ANTI-CD56 ANTIBODY-DRUG CONJUGATES AND THEIR USE IN THERAPY

Abstract

The invention relates to antibody-drug conjugates and to their use in therapy, in particular for treating CD56+ cancers.

Claims

1. A conjugate antibody-drug with the following formula (I): ##STR00037## in which: A is an anti-CD56 antibody or an antibody fragment; the attachment head is represented by one of the following formulae: ##STR00038## the linker is a cleavable linker represented by the following formula: ##STR00039## the spacer is represented by the following formula: ##STR00040## m is an integer from 1 to 10; n is an integer from 1 to 4.

2. The conjugate antibody-drug as claimed in claim 1, in which m is equal to 4 or 5.

3. The conjugate antibody-drug as claimed in claim 1, in which the cytotoxic drug is selected from methotrexate, IMIDs, duocarmycin, combretastatin, calicheamicin, monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), maytansine, DM1, DM4, SN38, amanitin, pyrrolobenzodiazepine, pyrrolobenzodiazepine dimer, pyrrolopyridodiazepine, pyrrolopyridodiazepine dimer, an inhibitor of histone deacetylase, an inhibitor of tyrosine kinase, and ricin, preferably MMAE.

4. The conjugate antibody-drug as claimed in claim 1, with the following formula: ##STR00041## ##STR00042##

5. The conjugate antibody-drug as claimed in claim 1, in which A is m906.

6. The conjugate antibody-drug as claimed in claim 1, with the following formula (Ia): ##STR00043## or with the following formula (Ia′): ##STR00044##

7. A composition comprising one or more antibody-drug conjugate(s) as claimed in claim 1.

8. The composition as claimed in claim 7, in which at least 50%, preferably approximately 60%, of the antibody-drug conjugates have an n equal to 4.

9. The composition as claimed in claim 7, in which A is an antibody and the mean Drug-to-Antibody Ratio (mean DAR) is comprised between 3.5 and 4, preferably comprised between 3.8 and 4, for example equal to 3.9±0.1.

10. The composition as claimed in claim 7, further comprising paclitaxel, docetaxel, doxorubicin and/or cyclophosphamide, lenalidomide, dexamethasone, carboplatin, etoposide and/or an antibody used in anti-cancer immunotherapy such as an anti-PD1 or an anti-PD-L1.

11. The conjugate antibody-drug as claimed in claim 1, for use as a drug.

12. The conjugate antibody-drug as claimed in claim 1, for use in the treatment of a CD56+ cancer, preferably melanoma, blastemal tumors, hemopathies such as acute myeloid leukemias, myelomas, blastic plasmacytoid dendritic cell neoplasms and neuroendocrinal carcinomas.

13. The conjugate antibody-drug for use as claimed in claim 12, in which the CD56+ cancer is selected from neuroendocrinal carcinomas such as small cell lung carcinoma or Merkel cell carcinoma, preferably Merkel cell carcinoma.

14. A method for the preparation of an antibody-drug conjugate as claimed in claim 1, comprising the following steps: (i) preparing a cytotoxic conjugate by coupling a attachment head with formula: ##STR00045## to a compound with formula: ##STR00046## in which: the linker is a cleavable linker selected from the following formulae: ##STR00047## the spacer is represented by the following formula: ##STR00048## X is Br, Cl, I or F; m is an integer from 1 to 10, advantageously from 2 to 7, from 3 to 6, advantageously equal to 4 or 5; and (ii) reacting the cytotoxic conjugate obtained in step (i) with an anti-CD56 antibody or an anti-CD56 antibody fragment.

15. The method for the preparation of an antibody-drug conjugate as claimed in claim 14, comprising a step that consists of reacting MMAE 6-(2,6-bis(bromomethyl)pyridin-4-yl)amido-N-hexanamide-valine-citrulline-p-aminobenzoyl carbamate or MMAE 6-((2,6-bis(bromomethyl)pyridin-4-yl)amino)-6-oxohexanamide-valine-citrulline-p-aminobenzoyl carbamate with an anti-CD56 antibody or an anti-CD56 antibody fragment.

16. The composition as claimed in claim 7, for use as a drug.

17. The composition as claimed in claim 10, for use in the treatment of a CD56+ cancer, preferably melanoma, blastemal tumors, hemopathies such as acute myeloid leukemias, myelomas, blastic plasmacytoid dendritic cell neoplasms and neuroendocrinal carcinomas.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0109] FIG. 1 represents the HIC (Hydrophobic Interaction Chromatography) profile of an antibody-drug conjugate composition in accordance with the invention. The figure shows that the composition is enriched in DAR4, with more than 50% DAR4.

[0110] FIG. 2 represents a SEC (Size Exclusion Chromatography) analysis of an antibody-drug conjugate composition in accordance with the invention. The figure shows that the composition is extremely homogeneous, with more than 99% of monomer.

[0111] FIG. 3 represents a native mass spectrometric analysis on a Vion IMS Qtof mass spectrophotometer coupled to an Acquity UPLC H-Class system from Waters (Wilmslow, UK) of an antibody-drug conjugate composition in accordance with the invention. This method can be used to clearly identify each type of DAR. The figure shows that the composition is enriched in DAR4, with close to 75% DAR4.

[0112] FIG. 4 represents the expression of CD56 for different cell lines (4 of MCC and one breast cancer control line) by flow cytometry after incubation with the anti-CD56 antibody labeled with the fluorophore FITC (Fluorescein IsoThioCyanate).

[0113] FIG. 5A, FIG. 5B, FIG. 5C, FIG. 5D, FIG. 5E represent the evaluation of the performances of the ADC MF-m906-MMAE, compared with the m906 controls (non-coupled antibody), MF-TTZ-MMAE (ADC Trastuzumab coupled to MMAE) and MMAE (toxin alone) on the MCC cell lines (FIG. 5A: WaGa, FIG. 56: PeTa, FIG. 5C: MS-1 and FIG. 5D: MKL-2) and breast cancer cell line (FIG. 5E: SK-BR3). The experiments were carried out independently in duplicate (6 biological replicates/experiment). The results are expressed as the mean (+/−SEM) of the percentage obtained.

[0114] FIG. 6A-6C represent the evaluation of the specificity of MF-m906-MMAE in the WaGa lines after knock-down of CD56. The WaGa cells were transduced independently with lentiviral vectors containing two distinct shRNAs inducible by doxycycline (Dox) (A, B and C) and targeting the sequences of CD56. After antibiotic selection (puromycin), the cells were exposed to doxycycline for 7 days before evaluation. (A-B-C): Confirmation of knock-down of CD56 by real-time RT-qPCR (A) (*: p<0.05, the control cells without doxycycline were used as a reference), by Western blot (attenuated mass of CD56=140 KDa) (B). (C) Evaluation of the cytotoxic effect of MF-m906-MMAE on cells expressing CD56 (−Dox) or not expressing CD56 (+Dox) by using three different shRNAs (Sh RNA A, Sh RNA B and Sh RNA C). The experiments were carried out independently in duplicate (6 biological replicates/experiment). The results are expressed as the mean (+/−SEM) of the percentage obtained.

[0115] FIG. 7 illustrates the evaluation of the performances of the conjugate MF-m906-MMAE and the controls (PBS and MF-TTZ-MMAE, a Trastuzumab ADC coupled to MMAE) in a xenograft model of MCC. FIG. 7 represents the plots for relative tumor volume (mean+/−SEM) during the study. The relative tumor volumes (RTV) were calculated using the tumor volume for the start of the study as the reference (Volume at d0=100%). Each point represents the mean of the RTVs for the groups treated with MF-m906-MMAE, MF-TTZ-MMAE and PBS, the gray arrows indicating the time of the injections.

[0116] FIG. 8 illustrates the evaluation of the performances of the conjugate MF-m906-MMAE and the controls (PBS and MF-TTZ-MMAE, a Trastuzumab ADC coupled to MMAE) in a xenograft model of MCC. FIG. 8 represents the weight of the tumors at the end of the study in the experimental group and the control groups (*: p<0.05). The horizontal lines are the means, the quartiles and the limits.

[0117] FIG. 9 represents the evaluation of the performances of the ADC MF-m906-MMAE, compared with the controls m906 (non-coupled antibody), MF-TTZ-MMAE (Trastuzumab ADC coupled to MMAE) and MMAE (toxin alone) on the cell line for small cell lung cancer, H69. The experiments were carried out independently in triplicate (6 biological replicates/experiment). The results are expressed as the mean (+/−SEM) of the percentage obtained.

EXAMPLES

Example 1: Synthesis of a Cytotoxic Conjugate in Accordance with the Invention

General Reaction Scheme

[0118] ##STR00028##

[0119] (a) BnOH, SOCl.sub.2, DCM, 18 h, 75° C.; (b) APS, MeOH, H.sub.2O, H.sub.2SO.sub.4, 1 h, 50° C.; (c) H.sub.2, Pd/C, MeOH, 2 h, TA; (d) HATU, 2,6-lutidine, DMF, H.sub.2N—(CH.sub.2).sub.5—COOMe, 15 h, 0° C., then TA; (e) PBr.sub.3, MeCN, 2h, 45° C.; (f) LiOH, THF, H.sub.2O, 8.5 h, TA; (g) EEDQ, DIPEA, DMF, MeCN, H.sub.2N-VCPABC-MMAE, 2 h20, 25° C.

[0120] Detailed Reaction Scheme

Preparation of benzyl isonicotinate (2)

[0121] ##STR00029##

[0122] Isonicotinic acid (1) (5.00 g; 40.614 mmol; 1.0 eq) was dissolved in thionyl chloride (15 mL; 206.77 mmol; 5.1 eq) and heated under reflux overnight. After returning to ambient temperature, the excess thionyl chloride was eliminated by evaporation under reduced pressure, then the residue obtained was dissolved in anhydrous dichloromethane (55 mL). Benzyl alcohol was added (4.2 mL; 40.614 mmol; 1.0 eq) and the mixture was stirred under reflux for 10 h. After returning to ambient temperature, the reaction medium was neutralized with a saturated solution of sodium hydrogen carbonate and extracted with dichloromethane (3×100 mL). The organic phases were combined, washed with a saturated solution of sodium chloride, dried over magnesium sulfate and concentrated under reduced pressure. The product obtained was purified by flash chromatography (SiO.sub.2, cyclohexane/ethyl acetate 50:50) in order to give (2) (6.97 g; 80%) in the form of a colorless oil.

[0123] .sup.1H NMR (300 MHz, DMSO) δ 8.80 (dd; J=6.1; 1.6 Hz; 2H1,5), 7.86 (dd; J=6.1; 1.6 Hz, 2H2,4), 7.56-7.29 (m; 5H9-13), 5.39 (s; 2H7).

[0124] .sup.13C NMR (75 MHz, DMSO) δ 165.0 (1C.sub.6); 151.3 (2C.sub.1,5); 137.2 (1C.sub.3); 136.1 (1C.sub.8); 129.0 (2C.sub.10,12); 128.8 (1C.sub.11); 128.6 (2C.sub.9,13); 123.0 (2C.sub.2,4); 67.4 (1C.sub.7).

[0125] HRMS (ESI): calculated neutral mass for C.sub.13H.sub.11NO.sub.2 [M]: 213.0790; observed: 213.0796.

Preparation of benzyl 2,6-bis(hydroxymethyl)isonicotinate (3)

[0126] ##STR00030##

[0127] Benzyl isonicotinate (2) (2.48 g; 11.630 mmol; 1.0 eq) was dissolved in methanol (43 mL), stirred at 50° C. and concentrated sulfuric acid (320 μL; 6.016 mmol; 0.52 eq) was added. A solution of ammonium persulfate (26.500 g; 116.000 mmol; 10.0 eq) in water (43 mL) was added in two steps: a first rapid addition of 30 droplets; a white suspension was formed, then rapidly, drop by drop, for 5 min. The reaction ran away up to 75° C., then the yellow solution obtained was stirred at 50° C. for an additional 1 h. After returning to ambient temperature, the methanol was evaporated under reduced pressure. 50 mL of ethyl acetate was added and the medium was neutralized by addition of a saturated solution of sodium hydrogen carbonate. The aqueous phase was extracted with ethyl acetate (3×100 mL) and the combined organic phases were washed with a saturated solution of sodium chloride, dried over magnesium sulfate, then concentrated under reduced pressure. The impure product was purified by flash chromatography (SiO.sub.2, dichloromethane/methanol, 95:5) in order to give (3) (1.56 g; 49%) in the form of a beige solid.

[0128] .sup.1H NMR (300 MHz, DMSO) δ 7.81 (s; 2H.sub.2,4); 7.55-7.32 (m; 5H.sub.9-13); 5.60 (t; J=5.9 Hz; 2H.sub.15,17); 5.40 (s; 2H.sub.7); 4.59 (d; J=5.9 Hz; 4H14,16).

[0129] .sup.13C NMR (75 MHz, DMSO) δ 165.0 (1C6); 162.8 (2C.sub.1,5); 138.0 (1C.sub.3); 135.7 (1C.sub.8); 128.6 (2C.sub.10,12); 128.4 (1C.sub.11); 128.3 (2C.sub.9,13); 117.0 (2C.sub.2,4); 66.9 (1C.sub.7); 63.9 (2C.sub.14,16).

[0130] HRMS (ESI): calculated neutral mass for C.sub.15H.sub.15NO.sub.4 [M]: 273.1001; observed: 273.1001.

Preparation of 2,6-bis(hydroxymethyl)isonicotinic acid (4)

[0131] ##STR00031##

[0132] Benzyl 2,6-bis(hydroxymethyl)isonicotinate (3) (1.33 g; 4.867 mmol; 1.0 eq) was dissolved in methanol (50 mL) and the solution was degassed with argon for 15 min. Palladium on carbon, 10% by weight (133 mg) was added and the reaction medium was stirred at ambient temperature in an atmosphere of hydrogen for 2 h. The reaction medium was filtered over dicalite (rinsed with methanol). The filtrate was concentrated under reduced pressure in order to give (4) (849 mg; 95%) in the form of a beige solid.

[0133] .sup.1H NMR (300 MHz, DMSO) δ 7.78 (s; 2H.sub.2,4); 5.54 (s broad; 2H.sub.9,11); 4.59 (s; 4H.sub.8,10).

[0134] .sup.13C NMR (75 MHz, DMSO) δ 166.7 (106); 162.5 (2C.sub.1,5); 139.4 (1C.sub.3); 117.3 (2C.sub.2,4); 64.0 (2C.sub.8,10).

[0135] HRMS (ESI): calculated neutral mass for C81-19N04 [M]y 183.0532; observed: 183.0526.

Preparation of methyl 6-((2,6-bis(hydroxymethyl)pyridin-4-yl)amidohexanoate (5)

[0136] ##STR00032##

[0137] 2,6-bis(hydroxymethyl)isonicotinic acid (4) (50 mg; 0.273 mmol; 1 eq) was dissolved in anhydrous N,N-dimethylformamide (3.0 mL), the solution was cooled to 0° C., then HATU (156 mg; 0.410 mmol; 1.5 eq) and 2,6-lutidine (147.0 μL; 1.260 mmol; 4.7 eq) were added. The activation solution was stirred at 0° C. for 15 min, then methyl 6-aminohexanoate (59 mg; 0.322 mmol; 1.2 eq) was added. The walls of the flask were rinsed with 2 mL of anhydrous N,N-dimethylformamide and the reaction medium was stirred at ambient temperature for 15 h. The reaction mixture was diluted in ethyl acetate, washed three times with a saturated solution of sodium chloride, dried over magnesium sulfate, filtered and concentrated under reduced pressure. The product was purified by flash chromatography (dichloromethane/methanol, 90:10) in order to give (5) (76 mg; 91%) in the form of an off-white solid.

[0138] .sup.1H NMR (300 MHz, DMSO) δ 8.79 (t; J=5.6 Hz; 1H.sub.7); 7.71 (s; 2H.sub.2,4); 5.50 (t; J=5.8 Hz; 2H.sub.16,18); 4.57 (d; J=5.8 Hz; 4H.sub.15,17); 3.57 (s; 3H.sub.14); 3.25 (m; 2H.sub.8); 2.30 (t; J=7.4 Hz; 2H.sub.12); 1.62-1.45 (m; 4H.sub.9,11); 1.37-1.21 (m; 2H.sub.10).

[0139] .sup.13C NMR (75 MHz, DMSO) δ 173.3 (1C.sub.13); 165.1 (1C.sub.6); 161.8 (2.sub.1,5); 142.9 (1C.sub.3); 115.8 (2C.sub.2,4); 64.1 (2C.sub.15,17); 51.2 (1C.sub.14); 38.5 under DMSO peak (1C.sub.8); 33.2 (1C.sub.12); 28.6 (1C.sub.9); 25.9 (1C.sub.11); 24.2 (1C.sub.10).

[0140] HRMS (ESI): calculated neutral mass for C15H.sub.22N.sub.2O.sub.5 [M]: 310.1529; observed: 310.1526.

Preparation of methyl 6-(2,6-bis(bromomethyl)pyridin-4-yl)amidohexanoate (6)

[0141] ##STR00033##

[0142] Methyl 6-((2,6-bis(hydroxymethyl)pyridin-4-yl)amidohexanoate (5) (55 mg; 0.177 mmol; 1 eq) was taken up into suspension in anhydrous acetonitrile (10.5 mL) then phosphorus tribromide (50 μL; 0.532 mmol; 3.0 eq) was added dropwise. The reaction medium was stirred at 45° C. for 2 h. The solution was cooled to 0° C., neutralized with water (10 mL) and extracted with ethyl acetate (3×15 mL). The combined organic phases were washed with a saturated solution of sodium chloride, dried over magnesium sulfate and concentrated under reduced pressure. The product was purified by flash chromatography (SiO.sub.2, cyclohexane/ethyl acetate 60:40) in order to give (6) (57 mg; 74%) in the form of a white solid.

[0143] .sup.1H NMR (300 MHz; DMSO) δ 8.83 (t, J=5.6 Hz; 1H.sub.7); 7.84 (s; 2H.sub.2,4); 4.74 (s; 4H.sub.15,16); 3.57 (s, 3H.sub.14); 3.31-3.20 (m; 2H.sub.8); 2.31 (t; J=7.4 Hz; 2H.sub.12); 1.64-1.45 (m; 4H.sub.9,11); 1.39-1.22 (m, 2H.sub.10).

[0144] .sup.13C NMR (75 MHz, DMSO) δ 173.3 (1C.sub.13); 163.8 (1C.sub.6); 157.5 (2C.sub.1,5); 144.2 (1C.sub.3); 120.8 (2C.sub.2,4); 51.2 (1C.sub.14); 38.9 under DMSO peak (1C.sub.8); 34.1 (2C.sub.15,16); 33.2 (1C.sub.12); 28.5 (1C.sub.9); 25.9 (1C.sub.11); 24.2 (1C.sub.10).

[0145] HRMS (ESI): calculated neutral mass for C.sub.15H.sub.20Br.sub.2N.sub.2O.sub.3 [M]: 433.9841; observed: 433.9832.

Preparation of 6-(2,6-bis(bromomethyl)pyridin-4-yl)amidohexanoic acid (7)

[0146] ##STR00034##

[0147] Methyl 6-(2,6-bis(bromomethyl)pyridin-4-yl)amidohexanoate (6) (57 mg; 0.131 mmol; 1.0 eq) was dissolved in tetrahydrofuran (4 mL) and a solution of hydrated lithium hydroxide (8 mg; 0.327 mmol; 2.5 eq) in water (4 mL) was added slowly. The reaction medium was stirred at ambient temperature for 8.5 h. The tetrahydrofuran was evaporated off under reduced pressure and the aqueous residue was treated with an aqueous 1N hydrochloric acid solution and extracted with ethyl acetate (3×10 mL). The combined organic phases were washed with a saturated solution of sodium chloride, dried over magnesium sulfate and concentrated under reduced pressure. The product was purified by flash chromatography (dichloromethane/methanol, 90:10) in order to give (7) (44 mg; 80%) in the form of a white solid.

[0148] .sup.1H NMR (300 MHz; DMSO) δ 12.00 (s; 1H.sub.14); 8.83 (t; J=5.5 Hz; 1H.sub.7); 7.84 (s; 2H.sub.2,4); 4.74 (s; 4H.sub.15,17); 3.31-3.21 (m; 2H.sub.8); 2.21 (t; J=7.3 Hz; 2H.sub.12); 1.60-1.46 (m; 4H.sub.9,11); 1.39-1.25 (m; 2H.sub.10).

[0149] .sup.13C NMR (75 MHz; DMSO) δ 174.4 (1C.sub.13); 163.8 (1C.sub.6); 157.5 (2C.sub.1,5); 144.1 (1C.sub.3); 120.8 (2C.sub.2,4); 39.0 under DMSO peak (1C.sub.8); 34.1 (2C.sub.15,16); 33.6 (1C.sub.12); 28.6 (1C.sub.9); 26.0 (1C.sub.11); 24.2 (1C.sub.10).

[0150] HRMS (ESI): m/z calculated for C.sub.14H.sub.19Br.sub.2N.sub.2O.sub.3 [M+H].sup.+: 420.9757; observed: 420.9752.

Preparation of MMAE 6-(2,6-bis(bromomethyl)pyridin-4-yl)amido-N-hexanamide-valine-citrulline-p-aminobenzoyl carbamate (8)

[0151] ##STR00035##

[0152] In an inert atmosphere, in darkness and under anhydrous conditions, 6-(2,6-bis(bromomethyl)pyridin-4-yl)amidohexanoic acid (7) (13.2 mg; 0.0313 mmol; 2.28 eq) was dissolved in anhydrous acetonitrile (1.2 mL), then N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinoline (EEDQ) (21.2 mg; 0.0857 mmol; 6.25 eq) was added. The activation medium was stirred under 25° C. for 1 h 20. A solution of the trifluoroacetic acid salt of MMAE valine-citrulline-p-aminobenzoyl carbamate (17.0 mg; 0.0137 mmol; 1.0 eq), dissolved in anhydrous N,N-dimethylformamide (300 μL) in the presence of N,N-diisopropylethylamine (9.4 μL; 0.0537 mmol; 3.92 eq), was added to the activation medium. The reaction medium obtained was stirred at 25° C. for 1 h. The mixture was diluted 2-fold with N,N-dimethylformamide and purified by semi-preparative high pressure liquid chromatography (t.sub.R=22.1 min; on the Gilson PLC 2050 system [ARMEN V2 (pump) and ECOM TOYDAD600 (UV detector)], UV detection at 254 nm at 25° C.; Waters XBridge™ C-18 column; 5 μm (250 mm×19.00 mm); elution carried out with 0.1% of trifluoroacetic acid (by volume) in water (solvent A), and acetonitrile (solvent B); gradient 20% to 100% of B for 32 min, then 100% of B for 6 min at 17.1 mL/min) in order to give (8) (18.2 mg; 87%) in the form of a white solid.

[0153] .sup.1H NMR (300 MHz, DMSO) δ (ppm) 10.04-9.95 (m; 1H); 8.94-8.79 (m; 1H); 8.20-8.06 (m; 2H); 7.98-7.87 (m; 1H); 7.84 (s; 2H); 7.81 (s; 1H); 7.70-7.61 (m; 1H); 7.58 (d; J=8.2 Hz; 2H); 7.38-7.11 (m; 6H); 6.07-5.92 (m; 1H); 5.47-5.37 (m; 1H); 5.15-4.96 (m; 1H); 4.73 (s; 4H); 4.54-4.29 (m; 2H); 4.32-4.12 (m; 1H); 4.05-3.92 (m; 1H); 3.30-3.08 (m; 9H); 3.06-2.93 (m; 2H); 2.91-2.77 (m; 2H); 2.24-2.05 (m; 2H); 2.21-2.11 (m; 3H); 2.02-1.88 (m; 1H); 1.60-1.44 (m; 5H); 1.36-1.13 (m; 4H); 1.08-0.93 (m; 6H); 0.93-0.67 (m; 28H).

[0154] HRMS (ESI): m/z calculated for C.sub.72H.sub.111Br.sub.2N.sub.12O.sub.14 [M+H].sup.+: 1525.6704;

[0155] observed: 1525.6700.

Example 2: Synthesis of an Antibody-Drug Conjugate in Accordance with the Invention

[0156] Code for synthesized product: MF-m906-MMAE (corresponding to formula (Ia), also designated as the “antibody-drug conjugate in accordance with the invention” below or, in general, “ADC”).

[0157] Antibody used to produce the antibody-drug conjugate in accordance with the invention: m906.

[0158] Preparation of Solutions

[0159] Bioconjugation buffer: Saline buffer 1×, for example phosphate, borate, acetate, glycine, tris(hydroxymethyl)aminomethane, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid in a pH range comprised between 6 and 9, with a final concentration of NaCl comprised between 50 and 300 mM and a final concentration of EDTA comprised between 0.1 and 10 mM.

[0160] m906 at a concentration comprised between 1 and 10 mg/mL in the bioconjugation buffer.

[0161] Reducing agent: Solution of a reducing agent selected from dithiothreitol, β-mercaptoethanol, tris(2-carboxyethyl)phosphine hydrochloride, tris(hydroxypropryl)phosphine in a concentration comprised between 0.1 and 10 mM in the bioconjugation buffer.

[0162] Linker solution: compound 8 in a concentration comprised between 0.1 and 10 mM in a mixture of organic solvents selected from dimethylsulfoxide, N,N-dimethylformamide, methanol, tetrahydrofuran, acetonitrile, N,N-dimethylacetamide, dioxane.

[0163] Bioconjugation Reaction

[0164] In an inert atmosphere, the reducing agent (4 to 100 eq) was added to m906 in the bioconjugation buffer (1 mg; 1 eq), then it was incubated in its entirety between 15° C. and 40° C. for 0.25 to 3 h, then the solution of compound 8 (4 to 100 eq) was added in an inert atmosphere and the reaction medium was stirred between 15° C. and 40° C. for 0.5 to 15 h. This reaction was duplicated, in parallel, as many times as were necessary in order to obtain the desired final quantity of ADC, i.e. 18 times.

[0165] Purification of ADC

[0166] The reaction mixture was purified over PD-10 (GE Healthcare) with PBS

[0167] Gibco buffer, pH 7.4, as many times as were necessary in order to eliminate the residual chemical reagents, i.e. purified 3 times.

[0168] Result

[0169] The steps described above enabled 12.87 mg of MF-m906-MMAE (71%) to be obtained.

Example 3: Analyses of Antibody-Drug Coniuqate (MF-m906-MMAE)

[0170] HIC (Hydrophobic Interaction Chromatography) Analysis

[0171] Method and Apparatus

[0172] The ADC MF-m906-MMAE was diluted to 1 mg/mL with PBS, pH 7.4, before being filtered over 0.22 μm. 50 μg of the product was injected onto a MAbPac HIC-Butyl column, 5 μm, 4.6×100 mm (ThermoScientific), connected to a HPLC Waters Alliance system (e2695) equipped with a PDA (e2998) set for detection at 280 nm. The ADC MF-m906-MMAE was eluted at a rate of 1 mL/min by a gradient from 100% of buffer A (1.5 M ammonium sulfate, 50 mM monobasic sodium phosphate, 5% isopropanol (v/v), pH 7.0) to 20% of buffer B (50 mM monobasic sodium phosphate, 20% isopropanol (v/v), pH 7.0) in 2 minutes, then to 85% of buffer B in buffer A in 30 minutes, then this gradient was maintained for 1 min. The temperature was maintained at 25° C. throughout the separation.

[0173] The results obtained for MF-m906-MMAE are presented in FIG. 1, and in Table 1 below.

TABLE-US-00001 TABLE 1 MF-m906-MMAE DAR DAR DAR DAR DAR DAR 0 1 2 3 4 5 Retention time (min) 8.65 10.87 12.39 18.36 21.47 25.9 Area (%) 0.39 0.09 5.45 16.20 59.69 18.17 mean DAR 3.89

[0174] SEC (Size Exclusion Chromatography) Analysis

[0175] Method and Apparatus

[0176] The ADC MF-m906-MMAE was diluted to 1 mg/mL with PBS, pH 7.4, before being filtered over 0.22 μm. 50 μg of the product was injected onto an AdvanceBio SEC 2.7 μm column, 7.8×300 mm (Agilent Technologies), connected to a HPLC Waters Alliance system (e2695) equipped with a PDA (2998), set for detection at 280 nm. The ADC MF-m906-MMAE was eluted at a rate of 1 mL/min by an isocratic buffer C (1 mM monobasic sodium phosphate, 155 mM sodium chloride, 3 mM dibasic sodium phosphate, 3 mM sodium azide, pH 7.0) in 24 minutes. The temperature was maintained at 25° C. throughout the separation.

[0177] The results are presented in FIG. 2 and in Table 2 below.

TABLE-US-00002 TABLE 2 MF-m906-MMAE Aggregates Monomers Retention time (min) 4.862 8.253 Area (%) 0.64 99.36

[0178] Native MS Analysis (Native Mass Spectrometry)

[0179] Method and Apparatus

[0180] The mass spectrometric analysis was carried out on a Vion IMS Qtof mass spectrometer coupled to an Acquity UPLC H-Class system from Waters (Wilmslow, UK). Before the MS analysis, the samples (20 ug) were desalinated on a BEH SEC 2.1×150 mm 300 Å desalination column by an isocratic gradient (50 mM ammonium acetate, pH 6.5) at 40 μL/min. A bypass valve was programmed to allow the solvent to enter the spectrometer between 6.5 and 9.5 min only. The MS data were acquired in positive mode with an ESI source over a m/z range of 500 to 8000 at 1 Hz and analyzed using UNIFI 1.9 software and the MaxEnt algorithm for the deconvolution.

[0181] The results are presented in FIG. 3 and in Table 3 below.

TABLE-US-00003 TABLE 3 MF-m906- MMAE DAR 0 DAR 1 DAR 2 DAR 3 DAR 4 DAR 5 MW (Da).sup.1 n.o..sup.2 n.o..sup.2 152572 153945 155315 156686 Area (%) 0    0 0.7 17.0 74.5 7.7 mean DAR 3.89 .sup.1G0F/G0F glycosylation .sup.2n.o. = not observed [00036]

Example 4: In Vitro Evaluation of Antibody-Drug Conjugate MF-m906-MMAE

[0182] 4.1. Recognition of Tumor Cells by m906: Merkel Cell Carcinoma

[0183] Immunohistochemistry on Tumors from Patients

[0184] Method and Apparatus

[0185] Immunohistochemical labelling with a commercial anti-CD56 antibody (123C3, Ventana, Prediluted) was carried out on a cohort of 90 MCC tumors included in a micro array tissue using a benchMark XT platform and following the instructions of the supplier. The expression of CD56 was evaluated by a person skilled in the art using the following semi-quantitative score: 0: absence of expression, 1: weak and/or heterogenous positivity; 2: intense and diffuse positivity.

[0186] Results: In general, 66% of the cases were positives (n=59) with an intense and diffuse expression (score 2) detected in 37% of the cases (n=33).

[0187] Flow Cytometry and Immunohistochemistry on the MCC Lines

[0188] Method and Apparatus

[0189] In order to evaluate the expression of CD56 by the cell lines, the tumor cells were incubated in the presence of an anti-CD56 antibody coupled to FITC (BioLegend, clone: HCD56) or of the control isotype in accordance with the indications supplied by the manufacturer. The cells were then washed twice in PBS+1% fetal calf serum, then analysed.

[0190] For the evaluation of the fixation of m906 and trastuzumab (anti-HER2 antibody control) on the tumor cells, immunocytochemical labeling was carried out with the m906 antibody used at 650 ng/mL, or the trastuzumab antibody (Herceptin 150 mg Roche) at 40 ng/mL, then revealed with the aid of a secondary antibody coupled to peroxidase.

[0191] Tested Cell Lines

[0192] WaGa (RRID:CVCL_E998).

[0193] MS-1 (RRID:CVCL_E995).

[0194] PeTa (RRID:CVCL_LC73).

[0195] MKL-2 (RRID:CVCL_D027).

[0196] Results:

[0197] WaGa, MS-1, PeTa and MKL-2 cells are Merkel cell carcinoma cell lines (hereinafter MCC). All of the above lines are CD56-positive (FIG. 4).

[0198] SK-BR-3 (RRID:CVCL_0033): HER2-positive breast cancer line, selected as a control because it does not express CD56.

[0199] The fixations of m906 and of trastuzumab (TTZ), included as a control, were tested on the lines by immunohistochemical studies. This analysis demonstrated a fixation of m906 on all of the MCC lines, while no fixation was observed with TTZ (Table 4: confirmation of fixation of m906 on the MCC lines).

TABLE-US-00004 TABLE 4 Cell line WaGa MS-1 PeTa MKL-2 SKBR3 Fixation of m906 + + + + − Fixation of − − − − + Trastuzumab +: presence of a fixation of the antibody to the target cell revealed by peroxidase, − absence of fixation

[0200] Imaging Flow Cytometry—m906 and Coloration of Intracellular Compartment and Image Acquisition

[0201] Method and Apparatus

[0202] In order to confirm its internalisation into the tumor cells, the antibody m906 was conjugated with Alexa Fluor 750 using the “SAIVI Rapid Antibody Labeling Kit” (Thermoscientific) following the instructions provided by the manufacturer. The WaGa cells (500 000 cells) were incubated for 30 min at ambient temperature with the conjugate m906-Alexa Fluor 750 in a buffer solution (PBS 1×, 2% fetal calf serum, 0.1% sodium azide). The cells were then fixed with the aid of BD Cytofix/Cytoperm (BD Biosciences) and permeabilized with Permwash (BD Biosciences, diluted to 1/10e) in accordance with the instructions from the manufacturer. The nuclear and lysosomal compartments were labeled with Hoechst 33342 (BD Pharmigen, 1/10000) and an anti-LAMP1 antibody coupled to phycoerythrin-Cyanine 5 (BD Pharmigen, H4A3), respectively. The analysis of the labeled cells was carried out with the aid of an Amnis® ImageStream®X Mark II flow cytometry imager (Amnis Corp., part of EMD Millipore, Seattle, Wash.) equipped with 4 lasers (375 nm, 488 nm, 642 nm and 785 nm (SSC)). The images for the WaGa cells were captured with Inspire™ imaging flow cytometry software at a magnification of 60× and with an extended depth of field (EDF).

[0203] Compensations were made before each analysis. The cells of interest were identified using the “Gradient RMS” tool of the Bright Field image (BF: white light). Debris and cellular doublets were excluded from the analysis as a function of the aspect ratio with respect to the zone of the BF image. The surface area and the mean intensity of the intracellular fluorescence (IMF) of the m906 conjugated with Alexa Fluor 750 (channel 12) was evaluated for 2 different incubation times (5 and 30 min) with the aid of the “surface mask” and “cytoplasm mask” tools, using the IDEAS® v6.2 software. The internalisation score for the m906 conjugated with Alexa Fluor 750 (channel 12) was determined using the internalisation function, allowing the ratio of the intensity of intracellular fluorescence to the intensity of the whole cells to be defined. Cells with internalized antibodies have positive scores. The co-localization assistant using the “Bright Detail Similarity” (BDS) function was employed in order to quantify the level of co-localization between the anti-LAMP1 antibody conjugated with phycoerythrin-Cyanine 5 (channel 5) and the m906 conjugated with Alexa Fluor 750 (channel 12). The positive score for BDS (n. 1) indicates lysosomal localization for the m906.

[0204] Results

[0205] The m906 anti-CD56 antibody is internalized in the lysosome in WaGa cells expressing CD56 (Table 5). This is a crucial step for the release of drugs by an ADC, which makes m906 a good candidate antibody for the development of an ADC.

TABLE-US-00005 TABLE 5 m906 Intracellular Internal- BDS*.sup.2 Incubation Number fluorescence fluorescence isation score period of cells surface of m906 score for (LAMP1/ (minutes) in focus (MFI*.sup.1) (MFI*.sup.1) m906 m906) 5 8617 930 50046 7.08 1.4 30 5223 580 50464 7.96 1.4 *.sup.1Mean Fluorescence Intensity *.sup.2Bright Detail Similarity

[0206] 4.2. Cytotoxicity of MF-m906-MMAE on Lines In Vitro

[0207] Evaluation of Viability (Proliferation Test)

[0208] Method and Apparatus

[0209] In order to evaluate cell viability; a cytotoxicity test using XTT was carried out. The cells were deposited in a 96-well plate (50 000 cells/well) in 7 replicates. The ADCs MF-m906-MMAE and MF-TTZ-MMAE (ADC control) were added in incremental concentrations. The culture medium acted as a negative control. After 4 days of exposure to the drug, 25 μL of reagent XTT was added per well and the absorption was measured at 450 nm after 4 hours of incubation at 37° C. The absorption at 620 nm was used as a reference.

[0210] Results

[0211] The evaluation of the cytotoxicity on cell lines has shown that the ADC MF-m906-MMAE is as cytotoxic as free MMAE (IC.sub.50 between 1-10 nM) for all of the MCC lines. Furthermore, neither the antibody m906 (i.e. non coupled to MMAE), nor the ADC MF-TTZ-MMAE (ADC control) has a cytotoxic effect on these same lines at the lowest effective concentrations tested, demonstrated the absence of intrinsic toxicity of the construct (FIG. 5).

[0212] The evaluation of cytotoxicity on the H69 line (RRID:CVCL_1579), a small cell lung carcinoma cell line, has shown that the ADC MF-m906-MMAE is as cytotoxic as free MMAE (IC.sub.50 between 1-2 nM). Furthermore, neither the antibody m906 (i.e. non coupled to MMAE), nor the ADC MF-TTZ-MMAE (ADC control) has a cytotoxic effect on this line at the lowest effective concentrations tested, demonstrating the absence of intrinsic toxicity of the construct (FIG. 9).

[0213] 4.3. Confirmation of the Specificity of m906: The Cytotoxic Effect Observed is Dependent on CD56 (FIG. 6)

[0214] Plasmids and Lentiviral Transduction

[0215] Method and Apparatus

[0216] Three shRNAs targeting the sequence for CD56 were generated (sequences obtained from Consortium RNAi (A: TRCN0000373085 (SEQ ID NO 9-10)/B: TRCN0000373034 (SEQ ID NO.11-12)/C: TRCN0000073460 (SEQ ID NO.13-14)) and cloned in a FH1tUTG lentiviral vector, as described above [5]. Note in this construct that the activity of the promoter controlling the transcription of sequences of shRNA can be induced by doxycycline. The lentiviral supernatants were produced in the HEK293T (RRID:CVCL_0063) cells as described above [6-7]. The harvested supernatant was sterilized by filtration (0.45 μm) and polybrene was added (1 μg/mL) before infection. After 14-20 h of incubation with the supernatants containing the lentiviruses, the target cells were washed then underwent antibiotic selection (puromycin). For invalidation of the expression of CD56 in the tumor lines (knock-down), the cells were exposed to doxycycline for 7 days before analysis.

[0217] Results

[0218] The cytotoxicity induced by MF-m906-MMAE was substantially reduced during CD56 knock-down and this was the case for the three shRNAs (FIG. 6), confirming that the recognition of CD56 by m906 is essential in order to induce a cytotoxicity for MF-m906-MMAE.

Example 5: In Vivo Evaluation of Antibody-Drug Conjugate (MF-m906-MMAE)

[0219] Therapeutic Performance of m906 in a Xenograft Model of MCC Cell Lines on

[0220] NOD/SCID mouse

[0221] Method and Apparatus

[0222] Mouse Model

[0223] Twenty 7-week-old female NOD/SCID mice (Janvier Labs) were kept under aseptic conditions. All of the procedures relating to the animals were approved by the local ethics committee (Apafis-10076-2017053015488124 v4). The CD56-positive MCC cell line “WaGa” [8] was used for tumor induction. The mice, anesthetized with isoflurane, received a subcutaneous injection of 10.sup.7 cells in Matrigel (injection site: back). The tumor size, determined by measuring the width, the length and the height with a calliper and the general condition of the animals were monitored every 2 days throughout the procedure. The tumor volume was determined using the following formula: width×length×height×π/6. When the volume of the tumor reached 50 mm.sup.3, the mice were included in the study and randomly assigned to the experimental or control groups.

[0224] Experimental Procedure

[0225] After inclusion, the animals received an intravenous injection of ADC (either MF-m906-MMAE or MF-TTZ-MMAE, 10 mg/kg) or the injection of an equivalent volume of PBS for the control mice. A new injection was made in the event of doubling of the volume of the tumor in the experimental group. The mice were sacrificed 30 days after inclusion or if a critical point was reached (tumor ulceration, loss of 20% of weight or prostration). An autopsy was carried out on the animals and all of the organs were examined macroscopically by a pathologist. The weight and volume of the tumors were evaluated after dissection. Microscopic examination of the tumors, the lungs and the liver was carried out in order to detect any potential metastatic progression.

[0226] Statistical Analysis

[0227] Continuous data were described using means and limits. Categorical data were described by numbers and percentages of interpretable cases. The combinations were evaluated using Fisher's exact test for the categorical data or by Mann-Whitney or Kruskall Wallis tests for the continuous data. The statistical analyses were carried out using XLStat software (Addinsoft, Paris, France). p<0.05 was considered to be statistically significant.

[0228] Results

[0229] MF-m906-MMAE reduced tumor growth in a murine xenograft model of MCC cell lines.

[0230] The results of the administration of a triple dose of 10 mg/kg of MF-m906-MMAE, MF-TTZ-MMAE or PBS are presented in FIG. 7 (relative tumor volumes) and FIG. 8 (tumor mass at end of study). In the last two groups, used as controls, a similar tumor growth was observed with a mean coefficient for the slope of the growth curve of 105% of the initial tumor volume per day (limits 35-166) and 108% of the initial tumor volume per day (limits 33-318) for the PBS and MF-TTZ-MMAE groups respectively). For the experimental group treated with MF-m906-MMAE, tumor growth was significantly retarded (mean coefficient for the slope of the growth curve of 18% of the initial tumor volume per day (limits 1-53); Kruskal Wallis test: p=0.01). As a consequence, the final median weight of the tumors was reduced in the group treated with MF-m906-MMAE compared with the control animals (FIG. 8) (mean weight 0.7 g (limits: 0.4-1.3) as opposed to 2.03 g (limits: 1.3-3.7) and 1.78 g (limits: 1-2.7), Kruskal Wallis test: p-0.02). After sacrifice, no metastasis was observed either in the experimental group or in the control groups. No signs of MF-m906-MMAE toxicity were observed on the non-tumoral tissues removed during autopsy.

SEQUENCE LISTING

[0231]

TABLE-US-00006 TABLE 6 Sequence number Sequence type Amino acid sequence SEQ ID NO: 1 CDR1 of the light QSLLHSNGYN chain of m906 SEQ ID NO: 2 CDR2 of the light YLG chain of m906 SEQ ID NO: 3 CDR3 of the light CMQSLQTPWT chain of m906 SEQ ID NO: 4 CDR1 of the heavy GGTFTGYYMHW chain of m906 SEQ ID NO: 5 CDR2 of the heavy NSGGTNYAQ chain of m906 SEQ ID NO: 6 CDR3 of the heavy LSSGYSGYFDYWGQG chain of m906 SEQ ID NO: 7 Light chain of m906 DVVMTQSPLSLPVTPGEPASIS CRSSQSLLHSNGYNFLDWYLQ KPGQSPQLLIYLGSNRASGVP DRFSGSGSGTDFTLKISRVEA DDVGVYYCMQSLQTPWTFGH GTKVEIKRTVAAPSVFIFPPSD EQLKSGTASVVCLLNNFYPRE AKVQWKVDNALQSGNSQESV TEQDSKDSTYSLSSTLTLSKAD YEKHKVYACEVTHQGLSSPVT KSFNRGEC SEQ ID NO: 8 Heavy chain of EVQLVQSGAEVKKPGSSVKVS m906 CKASGGTFTGYYMHWVRQAP GQGLEWMGWINPNSGGTNYA QKFQGRVTMTRDTSISTAYME LSRLRSDDTAVYYCARDLSSG YSGYFDYWGQGTLVTVSSAST KGPSVFPLAPSSKSTSGGTAA LGCLVKDYFPEPVTVSWNSGA LTSGVHTFPAVLQSSGLYSLSS VVTVPSSSLGTQTYICNVNHKP SNTKVDKKVEPKSCDKTHTCP PCPAPELLGGPSVFLFPPKPK DTLMISRTPEVTCVVVDVSHE DPEVKFNWYVDGVEVHNAKT KPREEQYNSTYRVVSVLTVLH QDWLNGKEYKCKVSNKALPA PIEKTISKAKGQPREPQVYTLP PSRDELTKNQVSLTCLVKGFY PSDIAVEWESNGQPENNYKTT PPVLDSDGSFFLYSKLTVDKS RWQQGNVFSCSVMHEALHNH YTQKSLSLSPGK SEQ ID NO: 9 RNAi TCCCAGCGTTGGAGAGTCCA TRCN0000373085 AATTCTCGAGAATTTGGACTC Forward TCCAACGCTTTTTTCGGG SEQ ID NO: 10 RNAi AAAAAAGCGTTGGAGAGTCC TRCN0000373085 AAATTCTCGAGAATTTGGACT Reverse CTCCAACGCT SEQ ID NO: 11 RNAi TCCCCGTTCCCTGAAACCGT TRCN0000373034 TAAACTCGAGTTTAACGGTTT Forward CAGGGAACGTTTTT SEQ ID NO: 12 RNAi CGGGAAAAACGTTCCCTGAA TRCN0000373034 ACCGTTAAACTCGAGTTTAAC Reverse GGTTTCAGGGAACG SEQ ID NO: 13 RNAi TCCCCATGTACCTTGAAGTG TRCN0000073460 CAATCTCGAGATTGCACTTCA Forward AGGTACATGTTTTT SEQ ID NO: 14 RNAi CGGGAAAAACATGTACCTTG TRCN0000073460 AAGTGCAATCTCGAGATTGC Reverse ACTTCAAGGTACATG SEQ ID NO: 15 Variable domain of DVVMTQSPLSLPVTPGEPASIS the light chain of CRSSQSLLHSNGYNFLDWYLQ m906 KPGQSPQLLIYLGSNRASGVP DRFSGSGSGTDFTLKISRVEA DDVGVYYCMQSLQTPWTFGH GTKVEIKR SEQ ID NO: 16 Variable domain of EVQLVQSGAEVKKPGSSVKVS the heavy chain of CKASGGTFTGYYMHWVRQAP m906 GQGLEWMGWINPNSGGTNYA QKFQGRVTMTRDTSISTAYME LSRLRSDDTAVYYCARDLSSG YSGYFDYWGQGTLVTVS

REFERENCES CITED IN THE FORMAT “[REFERENCE NUMBER]”

[0232] 1. Feng, Y. et al., MAbs, May-June; 8(4): 799-810, 2016 [0233] 2. Goyon, A et al., J. Chromatogr. B, 1065-1066, 35-43, 2017 [0234] 3. Fekete, S. et al., J. Pharm. Biomed. Anal., 130, 3-18, 2016 [0235] 4. Barran, P. et al., EuPA Open Proteomics, 11, 23-27, 2016 [0236] 5. Houben, R. et al., International journal of Cancer, 130, 847-856, 2012 [0237] 6. Angermeyer S. and al., J. Invest. Dermatol., 133(8):2059-2064.2013 [0238] 7. Aragaki M. et al., Biochem. Biophys. Res. Commun., 368(4):923-929, 2008 [0239] 8. Houben R, et al., J. Virol.; 84(14):7064-7072, 2010