 Nov. 2018 OV3 10 Dec. 2018 OV4 14 Jan. 2019 PET/ 28 Jan. 2019 CT2 OV5 5 Feb. 2019 OV6 25 Feb. 2019 OV7 14 Mar. 2019 OV8 21 Mar. 2019 OV9 27 Mar. 2019 Mixture 20 of 4 PET/ 3 May 2019 CT3 OV10 16 May 2019 Mixture 40 of 4 OV11 6 Jun. 2019 Mixture 10 of 5 OV12 4 Jul. 2019 Mixture 10 of 7 + Parvo OV13 25 Jul. 2019 Mixture 10 of 7 + Parvo OV14 6 Aug. 2019 Mixture 10 of 7 + Parvo OV15 5 Sep. 2019 7 strains 10 PET/ 7 Oct. 2019 CT5 OV16 8 Oct. 2019 7 strains 10 OV17 7 Nov. 2019 7 strains 10 OV18 4 Dec. 2019 Mixture 10 of 7 + NS1 OV19 14 Jan. 2020 Mixture 10 of 7 + NS1 OV20 13 Feb. 2020 Mixture 10 of 7 + NS1 OV21 17 Mar. 2020 Mixture 10 of 7 + NS1 OV22 26 May 2020 Mixture 10 of 10 b: Virus concentration in TICD50 in breast cancer treatment, this table is to be read in combination with table 5a Virus concentration in TICD50 Parotitis NDV- NDV- NDV VSV-2 virus REO-3 Vaccinia Parvo NDV-1 2a 2b NS1 2.00U + 09 3.16U + 07 6.32U + 07 1.26U + 09 1.58U + 07 3.16U + 07 7.32U + 06 1.00U + 09 4.42U + 06 1.40U + 07 1.40U + 08 4.42U + 06 1.40U + 07 1.40U + 08 4.42U + 06 1.40U + 07 1.40U + 08 6.31U + 08 1.40U + 08 4.42U + 09 1.40U + 08 6.31U + 08 1.40U + 08 4.42U + 09 1.40U + 08 6.31U + 08 3.16U + 07 1.40U + 08 4.42U + 09 1.40U + 08 6.31U + 08 4.42U + 06 1.40U + 08 1.40U + 08 6.31U + 08 4.42U + 06 1.40U + 08 1.40U + 08 6.31U + 08 4.42U + 06 1.40U + 08 1.40U + 08 6.31U + 08 4.42U + 06 1.40U + 08 1.40U + 08 6.31U + 07 3.16U + 06 1.00U + 08 1.00U + 08 b: Virus concentration in TICD50 in breast cancer treatment, this table is to be read in combination with table 5a Virus concentration in TICD50 NDV- NDV- NDV- NDV- NDV Nivo Atez NDV-Beva Ipi Apoptin NDV-B18R IL-12 1.00U+ 09  1.00U + 09 1.00U + 09 5.00U + 08 5.00U + 08 5.00U + 08 3.30U + 08 3.30U + 08 3.30E 5.00U + 08 5.00U + 08 5.00U + 08 1.00U + 09 1.00U + 09 1.00U + 09 2.00U + 08 2.00U + 08 2.00U + 08  2.0U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.00U + 09 1.00U + 09 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.00U + 09 1.00U + 09 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.00U + 09 1.00U + 09 1.40U + 08 1.40U + 08 1.40U + 08 1.40U + 08 1.00U + 09 1.00U + 09 1.40U + 08 1.40U + 08 1.40U + 08 1.00U + 05 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 08 1.00U + 07

REFERENCES

[0579] Blach-Olszewska et al., (1977) Why HeLa cells do not produce interferon? Arch Immunol Ther Exp (Warsz) 25:683-91. [0580] Chng et al., (2015) Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells, mAbs, 7:2, 403-412; http://dx.doi.org/10.1080/19420862.2015.1008351. [0581] Enoch et al., (1986) Activation of the Human beta-Interferon Gene Requires an Interferon-Inducible Factor, Mol. Cell. Biol. 6:801-10. [0582] Haryadi et al., (2015) Optimization of Heavy Chain and Light Chain Signal Peptides for High Level Expression of Therapeutic Antibodies in CHO Cells. PLoS ONE 10(2): e0116878. doi:10.1371/journal.pone.0116878. [0583] Schirrmacher, (2015) Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opin. Biol. Ther. 15:17 57-71 [0584] Zamarin et al., (2014) Localized oncolytic virotherapy overcomes systemic tumor resistance to immune checkpoint blockade immunotherapy. Sci. Transl. Med. 6(226). [0585] Zamarin & Palese, (2017) Oncolytic Newcastle Disease Virus for cancer therapy: old challenges and new directions. Future Microbiol. 7: 347-67.

APPENDIX 1: PRIMERS USED FOR THE GENERATION OF CDNA FRAGMENTS AND HELPER-PLASMIDS CDNA FRAGMENTS

[0586]

TABLE-US-00010 Frag- ment Size Primer Sequence (5′-3′) Cl 3.6 Noss-09 ACGACTCACTATAGGaccaaacagagaatcc kb (SEQ ID gtgag No. 40) Noss-121 CCGGGAAGATCCAGGgcactcttcttgcatg (SEQ ID ttac No. 41) C2 3.7 Noss-122 GGGCCTGCCTCACTAtggtggtaacatgcaa kb (SEQ ID gaag No. 42) Noss-123 TGCATGTTACCACCAatgtgtcattgtatcg (SEQ ID cttg No. 43) C3 5.7 Noss-125 CAAGAAGGGAGATACgtaatatacaagcgat kb (SEQ ID acaatg No. 44) Noss-126 TCGCTTGTATATTACttgttgtagcaaagag (SEQ ID cacc No. 45) C8 2.0 Noss-133 GGCCTGGATCTTCCCattatgctgtctgtat kb (SEQ ID acggtgc No. 46) Noss-10 ATGCCATGCCGACCCaccaaacaaagacttg (SEQ ID gtgaatg No. 47) iPCR 2.5 Noss-17 CCTATAGTGAGTCGTATTAATTTC pOLTV5 kb (SEQ ID (StuI) No. 48) Noss-128 CCTGGATCTTCCCGGGTCGG (SEQ ID No. 49) iPCR 2.5 Noss-137 GGGTCGGCATGGCATCTCCACC pOLTV5 kb (SEQ ID (SmaI) No. 50) Noss-138 GGGAAGATCCAGGCCTATAGTG (SEQ ID No. 51)

[0587] Helper-Plasmids (Generated by In-Fusion® Cloning in pCVI)

TABLE-US-00011 Gene primer sequence NP Noss-22 CTCTAGAGTCGACCCttctgccaacatgtcttccg (SEQ ID No. 52) Noss-23 GGGAAGCGGCCGCCCgtcggtcagtatccccagtc (SEQ ID No. 53) P Noss-24 CTCTAGAGTCGACCCcagagtgaagatggccaccttc (SEQ ID No. 54) Noss- GGGAAGCGGCCGCCCgtagtagtgatcagccattc 25n (SEQ ID No. 55) L Noss-26 CTCTAGAGTCGACCCgggtaggacatggcgggctc (SEQ ID No. 56) Noss-27 GGGAAGCGGCCGCCCtgcctttaagagtcacagttac (SEQ ID No. 57)