IN VITRO MEAT PRODUCTION

Abstract

The present invention relates to a method for producing a composition which comprises animal protein, comprising (a) isolating precursor cells from perinatal tissue of a mammal; (b) incubating the precursor cells under conditions which lead to a myogenic differentiation of the precursor cells; and (c) harvesting the cells. The present invention also relates to a method for producing precursor cells from perinatal tissue, to animal protein produced according to the invention, and precursor cells produced according to the invention. The present invention further relates to the use of a culture medium which has a reduced content of methionine in comparison to standard medium, to the differentiation of precursor cells, and to a method for the in vitro production of a meat-like composition.

Claims

1. A method for producing a composition which comprises animal protein, comprising (a) isolating precursor cells from perinatal tissue, preferably an umbilical cord, of an agricultural animal, preferably from the family Suidae, more preferably from the genus Sus, most preferably from the species Sus scrofa; (b) incubating the precursor cells under conditions which lead to a myogenic differentiation of the precursor cells, wherein the conditions which lead to a myogenic differentiation comprise incubation in a culture medium, which in comparison to the standard medium has a reduced content of methionine; and (c) harvesting the cells.

2. The method of claim 1, wherein the precursor cells are multipotent precursor cells, preferably mesenchymal stem cells, more preferably perinatal mesenchymal stem cells.

3. The method of claim 1, wherein the growth of the precursor cells comprises introduction of the precursor cells into a serum-free culture medium, which preferably comprises a proportion of conditioned serum-free medium.

4. The method of claim 1, wherein the conditions which lead to a myogenic differentiation comprise incubation in a culture medium with a concentration of methionine of at most 5 μM, preferably at most 4 μM, more preferably at most 3 μM, even more preferably at most 2.5 μM, and most preferably incubation in a culture medium without added methionine (0 μM methionine).

5. The method of claim 1, wherein during the myogenic differentiation contact of the precursor cells with a solid surface is avoided, whereby preferably microtissues of myogenically differentiated precursor cells are produced.

6. The method of claim 1, wherein step (a) comprises the following steps: (A) providing at least one perinatal tissue, preferably an umbilical cord, of a mammal; (B) comminuting the perinatal tissue, so that pieces thereof are obtained; (C) incubating the pieces of the perinatal tissue in a culture medium; (D) whereby precursor cells are obtained.

7. The method of claim 6, wherein the culture medium in step (C) is a culture medium which is free from serum of an agricultural animal, preferably is a serum-free medium.

8. (canceled)

9. (canceled)

10. A method for muscle regeneration, comprising administration of myogenically differentiated precursor cells which have been produced and differentiated according to the method of claim 1, to a mammal, preferably a human.

11. A method for producing a meat-like composition, comprising I) myogenic differentiation of precursor cells according to the method of claim 1; II) three-dimensional structuring of the differentiated precursor cells obtained in step I), and III) growth of the cells in the three-dimensional structure obtained in step II).

12. The method of claim 11, wherein the three-dimensional structure in step II) is obtained by bioprinting of differentiated precursor cells, preferably by bioprinting of microtissues comprising differentiated precursor cells.

Description

FIGURES

[0090] FIG. 1: Explant culture of mesenchymal stem cells from umbilical cord tissue from the pig: explant culture (A); typical change in morphology over time (B).

[0091] FIG. 2: Expression of markers by UC-MSC, detection via qRT-PCR; (A) CD73, (B) CD90, (C) CD105; as negative control, muscle cell cDNA (“muscle cDNA”) was used.

[0092] FIG. 3: UC-MSC from the umbilical cord of newborn piglets differentiate into fat cells (A) and muscle cells (B).

[0093] FIG. 4: Variation of the myogenic differentiation of C2C12 murine cells over time in different media, staining with an antibody against myosin (MF 20) on days 2 to 5 after introduction into the respective medium (d2-d5).

[0094] FIG. 5: Myogenic differentiation of UC-MSC in methionine-free medium; (A) transmitted light image of myogenically differentiated cells; (B) spontaneous formation of microtissues.

[0095] FIG. 6: Myogenically differentiated microtissue produced by the “hanging drop” method (transmitted light image).

EXAMPLE 1: OBTENTION OF UMBILICAL CORDS

[0096] Umbilical cords from pigs were only removed after completion of the natural cord separation process from the mother. For this, after cleaning and disinfection with 70% ethanol, the umbilical cords were tied off or clamped off about 2 cm from the navel and severed with sharp scissors. The umbilical cords were then multiply rinsed with sterile, ice-cooled Dulbecco's phosphate buffered saline with 1% penicillin and 1% amphotericin B (DPBS rinse solution), until blood residues had been removed and the tissue appeared white and clean. Then the umbilical cords were stored on ice in fresh DBPS rinse solution for transport and until further use.

[0097] Explant cultures were prepared in the sterile laboratory. Fresh umbilical cords were decontaminated in 3 steps after transfer into the sterile area, and thereafter constantly kept moist with DPBS rinse solution.

[0098] Decontamination of the Umbilical Cord: [0099] rinse umbilical cord several times (3-5 times) with DPBS rinse solution [0100] submerge umbilical cord in 70% EtOH (max. 1 min, to avoid tissue damage) [0101] rinse umbilical cord several times (3-5 times) with DPBS rinse solution

EXAMPLE 2: PREPARATION OF EXPLANT CULTURES

[0102] For the preparation of the explant cultures, pieces of the umbilical cord were placed in a small Petri dish with DPBS rinse solution and then cut up longitudinally and folded back; the tissue was cut into ca. 4×4 mm pieces or stamped out with a tissue cutter. In each case, 20 segments were placed in a 10 cm CellCoat dish.

[0103] Next 10 ml of culture medium were added to each explant culture (culture dish), and these then incubated at 37° C., 5% CO.sub.2 in the incubator. Modifications of the process (e.g. removal of the umbilical cord vasculature, isolation of Wharton's jelly) brought no significant improvement of the result.

EXAMPLE 3: TESTING OF THE EFFECT OF SERUM IN THE EXPLANT MEDIUM

[0104] Explant experiments were performed with standard culture medium (DMEM low glucose with 10% FCS, 1% PenStrep, 1% amphotericin) or with commercially obtainable special medium for mesenchymal stem cells (MesenCult ACF Plus, 1% PenStrep, 1% amphotericin, 2 mM L-glutamine, 1×ACF supplement (MC Stemcell Technologies, Cologne; with attachment factor: *05448)). MesenCult ACF Plus contains no animal additives or xenobiotics.

[0105] With all batches and independently of the nature of the medium used, after 4-5 days migrated cells (umbilical cord mesenchymal stem cells, UC-MSC) were clearly visibly present (FIG. 1); after 6 to 8 days the tissue pieces were removed and a first medium change performed. It could be shown that the presence of FCS exerts no influence on the establishment of the parent cell bank.

EXAMPLE 4: DETERMINATION OF THE IDENTITY OF THE UC-MSC

[0106] The UC-MSC identity was determined through the presence of various surface markers (Arutyunyan et al., 2016). The marker expression of MSC is heterogeneous, however CD73 (Wang et al., 2004; Corotchi, 2013), CD90 (Corotchi, 2013) and CD105 (Wang et al., 2004; Corotchi, 2013), which are said to be present in 98% of the cells, are particularly characteristic.

[0107] In addition, qRT-PCR according to standard methods was used for the typing. The results for the markers CD73, CD90 and CD105 are shown in FIG. 2. In addition, the pluripotency genes Okt4, SOX2 and Nanog were studied, also by means of qRT-PCR. Suitable primers are shown in Table 1.

EXAMPLE 5: TESTS FOR DIFFERENTIATION CAPACITY

[0108] In order to test whether the UC-MSC can in principle be differentiated into muscle cells and fat cells, on day 6 of culturing, the cells obtained were enzymatically detached and sown into 6 wells (2 wells per culture) of a 24-well Primaria plate. After 13 days in culture, the wells were almost confluently grown over and the cell count had increased from 1.9×10.sup.3 to 3.4×10.sup.3. In order to test the differentiation capacity (multipotency), a portion of the cells was placed in culture media which promote differentiation into fat cells or muscle cells respectively.

[0109] The adipogenic differentiation was induced by culturing in DMEM/F12 medium with 10% FBS, 2% glutamine, supplemented with 1 mM dexamethasone, 500 μM IBMX (3-isobutyl methylxanthine), 100 μM troglitazone and 1 μM/ml insulin for the duration of 48 hrs. After this, the induction medium was replaced by differentiation medium (DMEM/F12 medium with 10% FBS, 2% glutamine, 1 μM/ml insulin). After 3 days, the first fat droplets were visible and after 5 days the cells were fixed and stained with the dye Oil red for the fat determination (FIG. 3A).

[0110] The myogenic differentiation was triggered by culturing in DMEM with 4.5 g/l glucose (high glucose concentration) with 2% instead of 10% FBS. After 4 days, the cells were fixed and the differentiation determined by means of fluorescence-labeled antibodies against the muscle proteins desmin and F-actin, respectively (FIG. 3B).

[0111] The results of these experiments show that the isolated precursor cells are capable of myogenic and adipogenic differentiation.

EXAMPLE 6: OPTIMIZATION OF THE MYOGENIC DIFFERENTIATION

[0112] The known methods for myogenic differentiation use serum-containing culture media and are characterized by often low efficiency. The purpose was therefore to achieve high efficiency of the differentiation with exclusive use of natural, physiological processes, i.e. without chemical or genetic manipulation.

[0113] For the induction of the differentiation, methionine-reduced or methionine-free medium was used, which, without wishing to be bound to theoretical considerations, probably leads to the expression of myogenic genes (MyoD and MyoG) via a DNA demethylation.

[0114] In the differentiation experiments, the following media were used: [0115] “FCS”: DMEM high glucose, 2% FCS (fetal calf serum), 0.1% P/S (penicillin/streptomycin) [0116] “HS”: DMEM high glucose, 10% HS (horse serum), 0.1% P/S [0117] “HS+AZA”: DMEM high glucose, 5% HS, 0.1% P/S, 10 μM azacytidine [0118] “−Met+Glu”: DMEM high glucose −MQC (DMEM high glucose without methionine, glutamine, cystine, Gibco, 21013-024), 5% HS, 0.1% P/S, 4 mM L-glutamine [0119] “2.5 μM Met”: DMEM high glucose −MQC, 5% HS, 0.1% P/S, 2 mM L-glutamine, 2.5 μM L-methionine [0120] “5 μM Met”: DMEM high glucose −MQC, 5% HS, 0.1% P/S, 2 mM L-glutamine, 5 μM L-methionine

[0121] The cell line used was the murine cell line C2C12. The results are shown in FIG. 4, in which comparatively the standard medium (with reduced serum concentration=FCS), the chemical induction (medium with 10 μM 5-azacytidine=HS+AZA), and media without methionine (but supplemented with 4 mM glutamine=−Met+Glu) or with reduced methionine concentration (2.5 μM supplemented with 2 mM glutamine=2.5 μM Met) are compared, respectively. It was also tested whether it is more favorable to discontinue the differentiation medium after 48 hours. Since no optimizing effect occurred, the differentiation medium was left in the preparation for 5 days.

[0122] For the determination of the myogenic differentiation, antibodies against the muscle protein desmin (mouse anti-desmin, clone D-33, DAKO) and one antibody against myosin (MF 20, anti-sarcomere (MHC), in-house production with hybridoma cultures provided by Dr Julia v. Maltzahn, Leibnitz Institute on Ageing, Jena) were used. FIG. 4 shows stainings with MF 20, since the expression of sarcomere myosin is particularly relevant for differentiation success.

[0123] The variation in time of the different batches (FIG. 4) clearly shows that the medium developed by us even shows a greater differentiation success than the standard medium.

[0124] The differentiation begins sooner, the muscle fibers lie more densely and they appear visually thicker.

[0125] The methods with methionine-free or with methionine-reduced media, respectively, give significantly better results than the standard method (reduction of FCS) or the chemical method, and this already in normal 2D culture. In particular, the fusion rate is higher (see also: more cell nuclei in myotubes), the myotubes are bigger and occupy a greater total area. Table 2 shows corresponding measurement results on day 4.

TABLE-US-00001 TABLE 2 Quantification of differentiation results (day 4) FCS HS + Aza −met + Glu 2.5 μm met Cell nuclei*overall 2020 ± 148 .sup.A .sup. 2991 ± 246 .sup.B    2856 ± 148 .sup.B 2870 ± 95 .sup.B  Cell nuclei in myotubes**  90 ± 14 .sup.A 136 ± 5 .sup.A, B  466 ± 72 .sup.C 427 ± 55 .sup.C Cell nuclei content in myo-   4 ± 0.5 .sup.A   5 ± 0.4 .sup.A, B 16 ± 3 .sup.C 15 ± 2 .sup.C tubes (%) = fusion rate Area of myotubes (μm.sup.2) 20 ± 2 .sup.A 16 ± 1 .sup.A, B 29 ± 2 .sup.C 34 ± 3 .sup.C Number of myotubes .sup. 75 ± 4 .sup.  .sup. 74 ± 6      .sup. 57 ± 9*** .sup. 86 ± 7 .sup.  Myotubes total area (%) 12 ± 1 .sup.A  9 ± 1 .sup.A, B 18 ± 1 .sup.C 21 ± 2 .sup.C Ø myotube size (μm.sup.2)  0.3 ± 0.03 .sup.A   0.2 ± 0.006 .sup.A, B    .sup. 0.5 ± 0.07 .sup.C, D.sup.         0.4 ± 0.005 .sup.A, C, D.sup.  Different capital letters (A-D) mark significant (P < 0.05) differences between the particular differentiation conditions. *Here: myonuclei; **myotubes have at least 2 cell nuclei/myonuclei; ***the lower value results from detachment of formed myotubes owing to excessive myotube density in the culture vessel, which is connected with the differentiation process proceeding more rapidly in methionine-free medium.

[0126] Differentiation could also be achieved with UC-MSC in methionine-free medium (FIG. 5A). Further, it could be shown that UC-MSC in methionine-free medium already spontaneously form microtissue under the conditions of a conventional 2D culture (FIG. 5B).

EXAMPLE 7: CULTURE IN “HANGING DROP”

[0127] In order to further support the differentiation process, to impart structure and depth, respectively, to the subsequent product, and to achieve a meat-like texture, the new differentiation medium was used in combination with the “hanging drop” culture technique, in order to produce complex, three-dimensional microtissues. These microtissues can be the basis for the production of cell-based meat products. As well as shaped meat (steak- or schnitzel-like), this can also be unshaped meat products (e.g. like minced meat, burger meat) or sausage.

[0128] For this, cells were suspended in differentiation medium and then pipetted onto lids of culture vessels which are filled with phosphate-buffered saline. Next, the lids are placed on the vessels, in order to prevent drying out of the cultures. The process was tested again with C2C12 cells in 2 cell densities and with various differentiation media.

[0129] Differentiation Protocol: Gravitation

[0130] 1. Preparation of a Suspension Culture [0131] Wash C2C12 cells (80% confluent) 2× with PBS [0132] Briefly rinse with trypsin-EDTA solution (0.25% trypsin, 0.53 mM EDTA), to remove medium/FCS residues. [0133] Add 2-3 ml of the trypsin-EDTA solution (0.25% trypsin, 0.53 mM EDTA) to the dish (10 cm) and observe under the microscope when the cells are detached (about 5-15 min at room temperature). [0134] If the cells detach with difficulty: incubate at 37° C. [0135] Add fresh, complete (with FCS) growth medium (6-8 ml), carefully resuspend cells [0136] Transfer cells into 15 ml tubes [0137] Add 40 μl of a 10 mg/ml DNAse stock solution and incubate 5 mins at RT [0138] Briefly vortex and then centrifuge down (200×G, 5 mins) [0139] Remove and discard supernatant, wash cells 2× with 1 ml of growth medium [0140] Centrifuge and take up in 2 ml of medium, count and adjust half to [0141] (1) 5×10.sup.3 cells/ml or [0142] (2) 2.5×10.sup.3 cells/ml.

[0143] 2. Establish Hanging Drop Culture [0144] Fill bottom of a 6 cm culture dish with 5 ml PBS [0145] Turn the lid of the culture dish over and pipette 20 μl drops (1, 10,000 cells/drop) or 10 μl drops (2, 25,000 cells/drop) into the lid with a pipette, e.g. at cell density (1) 10×20 μl drops/dish, with cell density (2) 20×10 μl drops/dish [0146] Place the lid on the PBS-filled dish and place in the incubator. [0147] Incubate until cell layers or aggregates form, respectively, mostly after 24-72 hrs.

[0148] The formation of differentiating, 3-dimensional micro-aggregates takes place within 2-3 days, during which exclusively the aggregation and interaction of the cells (self-organization) owing to gravity and in the case of our novel differentiation medium the naturally triggered demethylation drive the process. Since the cells were stimulated for the formation of their own extracellular matrix structures, no artificial scaffold substances had to be used. Examples of results are shown in FIG. 6.

LITERATURE

[0149] AOAC International Official Methods for Analysis 17th Edition, AOAC International, Gaithersburg, Md., 2000 [0150] Arutyunyan et al., 2016. Stem Cells Internat Vol 2016, dx.doi.org/10.1155/2016/6901286 [0151] Bastian et al. (1985), J Assoc Off Anal Chem 68(5):876-880 [0152] Beeravolu et al. (2016). Stem Cell Res 16: 696-711 [0153] Cardaso et al. (2012), BMC Biotechnology 12:18; www.biomedcentral.com/1472-6750/12/18 [0154] Carlin et al., 2006. Reprod Biol Endocrinol 4: 8; DOI: 10.1186/1477-7827-4-8 [0155] Conconi et al., 2006. Int J Mol Med 18:1089-1096 [0156] Corotchi et al., 2013. Stem Cell Res Ther 4:81; DOI: 10.1186/scrt232 [0157] Hoynowski et al., 2007. Biochem Biophysic Res Comm 362:347-353; [0158] DOI:10.1016/j.bbrc.2007.07.182 [0159] Ishige et al., 2009, Int J Hematol 90:261-269 [0160] Kocaefe et al., 2010. Stem Cell Rev & Rep 6:512-522 [0161] Marcus-Sekura et al., 2011. Biologicals 39:359-369. [0162] Moretti et al. 2010, AdvBiochem Engin/Biotechnol 123: 29-54 [0163] Pham et al., (2016). Cell Tissue Bank 17: 289-302 [0164] Shivakumar et al., 2016. J Cell Biochem 117: 2397-2412. [0165] Simonne et al., (1997), Journal of the Science of Food and Agriculture 73(1):39-45 [0166] Stephens et al. 2018. Trends in Food Science & Technology 78: 155-166. [0167] Thorrez & Vandenburgh. 2019. Nat Biotechnol 37: 215-226. [0168] Wang et al, 2004. Stem Cells 22:1330-1337

TABLE-US-00002 TABLE 1 Primers for detection of gene expression, all primers are derived from Sus scrofa sequences. Product Gene Sequence (SEQ ID No:) length Reference Sequence Comments NTSE fwd: CGTGGCGCGACTTTCTACCA (1) 167 XM_001227005.4 -rev-primer at exon 2- (CD73) rev: CCAGGGCCATGGCATCGTAA (2) 3 transition THY-1 fwd: TCGCTCTCTTGCTAACAGTCTTGC (3) 128 NM_001146129.1 -fwd-primer at exon 1- (CD90) rev: CTGAATGGGCAGGTTGGTGGT (4) 2 transition ENG fwd: TCAGCAACGAGTGGTCGTC (5) 243 NM_214031.1 -fwd-primer at exon 9- (CD105) rev: CCACGTCAGGCCCCAGATTC (6) 10 transition, rev- primer in exon 12 Nanog fwd: TCGACACCGAGACTGTCTCTCC (7) 188 ENSSSCT -fwd-primer at exon 1- rev: ACAGAGCTGGGTCTGCGAGA (8) 00000062427.1 2 transition POU5F1 fwd: CCCGCCCTATGACTTCTGCG (9) 220 NM_001113060.1 -rev-primer at the (Oct-4) rev: CTGGGACTCCTCGGGGTTCG (10) exon transition Sox2 fwd: CAGTGGTCAAGTCCGAGGCG (11) 209 NM 001123197.1 -only one exon known, rev: TGTACCGTTGATGGCCGTGC ( 12) no exon-spanning primer CD14 fwd: TGCCAAATAGACGACGAAGA (13) 385 NM_001097445.2 -no exon-spanning rev: ACGACACATTACGGAGTCTGA (14) last 3 bases of exon one are CDS′ start primer available since codon CD34 fwd: TGAAACCTCACTGCCTGCTGC (15) 272 NM_214086.1 -fwd primer is exon- rev: AGGGTCTTCGCCCAGCCTTTCT (16) spanning, primer pair also covers two introns