PHARMACEUTICAL COMPOSITION COMPRISING NEW LACTOBACILLUS PLANTARUM KC3 STRAIN AND LEONURUS JAPONICUS EXTRACT AS ACTIVE INGREDIENTS FOR PREVENTING OR TREATING RESPIRATORY DISEASE AND USE THEREOF
20230147942 · 2023-05-11
Assignee
Inventors
- Han Jae SHIN (Daejeon, KR)
- Young Chul LEE (Daejeon, KR)
- Do Hoon Kim (Daejeon, KR)
- In Ock LEE (Incheon, KR)
- Min Ho SEO (Gwangmyeong-si, KR)
- Bo Hye HEO (Ansan-si, KR)
- Yoo Il KIM (Seo-gu, KR)
- Woo Ri KIM (Incheon, KR)
- Yoo Jin KWON (Ansan-si, KR)
- Byoung Kook KIM (Seoul, KR)
- In Suk Choi (Seoul, KR)
Cpc classification
A61K9/2018
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
A23L33/105
HUMAN NECESSITIES
A61K47/26
HUMAN NECESSITIES
A61K9/0095
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A61K35/00
HUMAN NECESSITIES
A61K9/2059
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
International classification
A61P29/00
HUMAN NECESSITIES
A61K9/14
HUMAN NECESSITIES
A61K9/48
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A61K47/26
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
A23L33/105
HUMAN NECESSITIES
Abstract
Disclosed are a pharmaceutical composition for preventing or treating a respiratory disease, and health functional food, a food composition, and a quasi-drug composition for preventing and ameliorating a respiratory disease, each including, as active ingredients, a Lactobacillus plantarum KC3 strain and a Leonurus japonicus extract. The composition including the Lactobacillus plantarum KC3 strain (Accession No: KCTC13375BP) and the Leonurus japonicus extract as active ingredients according to an aspect has a defense effect against respiratory damage caused by air pollutants such as fine dust and can inhibit expression of IL-17A, TNF-α, and CXCL-1, thereby being able to effectively treat or prevent a respiratory disease including chronic obstructive pulmonary disease (COPD). In addition, the effect of the active ingredient combination above results in a synergistic inhibition or treatment effect on bronchial inflammation by the administration compared to the existing therapeutic effect of a respiratory inflammatory disease of each of the Leonurus japonicus extract and the lactic acid bacteria KC3. Thus, the present disclosure can be usefully utilized for the prevention or treatment of a respiratory disease.
Claims
1. A pharmaceutical composition for preventing or treating a respiratory disease, the pharmaceutical composition comprising, as active ingredients, one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (Accession No: KCTC13375BP), a culture thereof, a fermentation solution thereof, a lysis solution thereof, an extract thereof, and a concentrate of the culture and a Leonurus japonicus extract.
2. The pharmaceutical composition of claim 1, wherein the one or more selected from the group consisting of the Lactobacillus plantarum KC3 strain (Accession No: KCTC13375BP), the culture thereof, the fermentation solution thereof, the lysis solution thereof, the extract thereof, and the concentrate of the culture and the Leonurus japonicus extract are included at a weight ratio in a range of 1 to 0.1 to 10 (w/w).
3. The pharmaceutical composition of claim 1, wherein the Lactobacillus plantarum KC3 strain is included at a density in a range of 0.1 x 10.sup.9 CFU/cell to 1.0×10.sup.9 CFU/cell.
4. The pharmaceutical composition of claim 1, wherein the Leonurus japonicus extract is extracted from water, a C.sub.1-C.sub.10 alcohol, or a mixture thereof.
5. The pharmaceutical composition of claim 1, wherein the respiratory disease is any one of respiratory diseases selected from the group consisting of bronchitis, tuberculosis, chronic pulmonary disease, rhinitis, otitis media, viral respiratory disease, sore throat, tonsilitis, pneumonia, asthma, and chronic obstructive pulmonary disease (COPD).
6. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition inhibits expression of IL-17A, TNF-α, and CXCL-1.
7. Health functional food for preventing or ameliorating a respiratory disease, the health functional food comprising, as active ingredients, one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (Accession No: KCTC13375BP), a culture thereof, a fermentation solution thereof, a lysis solution thereof, an extract thereof, and a concentrate of the culture and a Leonurus japonicus extract.
8. A food composition for preventing or ameliorating a respiratory disease, the food composition comprising, as active ingredients, one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (Accession No: KCTC13375BP), a culture thereof, a fermentation solution thereof, a lysis solution thereof, an extract thereof, and a concentrate of the culture and a Leonurus japonicus extract.
9. A quasi-drug composition for preventing or ameliorating a respiratory disease, the quasi-drug composition comprising, as active ingredients, one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (Accession No: KCTC13375BP), a culture thereof, a fermentation solution thereof, a lysis solution thereof, an extract thereof, and a concentrate of the culture and a Leonurus japonicus extract.
10. A method of preventing or treating a respiratory disease, the method comprising administering a composition to a subject in need thereof, the composition comprising, as active ingredients, one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (Accession No: KCTC13375BP), a culture thereof, a fermentation solution thereof, a lysis solution thereof, an extract thereof, and a concentrate of the culture and Leonurus japonicus extract.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0090]
[0091]
[0092]
[0093]
[0094]
MODE OF DISCLOSURE
[0095] Hereinafter, preferable Examples and Experimental Examples are provided to help understanding of the present disclosure. However, Examples below are only provided for easier understanding of the present disclosure, and the content of the present disclosure is not limited by Examples and Experimental Examples below.
EXAMPLE 1
Isolation of New Lactic Acid Bacteria from Lactobacillus plantarum KC3
EXAMPLE 1-1
Preparation of Raw Materials of Kimchi
[0096] For use as cabbage kimchi which is a raw material of the present disclosure, kimchi for family use in North Jeolla Province was prepared according to the following process using materials all purchased from a local mart (Hanaro Mart, Wansan-gu, Jeonju-si).
[0097] (1) Step 1: Five Korean cabbages (about 1 kg each) were prepared and cut into two pieces after getting rid of inedible portions. 500 g of salt was dissolved in water in a container for salting. The divided Korean cabbage pieces were soaked in salted water, and after being taken out of the salted water, salt was sprinkled in layers between cabbage leaves. The Korean cabbages were then salted for 5 to 6 hours, washed with clean water 3 to 4 times, and placed on a large colander for dehydration.
[0098] (2) Step 2: Two Korean radishes (about 1.2 kg each) were prepared, trimmed and washed after getting rid of radish leaves, and then cut into thin strips in 4-5 cm long. Half bundle of great green onions (about 0.5 kg), half bundle of chives (about 0.5 kg), and half bundle of mustard leaves (about 0.5 kg) were also trimmed and washed, and cut into the same length as the radish strips.
[0099] (3) Step 3: 50 g of garlic, 10 g of ginger, and 200 g of salted shrimp were finely minced, and 300 ml (about 200 g) of anchovy sauce was prepared. Rice porridge was cooked with 150 g of glutinous rice soaked in water. After cooling the rice porridge, the prepared anchovy sauce and the minced salted shrimp, garlic, and ginger were added thereto with 500 g of red pepper powder, and all the seasonings were mixed evenly.
[0100] (4) Step 4: After putting and mixing all the radish strips, great green onion, chives, and mustard leaves that were all cut to the similar length as in Step 2, kimchi seasoning was made by seasoning with salt (about 0.5 kg) and sugar (about 0.5 kg).
[0101] (5) Step 5: After spreading the kimchi seasoning evenly between the Korean cabbage leaves, the Korean cabbage was rolled by the outermost leaf. Then, the Korean cabbage was placed one by one in a container in a way that the cross section of the Korean cabbage faced up, and the container was stored in a low-temperature storage (0° C. to −2° C.) so as to ripen the kimchi for 1 year, thereby producing raw materials for the Korean cabbage kimchi.
EXAMPLE 1-2
Isolation and Identification of New Lactobacillus plantarum KC3 Strain
[0102] Regarding isolation and identification processes for the Lactobacillus plantarum KC3 strain of the present disclosure, the raw materials for the Korean cabbage kimchi of Example 1-1 were inoculated by 0.1 ml each onto an MRS sodium medium (supplemented with MRS medium (DF0881-17-5, Difco) and 1.5% agar (214010, Difco)) to which bromcresol purple (114375, Sigma) and sodium azide (S2002, sigma) were diluted with a peptone diluent (MB-B2220, MB cell) and added, by a streak-plate method. After culturing in an anaerobic condition at 37° C. for 48 hours, colonies that turned yellow in the medium were selected as tentative lactic acid bacteria.
[0103] As a result of identifying the isolated strain, it was confirmed that the strain was a gram-positive facultative anaerobic bacillus was negative for the catalase and motility.
[0104] It was also confirmed that the strain did not grow at 15° C. and 45° C., and based on that no gas from glucose and no ammonia from alginine were produced, the strain was confirmed to belong to the genus Lactobacillus.
EXAMPLE 1-3
Identification of Microorganism (Based on Analysis of Glucose Utilization and 16s rRNA Identification)
[0105] 1-3-1. Analysis of Glucose Utilization
[0106] The glucose utilization of the selected lactic acid bacteria was analyzed using an API CHL50 kit (50300, bioMerieux). As a result of the analysis, it was confirmed that, as shown in Table 1 below, glucose from D-ribose, D-galactose, D-glucose, D-fructose, D-mannose, D-mannitol, D-sorbitol, methyl-αD-mannopyranoside, amyglandine albutine, esculin ferric citrate, D-cellobiose, D-maltose, D-lactose, D-melibiose, D-saccharose, D-trehalose, D-melezitose, and D-raffinose was utilized.
TABLE-US-00001 TABLE 1 Glucose utilization of Lactobacillus plantarum KC3 uti- uti- Glucose lization Glucose lization Control − Esculin ferric citrate + Glycerol − Salicin ± Erythritol − D-Celiobiose + D-Arabinose − D-Maltose + L-Arabinose − D-Lactose + D-Ribose + D-Melibiose + D-Xylose − D-Saccharose + L-Xylose − D-Trehalose + D-Adonitol − Inulin − Methyl-βD-Xylopyran- − D-Melezitose + oside D-Galactose + D-Raffinose + D-Glucose + Amidon − D-Fructose + Glycogen − D-Mannose + Xylitol − L-Sorbose − Gentiobiose ± L-Rhamnose − D-Turanose − Dulcitol − D-Lyxose − Inositol − D-Tagatose − D-Mannitol + D-Fucose − D-Sorbitol + L-Fucose − Methyl-αD-Mannopyran- + D-Arabitol − oside Methyl-αD-Glucopyran- − L-Arabitol − oside N-AcetylGlucosamine ± potassium Gluconate − Amygdalin + potassium 2-KetoGluconate − Arbutin + potassium 5-KetoGluconate −
[0107] 1-3-2. 16s rRNA Identification
[0108] The colonies grown on the MRS solid medium (supplemented with MRS medium (DF0881-17-5, Difco) and 1.5% agar (214010, Difco)) were collected and subjected to double-stranded DNA sequencing (Solgent, Korea). As a result of identifying the strain by BLAST, the obtained nucleic sequence (SEQ ID NO: 1 in Table 2) showed a homology of 99% to the Lactobacillus plantarum, confirming that the new microorganism of the present disclosure was the strain (hereinafter also referred to as “new lactic acid bacteria from KC3” or “CKDB-KC3”).
TABLE-US-00002 TABLE 2 16s rRNA nucleic sequence of Lactobacillus plantarum KC3 16s rRNA nucleic sequence of SEQ Lactobacillus plantarum KC3 ID NO. AGATTAGACGTTCCCTTCGGGGACATGGATACAGGTGGTGC 1 ATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTGGGTTAAGT CCCGCAACGAGCGCAACCCTTATTATCAGTTGCCAGCATTA AGTTGGGCACTCTGGTGAGACTGCCGGTGACAAACCGGAGG AAGGTGGGGATGACGTCAAATCATCATGCCCCTTATGACCT GGGCTACACACGTGCTACAATGGATGGTACAACGAGTTGCG AACTCGCGAGAGTAAGCTAATCTCTTAAAGCCATTCTCAGT TCGGATTGTAGGCTGCAACTCGCCTACATGAAGTCGGAATC GCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCC CGGGCCTTGTACACACCGCCCGTCACACCATGAGAGTTTGT AACACCCAAAGTCGGTGGGGTAACCTTTTAGGAACCAGCCG CCTAAGGTGGGACAGATGATTAGGGTGAAGTCGTACA
[0109] 1-3-3. Characteristics of Microorganism
[0110] The characteristics of the new Lactobacillus plantarum KC3 according to the present disclosure are as follows:
[0111] (1) Form of Bacteria
[0112] Form of bacteria when cultured in MRS agar plate medium at 37° C. for 48 hours
[0113] {circle around (1)} Cell type: Bacillus
[0114] {circle around (2)} Mobility: None
[0115] {circle around (3)} Spore-forming ability: None
[0116] {circle around (4)} Gram staining: Positive
[0117] (2) Shape of Colony
[0118] Form of colonies when cultured in MRS agar plate medium at 37° C. for 48 hours
[0119] {circle around (1)} Shape: Round
[0120] {circle around (2)} Bulge: Convex
[0121] {circle around (3)} Surface: Smooth
[0122] {circle around (4)} Color: Milky-white
[0123] (3) Physiological Properties
[0124] {circle around (1)} Temperature for growth and development
[0125] Temperature enable growth and development: 15° C. to 40° C.
[0126] Optimal temperature for growth and development: 36° C. to 38° C.
[0127] {circle around (2)} pH for growth and development
[0128] pH enable growth and evelopment: 4.6 to 7.5
[0129] Optimal pH: 6.0 to 7.0
[0130] {circle around (1)} Effect on oxygen: Facultative anaerobic
[0131] (4) Catalase: Negative
[0132] (5) Gas generation: Negative
[0133] (6) Indole production: Negative
[0134] (7) Lactic acid production: Positive
[0135] (8) Biogenic amine production: Negative
[0136] Based on the results of the microorganism identification and the bacteria characteristics above, a new strain isolated from kimchi was named Lactobacillus plantarum KC3 and deposited at the Korea Research Institute of Bioscience and Biotechnology (Accession No: KCTC13375BP) on Oct. 20, 2017 (
EXAMPLE 2
Confirmation of Characteristics of New Lactic Acid Bacteria from Lactobacillus plantarum KC3
EXAMPLE 2-1
Tolerance Experiment of Gastric Acid and Bile Acid
[0137] Gastric acid secretion in gastric fluids and bile acid secreted from the pancrease are significantly important factors affecting the survival of microorganisms. Thus, in order to confirm gastric acid-resistance and bile acid-resistance of the new lactic acid bacteria from the Lactobacillus plantarum KC3 of the present disclosure, an experiment was performed as follows.
[0138] It was a process of examining the resistance to artificial gastric fluids and bile to explore the possibility for use as probiotics, and then selecting and identifying strains having excellent activity and strong resistance.
[0139]
[0140] More specifically, the Lactobacillus plantarum KC3 strain was grown in an MRS medium (with oxgall) containing 0.03% of bile (oxgall) and 0.05% of L-cysteine and an MRS medium (without oxgall) containing 0.05% of L-cysteine. All values (or data) are the mean±standard deviation for triplicate experiments, and * indicates a case where p<0.05 between a group including oxgall and a group not including oxgall.
[0141]
[0142] More specifically, the figure shows the survival rate of the Lactobacillus plantarum KC3 strain after 3 hours in hydrochloric acid solution having a pH of 2.0, 3.0, 4.0 and 6.4, and as compared with the start point (or start time), * indicates a case of p<0.05, ** indicates a case of p<0.01, and *** indicates a case of p<0.001.
EXAMPLE 2-2
Confirmation of Antibacterial Activity of Strain
[0143] In order to confirm antibacterial activity of the new lactic acid bacteria from the Lactobacillus plantarum KC3, an antibacterial activity experiment was performed.
[0144] The antibacterial activity experiment was to confirm the inhibitory activity against Escherichia coli, Salmonella typhimurium, Staphylococcus aureus, and Listeria monocytogenes. The stronger the inhibitory activity against harmful bacterial is, the better the antibacterial activity is.
[0145] Table 3 shows the experimental results about the antibacterial activity of the Lactobacillus plantarum KC3 strain, wherein the initial number of bacteria of the Lactobacillus plantarum KC3 strain was about 2.10±0.17×10.sup.6 CFU/mL, and the results were obtained after 6 hours of the experiments at 37° C. Here, all values (or data) are the mean±standard deviation for triplicate experiments.
TABLE-US-00003 TABLE 3 Antibacterial activity of Lactobacillus plantarum KC3 Growth pathogens.sup.a KC3 + pathogens.sup.a Inhibition Pathogens CFU/mL pH CFU/mL pH (%) Escherichia coli 3.23 ± 0.25 × 10.sup.6 5.98 8.50 ± 0.05 × 10.sup.5 4.84 73.98% Salmonella 6.46 ± 0.35 × 10.sup.6 6.10 4.00 ± 0.26 × 10.sup.6 5.25 38.14% Typhimurium Listeria 1.57 ± 0.20 × 10.sup.5 6.06 1.13 ± 0.06 × 10.sup.5 4.94 27.97% monocytogenes Staphyloccous aureus 3.46 ± 0.87 × 10.sup.6 6.08 2.83 ± 0.61 × 10.sup.6 4.9 18.27%
EXAMPLE 2-3
Experiment on Antibiotic Susceptibility of Strain
[0146] In order to confirm antibiotics resistance level of the new lactic acid bacteria from the of the Lactobacillus plantarum KC3 the present disclosure, an experiment was performed as follows by applying the method described in the document
[0147] To measure the antibiotics resistance level of the strain, an MIC test was carried out. Lactic acid bacteria that were inoculated into an MRS medium (DF0881-17-5, Difco) and cultured at 37° C. for 18 hours were spread on an LSM solid medium (90% iso-sensitest broth (CM0473, Oxoid), 10% MRS medium (DF0881-17-5, Difco), and 1.5% agar (214010, Difco)). Strips for each type of antibiotics, such as Amikacin (92018, Liofilchem srl), Gentamycin (92009, Liofilchem srl), Kanamycin (92034, Liofilchem srl), Streptomycin (92112, Liofilchem srl), Penicillin-G (92102, Liofilchem srl), Oxacillin (92015, Liofilchem srl), Ampicillin (920030, Liofilchem srl), Bacitracin (92019, Liofilchem srl), Rifampicin (92001, Liofilchem srl), Polymyxin B (92004, Liofilchem srl), Chloramphenico 1(92075, Liofilchem srl), Vancomycin (92057, Liofilchem srl), and the like, were put on the medium, and the bacteria were grown at 37° C. for 24 hours. Then, a section where a clear zone disappeared was observed with the naked eyes, and an MIC was measured therefrom.
[0148] Table 4 shows the results of the antibiotics resistance against the Lactobacillus plantarum KC3 strain. In Table 4, R indicates resistance and represents that the size of an inhibition zone is about 0 mm; IS indicates mediate resistance and represents that the size of an inhibition zone is in a range of about 1 mm to about 5 mm; and S indicates susceptibility and represents that the size of an inhibition zone is greater than about 5 mm.
TABLE-US-00004 TABLE 4 Antibiotics susceptibility of Lactobacillus plantarum KC3 Anti-microbial Antibiotic Anti-microbial Antibiotic agents resistance agents resistance Aminoglycosides Gram-positive-spectrum IS (4 mm) Amikacin IS (1 mm) Bacitracin S (7 mm) Gentamycin IS (3 mm) Rifampicin S (7 mm) Kanamycin R (0 mm) Novabiocin S (7 mm) Neomycin IS (3 mm) Lincomycin S (10 mm) Streptomycin R (0 mm) Gram-negative spectrum β-lactams Polymyxin B R (0 mm) Penicillin-G IS (5 mm) Broad spectrum Oxacillin IS (2 mm) Chloramphenicol S (10 mm) Ampicillin S (14 mm) Vancomycin R (0 mm)
EXAMPLE 2-4
Confirmation of Biogenic Amine Producibility of Strain
[0149] To confirm biogenic amine producibility of the new lactic acid bacteria from the Lactobacillus plantarum KC3 of the present disclosure, an experiment was performed as follows by applying the method described in the document
[0150] Biogenic amines are produced by fermentation of food and may vary depending on a type of microorganisms or chemical and physical conditions. Since biogenic amines produced in fermented food can cause food poisoning or allergic reactions, the biogenic amines are considered as important criteria for selecting a safe strain for food engineering
[0151] Accordingly, to confirm whether the strain of the present disclosure formed biogenic amines, the strain grown in an MRS liquid medium (DF0881-17-5, Difco) for 16 hours at 37° C. was transferred to a special medium and cultured at 37° C. for 48 hours.
[0152] An MRS liquid medium (DF0881-17-5, Difco) to which an amino acid precursor for each of tyrosine (SIGMA, T1145), histidine (SIGMA, H5659), ornithine (SIGMA, 02375), and lysine (DAEJUNG, 5093-4105) was added was prepared. In each medium, it was confirmed whether the biogenic amines, i.e., tyramine, histamine, putrescine, and cadaverine, were produced by the strain. In detail, onto an MRS liquid medium (DF0881-17-5, Difco) to which 0.1% of the amino acid precursor was added, 1% of the isolated Lactobacillus plantarum strain was inoculated, and then subcultured 5 times to 10 times. The resulting strain was then spread on a biogenic amine identification medium [prepared by mixing 0.5% of trypton, 0.5% of yeast extract, 0.5% of cocoon extract, 0.5% of sodium chloride, 0.25% of glucose, 0.05% of Tween-80, 0.02% of magnesium sulfate, 0.005% of manganese sulfate, 0.004% of iron sulfate, 0.2% of citric acid salt, 0.001% of thiamine, 0.2% of K2PO4, 0.01% of calcium carbonate, 0.005% of pyridoxal-5-phosphate, 1% of amino acid, 0.006% of bromocresol purple, and 2% of agar with distilled water and adjusting the pH to 5.3 for use], and cultured at 37° C. for 24 hours to 48 hours. Then, by checking whether the color changes to purple, the biogenic amine producibility of the strain was determined.
[0153] Bromocresol purple contained in a decarboxylase medium is yellow at pH 5.2, but turns purple as the pH increases to 6.8. Thus, based on the color that turns purple as the pH increases by the production of the biogenic amines, the production of the biogenic amines was confirmed.
[0154] Table 5 below shows the results of analyzing the biogenic amine producibility of the Lactobacillus plantarum KC3 strain. As shown in Table 4, it was confirmed that the strain was negative for all of putrescine, tyramine, histamine, and cadaverine. Accordingly, it was confirmed that the strain of the present invention had no ability to produce the biogenic amines that can induce hypersensitive immune responses.
TABLE-US-00005 TABLE 5 Biogenic amine producibility of Lactobacillus plantarum KC3 Biogenic amines Strain Putrescine Tyramine Histamine Cadaverine KC3 − − − −
EXAMPLE 3
Culture and Preparation of Lactic Acid Bacteria from Lactobacillus plantarum KC3
[0155] Culturing of the isolated and identified Lactobacillus plantarum KC3 was performed in a flask containing an MRS medium (supplemented with an MRS (DF0881-17-5, Difco)) associated with lactic acid bacteria seed at 37° C. for 24 hours.
[0156] Each culture was inoculated into an optimized medium (self-manufactured) in a fermenter (Bio Control & Science, MARADO-05D-PS).
[0157] For the fermentation, the pH was maintained constant between 5.5 and 6.0 by automatically adding NaOH solution (25% w/v) to the medium, and the fermentation was performed at 37° C. for 18 hours to 20 hours while stirring at 120 rpm.
[0158] Lyophilization of 40× concentrated cells was performed according to the manual (Cooling & Heating System, Lab-Mast 10).
[0159] After lyophilization, colony-forming units (CFU) per 1 g of each probiotic powder were measured by serial dilution. The strain was suspended in 0.1 M PBS, and the density thereof was adjusted to 10.sup.9 CFU/mL before use.
EXAMPLE 4
Preparation of Leonurus japonicus Extract
[0160] 500 g of dried whole herb of Leonurus japonicus (available by Human herb) was evenly mixed, and 30% alcoholic liquor mixed with distilled water was added thereto. First extraction process was performed thereon at 80±2° C. for 4 hours, and then, a filtration process was repeated twice with a filtering paper having a size of 1 μm. The extract thus obtained was then concentrated in a vacuum at 52.5±2.5° C. and about 650±30 mmHg. Following sterilization at 85.0±2.0° C. for 1 hour, the resultant product was cooled to 55° C., and a spray drier (KL-8,Seokang Engineering Inc., inlet temperature of 190±10° C., outlet temperature of 95±5° C.) was used to prepare a Leonurus japonicus extract(71 g, hereinafter referred to as “LS”).
EXAMPLE 5
Preparation of Cmposition Icluding, as Active Ingredients, Lactobacillus plantarum KC3 Strain and Leonurus japonicus Extract
[0161] 6.7 mg/mL (=1×10.sup.9 CFU/cell) of the Lactobacillus plantarum KC3 strainof Example 1 and 8.3 mg/mL(=100 mg/kg BW) of the Leonurus japonicus extract solution of Example 4 were mixed ata ratio of 1:1 based on the dry weight, so as to prepare a mixture (KC3+Leo) of the Lactobacillus plantarum KC3 strain and the Leonurus japonicus extract.
[0162] Experimental Example 1
Confirmation of Defense Effect of Mixture of Lactobacillus plantarum KC3 strain and Leonurus japonicus Extract Against Respiratory Damage Caused by Air Pollutants
[0163] 1-1. Experiment on Mouse Model having Respiratory Damage
[0164] An experiment was carried out to confirm whether the composition prepared in Examples above exhibited a defense effect against respiratory damage caused by air pollutants. BALB/c male mice (7-week-old, 20 g to 25 g, Orient Bio) were divided into groups of 6 mice, and as assigned to 6 mice in each group, and Alum was diluted in components of air pollutants, i.e., 10 mg/ml of coal combustible materials, 10 mg/ml of fly ash, and 5 mg/ml of diesel exhaust particle (DEP) to have a final concentration of 1% so that a final concentration of each component was 1.5 mg/ml for coal combustible material/fly ash and 5 mg/ml for DEP in a mixture. Then, to all groups except for a normal group, the mixture was directly injected into the airway and nose of the experimental animals by 50 pl each on the 4.sup.th, 7.sup.th and 10.sup.th says of the experiment.
[0165] For a positive control group treated with dexamethasone (Sigma D2915), administed at 3 mg/kg BW of the mouse model, the Lactobacillus plantarum KC3 strain (KC3) was diluted at a concentration of 1×10.sup.9CFU/cell (about 2 mg/kg BW), the Leonurus japonicus extract was diluted in distilled water at a dose of 100 mg/kg of BW, and then orally administered at a dose of 300 pl every day (for 11 days). For a mixed group including the KC3 strain and the Leonurus japonicus extract, the solution was mixed and diluted at a ratio of 1:1 by the dry weight as in Examples above, and then orally administered at a dose of 300 pl every day (for 11 days) (the cell amount in the KC3 included in the mixture was 0.5×10.sup.9 CFU/cell, and the dose of the Leonurus japonicus extract was set at 50 mg/kg BW). The oral administration was performed at a dose of 300 μl per mouse, and an autopsy was performed on the 12.sup.th day after the start of the experiment to recover the BAL solution.
Experimental Example 1-2
Confirmation of Total Number of Cells in BAL Fluid
[0166] In the case of treatment with the Lactobacillus plantarum KC3 strain, the Leonurus japonicus extract, or the mixture thereof, BAL was performed in a disease mouse model by the following method to confirm how the total number of cells in BAL fluid changed (see Schins et al., Toxicol Appl Pharmacol. 195(1), 1-11 (2004) and Smith et al., Toxicol Sci, 93(2), 390-399 (2006)).
[0167] In the case of treatment with the Lactobacillus plantarum KC3 strain, the Leonurus japonicus extract, or the composition of Examples above, a BAL experiment was performed in a disease mouse model. Results obtained by confirming the total number of cells in the BAL fluid are shown in Table 6 and
TABLE-US-00006 TABLE 6 Changes in the total number of cells in BAL fluid Total number of Inhibition rate BAL cells (×10.sup.4 (based on Division cells/ml) induced group) Normal control group 25.5 ± 4.1 Induced group 155.3 ± 19.4 Positive control group 71.2 ± 8.3 54% KC3 strain alone 89.9 ± 10.3 42% Leonurus japonicus 92.4 ± 9.8 41% extract alone Mixture of KC3 66.7 ± 7.1 57% strain + Leonurus japonicus extract
[0168] As confirmed in Table 6 and
Experimental Example 1-3
Confirmation of Ratio of Number of Neutrophils to Total Number of Cells in BAL Fluid
[0169] In the case of treatment with the Lactobacillus plantarum KC3 strain, the Leonurus japonicus extract, or the composition including a mixture of the KC3 strain and the Leonurus japonicus extract, an experiment to confirm whether neutrophils exhibited an effect on the number of cells among the total number of cells in the BAL fluid.
[0170] For details, the methods and the positive control group were set in the same manner as in Experimental Example 1-3, and the experiment was carried out under the same conditions as described above. From the recovered BAL fluid, inflammatory immune cells, neutrophils, were stained by Diff-Qick staining, and a ratio of stained neutrophil cells to the total cells was confirmed, and the results are shown in Table 7.
TABLE-US-00007 TABLE 7 Confirmation of ratio of number of neutrophils to total number of cells in BAL fluid Ratio of number of Inhibition rate neutrophils to total number (based on Division of BAL cells (400X) induced group) Normal control 1.0 ± 0.1 group Induced group 70.7 ± 10.3 Positive control 35.5 ± 6.1 50% group KC3 lactic acid 34.1 ± 4.2 52% bacteria alone Leonurus japonicus 40.8 ± 5.2 42% extract alone Mixture of KC3 28.5 ± 4.1 60% strains + Leonurus japonicus extract
[0171] As shown in Table 7, it was confirmed that the number of neutrophils increased by air pollutants such as fine dust was about 70.7±10.3 in the inflammation-induced group compared to the normal group, indicating that the number of neutrophils increased about 70% or more compared to the normal group. However, when the mixture of the KC3 strain and Leonurus japonicus extract was administered, the inhibitory rate based on the induced group was about 60%, confirming a significant effect of inhibiting respiratory inflammation to a significant degree compared to the groups administered with each component alone. That is, the inhibitory activity of the induced group on respiratory inflammation was confirmed to be significantly excellent compared to the inhibitory activity of the positive control group. Overall, it was confirmed that the group administered with the mixture of the KC3 strain and the Leonurus japonicus extract showed a synergic defense effect against damage caused by respiratory inflammation compared to the groups administered with each component alone.
Experimental Example 1-4
Confirmation of Inhibition of Expression of Inflammation Factors in BAL Fluid
[0172] An experiment was carried out to confirm whether the expression level of inflammation factors in the BAL fluid can be lowered, when treated with the Lactobacillus plantarum KC3 strain, the Leonurus japonicus extract, or the mixture thereof.
[0173] The experiment was carried out in the same manner as in Experimental Example 1-3, except that the number of cells in BAL fluid was measured. Instead of measuring the number of cells, ELISA was performed to measure the expression level of respiratory inflammation factors, such as IL-17A, TNF-α, and CXCL-1, expressed in BAL fluid. In detail, IL-17A antibodies (M1700, R&D Systems, Minneapolis, USA), TNF-α antibodies (MTA00B, R&D Systems, Minneapolis, USA), and CXCL-1 antibodies (MKCOOB, R&D Systems, Minneapolis, USA) were diluted with a buffer solution, coated microwells, and then cultured at 4° C. for 16 hours. Each well was washed with a buffer solution three times, and 10-fold diluted serum was dispensed at 100 μl per well. After being left at room temperature for 1 hour, the wells were washed twice. Then, 100 μl of Avidin-HRP-conjugated antibodies (DY007, R&D Systems, Minneapolis, USA) was treated thereon, and the wells were left again at room temperature for 1 hour, followed by washing again.
[0174] Tetramethylbenzidine (TMB) base solution (DY007, R&D Systems, Minneapolis, USA) was dispensed at 100 μl per well, and the well plate was left in the dark for 30 minutes. After 50 μl of a stopping solution (DY007, R&D Systems, Minneapolis, USA) was treated thereon, absorbance of the cells was measured at 450 nm. By the ELISA, the expression levels of IL-17A, TNF-α, and CXCL-1 were determined, and the results are shown in Table 8.
TABLE-US-00008 TABLE 8 Confirmation of expression levels of inflammation factors in BAL fluid Concentration (pg/mL) (inhibition rate (%) based on induced group is indicated in parentheses) Division IL-17A TNF-α CXCL-1 Normal control 15.3 ± 3.2 52.4 ± 7.7 55 ± 6.1 group Induced group 33.5 ± 5.7 120.1 ± 13.4 201 ± 13.7 Positive control 19.7 ± 6.3 (41%) 64.5 ± 7.7 (46%) 122 ± 12.4 (39%) group KC3 strain alone 23.3 ± 1.7 (30%) 73.4 ± 8.8 (39%) 141 ± 11.1 (30%) Leonurus japonicus 19.8 ± 3.3 (41%) 69.3 ± 7.8 (42%) 110 ± 10.7 (45%) extract alone Mixture of KC3 14.8 ± 5.3 (56%) 50.3 ± 6.1 (58%) 85.9 ± 9.2 (5 7%) strain + Leonurus japonicus extract
[0175] As shown in Table 8, it was confirmed that, as a result of measuring the amounts of inflammation biomarkers, such as IL-17A, TNF-α, CXCL-1, and the like, in BAL fluid, the levels of the inflammation biomarkers (e.g., IL-17A, TNF-α, and CXCL-1) having increased respiratory damage by air pollutants were significantly reduced by the treatment with the mixture of the KC3 strain and the Leonurus japonicus extract by about 56% or more in all three inflammation biomarkers. When even compared with the groups treated with each component alone, such reduction is regarded as a synergic defense effect on respiratory damage through respiratory inflammation defense to a significant degree. In addition, it was confirmed that the mixture exhibited significantly superior inhibitory activity on bronchial inflammation compared to the positive control group.
[0176] Experimental Example 2. Measurement of chronic obstructive pulmonary disease (COPD) biomarkers in blood
[0177] When treating the composition with the Lactobacillus plantarum KC3 strain, the Leonurus japonicus extract, or the mixture thereof, an experiment was carried to confirm whether the composition exhibited a therapeutic effect on COPD which is a type of respiratory diseases that can induced by fine dust.
[0178] In detail, an evaluation test was performed using ELISA to measure symmetric dimethylarginine (SDMA), which is a COPD biomarker, in the blood.
[0179] Serum was isolated from the blood collected from the heart of the BALB/c male mouse (7-week-old, 20 g to 25 g, Orient Bio) of Experimental Example 1, and SDMA antibodies (MBS2605912, MyBioSource, SanDiego, Calif., USA) were diluted with a buffer solution and coated microwells (96 wells, SPL 30096, Allforab), and then cultured at 4° C. for 16 hours. Each well was washed with a buffer solution three times, and 10-fold diluted serum was dispensed at 100 μl per well.
[0180] After being left at room temperature for 1 hour, the wells were washed twice. Then, 100 μl of Avidin-HRP-conjugated antibodies (DY007, R&D Systems, Minneapolis, USA) was treated thereon, and the wells were left again at room temperature for 1 hour, followed by washing again. A TMB base solution (DY007, R&D Systems, Minneapolis, USA) was dispensed at 100 μl per well, and the well plate was left in the dark for 30 minutes. After 50 μl of a stopping solution (DY007, R&D Systems, Minneapolis, USA) was treated thereon, absorbance of the cells was measured at 450 nm. After treating the composition with each of the Lactobacillus plantarum KC3 strain, the Leonurus japonicus extract, the mixture thereof, results of measuring the amount of SDMA, which is a COPD biomarker, in the blood are shown in Table 9.
TABLE-US-00009 TABLE 9 Measurement of SDMA as COPD biomarker in blood SDMA level (μg/mL) Inhibition rate (based on Division in serum induced group) Normal control 7.1 ± 3.1 group Induced group 17.2 ± 3.7 Positive control 10.1 ± 1.9 41% group KC3 strain alone 12.1 ± 3.3 30% Leonurus Japonicus 7.2 ± 1.7 58% extract alone Mixture of KC3 4.1 ± 1.3 76% strain + Leonurus japonicus extract
[0181] As shown in Table 9, it was confirmed that, as previously confirmed in the induced group, the level of SDMA which is a COPD biomarker increased by air pollutants reduced by the administration of the mixture of the KC3 strain and the Leonurus japonicus extract, thereby confirming the inhibitory activity on COPD by about 76% or more compared to the induced group. Overall, it was confirmed that the effect of the administration of the mixture as described above was significantly excellent even compared to the administration of each component alone, thereby confirming a synergic effect of the mixture also for the treatment or prevention of a respiratory disease, so as to inhibit COPD which is a representative respiratory disease.
[0182] Formulation Examples of the composition including the mixture of the Lactobacillus plantarum KC3 strain and the Leonurus japonicus extract according to an aspect are described below, but the present disclosure is not intended to be limited thereto, but only to be described in detail.
Formulation Example 1
Preparation of Powder
[0183]
TABLE-US-00010 Mixture of Lactobacillus plantarum KC3 20 mg strain and Leonurus japonicus extract Lactose 100 mg Talc 10 mg
[0184] The components above were mixed and filled in an airtight bag to prepare a powder.
Formulation Example 2
Preparation of Tablet
[0185]
TABLE-US-00011 Mixture of Lactobacillus plantarum KC3 10 mg strain and Leonurus japonicus extract Corn starch 100 mg Lactose 100 mg Magnesium stearate 2 mg
[0186] The tablet was prepared by mixing the above components and en-tableting the same, according to an existing tablet formation method.
Formulation Example 3
Preparation of Capsule
[0187]
TABLE-US-00012 Mixture of Lactobacillus plantarum KC3 10 mg strain and Leonurus japonicus extract Crystalline cellulose 3 mg Lactose 14.8 mg Magnesium stearate 0.2 mg
[0188] A capsule was prepared by mixing the components above and filling a gelatin capsule with the mixture, according to an existing capsule formation method.
Formulation Example 4
Preparation of Injection
[0189]
TABLE-US-00013 Mixture of Lactobacillus plantarum KC3 10 mg strain and Leonurus japonicus extract Mannitol 180 mg Distilled water for injection 2974 mg Na.sub.2HPO.sub.412H.sub.2O 26 mg
[0190] According to an existing injection formation method, an injection was prepared based on the component contents above per 1 ampoule (2).
Formulation Example 5
Formation of Liquid
[0191]
TABLE-US-00014 Mixture of Lactobacillus plantarum KC3 10 mg strain and Leonurus japonicus extract Isomerized glucose syrup 10 g Mannitol 5 g Purified water optimum amount
[0192] According to an existing preparation method for a liquid formulation, each component was added to purified water and dissolved therein, and an optimum amount of lemon flavor was added and mixed with the components above. Then, purified water was added thereto so that the total volume was adjusted to 100 ml, and the resultant solution filled in a brown bottle and sterilized, thereby preparing a liquid formulation.
Formulation Example 6
Preparation of Health Food
[0193]
TABLE-US-00015 Mixture of Lactobacillus plantarum KC3 1,000 mg strain and Leonurus japonicus extract Vitamin mixture optimum amount Vitamin A acetate 70 ug Vitamin E 1.0 mg Vitamin B1 0.13 mg Vitamin B2 0.15 mg Vitamin B6 0.5 mg Vitamin B12 0.2 ug Vitamin C 10 mg Biotin 10 ug Nicotin acid amide 17 mg Folic acid 50 ug Calcium pantothenate 0.5 mg Minearl mixture optimum amount Ferrous sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg Monopotassium phosphate 15 mg Dipotassium phosphate 55 mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium chloride 24.8 mg
[0194] The compositional ratios of the vitamins and minerals in the mixture were set based on components relatively suitable for health food in preferable Examples, but the mixing ratios may be arbitrarily modified. According to the health food preparation methods in the art, each component may be mixed to prepare granules which will be then used for the preparation of the health food composition.
Formation Example 7
Preparation of Health Beverage
[0195]
TABLE-US-00016 Mixture of Lactobacillus plantarum KC3 1,000 mg strain and Leonurus japonicus extract Citric acid 1,000 mg Oligosaccharide 100 g Pulm concentrate 2 g Taurin 1 g By addition of purified water 900 ml in total
[0196] According to an existing method of preparing a health beverage, the components above were mixed and heated at 85° C. for about one hour while stirring. The prepared solution was filtered and collected in a sterilized 2 L container. The container was sealed, sterilized, and stored in a refrigerator to be used for the preparation of a health beverage composition.