METHOD OF SYNTHESIZING SINGLE-STRANDED NUCLEOTIDE SEQUENCE, BLOCKED NUCLEOSIDE TRIPHOSPHATES AND RELATED METHODS

20230148152 · 2023-05-11

    Inventors

    Cpc classification

    International classification

    Abstract

    There is provided a method of synthesizing a single-stranded nucleotide sequence, the method comprising adding a blocked nucleoside triphosphate to an initiator nucleotide sequence to incorporate a corresponding blocked nucleotide thereto in the presence of a polymerase, wherein the blocked nucleoside triphosphate has one of the general formulae (I), (II), (III), (IV), (V) and (VI).

    Claims

    1. A method of synthesizing a single-stranded nucleotide sequence, the method comprising: (i) adding a blocked nucleoside triphosphate to an initiator nucleotide sequence to incorporate a corresponding blocked nucleotide thereto in the presence of a polymerase, wherein the blocked nucleoside triphosphate has one of the general formulae (I), (II), (III), (IV), (V) and (VI): ##STR00050## ##STR00051## wherein n=0 or 1; m=0 to 20; R.sup.z is H or OH; R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.a, R.sup.b and R.sup.c are each independently selected from hydrogen, alkyl, alkenyl, aryl and heteroaryl; R.sup.7 is selected from hydrogen, alkyl, halogen, —OR.sup.19, —NR.sup.20R.sup.21 and —SR.sup.22, wherein R.sup.19, R.sup.20, R.sup.21 and R.sup.22 are independently selected from hydrogen, alkyl, alkenyl, aryl and heteroaryl; R.sup.8, R.sup.9, R.sup.10, R.sup.11, R.sup.12, R.sup.13, R.sup.14, R.sup.15, R.sup.16, R.sup.17 and R.sup.18 are independently selected from hydrogen, alkyl, alkenyl, aryl and heteroaryl; X is a heteroatom selected from O, S and NH; Y.sup.1 and Y.sup.2 are independently selected from S and Se; and Z is a chemical moiety that is capable of being released under suitable conditions to trigger removal of the adjacent benzyl linker.

    2. The method of claim 1, wherein Z is NO.sub.2.

    3. The method of claim 1, wherein R.sup.a, R.sup.b and R.sup.c are each methyl.

    4. The method of claim 1, further comprising (ii) removing a removable terminating group from the incorporated blocked nucleotide to obtain a corresponding nucleotide that is unblocked at the 3′-O position.

    5. The method of claim 4, further comprising (iii) adding a blocked nucleoside triphosphate of any one of the general formulae (I), (II), (III), (IV), (V) and (VI) to the 3′-O position of the unblocked nucleotide obtained in step (ii) in the presence of a polymerase; and (iv) optionally repeating step (ii) and/or (iii) one or more times until a single-stranded nucleotide sequence of a desired length is obtained.

    6. The method of claim 1, wherein the polymerase is a template independent polymerase, optionally wherein the polymerase comprises terminal deoxynucleotidyl transferase (TdT) and/or polymerase theta (POLQ).

    7. (canceled)

    8. The method of claim 4, wherein the step (ii) of removing the removable terminating group is adapted to be carried out in aqueous conditions.

    9. The method of claim 5, wherein each step of the method is adapted to be carried out in aqueous conditions.

    10. The method of claim 1, wherein the nucleobase is selected from the group consisting of adenine (A), cytosine (C), guanine (G), thymine (T), uracil (U), uric acid, isocytosine, isoguanine, 2-aminopurine, 2,6-diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N-6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine, uracil-5-oxy acetic acid, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-S-oxyacetic acid, 5-methyl-2-thiouracil and 3-(3-amino-3-N-2-carboxypropyl) uracil.

    11. The method of claim 1, wherein the method is substantially devoid of the formation of side products that are reactive to the nucleobases of the nucleotide sequence.

    12. The method of claim 1, wherein the single-stranded nucleotide sequence comprises a single-stranded deoxynucleotide sequence.

    13. The method of claim 1, wherein the initiator nucleotide sequence comprises a single-stranded deoxynucleotide sequence or part thereof.

    14. The method of claim 1, wherein the blocked nucleoside triphosphate comprises a deoxyribonucleoside triphosphate, optionally wherein the deoxyribonucleoside triphosphate is selected from the group consisting of deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate and deoxythymidine triphosphate.

    15. (canceled)

    16. The method of claim 1, wherein the blocked nucleoside triphosphate is selected from the following: ##STR00052## ##STR00053## ##STR00054## ##STR00055## ##STR00056## wherein nucleobase is selected from the group consisting of adenine (A), cytosine (C), guanine (G), uracil (U) and thymine (T).

    17. The method of claim 5, wherein step (i) and/or (iii) comprises forming a phosphodiester linkage between the initiator nucleotide sequence and the blocked nucleoside triphosphate.

    18. The method of claim 5, wherein step (i) and/or (iii) comprises release of a pyrophosphate.

    19. A blocked nucleoside triphosphate for the method of claim 1, the blocked nucleoside triphosphate having any one of the general formulae (I), (II), (III), (IV), (V) and (VI): ##STR00057## ##STR00058## wherein n=0 or 1; m=0 to 20; R.sup.z is H or OH; R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.a, R.sup.b and R.sup.c are each independently selected from hydrogen, alkyl, alkenyl, aryl and heteroaryl; R.sup.7 is selected from hydrogen, alkyl, halogen, —OR.sup.19, —NR.sup.20R.sup.21 and —SR.sup.22, wherein R.sup.19, R.sup.20, R.sup.21 and R.sup.22 are independently selected from hydrogen, alkyl, alkenyl, aryl and heteroaryl; R.sup.8, R.sup.9, R.sup.10, R.sup.11, R.sup.12, R.sup.13, R.sup.14, R.sup.15, R.sup.16, R.sup.17 and R.sup.18 are independently selected from hydrogen, alkyl, alkenyl, aryl and heteroaryl; X is a heteroatom selected from O, S and NH; Y.sup.1 and Y.sup.2 are independently selected from S and Se; Z is a chemical moiety that is capable of being released under suitable conditions to trigger removal of the adjacent benzyl linker, and with the proviso that when n=0, R.sup.1 and R.sup.2 are both not hydrogen.

    20. The blocked nucleoside triphosphate of claim 19, wherein Z is NO.sub.2.

    21. The blocked nucleoside triphosphate of claim 19, wherein R.sup.a, R.sup.b and R.sup.c are each methyl.

    22. The blocked nucleoside triphosphate according to claim 19 selected from the following: ##STR00059## ##STR00060## ##STR00061## ##STR00062## wherein nucleobase is selected from the group consisting of adenine (A), cytosine (C), guanine (G), uracil (U) and thymine (T).

    23.-26. (canceled)

    Description

    BRIEF DESCRIPTION OF FIGURES

    [0107] FIG. 1A is a graph showing the overall full mass spectrum of CE-dTTP reversible terminator (1). FIG. 1B is a graph showing a section of the spectrum zoomed into the m/z range of from about 260 to about 580.

    [0108] FIG. 2A is a graph showing .sup.1H NMR spectrum of DT-dTTP nucleoside precursor (14). FIG. 2B is a graph showing .sup.13C NMR spectrum of DT-dTTP nucleoside precursor (14). FIG. 2C is a graph showing the overall full mass spectrum of DT-dTTP reversible terminator (2). FIG. 2D is a graph showing a section of the spectrum zoomed into the m/z range of from about 330 to about 720.

    [0109] FIG. 3A is a graph showing the overall full mass spectrum of AL/ALM-dTTP reversible terminator (4). FIG. 3B is a graph showing a section of the spectrum zoomed into the m/z range of from about 260 to about 600.

    [0110] FIG. 4A is a graph showing the overall full mass spectrum of PNBA-dTTP reversible terminator (5). FIG. 4B is a graph showing a section of the spectrum zoomed into the m/z range of from about 320 to about 700.

    [0111] FIG. 5 is a schematic diagram 100 for illustrating a tailing experiment design developed for evaluating the incorporation and termination activities of the nucleoside triphosphate reversible terminators (RT-dTTPs) designed in accordance with various embodiments disclosed herein.

    [0112] FIG. 6A shows polyacrylamide gel electrophoresis (PAGE) patterns of DT-dTTP reversible terminator (2), SEM-dTTP reversible terminator (3), AL-dTTP reversible terminator (4), PNBA-dTTP reversible terminator (5) and DMA-dTTP reversible terminator (6), tested alongside comparative examples namely, TBS-dTTP, ALE-dTTP, ONBA-dTTP and DTM-dTTP using the tailing experiment design (with recombinant TdT as enzyme). FIG. 6B shows the polyacrylamide gel electrophoresis (PAGE) patterns post stained with SYBR Gold).

    [0113] FIG. 7A shows polyacrylamide gel electrophoresis (PAGE) patterns of DT-dTTP reversible terminator (2) using the tailing experiment design (with recombinant TdT as enzyme). FIG. 7B shows the polyacrylamide gel electrophoresis (PAGE) patterns post stained with SYBR Gold. Lane 1 denotes reaction 1: FAM-20-mer+DT-dTTP/desalting+dATP/desalting; Lane 2 denotes reaction 2: FAM-20-mer+dATP/desalting; Lane ss denotes FAM-20-mer; and Lane L denotes 10 bp DNA ladder.

    [0114] FIG. 8A and FIG. 8B show polyacrylamide gel electrophoresis (PAGE) patterns of DT-dTTP reversible terminator (2), SEM-dTTP reversible terminator (3), AL-dTTP reversible terminator (4), PNBA-dTTP reversible terminator (5) and DMA-dTTP reversible terminator (6), tested alongside comparative examples namely, TBS-dTTP, ALE-dTTP, ONBA-dTTP, DTM-dTTP and Ac-dTTP using the tailing experiment design (with engineered TdT as enzyme).

    [0115] FIG. 9A and FIG. 9B show the polyacrylamide gel electrophoresis (PAGE) patterns of FIG. 8A and FIG. 8B respectively post stained with SYBR Gold. The conditions are as follows: 15% Urea PAGE, 150V, 7A, 53 minutes taken for blue dye to reach edge.

    [0116] FIG. 10A shows the polyacrylamide gel electrophoresis (PAGE) patterns of CE-dTTP reversible terminator (1) and Az-dTTP (with engineered TdT as enzyme) versus CE-dTTP reversible terminator (1) and Az-dTTP (with recombinant TdT as enzyme). FIG. 10B shows the polyacrylamide gel electrophoresis (PAGE) patterns post stained with SYBR Gold.

    [0117] FIG. 11 shows polyacrylamide gel electrophoresis (PAGE) patterns of CE-dTTP reversible terminator (1) and DT-dTTP reversible terminator (2), tested alongside comparative example Az-dTTP using the laddering experiment design.

    [0118] FIG. 12 is a schematic diagram 200 for illustrating an experimental design developed for evaluating the reversibility of the nucleoside triphosphate reversible terminators (RT-dTTPs) designed in accordance with various embodiments disclosed herein.

    [0119] FIG. 13 shows polyacrylamide gel electrophoresis (PAGE) patterns of CE-dTTP reversible terminator (1) obtained from the reversibility screening experiments. Lane 1 denotes incorporation: reaction 1-5′-FAM-20 mer+CE-dTTP; Lane 2 denotes incorporation+elongation: reaction 2-5′-FAM-20 mer+25+CE-dTTP+dATP; Lane 3 denotes incorporation+capping+elongation: 5′-FAM-20 mer+CE-dTTP+Az-ddGTP+dATP; Lane 4 denotes incorporation+capping+deprotection+elongation: reaction 4-5′-FAM-20 mer+CE-dTTP+Az-ddGTP+deprotection+dATP; Lane 5 denotes incorporation+deprotection+elongation: reaction 5-5′-FAM-20 mer+CE-dTTP+deprotection+dATP.

    [0120] FIG. 14 shows polyacrylamide gel electrophoresis (PAGE) patterns of CE-dTTP reversible terminator (1) obtained from the reversibility screening experiments. Lane 1 is loaded with 10 bp ladder; Lane 2 (reverse) is loaded with FAM-20-mer+CE-dTTP+Az-ddGTP+CE deprotection+dATP; Lane 3 (non reverse) is loaded with FAM-20-mer+CE-dTTP+Az-ddGTP+dATP; Lane 4 (no tailing) is loaded with FAM-20-mer+CE-dTTP+Az-ddGTP; and Lane 5 (no CE-dTTP) is loaded with FAM-20-mer+Az-ddGTP+CE deprotection+dATP.

    [0121] FIG. 15 shows polyacrylamide gel electrophoresis (PAGE) patterns of DT-dTTP reversible terminator (2) obtained from the reversibility screening experiments. Lane 1 (reverse) is loaded with FAM-20-mer+DT-dTTP+Az-ddGTP+DT deprotection+dATP; Lane 2 (non reverse) is loaded with FAM-20-mer+DT-dTTP+Az-ddGTP+dATP; Lane 3 (no DT-dTTP) is loaded with FAM-20-mer+Az-ddGTP+DT deprotection+dATP; and Lane 4 is loaded with FAM-20-mer.

    EXAMPLES

    [0122] Example embodiments of the disclosure will be better understood and readily apparent to one of ordinary skill in the art from the following examples, tables and if applicable, in conjunction with the figures. It should be appreciated that other modifications related to structural, and chemical changes may be made without deviating from the scope of the invention. Example embodiments are not necessarily mutually exclusive as some may be combined with one or more embodiments to form new example embodiments. The example embodiments should not be construed as limiting the scope of the disclosure.

    Example 1: Nucleoside Triphosphate Reversible Terminators

    [0123] The chemical structures of seven examples of nucleoside triphosphate reversible terminators designed in accordance with various embodiments disclosed herein are shown in Scheme 4 below (see Examples (1) to (7) in the scheme). These nucleoside triphosphate reversible terminators (1) to (7) are blocked at the 3′-O position respectively by removable terminating groups (RT) namely 2-cyanoethyl ether (herein termed “CE”), 2-(tert-butyldisulfanyl)ethyl carbonate or disulfide carbonate (herein termed “DT”), 2-(trimethylsilyl)ethoxymethyl (herein termed “SEM”), (allyloxy)methyl (herein termed “AL” or “ALM”), 4-nitrobenzyloxy-methyl (herein termed “PNBA”), dithianemethyl acetal (herein termed “DMA”) and (2-cyanoethoxy)methyl (herein termed “CEM”).

    ##STR00039##

    [0124] For comparative purposes, a total of seven other nucleoside triphosphate reversible terminators that are blocked at the 3′-position was also synthesized and analysed alongside Examples (1) to (7). The comparative examples are blocked at the 3′-O position respectively by acetate ester (herein termed “Ac”), tert-butyldimethylsilyl ether (herein termed “TBS”), levulinic ester (herein termed “LE”), acetal levulinyl ester (herein termed “ALE”), 2-nitrobenzyloxy-methyl (herein termed “ONBA”), disulfide methyl ether (herein termed “DTM”) and azidomethyl (herein termed “Az”).

    [0125] Advantageously, the nucleoside triphosphate reversible terminators designed in accordance with various embodiments disclosed herein are recognized by template independent polymerases and cleavage of the removable terminating/blocking groups can be performed under a wide range of reaction conditions. The cleavage of the removable terminating/blocking groups enables a process elongating the nucleic acid sequence through a series of iteration cycles, thereby showing that these nucleoside triphosphate reversible terminators are successful in enzymatic synthesis of nucleic acids.

    [0126] In the following examples, the results demonstrated the utility of these nucleoside triphosphate reversible terminators in single base addition to single-stranded nucleotide sequence catalysed by commercial/engineered template-independent terminal deoxynucleotidyl transferase (TdT) enzyme as the polymerase (Scheme 5).

    ##STR00040##

    [0127] On the other hand, synthesis of single-stranded nucleotide sequence was not successful or inferior with the seven comparative examples (as listed in Scheme 4) under mild reaction conditions (e.g. substantially aqueous conditions).

    [0128] Accordingly, it will be appreciated by a person skilled in the art that the design of the nucleoside triphosphate reversible terminators in accordance with various embodiments disclosed herein requires careful architecture to work. Such designs are not easily conceived and are not merely obvious modification of existing protecting groups for the purpose of synthesizing single-stranded nucleotide sequence. It will also be appreciated that it is not easy to be able to arrive at alternative novel protecting/terminating groups that work with polymerases such as TdT under mild reaction conditions (e.g. substantially aqueous conditions).

    Example 2: Synthesis of Nucleoside Triphosphate Reversible Terminators

    [0129] The respective synthesis procedures for 2-cyanoethyl ether (CE)-dTTP reversible terminator (1), disulfide carbonate (DT)-dTTP reversible terminator (2), 2-(trimethylsilyl)ethoxymethyl (SEM)-dTTP reversible terminator (3), (allyloxy)methyl (ALM)-dTTP reversible terminator (4), 4-nitrobenzyloxy-methyl (PNBA)-dTTP reversible terminator (5), dithianemethyl acetal (DMA)-dTTP reversible terminator (6) and (2-cyanoethoxy)methyl (CEM)-dTTP reversible terminator (7) are provided in detail below.

    Materials and Methods

    [0130] All reactions were carried out under an argon atmosphere with dry solvents under anhydrous conditions. Water, ethyl acetate (EtOAc), methylene chloride (CH.sub.2Cl.sub.2), and petroleum ether were purchased at the highest commercial quality and used without further purification. Reagents were purchased at the highest commercial quality and used without further purification. Yields refer to chromatographically and spectroscopically (.sup.1H NMR) homogeneous materials. Reactions were monitored by thin-layer chromatography (TLC) carried out on 0.25 mm E. Merck silica gel plates (60F-254) using UV light as visualizing agent and a solution of potassium permanganate and heat as developing agents. E. Merck silica gel (60, particle size 0.040-0.063 mm) was used for flash-column chromatography. Dioxane and dimethylformamide (DMF) were freshly taken from the solvent purification system (SPS) machine. Pyridine was refluxed over calcium hydride (CaH.sub.2) for 2 h before being distilled at atmospheric pressure. Tributylamine was distilled under vacuum over CaH.sub.2 at 120° C. (without molecular sieves). NMR spectra were recorded on a Bruker DRX-400 (400 MHz) instrument and calibrated using residual non deuterated solvent as an internal reference. IR spectra were recorded on a Perkin-Elmer Spectrum One FTIR spectrometer with diamond ATR accessory. High-resolution mass spectra (HRMS) were recorded on an Agilent ESI TOF (time-of-flight) mass spectrometer at 3.5 kV emitter voltage.

    Synthesis of 2-Cyanoethyl Ether (CE)-dTTP Reversible Terminator (1)

    [0131] Scheme 6 shows the reaction scheme for the synthesis of CE-dTTP nucleoside triphosphate reversible terminator (1).

    ##STR00041##

    5′-O-dimethoxytrityl-N3-benzoylthymidine (8)

    [0132] To a solution of 5′-O-(dimethoxytrityl)thymidine (7) (506 mg, 0.93 mmol) in CH.sub.3CN (15 mL) was added N,O-Bis(trimethylsilyl)acetamide (BSA, 456 μL, 1.86 mmol) and the solution was heated at 90° C. for 1 h. After cooling down to 25° C., triethylamine (258 μL, 1.86 mmol) and benzoyl chloride (130 μL, 1.30 mmol) were added and the medium was stirred for 16 h before tetra-n-butylammonium fluoride (TBAF, 1 M in THF, 2.8 mL, 2.8 mmol) was added and stirring was continued for 1 h. After concentration under vacuum, the residue was dissolved in ethyl acetate (AcOEt) and washed with sat. NaHCO.sub.3 and water. The organic layer was dried over Na.sub.2SO.sub.4, concentrated and the crude product was purified by silica gel chromatography (5%, 10% then 20% of AcOEt in CH.sub.2Cl.sub.2) to afford 5′-O-dimethoxytrityl-N3-benzoylthymidine (8) as a white solid (513 mg, 85%).

    5′-O-dimethoxytrityl-3′-O-(2-cyanoethyl)-N.SUB.3.-benzoylthymidine (9)

    [0133] To a suspension of 5′-O-dimethoxytrityl-N3-benzoylthymidine (8) (500 mg, 0.77 mmol) in t-BuOH (7 mL) were added acrylonitrile (1 mL, 15.2 mmol) and Cs.sub.2CO.sub.3 (300 mg, 0.92 mmol). After 16 h at 25° C., the medium was filtered over Celite®, the filtrate was concentrated and .sup.1H and .sup.13C NMR NMR spectra showed pure 5′-O-dimethoxytrityl-3′-O-(2-cyanoethyl)-N.sub.3-benzoylthymidine (9) which was directly used in the next step.

    3′-O-(2-cyanoethyl)-thymidine (10)

    [0134] Crude 5′-O-dimethoxytrityl-3′-O-(2-cyanoethyl)-N3-benzoylthymidine (9) was suspended in ammonia (7 M in MeOH, 8 mL) and deionized water (2 mL). The initial heterogeneous solution homogenized over time and after 3 h the medium was concentrated under vacuum. The residue was dissolved in CH.sub.2Cl.sub.2, washed with deionized water and the organic layer was concentrated before CH.sub.2Cl.sub.2 (10 mL) and dichloroacetic acid (600 μL, 7.26 mmol) were added. After 15 min, the deep orange solution was concentrated and the residue was purified by silica gel chromatography (CH.sub.2Cl.sub.2/AcOEt 1/1, then CH.sub.2Cl.sub.2/CH.sub.3OH 95/5) to provide 3′-O-(2-cyanoethyl)-thymidine (10) as a white foam (141 mg, 62% over three steps).

    [0135] 2-cyanoethyl ether (CE)-dTTP nucleoside precursor (10) was then converted to nucleoside triphosphate (1) via Ludwig-Eckstein triphosphate synthesis (Scheme 10).

    [0136] The CE-dTTP reversible terminator (1) was characterized by HRMS. HRMS (ESI−): m/z calcd for C.sub.13H.sub.19N.sub.3O.sub.14P.sub.3 [M−H].sup.− 534.0080, found 534.0104. The mass spectrum of (1) is shown in FIG. 1.

    Synthesis of Disulfide Carbonate (DT)-dTTP Reversible Terminator (2)

    [0137] Scheme 7 shows the reaction scheme for the synthesis of DT-dTTP nucleoside precursor (14).

    ##STR00042##

    Carbonate (13):

    [0138] To a solution of 2-(tert-butyldisulfanyl)ethyl-(4-nitrophenyl)-carbonate (12) (156 mg, 0.47 mmol) in CH.sub.2Cl.sub.2 (9 mL) were added 5′-O-(4,4′-Dimethoxytrityl)thymidine (11) (284 mg, 0.52 mmol) and DMAP (57 mg, 0.47 mmol) at 25° C. After 16 h, washings with sat. NaHCO.sub.3 and water, most of the yellow color (i.e., nitrophenol) went in the aq. layer. Purification on silica (petroleum ether/ethyl acetate: 7/3 then 1/1) provided 319 mg of the desired carbonate (92% yield).

    Carbonate (14):

    [0139] To a solution of the above carbonate (401 mg, 0.54 mmol) in CH.sub.2Cl.sub.2 (12 mL) was added DCA (250 μL, 2.8 mmol) and after 1 h, the TLC showed a clean DMT deprotection. After 2.5 h, the reaction mixture was concentrated and loaded on silica gel for purification (petroleum ether/ethyl acetate: 7/3, 1/1 then 3/7) to give 199 mg of a white foam (85% yield). The .sup.1H NMR and .sup.13C NMR spectra of (14) are provided in FIGS. 2A and 2B respectively.

    [0140] The disulfide carbonate (DT)-dTTP nucleoside precursor (14) was then converted to nucleoside triphosphate (2) via Ludwig-Eckstein triphosphate synthesis (Scheme 10). The DT-dTTP reversible terminator (2) was characterized by HRMS, the mass spectrum of (2) is shown in FIGS. 2C and 2D. HRMS (ESI−): m/z calcd for C.sub.17H.sub.28N.sub.2O.sub.16P.sub.3S.sub.2 [M−H].sup.− 673.0099, found 673.0116.

    Synthesis of 2-(Trimethylsilyl)Ethoxymethyl (SEM)-dTTP Reversible Terminator (3)

    [0141] Scheme 8 shows the reaction scheme for the synthesis of SEM-dTTP nucleoside precursor (17).

    ##STR00043##

    5′-O-dimethoxytrityl-N3-benzoylthymidine (8)

    [0142] To a solution of 5′-O-(dimethoxytrityl)thymidine (7) (506 mg, 0.93 mmol) in CH.sub.3CN (15 mL) was added N,O-Bis(trimethylsilyl)acetamide (BSA, 456 μL, 1.86 mmol) and the solution was heated at 90° C. for 1 h. After cooling down to 25° C., triethylamine (258 μL, 1.86 mmol) and benzoyl chloride (130 μL, 1.30 mmol) were added and the medium was stirred for 16 h before tetra-n-butylammonium fluoride (TBAF, 1 M in THF, 2.8 mL, 2.8 mmol) was added and stirring was continued for 1 h. After concentration under vacuum, the residue was dissolved in ethyl acetate (AcOEt) and washed with sat. NaHCO.sub.3 and water. The organic layer was dried over Na.sub.2SO.sub.4, concentrated and the crude product was purified by silica gel chromatography (5%, 10% then 20% of AcOEt in CH.sub.2Cl.sub.2) to afford 5′-O-dimethoxytrityl-N3-benzoylthymidine (8) as a white solid (513 mg, 85%).

    Acetal (16):

    [0143] To a solution of 5′-O-dimethoxytrityl-N3-benzoylthymidine (8) (200 mg, 0.308 mmol) in CH.sub.2Cl.sub.2 (3 mL) were added N,N-Diisopropylethylamine (DIPEA, 161 μL, 0.924 mmol) and 2-(Trimethylsilyl)ethoxymethyl chloride (72 μL, 0.616 mmol). After 16 h at 25° C., more 2-(trimethylsilyl)ethoxymethyl chloride (36 μL, 0.308 mmol) was added and the medium was stirred further for 24 h. The solution was then diluted with CH.sub.2Cl.sub.2, washed with aq. NaHCO.sub.3 (sat.) and the organic layer was dried over Na.sub.2SO.sub.4. Half of the CH.sub.2Cl.sub.2 was removed under reduced pressure and to the resulting solution of acetal (15) was added dichloroacetic acid (DCA, 203 μL, 2.47 mmol). After 1 h at 25° C., the medium was concentrated and the residue was purified by silica gel chromatography (gradient CH.sub.2Cl.sub.2/AcOEt 97.5/2.5 to 80/20) to provide acetal (16) as a white foam (83 mg, 57% over two steps).

    Acetal (17):

    [0144] To a suspension of acetal (16) (83 mg, 0.174 mmol) in CH.sub.3OH (1.93 mL) was added ammonia (7M in CH.sub.3OH, 2 mL, 14 mmol) and the medium was stirred at 25° C. for 16 h. The volatiles were evaporated under vacuum and the residue was purified by silica gel chromatography (gradient CH.sub.2Cl.sub.2/CH.sub.3OH 100/0 to 97.5/2.5) to provide acetal (17) as a colorless oil (48 mg, 74%).

    [0145] The 2-(trimethylsilyl)ethoxymethyl (SEM)-dTTP nucleoside precursor (17) was then converted to nucleoside triphosphate (3) via Ludwig-Eckstein triphosphate synthesis (Scheme 10).

    Synthesis of (Allyloxy)Methyl (ALM)-dTTP Reversible Terminator (4), 4-Nitrobenzyloxy-Methyl (PNBA)-dTTP Reversible Terminator (5), Dithianemethyl Acetal (DMA)-dTTP Reversible Terminator (6) and (2-Cyanoethoxy)Methyl (CEM)-dTTP Reversible Terminator (7)

    [0146] Scheme 9 shows the reaction scheme for the synthesis of ALM-dTTP nucleoside precursor (22a), PNBA-dTTP nucleoside precursor (22b), DMA-dTTP nucleoside precursor (22c) and CEM-dTTP nucleoside precursor (22d) respectively.

    ##STR00044##

    3′-O-(Methylthiomethyl)-5′-O-(tert-butyldimethylsilyl)thymidine (19)

    [0147] To a solution of 5′-O-(tertbutyldimethylsilyl) thymidine (18) (4.0 g, 11.2 mmol) in DMSO (20 mL) were added AcOH (10 mL) and Ac.sub.2O (30 mL) at 25° C. After 48 h, sat. NaHCO.sub.3 and ethyl acetate were added and the aqueous layer was extracted with ethyl acetate. The combined organic layers were washed with water, dried over Na.sub.2SO.sub.4 and after filtration and concentration, the residue was purified on silica gel (petroleum ether/ethyl acetate 9/1, 7/3 then 65/35), giving 4.63 g of thioether (19) at a colorless gum (99%).

    Procedure for the Synthesis of Acetals (21a-d):

    [0148] To a suspension of dried thioether (19) (1 eq.) and freshly activated 4 Å molecular sieve (˜0.5-1 g/mmol of substrate) at 0° C. were added alcohol 20a, 20b, 20c or 20d (1.1-1.6 eq.), NIS (1.1 eq.) and trifluoromethanesulfonic acid (0.05-0.1 eq.) and the solution was stirred for 1 h. The medium was quenched with 1 M sodium sulfite followed by slow addition of NaHCO.sub.3 and the organic layer was dried over Na.sub.2SO.sub.4. After filtration and concentration under vacuum, the residue was purified on silica gel (petroleum ether/ethyl acetate) to provide the corresponding acetal 21a, 21b, 21c, 21d (63%, 42%, 10%, and 38%, respectively) and 22d (20%).

    Procedure for the Synthesis of Acetals (22a-d):

    [0149] To a solution of acetals 21a, 21b, 21c or 21d in THF (0.05 M) was added triethylamine trihydrofluoride (5 eq.) and the resulting solution was stirred in a plastic container for 4 days. The medium was then concentrated under vacuum and the residue was purified on silica gel (CH.sub.2Cl.sub.2/CH.sub.3OH) to provide the corresponding acetal 22a, 22b, 22c and 22d (89%, 65%, 68%, and 72%, respectively).

    [0150] The (allyloxy)methyl (ALM)-dTTP nucleoside precursor (22a), 4-nitrobenzyloxy-methyl (PNBA)-dTTP nucleoside precursor (22b), dithianemethyl acetal (DMA)-dTTP nucleoside precursor (22c) and (2-cyanoethoxy)methyl (CEM)-dTTP nucleoside precursor (22d) were then respectively converted to nucleoside triphosphates (4), (5), (6) and (7) via Ludwig-Eckstein triphosphate synthesis (Scheme 10).

    [0151] The ALM-dTTP reversible terminator (4) was characterized by HRMS. HRMS (ESI−): m/z calcd for C.sub.14H.sub.22N2015P.sub.3 [M−H].sup.− 551.0233, found 551.0250. The mass spectrum of (4) is shown in FIG. 3.

    [0152] The PNBA-dTTP reversible terminator (5) was characterized by HRMS. HRMS (ESI−): m/z calcd for C.sub.18H.sub.23N3017P.sub.3 [M−H].sup.− 646.0240, found 646.0257. The mass spectrum of (5) is shown in FIG. 4.

    Synthesis of Nucleoside Triphosphate Reversible Terminators (1-7) Respectively from Nucleosides (10), (14), (17) and (22a-d)

    [0153] Scheme 10 shows the general reaction scheme for the synthesis of nucleoside triphosphates from their corresponding nucleosides/precursors. The nucleoside triphosphate reversible terminators were prepared from the 5′-hydroxy precursors using a method developed by Ludwig and Ecktein (J. Org. Chem. 1989, 54, 631-635) and modified by Hollenstein, M. et al. (J. Vis. Exp. 2014, 86, e51385), the contents of which are fully incorporated by reference.

    ##STR00045##

    [0154] Nucleoside (10), (14), (17) or (22a-d) (dried under vacuum for 16 h, ˜0.2 mmol) was dissolved in a minimum of dry pyridine (0.4 mL). Then, dry dioxane (0.8 mL) and 2-chloro-1,3,2-benzodioxaphosphorin-4-one (˜0.24 mmol) were added and the reaction was stirred at 25° C. for 45 min. A pyrophosphate solution was prepared by mixing tributylammonium pyrophosphate (dried under vacuum for 16 h, ˜ 0.26 mmol) in dry DMF (0.35 mL) with freshly distilled tributylamine (˜0.50 mmol). The cloudy and heterogenous solution obtained was added to the reaction mixture (a white precipitate appears but quickly disappeared to a yellow solution) and stirred at 25° C. for 45 min. A solution of iodine (˜0.32 mmol) in pyridine/H.sub.2O (100 μL/20 μL) was added and the resulting dark solution was stirred at 25° C. for 30 min before a 10% aqueous solution of Na.sub.2S.sub.2O.sub.3 was added to quench the excess of iodine. The volatiles were evaporated under reduced pressure (NBu.sub.3 and DMF could not be removed), water (3 ml) was added and the mixture was allowed to stand at 25° C. for 1 h to hydrolyze the cyclic triphosphate moiety (observation of a white precipitate). The aqueous solution was washed with CH.sub.2Cl.sub.2 before being concentrated at 35° C. under vacuum. Methanol was added to the residue to lead to a precipitate which was sonicated and centrifuged to remove the methanol. This operation was repeated two times and the final residue was dried under vacuum. Purification by reverse-phase HPLC using TBAB and CH.sub.3CN as mobile phase afforded the desired nucleoside triphosphates (1) to (7).

    Example 3: Deprotection of Reversible Terminators

    [0155] The deprotection mechanisms for removing the removable terminating groups from the 3′-position of the reversible terminators are described as follows. Advantageously, the nucleoside triphosphate reversible terminators designed in accordance with various embodiments disclosed herein possess unique features such that they can be removed under mild reaction conditions. In particular, the removal of the removable terminating groups can be performed in aqueous conditions.

    Deprotection of 2-cyanoethyl ether (CE) and/or (2-cyanoethoxy)methyl (CEM)

    [0156] The deprotection of the CE and/or CEM groups can be performed in basic conditions at temperatures ranging from 25° C. to 80° C., as shown in Scheme 11. For example, aqueous solutions of ammonia (NH.sub.4OH) can be used to successfully remove the CE group.

    ##STR00046##

    Deprotection of Disulfide Carbonate (DT) or Carbamate

    [0157] The deprotection of disulfide carbonate or carbamate group can be performed in a reductive environment at 25° C., as shown in Scheme 12. For example, aqueous solutions of dithiothreitol (DTT) or tris(2-carboxyethyl)phosphine) (TCEP) can be used to successfully remove the disulfide carbonate or carbamate group.

    [0158] In particular, the disulfide bond (or disulfide self-immolative linker) in disulfide carbonate or carbamate can be cleaved under aqueous reductive conditions and subsequent cyclization of the resulting thiol can restore the 3′-hydroxy of the nucleotide. An important aspect of this mechanism is that the 5-membered ring released is an unreactive species unable to react with the nucleobases of the nucleotide sequence or oligonucleotide.

    ##STR00047##

    Deprotection of 2-(Trimethylsilyl)Ethoxymethyl (SEM)

    [0159] The deprotection of the SEM group can be performed in a mildly basic environment or in aqueous solutions of fluoride sources like tetra-n-butylammonium fluoride (TBAF) or potassium fluoride (KF).

    Deprotection of (Allyloxy)Methyl (ALM)

    [0160] The deprotection of the ALM group can be performed in the presence of transition metal(s), as shown in Scheme 13. Examples of transition metals include but are not limited to palladium, ruthenium, rhodium and platinum salts.

    ##STR00048##

    Deprotection of 4-Nitrobenzyloxy-Methyl (PNBA)

    [0161] The deprotection of the PNBA group can be performed in a reductive environment followed by an exposure to acidic conditions, as shown in Scheme 14. Alternatively, the nitro group can be reduced in the presence of nitroreductase (NTR) enzyme or electrochemical conditions.

    ##STR00049##

    Deprotection of Dithianemethyl Acetal (DMA)

    [0162] The deprotection of the DMA group can be performed in a mild oxidative environment at 25° C. like in aqueous solutions of NaIO.sub.4, iodine, oxone or peroxides (e.g., H.sub.2O.sub.2). The deprotection of the DMA group can also be performed in sodium periodate, followed by subjecting to mild basic conditions at a pH of about 8, in the presence of a base. Examples of the base include but are not limited to potassium carbonate (K.sub.2CO.sub.3) and aniline (PhNH.sub.2).

    Example 4: Incorporation of Reversible Terminators into Nucleic Acids

    [0163] A series of screening experiments were designed and conducted to test the recognition of the reversible terminators nucleoside triphosphate reversible terminators designed in accordance with various embodiments disclosed herein by template-independent polymerase and the efficiency of the incorporation of such reversible terminators into the nucleic acid chain. In these experiments, the template-independent polymerase used is recombinant or engineered template-independent terminal deoxynucleotidyl transferase (TdT) enzyme and the initiator used is a single-stranded oligonucleotide sequence.

    Materials Used in Screening Experiments

    FAM-20-mer: [FAM]TGTAGTGTCTTGTTCTGTGA (SEQ. ID NO. 1)

    [0164] rTdT: recombinant terminal deoxynucleotidyl transferase (TdT)
    eTdT: engineered terminal deoxynucleotidyl transferase (TdT)
    RT-dTTP: reversibly terminated deoxythymidine triphosphate

    [0165] Terminal deoxynucleotidyl transferase (TdT) is an enzyme that catalyzes the addition of mononucleotides from dTTPs to the terminal 3′-OH of a DNA initiating sequence, accompanied by the release of inorganic pyrophosphate. The enzyme thus provides a unique method for the base by base enzymatic incorporation.

    [0166] Reversibly terminated deoxynucleotidyl triphosphates (RT-dNTPs) provided building blocks to be used in TdT catalyzed enzymatic nucleotide synthesis.

    [0167] Two screening methods were used to evaluate the RT-dNTPs' incorporation capabilities with TdT and termination activity. One method is tailing experiment design and the other is laddering experiment design.

    Example 5: Evaluating RT-dNTP(s)'s Incorporation and Termination Activities Using Tailing Experiment Design

    [0168] In this experimental design (FIG. 5), single-stranded deoxyoligonucleotides (20 nt) 102 with FAM tagged on 5′ end reacts with RT-dNTP 104 using TdT as the catalyst, and produce 21-mer (102a and 102b).

    [0169] As the incorporation is not 100%, the unreacted FAM tagged oligo will further react with natural deoxynucleotidyl triphosphates (dATP) 106, and produces tailing products 102c. The 21-mer (102a and 102b) and tailing products (102c) can be separated by polyacrylamide gel electrophoresis.

    Experimental Protocol for Tailing Experimental Design

    Incorporation of RT-dNTP to the 3′ Termini of Single-Stranded DNA Primers (FAM-20-Mer):

    [0170] 1. Set up the following reactions

    TABLE-US-00001 TdT 5 × Buffer 4.0 μL Primer 2 pmole (FAM-20-mer) (1 μL of 2 μM) RT-dTTP 8 nmol (10 mM) (0.8 μL of 10 mM) rTdT 10-20 units (0.5 μL of original solution) Water to a final 20 μL volume of

    [0171] 2. Incubate the solution at 37° C. for 60 min

    [0172] 3. Purification [0173] Desalt with Zymo column Oligo Clean & Concentrator D4061 (following manufacturer's protocol) to obtain 15 μL aqueous solution and concentrate on speedvac to dry

    [0174] Elongation of Nucleotide with Natural dATP:

    [0175] 4. Set up the following reactions

    TABLE-US-00002 TdT 5 × Buffer 4.0 μL Dry sample 2 pmol from step 3 (0 μL) dATP (10 mM) 8 nmol (0.8 μL of 10 mM) rTdT 10-20 units (0.5 μL of original solution) Water to a final 20 μL volume of

    [0176] 5. Incubate at 37° C. for 60 min

    [0177] 6. Stop the reaction by heating at 70° C. for 10 min

    [0178] 7. Purification [0179] Desalt with Zymo column Oligo Clean & Concentrator D4061 (following manufacturer's protocol) to obtain 15 μL aqueous solution and concentrate on speedvac to dry

    [0180] 8. Denaturing PAGE (20% urea PAGE, 200V for 90 min) [0181] Preheat 1×TBE buffer at 65° C. [0182] Set up gel in gel tank, flush wells, pre-run 20% urea polyacrylamide gel at 200V for 30 min [0183] Prepare loading sample (dry sample+2.5 μL 1×TBE, 0.5 μL loading buffer), preheat sample at 95° C. for 10 min [0184] Flush each well 3 times to remove urea in wells, load sample, and run for 90 min [0185] Image under UV light without post staining. If post staining is needed, SYBR Gold is used.

    Evaluation Studies Using Tailing Experimental Design

    [0186] In evaluating the RT-dTTP(s)'s incorporation and termination activities using tailing experiment design, two types of TdTs are used for the evaluation studies: recombinant TdT (rTdT) purchased from Promega and engineered TdT (eTdT).

    [0187] Screening of RT-dTTPs with rTdT as Enzyme

    [0188] DT-dTTP reversible terminator (2), SEM-dTTP reversible terminator (3), AL-dTTP reversible terminator (4), PNBA-dTTP reversible terminator (5) and DMA-dTTP reversible terminator (6) were tested alongside comparative examples namely, TBS-dTTP, ALE-dTTP, ONBA-dTTP and DTM-dTTP.

    [0189] The results obtained from screening RT-dTTPs with rTdT as enzyme are shown in FIG. 6A (FAM only) and FIG. 6B (which was post stained with SYBR Gold). As shown in FIG. 6A, when using rTdT as the enzyme, SEM-dTTP, PNBA-dTTP and DMA-dTTP gave 21-mer products, which indicated that these RT-dTTPs designed in accordance with various embodiments disclosed herein have been successfully incorporated into the original FAM-20-mer.

    [0190] DT-dTTP showed particularly good yield of 21-mer, as can be seen from FIG. 7.

    [0191] Screening of RT-dTTPs with eTdT as Enzyme

    [0192] DT-dTTP reversible terminator (2), SEM-dTTP reversible terminator (3), AL-dTTP reversible terminator (4), PNBA-dTTP reversible terminator (5) and DMA-dTTP reversible terminator (6) were tested alongside comparative examples namely, TBS-dTTP, ALE-dTTP, ONBA-dTTP, DTM-dTTP and Ac-dTTP.

    [0193] The results obtained from screening RT-dTTPs with eTdT as enzyme are shown in FIG. 8A and FIG. 8B (FAM only). The results post stained with SYBR Gold are shown in FIG. 9A and FIG. 9B.

    [0194] As shown in FIG. 8A and FIG. 8B, when using eTdT as the enzyme, SEM-dTTP, DT-dTTP, PNBA-dTTP, DMA-dTTP and AL-dTTP gave 21-mer products, which indicated that these RT-dTTPs designed in accordance with various embodiments disclosed herein have been successfully incorporated into the original FAM-20-mer.

    [0195] Summary of Results

    [0196] As can be seen from the reactions above, it can be concluded that SEM-dTTP, DT-dTTP, PNBA-dTTP, DMA-dTTP and AL-dTTP can be successfully incorporated in single stranded oligonucleotide via the catalysis of TdT and also terminate further base incorporation.

    [0197] Screening of RT-dTTPs Using rTdT Vs. eTdT

    [0198] Using Az-dTTP and CE-dTTP, the catalytic activity of rTdT was compared with that of eTdT as shown in FIG. 10A (FAM only) and FIG. 10B (post stained with SYBR Gold). The results shown in FIG. 10 indicated that the engineered eTdT has much high incorporation yield than rTdT.

    Example 6: Evaluating RT-dNTP(s)'s Incorporation and Termination Activities Using Laddering Experiment Design

    [0199] The laddering experiment design is to differentiate the ratio between natural dNTP and RT-dNTP. If RT-dNTP can be successfully incorporated and terminated the reaction, the results of the enzymatic synthesis will be a mixture of incorporation products.

    Experimental Protocol for Laddering Experimental Design

    Laddering Experiment Design:

    [0200]

    TABLE-US-00003 Rxn 1 - 5′-FAM-20-mer + 100% dATP Rxn 2 - 5′-FAM-20-mer + 25% dATP + 75% RT-dTTP Rxn 3 - 5′-FAM-20-mer + 2.5% dATP + 97.5% RT-dTTP Rxn 4 - 5′-FAM-20-mer + 0.25% dATP + 99.75% RT-dTTP Rxn 5 - 5′-FAM-20-mer + 100% RT-dTTP Rxn 6 - 5′-FAM-20-mer + 100% RT-dTTP (no TdT)

    Incorporation of RT-dTTP to the 3′ Termini of Single-Stranded DNA Primers:

    [0201] 1. Set up the following reactions

    TABLE-US-00004 Promega TdT 5 × Buffer 4 μL Primer (FAM-20mer) 2 pmol (μL of 2 μM) dATP (10 mM) X % of 8 nmol (0.8 μL of 10 mM) RT-dTTP (10 mM) (100-X) % of 8 nmol (0.8 μL of 10 mM) rTdT 10-20 units (0.5 μL of original solution) Water to a final 20 μL volume of

    [0202] 2. Incubate at 37° C. for 60 min

    [0203] 3. Stop the reaction by heating at 70° C. for 10 min

    [0204] 4. Purification [0205] Desalt with Zymo column Oligo Clean & Concentrator D4061 (following manufacturer's protocol) to obtain 15 μL aqueous solution and concentrate on speedvac to dry

    [0206] 5. Denaturing PAGE (20% urea PAGE, 200V for 90 min) [0207] Preheat 1×TBE buffer at 65° C. [0208] Set up gel in gel tank, flush wells, pre-run 20% urea polyacrylamide gel at 200V for 30 min [0209] Prepare loading sample (dry sample+2.5 μL 1×TBE, 0.5 μL loading buffer), preheat sample at 95° C. for 10 min [0210] Flush each well 3 times to remove urea in wells, load sample, and run for 90 min [0211] Image under UV light without post staining. If post staining is needed, SYBR Gold is used.

    Evaluation of Studies Using Laddering Experimental Design

    [0212] From the laddering experiments as shown in FIG. 11, it is shown clearly that CE-dTTP and DT-dTTP can terminate the reaction as well as Az-dTTP.

    Example 7: Evaluation of Reversibility of Reversible Terminators

    [0213] Once RT-dTTP is incorporated to the single-stranded oligonucleotide, the reversible terminator needs to be removed to enable the next base incorporation. To evaluate the reversibility of reversibly terminators, as shown in FIG. 12, RT-dTTPs 204 are first incorporated to single-stranded oligonucleotides (FAM-20-mer) 202 by eTdT. The reaction will produce a mixture of products which includes the reversibly terminated 21-mer (202a and 202b) and unreacted original 20-mer 202. Then azido-ddGTP 206 will be added to 3′-termini of the unreacted 20-mer 202. As 3′ termini become a dideoxynucleotide 202c, the azido oligonucleotide will not be able to further react with any dTTP via TdT. Then reversibly terminator will be removed in certain conditions, and further incorporated with natural dTTP 208 via TdT. If there are tailing products (202f and 202 g), it indicates that reversibly terminator has been successfully removed.

    Experimental Protocol for Evaluating CE's Reversibility

    Incorporation of CE-dTTP to the 3′ Termini of Single-Stranded DNA Primers (FAM-20-Mer):

    [0214] 1. Set Up the Following Reactions

    TABLE-US-00005 TdT 5 × Buffer 4.0 μL Primer (FAM-20-mer) 2 pmol (1 μL of 2 μM) RT-dTTP (10 mM) 8 nmol (0.8 μL of 10 mM) eTdT 10-20 units (0.5 μL of original solution) Water to a final 20 μL volume of

    [0215] 2. Incubate the solution at 37° C. for 60 min

    [0216] 3. Purification [0217] Desalt with Zymo column Oligo Clean & Concentrator D4061 (following protocol) to obtain 15 μL aqueous solution and concentrate on speedvac to dry

    Removal of CE:

    [0218] 4. Add 85 μL of 30% NH.sub.4OH and heat at 80° C. for 1 h

    [0219] 5. Purification [0220] Desalt with Zymo column Oligo Clean & Concentrator D4061 (following protocol) to obtain 15 μL aqueous solution and concentrate on speedvac to dry
    Elongation of Nucleotide with Natural dATP:

    [0221] 6. Set up the following reactions

    TABLE-US-00006 TdT 5 × Buffer 4.0 μL Dry sample 2 pmol from step 3 (0 μL) dATP (10 mM) 8 nmol (0.8 μL of 10 mM) rTdT 10-20 units (0.5 μL of original solution) Water to a 20 μL final volume of

    [0222] 7. Incubate at 37° C. for 60 min

    [0223] 8. Stop the reaction by heating at 70° C. for 10 min

    [0224] 9. Purification [0225] Desalt with Zymo column Oligo Clean & Concentrator D4061 (following protocol) to obtain 15 μL aqueous solution and concentrate on speedvac to dry

    [0226] 10. Denaturing PAGE (20% urea PAGE, 200V for 90 min) [0227] Preheat 1×TBE buffer at 65° C. [0228] Set up gel in gel tank, flush wells, pre-run 20% urea polyacrylamide gel at 200V for 30 min [0229] Prepare loading sample (dry sample+2.5 μL 1×TBE, 0.5 μL loading buffer), preheat sample at 95° C. for 10 min [0230] Flush each well 3 times to remove urea in wells, load sample, and run for 90 min [0231] Image under UV light without post staining. If post staining is needed, SYBR Gold is used.

    Experimental Protocol for Evaluating DT's Reversibility

    Incorporation of DT-dTTP to the 3′ Termini of Single-Stranded DNA Primers (FAM-20-Mer):

    [0232] 1. Set up the following reactions

    TABLE-US-00007 TdT 5 × Buffer 4.0 μL Primer 2 pmol (FAM-20-mer) (1 μL of 2 μM) DT-dTTP 8 nmol (10 mM) (0.8 μL of 10 mM) eTdT 10-20 units (0.5 μL of original solution) Water to a final 20 μL volume of

    [0233] 2. Incubate the solution at 37° C. for 60 min

    [0234] 3. Purification [0235] Desalt with Zymo column Oligo Clean & Concentrator D4061 (following protocol) to obtain 15 μL aqueous solution and concentrate on speedvac to dry

    Removal of DT:

    [0236] 4. Add 0.1 M DTT solution for 1 h

    [0237] 5. Purification [0238] Desalt with Zymo column Oligo Clean & Concentrator D4061 (following protocol) to obtain 15 μL aqueous solution and concentrate on speedvac to dry
    Elongation of Nucleotide with Natural dATP:

    [0239] 6. Set up the following reactions

    TABLE-US-00008 TdT 5 × Buffer 4.0 μL Dry sample 2 pmol from step 3 (0 μL) dATP 8 nmol (10 mM) (0.8 μL of 10 mM) rTdT 10-20 units (0.5 μL of original solution) Water to a final 20 μL volume of

    [0240] 7. Incubate at 37° C. for 60 min

    [0241] 8. Stop the reaction by heating at 70° C. for 10 min

    [0242] 9. Purification [0243] Desalt with Zymo column Oligo Clean & Concentrator D4061 (following manufacturer's protocol) to obtain 15 μL aqueous solution and concentrate on speedvac to dry

    [0244] 10. Denaturing PAGE (20% urea PAGE, 200V for 90 min) [0245] Preheat 1×TBE buffer at 65° C. [0246] Set up gel in gel tank, flush wells, pre-run 20% urea polyacrylamide gel at 200V for 30 min [0247] Prepare loading sample (dry sample+2.5 μL 1×TBE, 0.5 μL loading buffer), preheat sample at 95° C. for 10 min [0248] Flush each well 3 times to remove urea in wells, load sample, and run for 90 min [0249] Image under UV light without post staining. If post staining is needed, SYBR Gold is used.

    Reversibility Results of Reversible Terminators

    [0250] In this experiment, CE-dTTP and DT-dTTP were used as the reversible terminations for evaluation.

    [0251] As shown in FIG. 13 and FIG. 14, removal of CE was successful and 3′-OH was retrieved. FIG. 13 shows that 3′-CE can be deprotected and the retrieved 3′-OH can further react with dATP. As shown in FIG. 15, removal of DT was also successful. In summary, both CE and DT are successfully removed, and the resulted oligonucleotides are able to incorporate with natural dTTP after deprotection of CE or DT.

    [0252] Accordingly, it is shown that the method of synthesizing single-stranded nucleotide sequence is effective and the reversible terminators nucleoside triphosphate reversible terminators designed in accordance with various embodiments disclosed herein were successfully incorporated into single-stranded nucleotide sequences using recombinant or engineered template-independent terminal deoxynucleotidyl transferase (TdT) enzyme.

    [0253] It will be appreciated by a person skilled in the art that other variations and/or modifications may be made to the embodiments disclosed herein without departing from the spirit or scope of the disclosure as broadly described. For example, in the description herein, features of different exemplary embodiments may be mixed, combined, interchanged, incorporated, adopted, modified, included etc. or the like across different exemplary embodiments. The present embodiments are, therefore, to be considered in all respects to be illustrative and not restrictive.