Complex of nucleic acid medicine and multibranched lipid
11638717 · 2023-05-02
Assignee
Inventors
- Akira Kugimiya (Toyonaka, JP)
- Mitsuaki Sekiguchi (Amagasaki, JP)
- Norikazu Kuroda (Toyonaka, JP)
- Jun Nakamura (Toyonaka, JP)
- Tetsuya Tanino (Toyonaka, JP)
- Yasunori Mitsuoka (Toyonaka, JP)
- Takeshi Kasuya (Osaka, JP)
- Yasuharu Kato (Toyonaka, JP)
Cpc classification
C07H21/00
CHEMISTRY; METALLURGY
A61K47/50
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
A61K47/543
HUMAN NECESSITIES
C12N15/00
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
A61K31/7088
HUMAN NECESSITIES
A61K47/50
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The purpose of the present invention is to provide novel complexes that improve the effect of nucleic acid medicines. Provided is a complex in which a multibranched lipid(s) binds through a linker to a strand of an oligonucleotide comprising a nucleic acid medicine having suppressing activity of the target gene expression.
Claims
1. A complex, comprising: an oligonucleotide having suppressing activity of a target gene expression; a linker; and a lipid binding through the linker to the oligonucleotide and comprising a group of formula ##STR00106## wherein A.sup.11 is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl or a group of formula: ##STR00107## A.sup.1 to A.sup.10 and A.sup.16 to A.sup.17 are each independently a bond, substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene, when A.sup.1 and A.sup.2 or A.sup.16 and A.sup.17 are substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene, any carbon atom of A.sup.1 and any carbon atom of A.sup.2, or any carbon atom of A.sup.16 and any carbon atom of A.sup.17 taken together may form substituted aromatic carbocycle or substituted non-aromatic carbocycle, Y.sup.1 to Y.sup.7 are each independently a bond or O, X.sup.1, X.sup.3 and X.sup.6 are each independently NR.sup.1C(═O), C(═O)NR.sup.1, R.sup.2C(═O)NR.sup.1 or NR.sup.1C(═O)R.sup.2, X.sup.2, X.sup.4, X.sup.5 and X.sup.7 are each independently a bond, NR.sup.3C(═O), C(═O)NR.sup.3, R.sup.4C(═O)NR.sup.3, NR.sup.3C(═O)R.sup.4 or S—S, R.sup.2 and R.sup.4 are each independently O or NR.sup.5, R.sup.1, R.sup.3 and R.sup.5 are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl, A.sup.12 and A.sup.14 are substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, or a group comprising a fat-soluble compound, A.sup.13, A.sup.15, A.sup.20 and A.sup.21 are each independently substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl, and m, n, p, q, r, s and t are each independently 1 or 2, provided that a substituent for the alkyls, alkenyls, alkynyls, alkylenes, alkenylenes and alkynylenes is halogen, hydroxy, carboxy, amino, imino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso, azide, hydrazino, ureide, amidino, guanidino, trialkylsilyl, aromatic carbocyclyl, non-aromatic carbocyclyl, non-aromatic heterocyclyl, non-aromatic heterocyclyl, aromatic carbocyclylcarbonyl, non-aromatic carbocyclylcarbonyl, aromatic heterocyclylcarbonyl or non-aromatic heterocyclylcarbonyl, and the substituent is unsubstituted or comprises one or more substituents selected from Group α consisting of hydroxy, alkyl, alkyloxy, mercapto, alkylthio, amino, alkylamino and halogen, and wherein the linker is a group of formula ##STR00108## wherein L.sup.0 binds to the oligonucleotide and L.sup.6 binds to the lipid, L.sup.0 is a bond, a nucleotide linker or a non-nucleotide linker, and L.sup.1 is a group of formula ##STR00109## wherein Z are each independently O or S, R.sup.6 are each independently hydroxy, alkyl or alkyloxy, L.sup.2 and L.sup.4 are each independently a bond or substituted or unsubstituted C1 to C20 alkylene, L.sup.3 are each independently C(═O)NR.sup.7, NR.sup.8C(═O), or S—S, wherein R.sup.7 is hydrogen or substituted or unsubstituted alkyl and R.sup.8 is hydrogen, substituted or unsubstituted alkyl or R.sup.8 and a carbon atom in alkylene of L.sup.2 taken together may form substituted or unsubstituted nitrogen-containing ring, L.sup.5 are each independently a bond, substituted or unsubstituted C1 to C20 alkylene, C(═O)NR.sup.9, NR.sup.9C(═O), NR.sup.9, O, or substituted or unsubstituted non-aromatic heterocyclyl, R.sup.9 is each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl, u is 1 or 2, and L.sup.6 is a bond or an amino acid linker.
2. The complex of claim 1, wherein, in the lipid, A.sup.1 to A.sup.5 and Y.sup.1 to Y.sup.5 are a bond, A.sup.6 to A.sup.10 are each independently a bond, substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene, X.sup.1 to X.sup.5 are NHC(═O), and n, p, q and r are 1.
3. The complex of claim 1, wherein A.sup.11 and A.sup.13 are C6 to C30 alkyl.
4. The complex of claim 1, wherein the lipid binds at the 3′-end and/or 5′-end of the oligonucleotide.
5. A complex of one of formulas (C-2) to (C-7) ##STR00110## wherein OL is an oligonucleotide having suppressing activity of a target gene expression, 5′ represents that the oligonucleotide binds at the 5′-end of the oligonucleotide, 3′ represents that the oligonucleotide binds at the 3′-end of the oligonucleotide, Z.sup.1-1 is O or S, L.sup.0-1 is a bond, a nucleotide linker or a non-nucleotide linker, L.sup.5-1 is a bond, NH or O, L.sup.6-1 is a bond or an amino acid linker, LI is a lipid comprising a group of one of formulas (LI-1) to (LI-9) ##STR00111## wherein A.sup.1-1 is a bond or methylene, A.sup.2-1 is C1 to C4 straight alkylene, A.sup.11-1 is C7 to C23 straight or branched alkyl, and A.sup.12-1 is C3 to C23 straight or branched alkyl or alkenyl, a group comprising a fat-soluble compound, or a group of formula ##STR00112## wherein A.sup.13-1, A.sup.14-1 and A.sup.15-1 are C9 to C13 straight alkyl, ##STR00113## wherein A.sup.20-1 and A.sup.21-1 is C13 straight alkyl, and A.sup.12-2 is C15 straight alkyl or a group comprising a fat-soluble compound, ##STR00114## wherein A.sup.11-2 is C15 straight alkyl, and A.sup.12-3 is C1 to C4 straight alkyl substituted with amino, ##STR00115## wherein A.sup.20-2 and A.sup.21-2 are C13 straight alkyl, and A.sup.12-4 is C4 straight alkyl substituted with amino, ##STR00116## wherein A.sup.11-3 and A.sup.12-5 are C15 straight alkyl, ##STR00117## wherein A.sup.11-4 is C14 straight alkyl, and A.sup.12-6 is C6 to C12 straight alkyl.
6. A pharmaceutical composition, comprising: the complex of claim 1.
7. The complex of claim 2, wherein A.sup.11 and A.sup.13 are C6 to C30 alkyl.
8. The complex of claim 2, wherein the lipid binds at the 3′-end and/or 5′-end of the oligonucleotide.
9. The complex of claim 3, wherein the lipid binds at the 3′-end and/or 5′-end of the oligonucleotide.
10. A pharmaceutical composition, comprising: the complex of claim 2.
11. A pharmaceutical composition, comprising: the complex of claim 3.
12. A pharmaceutical composition, comprising: the complex of claim 4.
13. A pharmaceutical composition, comprising: the complex of claim 5.
14. The complex of claim 7, wherein the lipid binds at the 3′-end and/or 5′-end of the oligonucleotide.
15. The complex of claim 1, wherein the lipid binds at the 3′-end and 5′-end of the oligonucleotide.
16. The complex of claim 1, wherein the lipid binds at the 3′-end of the oligonucleotide.
17. The complex of claim 1, wherein the lipid binds at the 5′-end of the oligonucleotide.
18. A pharmaceutical composition, comprising: the complex of claim 15.
19. A pharmaceutical composition, comprising: the complex of claim 16.
20. A pharmaceutical composition, comprising: the complex of claim 17.
Description
EXAMPLES
(1) The present invention will be described in more detail with reference to, but not limited to, the following Examples, Reference Examples and Test Examples.
(2) NMR analysis of each compound obtained in Examples was performed by 300 MHz or 400 MHz using CD.sub.3OD, CDCl.sub.3 or DMSO-d6.
(3) UPLC analysis was performed under the following conditions.
(4) 1) ODS Acid Analysis
(5) Mobile phases: [A] is 0.1% aqueous formic acid solution, and [B] is acetonitrile solution containing 0.1% formic acid
(6) Gradient: linear gradient of 5%-100% Solvent [B] for 3.5 minutes was performed, and 100% Solvent [B] was maintained for 0.5 minute.
(7) Column: ACQUITY UPLC (Registered Trademark) BEH C18 (1.7 μm, i.d. 2.1×50 mm) (Waters)
(8) Flow rate: 0.8 mL/min
(9) PDA detection wavelength: 254 nm (Detection range 210-500 nm)
(10) 2) ODS Base Analysis
(11) Mobile phases: [A] is 10 mM aqueous ammonium carbonate solution, and [B] is acetonitrile
(12) Gradient: linear gradient of 5%-100% Solvent [B] for 3.5 minutes was performed, and 100% Solvent [B] was maintained for 0.5 minute.
(13) Column: ACQUITY UPLC (Registered Trademark) BEH C18 (1.7 μm, i.d. 2.1×50 mm) (Waters)
(14) Flow rate: 0.8 mL/min
(15) PDA detection wavelength: 254 nm (Detection range 210-500 nm)
(16) 3) C4 Base Analysis
(17) Mobile phases: [A] is 10 mM aqueous ammonium carbonate solution and [B] is acetonitrile
(18) Gradient: linear gradient of 60%-100% Solvent [B] for 3.5 minutes was performed, and 100% Solvent [B] was maintained for 0.5 minute.
(19) Column: Xbridge Protein BEH C4 (3.5 μm, i.d. 2.1×50 mm) (Waters)
(20) Flow rate: 0.8 mL/min
(21) PDA detection wavelength: 254 nm (Detection range 210-500 nm)
Example 1 Synthesis of the Complex of the Present Invention
(22) A) Synthesis of Lipids
(23) 1) Synthesis of 5-n′
(24) ##STR00049##
wherein n′ is an integer of 5 to 29.
1-1) Synthesis of Compound 5-12
Step 1
(25) Compound 2-12 (5.07 g, 22.19 mmol, Tokyo Chemical Industry Co., Ltd.) was dissolved in DMF (51.8 mL) and dichloromethane (28.6 mL). DIEA (5.81 mL, 33.3 mmol) and HBTU (9.26 g, 24.4 mmol) were added thereto, and the mixture was vigorously stirred at room temperature for 30 minutes. To the resulting white suspended solution, Compound 1 (1.0 g, 11.1 mmol) was added at room temperature, and the mixture was vigorously stirred. Then, the mixture was heated to 40° C., and then stirred for two hours. To the reaction mixture was added aqueous saturated sodium bicarbonate solution (10 mL) to stop the reaction. The resulting white solid was collected by filtration. The resulting solid was washed with water (50 mL), acetonitrile (50 mL) and dichloromethane (50 mL) to obtain Compound 3-12 (4.8 g, 9.4 mmol) as white solid.
(26) .sup.1H-NMR (CDCl.sub.3):6.20 (2H, brs), 3.96 (1H, d, J=4.0 Hz), 3.75 (1H, m), 3.40 (2H, dd, J=4.0, 12.0 Hz), 3.25 (2H, dd, J=4.0, 12.0 Hz), 2.22 (4H, t, J=12.0 Hz), 1.62 (4H, d, J=8.0 Hz), 1.29-1.25 (40H, m), 0.90-0.86 (6, m)
(27) ESI-MS (m/z): 512 (M+1).
(28) Step 2
(29) Compound 3-12 (5.10 g, 9.98 mmol) was suspended in dichloromethane (257 mL), and DIEA (6.97 mL, 39.9 mmol) was added thereto. Then, Compound 4 (4.46 mL, 20.0 mmol) was added at room temperature, and the mixture was heated under reflux for two hours. After cooling to room temperature, the reaction mixture was transferred to a separatory funnel, and the organic layer was washed twice with aqueous saturated sodium bicarbonate solution (100 mL), twice with water (100 mL), and once with brine (100 mL). After the resulting organic layer was dried over magnesium sulfate, the solvent was distilled off under reduced pressure. The resulting brown oil, Compound 5-12 (4.80 g, 6.75 mmol) was obtained as a crude product. Formation of the compound was determined based on introduction of trivalent phosphorus by .sup.31P-NMR.
(30) .sup.31P-NMR(CDCl.sub.3)δ:148.2 (s)
(31) 2) Synthesis of Compound 8
(32) ##STR00050##
(33) To Compound 6 (see US2014/0142253, 292 mg, 0.435 mmol) in DMF solution (2.0 mL), imidazole (71 mg, 1.044 mmol) and t-butylchlorodimethylsilane (79 mg, 0.522 mmol) were added, and the mixture was stirred at room temperature for 16 hours. The reaction mixture was diluted with water and extracted with cyclopentyl methyl ether. The organic layer was washed with water and brine, and then dried over sodium sulfate. The solvent was distilled off under reduced pressure to obtain the crude product of Compound 7 (352 mg).
(34) To the crude product of Compound 7 (352 mg) in dichloromethane solution (2.4 mL), diethylamine (0.6 mL, 5.74 mmol) was added, and the mixture was stirred at room temperature for 16 hours. After ethanol was added to the reaction mixture, the solvent was distilled off under reduced pressure. The residue was coevaporated twice with ethanol, and the resulting crude product was purified by amino silica gel column chromatography (chloroform) to obtain Compound 8 (190 mg, 78%) as colorless oil.
(35) .sup.1H-NMR (CDCl.sub.3) δ: 7.45-7.43 (2H, m), 7.32 (4H, d, J=8.8 Hz), 7.29-7.25 (2H, m), 7.22-7.18 (1H, m), 6.81 (4H, d, J=8.8 Hz), 3.79 (6H, s), 3.68-3.61 (2H, m), 3.08-3.02 (211, m), 2.63 (21, t, J=7.2 Hz), 1.75-1.69 (1H, m), 1.41-1.30 (6H, m), 1.27-1.15 (2H, m), 0.84 (9H, s), 0.01 (6H, s).
(36) 3) Synthesis of Compound 13-n′
(37) ##STR00051##
wherein n′ is an integer of 5 to 29.
3-1) Synthesis of Compound 13-6
Step 1
(38) To Compound 3-6 (1.0 g, 2.92 mmol) in THF (20 mL)-chloroform (20 mL) solution, DIEA (1.53 mL, 8.76 mmol), bis(nitrophenyl) carbonate (1.33 g, 4.38 mmol) and DMAP (178 mg, 1.46 mmol) were added, and the mixture was stirred at 60° C. for one hour. The reaction mixture was filtered. After the mother liquid was distilled off under reduced pressure, the resulting crude product was purified by silica gel column chromatography (hexane:ethyl acetate=60:40.fwdarw.20:80) to obtain Compound 9-6 (982 mg, 66%) as a white solid.
(39) .sup.1H-NMR (CDCl.sub.3) δ: 8.32-8.26 (2H, m), 7.42 (2H, dt, J=9.9, 2.5 Hz), 6.36 (2H, t, J=6.4 Hz), 4.80 (1H, ddd, J=10.7, 5.6, 3.3 Hz), 3.65-3.50 (4H, m), 2.26 (4H, t, J=7.6 Hz), 1.69-1.62 (4H, m), 1.28 (16H, dt, J=19.1, 4.7 Hz), 0.87 (6H, t, J=6.8 Hz).
(40) Step 2
(41) To Compound 8 (500 mg, 0.89 mmol) in dichloromethane solution (10.0 mL), Compound 9-6 (450 mg, 0.89 mmol) was added, and the mixture was stirred at room temperature for two hours. The reaction mixture was concentrated under reduced pressure and purified by amino silica gel column chromatography (hexane:ethyl acetate=65:35.fwdarw.10:90) to obtain Compound 10-6 (625 mg, 76%) as colorless oil.
(42) .sup.1H-NMR (CDCl.sub.3) δ: 7.42 (2H, d, J=7.4 Hz), 7.31 (4H, t, J=6.2 Hz), 7.26 (3H, t, J=3.9 Hz), 7.19 (1H, t, J=7.2 Hz), 6.82 (4H, t, J=6.0 Hz), 6.25 (2H, t, J=5.8 Hz), 4.70 (2H, dd, J=10.3, 5.3 Hz), 3.79 (6H, d, J=4.4 Hz), 3.62 (2H, dd, J=10.1, 5.1 Hz), 3.51 (2H, dd, J=13.3, 6.4 Hz), 3.32-3.26 (2H, m), 3.08 (4H, dt, J=20.2, 6.6 Hz), 2.19 (4H, t, J=7.7 Hz), 1.70 (1H, t, J=5.7 Hz), 1.61 (8H, t, J=9.3 Hz), 1.42 (2H, t, J=7.3 Hz), 1.26 (20H, tt, J=26.0, 10.5 Hz), 0.88 (6H, dd, J=12.0, 5.3 Hz), 0.83 (9H, s).
(43) Step 3
(44) To Compound 10-6 (625 mg, 0.67 mmol) in THF solution (10 mL), TBAF (1M THF solution, 1.34 mL, 1.34 mmol) was added, and the mixture was stirred at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure, and the resulting crude product was purified by diol silica gel column chromatography (hexane:ethyl acetate=50:50.fwdarw.10:90) to obtain Compound 11-6 (541 mg, 99%) as colorless liquid.
(45) .sup.1H-NMR (CDCl.sub.3) δ: 7.41 (2H, t, J=4.3 Hz), 7.26 (9H, ddt, J=31.6, 12.0, 4.9 Hz), 6.83 (4H, d, J=8.8 Hz), 6.38 (2H, q, J=6.1 Hz), 4.88 (1H, t, J=5.6 Hz), 4.67 (1H, t, J=5.0 Hz), 3.79 (6H, t, J=7.5 Hz), 3.69-3.61 (2H, m), 3.50-3.44 (2H, m), 3.30 (3H, tt, J=20.6, 6.5 Hz), 3.15-3.06 (3H, m), 2.63 (1H, s), 2.21-2.17 (4H, m), 1.78 (1H, s), 1.62 (4H, t, J=6.9 Hz), 1.43 (2H, t, J=5.4 Hz), 1.30 (20H, dt, J=29.2, 11.0 Hz), 0.87 (6H, t, J=6.9 Hz).
(46) Step 4
(47) To Compound 11-6 (541 mg, 0.66 mmol) in dichloromethane solution (2 mL), DIEA (0.35 mL, 1.98 mmol), DMAP (8.0 mg, 0.066 mmol) and succinic anhydride (132 mg, 1.32 mmol) were added, and the mixture was stirred at room temperature for four hours. The reaction mixture was concentrated under reduced pressure, and the resulting crude product was purified by silica gel column chromatography (chloroform:methanol=40:1.fwdarw.10:1) to obtain Compound 12-6 (591 mg, 97%) as colorless liquid.
(48) .sup.1H-NMR (CDCl.sub.3) δ: 7.41 (2H, d, J=7.5 Hz), 7.31-7.25 (8H, m), 7.20 (1H, t, J=7.2 Hz), 6.82 (4H, d, J=8.5 Hz), 6.62 (1H, t, J=6.3 Hz), 6.48 (1H, t, J=6.5 Hz), 5.91 (1H, t, J=5.5 Hz), 4.71 (1H, t, J=5.3 Hz), 4.42 (1H, dd, J=11.0, 3.2 Hz), 4.14 (1H, dd, J=10.9, 5.9 Hz), 3.79 (6H, s), 3.40 (4H, tt, J=20.4, 7.0 Hz), 3.08 (4H, dq, J=33.3, 8.0 Hz), 2.69-2.49 (4H, m), 2.20 (4H, dd, J=15.6, 8.2 Hz), 1.95 (1H, s), 1.61 (4H, d, J=7.0 Hz), 1.27 (22H, d, J=5.0 Hz), 0.87 (6H, dd, J=6.8, 5.1 Hz).
(49) Step 5
(50) To Compound 12-6 (312 mg, 0.34 mmol) in a mixture of acetonitrile/dichloromethane (4:1, 25 mL), DIEA (0.30 mL, 1.70 mmol) and HBTU (142 mg, 0.37 mmol) were added, and the mixture was shaken at room temperature for 15 minutes. To the reaction mixture, HybridCPG amino form 2000 Å (Prime Synthesis, Inc.) (2.8 g) was added, and the mixture was shaken for 24 hours. After the reaction mixture was filtered, HybridCPG resin was washed three times with acetonitrile and three times with diethyl ether and dried under reduced pressure. To the dried HybridCPG, a mixture of THF/acetic anhydride/pyridine (8:1:1, 30 mL) was added, and the mixture was shaken for three hours. After the reaction mixture was filtered, HybridCPG resin was washed twice with pyridine, twice with isopropanol and twice with diethyl ether, and dried under reduced pressure. The supported amount of Compound 12-6 was calculated by colorimetric assay of the DMTr cation, and Compound 13-6 whose supported amount is 114 μmol/g was obtained.
(51) 3-2) the Following Compounds were Synthesized in a Similar Method to 3-1). Compound 13-8 whose supported amount of Compound 12-8 is 107 μmol/g Compound 13-10 whose supported amount of Compound 12-10 is 69 μmol/g Compound 13-12 whose supported amount of Compound 12-12 is 31 μmol/g Compound 13-14 whose supported amount of Compound 12-14 is 40 μmol/g Compound 13-18 whose supported amount of Compound 12-18 is 15 μmol/g Compound 13-20 whose supported amount of Compound 12-20 is 48 μmol/g Compound 13-22 whose supported amount of Compound 12-22 is 47 μmol/g
4) Synthesis of Compound 14-n′
(52) ##STR00052##
wherein n′ is an integer of 5 to 29.
4-1) Synthesis of Compound 14-16
(53) To Compound 3-16 (3.0 g, 4.81 mmol) in THF solution (80 mL), pyridine (0.78 mL, 9.63 mmol), 4-nitrophenyl chloroformate (1.94 g, 9.63 mmol) and DMAP (59 mg, 0.481 mmol) were added, the mixture was stirred at 70° C. for three hours. The reaction mixture was filtered. After the mother liquid was distilled off under reduced pressure, and the resulting crude product was purified by silica gel column chromatography (hexane:ethyl acetate=50:50) to obtain Compound 14-16 (1 g, 26%) as a white solid.
(54) .sup.1H-NMR (CDCl.sub.3) δ: 8.29 (2H, dt, J=9.7, 2.6 Hz), 7.43 (2H, dt, J=9.9, 2.7 Hz), 6.28 (2H, t, J=6.4 Hz), 4.80-4.77 (1H, m), 3.62 (2H, ddd, J=14.5, 7.0,), 3.51 (2H, dt, J=14.5, 6.3 Hz), 2.25 (4H, t, J=7.7 Hz), 1.65 (4H, td, J=12.4, 5.3 Hz), 1.36-1.20 (56H, m), 0.88 (6H, t, J=6.8 Hz).
(55) 5) Synthesis of Compound 18
(56) ##STR00053##
(57) Compound 17 was synthesized from Compound 15 according to the methods described in Nucleic Acids Research, 42, 8796-8807 (2014).
(58) To Compound 17 (3.00 g, 7.15 mmol) in dichloromethane solution (15 ml), triethylamine (1.98 ml, 14.3 mmol, 2.0 eq.), succinic anhydride (751 mg, 7.51 mmol, 1.05 eq.) were added at room temperature, and the mixture was stirred at room temperature for one hour. The reaction mixture was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO.sub.2:120 g, chloroform:methanol:triethylamine=95:5:1.fwdarw.75:25:1) to obtain Compound 18 (3.37 g, Yield 91%) as colorless powder. By 1H-NMR, it was observed a mixture of rotamers, which is 63:37.
(59) ESI-MS (m/z): 530 (M+H). HPLC Peak RT=1.86 min.
(60) .sup.1H-NMR (CDCl.sub.3) δ: (Major) 7.39-7.33 (2H, m), 7.30-7.22 (6H, m), 7.22-7.16 (1H, m), 6.85-6.77 (4H, m), 4.50 (1H, brs), 4.41 (1H, m), 3.88 (1H, d, J=11.0 Hz), 3.775 (6H, s), 3.65 (1H, dd, J=11.0, 4.0 Hz), 3.43 (1H, dd, J=9.2, 4.5 Hz), 3.14 (1H, dd, J=9.2, 2.7 Hz), 2.85-1.97 (6H, m). (Minor) 7.39-7.33 (2H, m), 7.30-7.22 (6H, m), 7.22-7.16 (1H, m), 6.85-6.77 (4H, m), 4.41 (1H, m), 4.31 (1H, brs), 4.11 (1H, d, J=12.3 Hz), 3.783 (6H, s), 3.25 (1H, dd, J=12.3, 3.5 Hz), 3.18 (1H, dd, J=9.5, 4.8 Hz), 3.10 (1H, dd, J=9.5, 4.8 Hz), 2.85-1.97 (6H, m).
(61) 6) Synthesis of Compound 27-n′
(62) ##STR00054##
wherein n′ is an integer of 5 to 29.
6-1) Synthesis of Compound 27-12
Step 1
(63) Compound 19 was synthesized from Compound 1 according to the methods described in Journal of Medicinal Chemistry, 48, 7781 (2005).
(64) Step 2
(65) To Compound 19 (3.00 g, 7.15 mmol) in a mixture of THF-water (9:1) (30 ml), triphenylphosphine (1.98 ml, 14.3 mmol, 2.0 eq.) was added at room temperature, and the mixture was stirred at room temperature for one hour. The temperature was raised up to 70° C., and the mixture was stirred for four hours. After cooling to room temperature, the reaction mixture was concentrated under reduced pressure to the crude product of obtain Compound 20 as colorless oil.
(66) Step 3
(67) To Compound 20 (7.15 mmol) in dichloromethane (30 ml), triethylamine (2.10 ml, 15.1 mmol, 1.2 eq.) and Fmoc-C1 (3.59 g, 13.9 mmol, 1.1 eq.) were added at room temperature, and the mixture was stirred at room temperature for one hour. The reaction mixture was diluted with chloroform, washed with brine, and then dried over magnesium sulfate. The solvent was distilled off under reduced pressure. The resulting solid was washed with n-hexane and a little of chloroform, and then purified by silica gel column chromatography (SiO.sub.2:120 g, n-hexane:ethyl acetate=75:25-0:100) to obtain Compound 21 (4.18 g, Yield from Compound 19: 65%) as colorless foam.
(68) ESI-MS (m/z): 512 (M+H). HPLC Peak RT=2.71 min.
(69) .sup.1H-NMR (CDCl.sub.3):7.80 (2H, d, J=7.5 Hz), 7.60 (2H, d, J=7.5 Hz), 7.40 (2H, dd, J=7.5, 7.5 Hz), 7.30 (2H, dd, J=7.5, 7.5 Hz), 6.02 (1H, brs), 5.21 (2H, brs), 4.46-4.27 (2H, m), 4.21 (1H, m), 3.59 (1H, m), 3.45-3.29 (2H, m), 3.27-3.13 (2H, m), 1.46 (18H, s).
(70) Step 4
(71) To Compound 21 (1.5 g, 2.93 mmol), TFA (10 ml) was added, and the mixture was stirred at room temperature for one hour. The mixture was concentrated under reduced pressure to obtain the crude product of Compound 22.
(72) ESI-MS (m/z): 312 (M+H). HPLC Peak RT=1.06 min.
(73) Step 5
(74) To Compound 22 in dichloromethane (15 ml), triethylamine (2.43 ml, 17.59 mmol) and myristoyl chloride (1.59 g, 6.45 mmol) was added at room temperature, and the mixture was stirred at room temperature overnight. The resulting white precipitate was collected by filtration, washed with dichloromethane, water and n-hexane, and then dried under reduced pressure to obtain Compound 23-12 (2.45 g) as a solid.
(75) .sup.1H-NMR (CDCl.sub.3)δ:12.32 (1H, s), 7.76 (2H, d, J=7.3 Hz), 7.60 (2H, d, J=7.3 Hz), 7.35 (4H, dt, J=33.7, 7.3 Hz), 6.56 (1H, s), 6.40 (1H, s), 4.32-4.19 (2H, m), 3.60 (2H, s), 3.20-3.09 (4H, m), 2.23 (4H, t, J=7.1 Hz), 1.64 (4H, s), 1.37-1.25 (40H, m), 0.88 (6H, t, J=6.8 Hz).
(76) Step 6
(77) To Compound 23-12 (1.9 g, 2.60 mmol) in DMF (15 ml), piperidine (0.290 ml, 2.93 mmol) was added, and the mixture was stirred at 80° C. for 20 minutes. After cooling to room temperature, the resulting precipitate was collected by filtration, washed with n-hexane, and dried under reduced pressure to obtain Compound 24-12 (742 mg, Yield 50%) as a solid.
(78) .sup.1H-NMR (CDCl.sub.3)δ:6.43 (1H, s), 3.43 (2H, t, J=8.2 Hz), 3.03 (4H, m), 2.22 (4H, t, J=7.6 Hz), 1.73 (4H, m), 1.38-1.25 (40H, m), 0.88 (6H, t, J=6.7 Hz).
(79) Step 7
(80) To Compound 18 (585 mg, 1.13 mmol) in DMF (5 mL), DIEA (1.20 ml, 1.79 mmol) and HBTU (677 mg, 1.79 mmol) were added at room temperature, and the mixture was stirred at room temperature for 10 minutes. The mixture was added to Compound 24-12 (700 mg, 1.37 mmol) in dichloromethane (30 mL) at 45° C., and then the mixture was stirred for 30 minutes at 45° C. Since the insoluble material was confirmed, it was completely dissolved by adding DMF (1.5 mL). After the solvent of the reaction mixture was distilled off under reduced pressure, the reaction mixture was washed with aqueous saturated sodium bicarbonate solution, and then dried over magnesium sulfate. The solvent was distilled off under reduced pressure. The resulting residue was dissolved in ethyl acetate, and n-hexane was added thereto at 80° C. The target product was precipitated and collected by filtration to obtain Compound 25-12 (1.31 g, Yield 88%) as a solid. The resulting product was used for the next reaction without further purification.
(81) Step 8
(82) To Compound 25-12 (1.0 g, 0.919 mmol) in dichloromethane (20 ml), triethylamine (0.510 ml, 3.68 mmol, 4 eq.), succinic anhydride (184 mg, 1.839 mmol, 2 eq.) and dimethylamino pyridine (1 mg) were added in order at room temperature. After the mixture was stirred at room temperature for two hours, triethylamine (0.255 ml) and succinic anhydride (90 mg) was added thereto because the starting material was remained, and the mixture was stirred at room temperature overnight. The reaction mixture was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO.sub.2: 30 g, chloroform:methanol:triethylamine=100:0:1.fwdarw.90:10:1) to obtain Compound 26-12 (261 mg, Yield 35%) as a solid.
(83) ESI-MS (m/z): 1110 (M−H). HPLC Peak RT=3.08 min.
(84) Step 9
(85) Compound 27-12 whose supported amount of Compound 26-12 is 31.2 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(86) ##STR00055##
wherein s′, t′ and are each independently an integer of 3 to 20.
7-1) Synthesis of Compound 33-7-7-7
Step 1
(87) Compound 28-7-7-7 was synthesized according to the methods described in Journal of Controlled Release, 220, 44-50 (2015).
(88) Step 2
(89) To Compound 28-7-7-7 (1 g, 2.45 mmol) in THF (50 mL), bis(4-nitrophenyl) carbonate (2.23 g, 7.34 mmol) and DMAP (897 mg, 7.34 mmol) were added, and the mixture was stirred at 65° C. for two hours. The reaction mixture was distilled off under reduced pressure, and the resulting crude product was purified by silica gel column chromatography (hexane:ethyl acetate=100:10) to obtain Compound 29-7-7-7 (932 mg, 66%) as colorless solid.
(90) ESI-MS (m/z): 591 (M+H+H2O). HPLC Peak RT=2.49 min.
(91) Step 3
(92) To Compound 29-7-7-7 (644 mg, 1.12 mmol) in dichloromethane (6.4 mL), 6-amino-2-hydroxymethyl hexane-1-ol (500 mg, 0.89 mmol) in DMF (6.4 mL) and DIEA (0.39 mL, 2.24 mmol) were added, and the mixture was stirred at 40° C. for two hours. After water added to the reaction mixture to stop the reaction, the reaction mixture was transferred to a separatory funnel. The organic layer was washed twice with water and once with brine. After the resulting organic layer was dried over magnesium sulfate, the solvent was distilled off under reduced pressure. The resulting crude product was purified by silica gel column chromatography (hexane:ethyl acetate=50:50) to obtain Compound 30-7-7-7 (424 mg, 65%) as colorless oil.
(93) ESI-MS (m/z): 583 (M+H). HPLC Peak RT=2.06 min.
(94) Step 4
(95) To Compound 30-7-7-7 (424 mg, 0.729 mmol) in pyridine (6.4 mL), DMTrCl (272 mg, 0.802 mmol) was added, and the mixture was stirred at room temperature for 16 hours. The reaction mixture was concentrated under reduced pressure, and then purified by diol silica gel column chromatography (hexane:ethyl acetate=3:1) to obtain Compound 31-7-7-7 (510 mg, 51%) as colorless oil.
(96) ESI-MS (m/z): 883 (M−H). HPLC Peak RT=2.60 min
(97) Step 5
(98) To Compound 31-7-7-7 (510 mg, 0.58 mmol) in dichloromethane (6.4 mL), DMAP (137 mg, 1.12 mmol), succinic anhydride (337 mg, 3.37 mmol) and DIEA (0.59 mL, 3.37 mmol) were added, and the mixture was stirred at room temperature for 3 days. After the reaction mixture was concentrated under reduced pressure, the resulting crude product was purified by silica gel column chromatography (chloroform:methanol=20:1) to obtain Compound 32-7-7-7 (945 mg) as colorless liquid.
(99) ESI-MS (m/z): 983 (M−H). HPLC Peak RT=1.97 min
(100) Step 6
(101) Compound 33-7-7-7 whose supported amount of Compound 32-7-7-7 is 16 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(102) 8) Synthesis of Compound 42
(103) ##STR00056##
Step 1
(104) Compound 41 was synthesized from Compound 40 described in Bioorganic & Medicinal Chemistry Letters, 13(6), 1037-1040; 2003 in a similar method to Step 1 of 1-1) and Steps 1 to 4 of 3-1).
(105) .sup.1H-NMR (CDCl.sub.3) δ: 7.42-7.18 (m, 5H), 6.81 (m, 2H), 6.55 (brs, 1H), 6.39 (brs, 1H), 5.91 (brs, 1H), 4.72 (m, 1H), 4.43 (m, 1H), 4.15 (m, 1H), 3.79 (s, 6H), 3.45-3.37 (m, 4H), 3.05 (m, 4H), 2.58-2.52 (m, 4H), 2.19 (m, 4H), 1.95 (brs, 1H), 1.60-1.14 (m, 32H), 0.88 (m, 4H), 0.78-0.61 (m, 8H), 0.28 (m, 4H).
(106) Step 2
(107) Compound 42 whose supported amount of Compound 41 is 92 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(108) 9) Synthesis of Compound 48-n′
(109) ##STR00057##
wherein n′ is an integer of 5 to 29.
9-1) Synthesis of Compound 48-8
Step 1
(110) Decanoic acid (1.16 g, 6.75 mmol, Tokyo Chemical Industry Co., Ltd.) was dissolved in DMF (14 mL) and dichloromethane (14 mL). DIEA (3.14 mL, 18 mmol) and HBTU (2.82 g, 7.43 mmol) were added thereto, and the mixture was vigorously stirred at room temperature for one hour. To the resulting brown solution, Compound 43 (see Chemistry-A European Journal (2010), 16, (15), 4519-4532, S4519, 2.0 g, 2.25 mmol) was added at room temperature, and the mixture was stirred at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure. The residue was treated with acetonitrile containing 25% water, and the resulting solid was collected by filtration. The resulting solid was washed three times with water and three times with acetonitrile containing 25% water to obtain Compound 44-8 (2.19 g, 2.07 mmol) as a white solid.
(111) Step 2
(112) Compound 44-8 (0.5 g, 0.471 mmol) was dissolved in ethanol (6 mL), and palladium hydroxide (221 mg, Pd 20%, hydrous) was added thereto. The mixture was vigorously stirred under hydrogen atmosphere at room temperature for two hours. After substituting with nitrogen, the insoluble material was filtered through a Celite. The filtrate was concentrated under reduced pressure, and acetonitrile was added to the residue. The resulting white solid was collected by filtration to obtain Compound 45-8 (0.400 g, 0.471 mmol) as a white foamy solid.
(113) .sup.1H-NMR (CDCl.sub.3)δ:6.44 (brs, 2H), 3.71 (m, 6H), 3.37 (m, 6H), 3.27 (m, 12H), 2.45 (m, 6H), 2.17 (m, 6H), 1.63 (m, 6H), 1.25 (m, 36H), 0.88 (t, 9H, J=6.8 Hz).
(114) Step 3
(115) Under nitrogen atmosphere, to Compound 45-8 (0.4 g, 0.432 mmol) in DMF (1.7 mL)-dichloromethane (1.4 mL)-chloroform (1.0 mL), bis-(p-nitrophenyl) carbonate (0.131 g, 0.432 mmol) and DIEA (0.226 mL, 1.30 mmol) were added, and the mixture was stirred at room temperature for 12 hours. Next, Compound 8 (0.243 g, 0.432 mmol) obtained in 2) was added thereto, and the mixture was stirred at room temperature for six hours. The reaction mixture was diluted with ethyl acetate. The organic layer was washed three times with water, twice with 0.2 M aqueous potassium hydrogen carbonate solution, and with brine, and dried over anhydrous magnesium sulfate. After filtering off the solid, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (chloroform:acetone=1:0.fwdarw.9:1) to obtain Compound 46-8 (0.375 g, 0.247 mmol) as a white solid.
(116) .sup.1H-NMR (CDCl.sub.3)δ:7.40 (m, 2H), 7.30-7.26 (m, 13H), 7.09 (m, 3H), 5.82 (brs, 1H), 5.51 (brm, 1H), 3.78 (s, 6H), 3.68-3.65 (m, 13H), 3.25 (m, 12H), 3.03 (m, 2H), 2.44 (m, 6H), 2.17 (m, 6H), 1.63-1.60 (m, 6H), 1.27-1.25 (m, 28H), 0.89-0.72 (m, 18H).
(117) Step 4
(118) Compound 47-8 was synthesized from Compound 46-8 in a similar method to Steps 3 and 4 of 3-1).
(119) .sup.1H-NMR (CDCl.sub.3)δ:7.41-7.20 (m, 5H), 6.82 (m, 4H), 6.61 (brs, 3H), 3.79 (s, 6H), 3.69-3.62 (m, 12H), 3.25 (m, 12H), 3.02 (m, 6H), 2.60 (m, 6H), 2.42 (m, 6H), 2.17 (m, 6H), 1.60 (m, 12H), 1.27 (m, 20H), 0.88 (m, 9H).
(120) Step 5
(121) Compound 48-8 whose supported amount of Compound 47-8 is 68.6 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(122) 9-2) Synthesis of Compound 48-12
(123) The following compounds were synthesized in a similar method to 9-1). Compound 47-12
(124) .sup.1H-NMR (CDCl.sub.3) δ: 7.40-7.26 (m, 5H), 6.81 (m, 4H), 6.56 (brs, 3H), 3.79 (s, 6H), 3.69-3.62 (m, 12H), 3.25 (m, 12H), 3.07 (m, 8H), 2.58 (m, 4H), 2.44 (m, 6H), 2.17 (m, 6H), 1.60 (m, 12H), 1.27-1.22 (m, 60H), 0.88 (m, 9H).
(125) Compound 48-12 whose supported amount of Compound 47-12 is 70.0 μmol/g
(126) 10) Synthesis of Compound 55-m′-n′
(127) ##STR00058##
wherein m′ and n′ are each independently an integer of 5 to 29.
10-1) Synthesis of Compound 55-5-7
Step 1
(128) Compound 49 (20 g, 77 mmol, Tokyo Chemical Industry Co., Ltd.) was dissolved in dichloromethane (5 mL), and DIEA (13.5 mL, 77 mmol) was added thereto at 0° C. The temperature was raised to room temperature. Then, the mixture was stirred at room temperature overnight. The reaction mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (hexane:ethyl acetate=7:3-4:6) to obtain Compound 50 (22.5 g, 59.4 mmol) as colorless oil.
(129) .sup.1H-NMR (CDCl.sub.3):5.18 (brs, 2H), 4.11 (m, 4H), 3.74 (m, 1H), 3.45 (s, 1H), 3.39 (m, 1H), 3.29-3.20 (m, 4H), 0.93 (t, 4H, J=8.4 Hz), 0.00 (s, 18H).
(130) LC/MS: [M+] m/z: 380
(131) Step 2
(132) Under nitrogen atmosphere, to Compound 50 (3.79 g, 10 mmol) in THF (33 mL), bis-(p-nitrophenyl) carbonate (3.04 g, 10 mmol) and DIEA (1.75 mL, 10 mmol) and DMAP (1.2 g, 10 mmol) were added, and the mixture was stirred at room temperature for 12 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (hexane:ethyl acetate=4:1.fwdarw.1:1) to obtain Compound 51 (4.43 g, 8.14 mmol) as colorless oil.
(133) .sup.1H-NMR (CDCl.sub.3):8.26 (d, 2H, J=9.2 Hz), 7.38 (d, 2H, J=9.2 Hz), 5.20 (brs, 2H), 4.77 (brs, 1H), 4.13 (t, 2H, J=8.8 Hz), 3.51-3.46 (m, 4H), 0.93 (m, 4H), 0.00 (m, 18H).
(134) LC/MS: [M+] m/z: 545
(135) Step 3
(136) Compound 52 was synthesized from Compound 51 in a similar method to Steps 2 and 3 of 3-2).
(137) .sup.1H-NMR (CDCl.sub.3):7.41-7.20 (m, 5H), 6.82 (m, 4H), 3.79 (s, 6H), 3.72-3.62 (m, 4H), 3.22-3.01 (m, 6H), 1.29 (m, 6H).
(138) Step 4
(139) To 2-hexyldecanoic acid (110 mg, 0.428 mmol) in dichloromethane (2 mL)-DMF (2.5 mL), DIEA (0.102 mL, 0.583 mmol) and HBTU (0.162 g, 0.428 mmol) were added, and the mixture was vigorously stirred at room temperature for 30 minutes. To the resulting brown solution, Compound 52 (0.110 g, 0.194 mmol) was added at room temperature, and the mixture was stirred at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure. The residue was diluted with ethyl acetate. The organic layer was washed three times with water, and then dried over anhydrous magnesium sulfate. After filtering off the solid, the filtrate was concentrated under reduced pressure. The residue was purified by amino silica gel column chromatography (n-hexane:ethyl acetate=1:0.fwdarw.1:1) to obtain Compound 53-5-7 (90 mg, 0.086 mmol) as white amorphous.
(140) .sup.1H-NMR (CDCl.sub.3):7.42-7.19 (m, 5H), 6.83 (m, 4H), 4.81 (brm, 1H), 4.65 (brs, 1H), 3.79 (s, 6H), 3.67 (m, 2H), 3.46-3.39 (m, 3H), 3.25 (m, 1H), 3.11 (m, 3H), 2.05 (m, 2H), 1.78 (m, 1H), 1.55-1.24 (m, 48H), 0.84 (m, 12H).
(141) Step 5
(142) Compound 54-5-7 was synthesized from Compound 53-5-7 in a similar method to Step 4 of 3-1).
(143) .sup.1H-NMR (CDCl.sub.3)δ:7.42-7.19 (m, 5H), 6.83 (m, 4H), 6.65 (brs, 1H), 6.52 (brs, 1H), 5.86 (brs, 1H), 4.65 (m, 1H), 4.38 (brs, 1H), 4.13 (m, 1H), 3.79 (s, 6H), 3.41 (m, 4H), 3.02 (m, 4H), 2.55 (m, 4H), 2.05 (m, 2H), 1.78 (m, 1H), 1.55-1.24 (m, 48H), 0.84 (m, 12H).
(144) LC/MS: [M−] m/z: 1142
(145) Step 6
(146) Compound 55-5-7 whose supported amount of Compound 54-5-7 is 70.0 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(147) 11) Synthesis of Compound 59
(148) ##STR00059##
Step 1
(149) Compound 57 was synthesized from Compound 56 (6.94 g, 24.4 mmol, Tokyo Chemical Industry Co., Ltd.) in a similar method to Step 1 of 3-1).
(150) .sup.1H-NMR (CDCl.sub.3)δ:8.30 (d, 2H, J=9.2 Hz), 7.45 (m, 211), 6.32 (brs, 2H), 4.75 (brs, 1H), 4.55 (brs, 1H), 3.51 (m, 6H), 1.87 (m, 1H), 1.70 (m, 1H), 1.67 (m, 16H), 1.25 (m, 6H), 1.21 (m, 6H), 1.03 (m, 12H), 0.88 (m, 42H).
(151) LC/MS: [M+] m/z: 789
(152) Step 2
(153) Compound 58 was synthesized from Compound 57 in a similar method to Steps 2 to 4 of 3-1).
(154) .sup.1H-NMR (CDCl.sub.3)δ:7.42-7.18 (m, 6H), 6.80 (d, 4H, J=8.4 Hz), 5.89 (brs, 1H), 4.62 (brs, 1H), 4.38 (brs, 1H), 4.14 (brs, 1H), 3.79 (s, 6H), 3.57-3.34 (m, 4H), 3.05 (m, 6H), 2.66-2.57 (m, 4H), 1.87 (m, 1H), 1.75 (m, 1H), 1.66 (m, 1H), 1.56 (m, 16H), 1.45 (m, 6H), 1.25 (m, 6H), 1.03 (m, 12H), 0.88 (m, 42H). LC/MS: [M−] m/z: 1198
(155) Step 3
(156) Compound 59 whose supported amount of Compound 58 is 53.4 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(157) 12) Synthesis of Compound 62
(158) ##STR00060##
Step 1
(159) Under nitrogen atmosphere, to Compound 52 (307 mg, 0.389 mmol) in THF (3 mL), DIEA (0.102 mL, 0.583 mmol), DMAP (23.8 mg, 0.194 mmol) and Compound 57 (110 mg, 0.194 mmol) obtained from Step 1 of 11) were added, and the mixture was stirred at 55° C. for five hours. Then, the reaction mixture was allowed to stand at room temperature overnight. The reaction mixture was diluted with ethyl acetate. The organic layer was washed three times with water, and dried over anhydrous magnesium sulfate. After filtering off the solid, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (hexane:ethyl acetate=1:0.fwdarw.1:1) to obtain Compound 60 (100 mg, 0.054 mmol) as white amorphous.
(160) LC/MS: [M+3H]3+m/z: 622
(161) Step 2
(162) Compound 61 was synthesized from Compound 60 in a similar method to
(163) Step 4 of 3-1).
(164) LC/MS: [M+2H]2+m/z: 983
(165) Step 3
(166) Compound 62 whose supported amount of Compound 61 is 47.7 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(167) 13) Synthesis of Compound 65-n′
(168) ##STR00061##
wherein n′ is an integer of 5 to 29.
13-1) Synthesis of Compound 65-12
Step 1
(169) Under nitrogen atmosphere, to Compound 63 (see Nucleic Acids Research, Volume 42, Issue 13, 29 Jul. 2014, Pages 8796-8807, 0.621 g, 1.48 mmol) in dichloromethane (29 mL), DMAP (181 mg, 1.48 mmol), DIEA (0.258 mL, 1.48 mmol) and Compound 9-12 (1.0 g, 1.48 mmol) obtained in a similar way of Step 1 of 3-1) were added, and the mixture was heated under reflux for four hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (chloroform:methanol=1:0.fwdarw.9:1) to obtain Compound 64-12 (1.0 g, 1.05 mmol) as colorless oil.
(170) LC/MS: [M+H] m/z: 955
(171) Step 2
(172) Compound 65-12 was synthesized from Compound 64-12 in a similar method to Step 2 of 1-1).
(173) .sup.31P-NMR(CDCl.sub.33)δ:147.9, 147.6, 147.4, 146.3
(174) 14) Synthesis of Compound 69-n′
(175) ##STR00062##
wherein n′ is an integer of 5 to 29.
14-1) Synthesis of Compound 69-14
Step 1
(176) To a suspension of 9-fluorenylmethyl-N-hydroxysuccinimide (4.00 g, 11.87 mmol, Watanabe Chemical Industries, Ltd.) in methanol (40.0 mL), Compound 1 (1.07 g, 11.87 mmol) in methanol (10.0 mL) was added at room temperature, and the mixture was stirred for 1.5 hours. Pyridine hydrochloride (3.02 g, 26.1 mmol) was added to the reaction mixture. The mixture was stirred for 10 minutes, and then filtered. The filtrate was concentrated, and the resulting crude product was purified by silica gel column chromatography (chloroform:methanol=90:10.fwdarw.75:25) to obtain Compound 66 (1.53 g, 37%) as white solid.
(177) .sup.1H-NMR (DMSO-D6) δ: 7.90 (21, d, J=7.5 Hz), 7.82 (21, s), 7.70 (21, d, J=7.4 Hz), 7.44-7.41 (3H, m), 7.34 (2H, t, J=7.4 Hz), 5.53 (1H, d, J=5.0 Hz), 4.32 (2H, d, J=7.0 Hz), 4.22 (1H, t, J=6.7 Hz), 3.71 (1H, s), 3.12-3.06 (1H, m), 3.03-2.96 (1H, m), 2.87 (1H, dd, J=12.9, 2.6 Hz), 2.60 (1H, dd, J=12.9, 9.2 Hz).
(178) ESI-MS (m/z): 313 (M+1).
(179) Step 2
(180) Palmitic acid (300 mg, 1.17 mmol) was dissolved in DMF (6.0 mL) and dichloromethane (2.0 mL). DIEA (0.31 mL, 1.76 mmol) and HBTU (489 mg, 1.29 mmol) were added thereto, and the mixture was vigorously stirred at room temperature for 30 minutes. To the resulting cloudy solution, Compound 66 (409 mg, 1.17 mmol) was added at room temperature for three days. Aqueous saturated sodium bicarbonate solution (8.0 mL) and water (2.0 mL) were added to the reaction mixture to stop the reaction, and then white solid was collected by filtration. The resulting solid was washed with water (40 mL) to obtain Compound 67-14 (719 mg, quant.) as white solid.
(181) .sup.1H-NMR (DMSO-D6) δ: 7.89 (2H, d, J=7.4 Hz), 7.77 (1H, t, J=5.6 Hz), 7.70 (2H, d, J=7.4 Hz), 7.41 (2H, t, J=7.3 Hz), 7.33 (2H, t, J=7.3 Hz), 7.22 (1H, t, J=5.8 Hz), 4.95 (1H, s), 4.28-4.19 (3H, m), 3.51 (2H, t, J=5.6 Hz), 3.14-3.08 (2H, m), 3.02-2.89 (4H, m), 2.07 (2H, t, J=7.5 Hz), 1.47 (2H, s), 1.22 (19H, s), 0.94 (2H, d, J=6.5 Hz), 0.85 (3H, t, J=6.8 Hz).
(182) ESI-MS (m/z): 552 (M+1).
(183) Step 3
(184) Compound 68-14 was synthesized from Compound 67-14 in a similar method to Steps 1 to 4 of 3-1).
(185) ESI-MS (m/z): 1125 (M−H). HPLC Peak RT=1.09 min
(186) Step 4
(187) Compound 69-14 whose supported amount of Compound 68-14 is 108 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(188) 15) Synthesis of Compound 74-k-n′
(189) ##STR00063##
wherein k is an integer of 0 to 4, and n′ is an integer of 5 to 29.
15-1) Synthesis of Compound 74-3-14
Step 1
(190) Palmitic acid (209 mg, 0.81 mmol) was dissolved in DMF (6.0 mL). HBTU (309 mg, 0.81 mmol) was added thereto, and the mixture was stirred at room temperature for 10 minutes. To the reaction mixture, Compound 70-3 (300 mg, 0.81 mmol, Watanabe Chemical Industries, Ltd) and DIEA (0.14 mL, 0.81 mmol) were added, and the mixture was stirred at 50° C. for 5 minutes. Then, the mixture was stirred at room temperature for three hours. To the reaction mixture, 2 M hydrochloric acid was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with brine, and dried over sodium sulfate. The solvent was distilled off under the reduced pressure, and the resulting crude product was purified by silica gel column chromatography (chloroform:methanol=100:0.fwdarw.90:10) to obtain Compound 71-3-14 (491 mg, 99%) as a white solid.
(191) .sup.1H-NMR (CDCl.sub.3) δ: 7.76 (2H, d, J=7.4 Hz), 7.58 (2H, d, J=6.9 Hz), 7.39 (2H, t, J=7.3 Hz), 7.30 (2H, t, J=7.4 Hz), 6.43 (1H, d, J=7.3 Hz), 5.08 (1H, s), 4.58-4.18 (5H, m), 3.19-3.06 (3H, m), 2.21 (2H, t, J=7.6 Hz), 1.90-1.24 (30H, m), 0.87 (3H, t, J=6.5 Hz).
(192) ESI-MS (m/z): 608 (M+1).
(193) Step 2
(194) Compound 71-3-14 (240 mg, 0.40 mmol) was suspended in acetonitrile (2.5 mL) and dichloromethane (5.0 mL). DIEA (0.21 mL, 1.19 mmol) and HBTU (165 mg, 0.44 mmol) were added thereto, and the mixture was stirred at room temperature for 15 minutes. 6-amino-2-((bis(4-methoxyphenyl) (phenyl) methoxy) methyl) hexane-1-ol (178 mg, 0.40 mmol), which synthesized with reference to US2009/259030, in acetonitrile (2.5 mL) was added to the reaction mixture, and the mixture was stirred at room temperature for three hours. Saturated sodium bicarbonate solution was added to the reaction mixture and the mixture was extracted with ethyl acetate. The organic layer was washed with water and brine and dried over sodium sulfate. The solvent was distilled off under reduced pressure, and the resulting crude product was purified by silica gel column chromatography (hexane:ethyl acetate=70:30.fwdarw.10:90) to obtain Compound 72-3-14 (146 mg, 36%) as a white solid.
(195) .sup.1H-NMR (CDCl.sub.3): 7.76 (2H, d, J=7.5 Hz), 7.58 (2H, d, J=7.5 Hz), 7.39 (4H, t, J=7.4 Hz), 7.32-7.28 (8H, m), 7.20 (1H, t, J=7.3 Hz), 6.82 (4H, d, J=8.8 Hz), 6.21-6.15 (2H, m), 4.96 (1H, d, J=6.1 Hz), 4.42-4.28 (3H, m), 4.20 (1H, t, J=6.8 Hz), 3.78 (6H, s), 3.65-3.60 (2H, m), 3.24-3.18 (4H, m), 3.05 (1H, dd, J=9.1, 7.3 Hz), 2.62 (1H, t, J=5.6 Hz), 2.16 (2H, t, J=7.0 Hz), 1.84-1.76 (2H, m), 1.55-1.23 (38H, m), 0.88 (3H, t, J=6.8 Hz).
(196) ESI-MS (m/z): 1039 (M+1).
(197) Step 3
(198) Compound 73-3-14 was synthesized from Compound 72-3-14 in a similar method to Steps 1 to 4 of 3-1).
(199) ESI-MS (m/z): 1137 (M−H). HPLC Peak RT=1.34 min
(200) Step 4
(201) Compound 74-3-14 whose supported amount of Compound 73-3-14 is 120 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(202) 16) Synthesis of Compound 75-n″
(203) ##STR00064##
wherein n″ is an integer of 2 to 29.
16-1) Synthesis of Compound 75-2
(204) To Compound 2-2 (300 mg, 3.40 mmol) in THF (4.5 mL), N-hydroxysuccinic acid imide (431 mg, 3.75 mmol) was added. Next, N,N′-dicyclohexylcarbodiimide (773 mg, 3.75 mmol) in THF (1.5 mL) was added thereto, and the mixture was stirred at room temperature for two hours. After filtering off the resulting solid, the filtrate was concentrated to obtain Compound 75-2 (476 mg, 75%) as colorless oil.
(205) .sup.1H-NMR (CDCl.sub.3) δ: 2.84 (4H, s), 2.59 (2H, t, J=7.3 Hz), 1.84-1.74 (2H, m), 1.05 (3H, t, J=7.5 Hz).
(206) ESI-MS (m/z): 186 (M+1).
(207) 16-2) The following compounds were synthesized in a similar method to 16-1). Compound 75-6 (803 mg, 77%), white solid
(208) .sup.1H-NMR (CDCl.sub.3): 2.83 (4H, s), 2.60 (2H, t, J=7.5 Hz), 1.78-1.71 (2H, m), 1.42-1.29 (8H, m), 0.88 (3H, t, J=6.5 Hz).
(209) ESI-MS (m/z): 242 (M+1).
(210) Compound 75-10 (232 mg, 52%), white solid
(211) .sup.1H-NMR (CDCl.sub.3): 2.84 (4H, s), 2.60 (2H, t, J=7.5 Hz), 1.78-1.71 (2H, m), 1.42-1.20 (16H, m), 0.88 (3H, t, J=6.8 Hz).
(212) ESI-MS (m/z): 298 (M+1).
(213) Compound 75-12 (402 mg, 56%), white solid
(214) .sup.1H-NMR (CDCl.sub.3) δ: 2.83 (4H, s), 2.60 (2H, t, J=7.6 Hz), 1.78-1.70 (2H, m), 1.40 (2H, t, J=6.8 Hz), 1.26 (18H, s), 0.88 (3H, t, J=6.8 Hz).
(215) Compound 75-16 (256 mg, 62%), white solid
(216) .sup.1H-NMR (CDCl.sub.3): 2.84 (4H, s), 2.60 (2H, t, J=7.5 Hz), 1.78-1.70 (2H, m), 1.44-1.26 (24H, m), 0.88 (3H, t, J=6.8 Hz).
(217) Compound 75-18 (310 mg, 79%), white solid
(218) .sup.1H-NMR (CDCl.sub.3) δ: 2.84 (4H, s), 2.60 (2H, t, J=7.5 Hz), 1.78-1.70 (2H, m), 1.42-1.25 (32H, m), 0.88 (3H, t, J=6.8 Hz).
(219) 16-3) The following compounds were synthesized in a similar method to 16-1).
(220) ##STR00065## ##STR00066##
Compound 76 (429 mg, 82%), white solid
(221) .sup.1H-NMR (CDCl.sub.3) δ: 2.84 (4H, s), 2.59 (2H, t, J=7.5 Hz), 1.79-1.71 (2H, m), 1.63-1.53 (1H, m), 1.32-1.26 (2H, m), 0.90 (6H, d, J=6.7 Hz).
(222) ESI-MS (m/z): 228 (M+1).
(223) Compound 77 (302 mg, 60%), colorless oil
(224) .sup.1H-NMR (CDCl.sub.3): 2.83 (4H, d, J=4.0 Hz), 2.63-2.56 (1H, m), 1.82-1.56 (4H, m), 1.43-1.31 (4H, m), 1.03 (3H, t, J=7.5 Hz), 0.92 (3H, t, J=7.0 Hz).
(225) ESI-MS (m/z): 242 (M+1).
(226) Compound 78 (224 mg, 54%), colorless oil
(227) .sup.1H-NMR (CDCl.sub.3) δ: 2.83 (4H, d, J=4.8 Hz), 2.68-2.61 (1H, m), 1.78-1.68 (2H, m), 1.63-1.54 (2H, m), 1.43-1.26 (20H, m), 0.89-0.86 (6H, m).
(228) Compound 79 (296 mg, 84%), white solid
(229) .sup.1H-NMR (CDCl.sub.3): 2.82 (4H, s), 2.68-2.60 (1H, m), 1.74-1.68 (2H, m), 1.61-1.56 (2H, m), 1.40-1.25 (64H, m), 0.88 (6H, t, J=6.5 Hz).
(230) Compound 80 (373 mg, 82%), white solid
(231) .sup.1H-NMR (CDCl.sub.3): 2.83 (4H, s), 2.60 (2H, t, J=7.5 Hz), 1.76-1.67 (6H, m), 1.45-1.37 (2H, m), 1.26-1.11 (7H, m), 0.90-0.82 (2H, m).
(232) ESI-MS (m/z): 282 (M+1).
(233) Compound 81 (476 mg, quant.), white oil
(234) .sup.1H-NMR (CDCl.sub.3) δ: 3.68-3.63 (6H, m), 3.49-3.47 (2H, m), 3.01 (2H, t, J=7.1 Hz), 2.87-2.82 (4H, m), 2.74 (2H, t, J=7.1 Hz).
(235) ESI-MS (m/z): 285 (M+1).
(236) Compound 82 (459 mg, quant.), colorless oil
(237) .sup.1H-NMR (CDCl.sub.3) δ: 5.40-5.33 (411, m), 2.83 (4H, s), 2.77 (2H, t, J=6.3 Hz), 2.60 (2H, t, J=7.5 Hz), 2.05 (4H, q, J=6.7 Hz), 1.78-1.71 (211, m), 1.43-1.26 (14H, m), 0.89 (3H, t, J=6.7 Hz).
(238) ESI-MS (m/z): 378 (M+1).
(239) Compound 83 (433 mg, quant.), colorless oil
(240) .sup.1H-NMR (CDCl.sub.3) δ: 8.01 (1H, d, J=8.3 Hz), 7.88 (1H, d, J=7.9 Hz), 7.77 (1H, d, J=7.7 Hz), 7.58-7.49 (211, m), 7.45-7.39 (211, m), 3.53 (2H, t, J=8.0 Hz), 3.06 (211, t, J=8.0 Hz), 2.86 (411, s).
(241) ESI-MS (m/z): 298 (M+1).
(242) 17) Synthesis of Compound 84
(243) ##STR00067##
(244) To Compound 84 (200 mg, 1.27 mmol, Watanabe Chemical Industries, Ltd) in dichloromethane (4.0 mL), Compound 85 (0.22 mL, 1.27 mmol, Wako Pure Chemical Industries, Ltd.) was added, and the mixture was stirred at room temperature for six hours. The reaction mixture was concentrated to obtain the crude product of Compound 86 (563 mg) as colorless oil.
(245) ESI-MS (m/z): 324 (M+H). HPLC Peak RT=1.29 min
(246) 18) Synthesis of Compound 88
(247) ##STR00068##
(248) To Compound 87 (800 mg, 1.86 mmol) in dichloromethane (5.0 mL), bis(4-nitrophenyl)carbonate (848 mg, 2.79 mmol) and triethylamine (0.39 mL, 2.79 mmol) were added, and the mixture was stirred at room temperature for 24 hours. After the solvent was distilled off, the resulting crude product was purified by silica gel column chromatography (hexane: ethyl acetate=100:0.fwdarw.90:10) to obtain Compound 88 (1.21 g, quant.) as yellow oil.
(249) .sup.1H-NMR (CDCl.sub.3): 8.31 (2H, d, J=9.2 Hz), 7.48 (2H, d, J=9.2 Hz), 2.62 (2H, t, J=6.7 Hz), 2.16 (3H, s), 2.12 (6H, s), 1.87-1.74 (2H, m), 1.60-1.05 (24H, m), 0.87-0.83 (12H, m).
(250) ESI-MS (m/z): 596 (M+1).
(251) 19) Synthesis of Compound 90-k-n′
(252) ##STR00069##
wherein k is an integer of 0 to 4, n′ is an integer of 5 to 29.
19-1) Synthesis of Compound 90-3-12
Step 1
(253) Compound 89-3-12 was synthesized from Compound 70-3 and Compound 9-12 in a similar method to Steps 1 to 3 of 15-1).
(254) LC/MS: Rt=2.48 min [M−] m/z: 1435
(255) Step 2
(256) Compound 90-3-12 whose supported amount of Compound 89-3-12 is 68 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(257) 20) Synthesis of Compound 95-k-n′
(258) ##STR00070##
wherein k is an integer of 0 to 4, and n′ is an integer of 5 to 29.
20-1) Synthesis of Compound 95-3-12
Step 1
(259) Compound 92-3-12 was synthesized from Compound 91-3 in a similar method to Step 1 of 15-1) as pale red solid (1.11 g).
(260) .sup.1H-NMR (CDCl.sub.3) δ: 6.16 (1H, d, J=7.7 Hz), 5.64 (1H, m), 4.58 (1H, td, J=8.1, 4.6 Hz), 3.74 (3H, s), 3.27-3.23 (2H, m), 2.23-2.16 (4H, m), 1.86-1.82 (2H, m), 1.74-1.28 (48H, m), 0.88 (6H, t, J=6.8 Hz).
(261) Step 2
(262) Compound 92-3-12 (1.17 g) was dissolved in THF (12 mL). 2 M sodium hydroxide solution (2 mL) was added thereto, and the mixture was stirred overnight. The precipitate produced by adding acetonitrile (40 mL) was collected by filtration to obtain the crude solid. Then, it was dissolved in ethyl acetate (50 mL), and the organic layer was washed with 1 M hydrochloric acid solution (40 mL). The organic layer was washed with water, dehydrated in brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain Compound 93-3-12 as a colorless solid (199 mg) (Yield: 18%).
(263) .sup.1H-NMR (CDCl.sub.3) δ: 6.82 (1H, d, J=7.0 Hz), 5.81 (1H, t, J=6.0 Hz), 4.51 (1H, td, J=7.4, 4.6 Hz), 3.37 (1H, td, J=13.8, 6.9 Hz), 3.18 (1H, dt, J=19.4, 5.7 Hz), 2.33-2.25 (2H, m), 2.19 (211, t, J=7.7 Hz), 1.95-1.77 (2H, m), 1.63-1.25 (49H, m), 0.88 (6H, t, J=6.8 Hz).
(264) Step 3
(265) Compound 94-3-12 was synthesized from Compound 93-3-12 in a similar method to Step 1 of 3-1).
(266) m/z 1097.84[M−H]
(267) Step 4
(268) Compound 95-3-12 whose supported amount of Compound 94-3-12 is 84 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(269) 20-2) The following compounds were synthesized in a similar method to 20-1).
(270) Compound 94-3-14
(271) 1H-NMR (CDCl.sub.3) δ: 7.35-6.82 (13H), 6.47 (1H, m), 6.20 (1H, t, 6 Hz), 6.02 (1H, t, 6 Hz), 4.51 (1H, q, J=7.5 Hz), 4.42 (1H, dd, J=8.1, 3.6 Hz), 4.18 (1H, d, J=5.6 Hz), 4.09 (1H, dd, J=11.0, 4.3 Hz), 3.77 (6H, s), 3.42-2.97 (8H, m), 2.72-1.74 (12H, m), 1.60-1.15 (58H, m), 0.88 (6H, t, J=6.8 Hz).
(272) Compound 95-3-14 whose supported amount of Compound 94-3-14 is 60 μmol/g Compound 94-3-16
(273) 1H-NMR (CDCl.sub.3) δ: 8.02-6.81 (13H), 6.40 (1H, dd, J=8.9, 4.4 Hz), 6.18 (1H, t, J=6.4 Hz), 5.97 (1H, t, J=6.5 Hz), 4.53 (1H, dd, J=15.9, 7.4 Hz), 4.44 (1H, d, J=11, 4 Hz), 4.20-4.15 (11H, m), 4.09 (1H, dd, J=11.1, 4.0 Hz), 3.79 (6H, s), 3.45-3.00 (8H, m), 2.78-2.42 (4H, m), 2.20 (4H, m), 2.04-1.24 (62H, m), 0.88 (6H, t, J=6.8 Hz).
(274) Compound 95-3-16 whose supported amount of Compound 94-3-16 is 65 μmol/g Compound 94-2-14
(275) m/z 1138.74 [M−H]
(276) Compound 95-2-14 whose supported amount of Compound 94-2-14 is 77 μmol/g
(277) 21) Synthesis of Compound 97
(278) ##STR00071##
Step 1
(279) Compound 96 was synthesized from Compound 78 in a similar method to Steps 1 to 3 of 20-1).
(280) m/z 1153.04[M−H]
(281) Step 2
(282) Compound 97 whose supported amount of Compound 96 is 52 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(283) 22) Synthesis of Compound 100-j-n′
(284) ##STR00072##
wherein j is an integer of 1 to 3, and n′ is an integer of 5 to 29.
22-1) Synthesis of Compound 100-3-18
Step 1
(285) Compound 99-3-18 was synthesized from Compound 98-3 in a similar method to Steps 1 to 3 of 15-1).
(286) 1H-NMR (CDCl.sub.3) δ: 7.42 (2H, d, J=7.4 Hz), 7.30 (511, d, J=8.7 Hz), 7.19 (111, t, J=7.2 Hz), 6.81 (5H, d, J=8.7 Hz), 6.74 (1H, t, J=5.8 Hz), 6.26 (11, t, J=5.9 Hz), 5.55 (11, t, J=5.9 Hz), 4.72-4.67 (1H, m), 3.79 (611, s), 3.58-3.49 (17H, m), 3.32-3.27 (6H, m), 3.14 (211, q, J=6.5 Hz), 3.04 (211, d, J=5.4 Hz), 2.49-2.46 (411, m), 2.20 (511, t, J=7.5 Hz), 1.76-1.72 (411, m), 1.65-1.62 (10H, m), 1.42-1.41 (3H, m), 1.25 (68H, s), 0.88 (611, t, J=6.6 Hz).
(287) Step 2
(288) Compound 100-3-18 whose supported amount of Compound 99-3-18 is 56 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(289) 23) Synthesis of Compound 101 and 102
(290) ##STR00073##
(291) With the resin (Fmoc-NH-SAL resin, 100 μmol, Watanabe Chemical Industries, Ltd) settled in the column with filter, deprotection reaction (20% piperidine 2 mL/100 μmol resin) and condensation reaction (300 μmol protected amino acids, 300 μmol HBTU, 300 μmol 1-hydroxybenzotriazole monohydrate, 600 μmol DIEA, DMF/NMP (1:1) 2 mL/100 μmol resin) were repeated to extend peptide chains.
(292) For synthesis of N terminal region of peptide, after peptide elongation and deprotection reaction as the above with Fmoc-Lys(Fmoc)-OH (Watanabe Chemical Industries, Ltd), myristic acid was condensed with the peptide on the resin (300 μmol myristic acid, 300 μmol HBTU, 600 μmol DIEA, chloroform/NMP (1:1) 2 mL/100 μmol resin) to synthesize a lipidated peptide. Cleavage solution (TFA 92.5%, H.sub.2O 2.5%, TIS 2.5%, DODT 2.5%, 2 mL/100 μmol resin) was added to the synthesis column, reacted at room temperature for one hour, and filtered. The solvent (acetonitrile or water) was added to the filtrate and the precipitate was collected. The precipitate was dissolved in DMSO, and purified by reversed phase (YMC Pack C4, 150×10 mm I.D., Flow rate: 3-5 mL/min, 10 mM TEAA-acetonitrile, isocratic elution (Washed with 50% acetonitrile, and then eluted with 95% acetonitrile), Detection 260 nm, 280 nm). The collected fraction was condensed and lyophilized to obtain the lipid-peptide (e.g., Compound 101 or Compound 102) as white solid. Compound 101 [M+H]+, calc. 997.68824, obs. 997.4476 Compound 102 [M+H]+, calc. 1082.77739, obs. 1082.7048
(293) 24) Synthesis of Compound 103
(294) ##STR00074##
(295) Compound 103 was synthesized from Fmoc-D-Lys(Fmoc)-OH (Watanabe Chemical Industries, Ltd) in a similar method to 16-1).
(296) ESI-MS, [M+H]+ calc. 688.26534, obs. 688.4007
(297) 24) Synthesis of Compound 105-n′
(298) ##STR00075##
wherein n′ is an integer of 5 to 29.
24-1) Synthesis of Compound 105-14
(299) Compound 105-14 was synthesized from Compound 104 in a similar method to Step 1 of 1-1) and Step 1 of 3-1)
(300) ESI-MS (m/z): 779 (M−H).
(301) 25) Synthesis of Compound 112
(302) ##STR00076##
Step 1
(303) 6-N-Boc-caproic acid (1.0 g, Sigma-Aldrich) was dissolved in DMF (20 mL). DIEA (2.3 mL) and HBTU (1.8 g) were added thereto, and the mixture was stirred at room temperature for 15 minutes. Compound 106 (0.45 g, Tokyo Chemical Industry Co., Ltd.) was added thereto, and the mixture was stirred at room temperature overnight. The reaction mixture was poured into saturated sodium bicarbonate solution (50 mL), and extracted with ethyl acetate (100 mL). The organic layer was concentrated under reduced pressure and the residue was purified by flash chromatography (silica gel, A solvent: chloroform/B solvent: 25% methanol chloroform, gradient: 0.fwdarw.5% B solvent for 15 minutes) to obtain Compound 107 as brown oil (1.12 g)(Yield 44%).
(304) m/z 585.19[M−H]− (ES Negative mode), Theoretical value 586.394[M]
(305) Step 2
(306) Compound 107 (1.12 g) was dissolved in dichloromethane (5.6 mL). TFA (5.6 mL) was added thereto, and the mixture was stirred at room temperature for 30 minutes. Then, the mixture was coevaporated with toluene twice to remove TFA and dried to obtain Compound 108 as orange oil (1.9 g).
(307) m/z 387.44[M+H]+ (ES Positive mode), Theoretical value 386.289[M]
(308) Step 3
(309) Compound 108 (1.9 g) was dissolved in 1,4-dioxane/water (1:1, 14.6 mL), and sodium hydrogen carbonate (1.58 g) was added thereto. 9-fluorenylmethyl chloroformate (1.08 g) was added to the mixture and the mixture was stirred under heating. Sodium hydrogen carbonate (0.79 g) was added thereto, and the mixture was cooled to room temperature. The solid was collected by filtration. The solid was redissolved in ethyl acetate, n-hexane was added thereto. The precipitated solid was collected by filtration and dried to obtain Compound 109 (1.93 g) as a white solid.
(310) m/z 831.46[M+H]+ (ES Positive mode), Theoretical value 830.425[M]
(311) Step 4
(312) Compound 109 (0.50 g) was suspended in dichloromethane (5 mL), and N,N-dimethylaniline (0.61 mL) and aluminium (III) chloride (0.40 g) were added thereto. The mixture was stirred under reflux for one hour, and the reaction was stopped by adding dropwise 1 M hydrochloric acid (20 mL). The mixture was extracted with ethyl acetate (2×30 mL), and the resulting organic layer was washed with water (2×30 mL). Then, it was dehydrated in brine, concentrated to dryness, and purified by flash chromatography (Silica type, A solvent chloroform/B solvent 25% methanol chloroform, gradient: 0.fwdarw.50% B solvent for 12 minutes) to obtain Compound 110 as colorless solid (32 mg) (Yield 7%).
(313) m/z 815.32[M−H]− (ES Negative mode), Theoretical value: 816.410[M]
(314) Step 5
(315) Compound 111 was synthesized from Compound 110 in a similar method to Step 4 of 3-1).
(316) m/z 1248.38[M+H]+ (ES Positive mode), Theoretical value: 1247.656[M]
(317) Step 6
(318) Compound 112 whose supported amount of Compound 111 is 45 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(319) 26) Synthesis of Compound 120
(320) ##STR00077##
Step 1
(321) Compound 113 (2 g, Sigma-Aldrich) was dissolved in methanol (20 mL), and 1,2-di(pyridine-2-yl)disulphane (1.91 g) was added thereto. The mixture was stirred at room temperature for one day. The reaction was stopped by adding dropwise to 1 M hydrochloric acid solution (50 mL), and the mixture was extracted with ethyl acetate (2×50 mL). The resulting organic layer was concentrated to obtain Compound 114 as yellow oil (2.44 g)(Yield 83%).
(322) m/z 340.38[M+H]+ (ES Positive mode), Theoretical value 339.205[M]
(323) Step 2
(324) Compound 114 (1.22 g) was dissolved in methanol (2 mL). Ethyl L-cysteine hydrochloride (0.53 g) was added thereto, and the mixture was stirred at room temperature overnight. After adding acetonitrile (5 mL), the precipitated solid was collected by filtration. The solid was washed with acetonitrile and dried to obtain Compound 115 as colorless solid (0.98 g) (Yield 72%).
(325) m/z 378.96[M+H]+(ES Positive mode), Theoretical value 377.242[M]
(326) Step 3
(327) Compound 115 (400 mg) was dissolved in 1,4-dioxane (4 mL), tetrahydrofuran (4 mL) and water (1 mL). Sodium hydrogen carbonate (222 mg), DIEA (462 μL) and 9-fluorenylmethyl chloroformate (174 mg) were added thereto, and the mixture was stirred at room temperature for three hours. 9-fluorenylmethyl chloroformate (80 mg) was added, and the mixture was stirred at room temperature for one hour to complete the reaction. After addition of water (50 mL), the mixture was extracted with ethyl acetate (50 mL), and the resulting organic layer was washed with brine. The organic layer was concentrated under reduced pressure and purified by flash chromatography (silica type, A solvent: n-hexane/B solvent: ethyl acetate, gradient: 0.fwdarw.20% B solvent for 20 minutes) to obtain Compound 116 as colorless amorphous (534 mg) (Yield 84%).
(328) m/z 599.64[M+H]+(ES Positive mode), Theoretical value: 599.310[M]
(329) Step 4
(330) Compound 116 (534 mg) was dissolved in tetrahydrofuran (5.3 mL). 1 M aqueous sodium hydroxide solution (2 mL) was added thereto, and the mixture was stirred at room temperature overnight. 1 M aqueous hydrochloric acid solution (40 mL) and ethyl acetate (40 mL) were added to the reaction mixture, and the resulting organic layer was separated and washed twice with water. The organic layer was washed with brine, concentrated under reduced pressure, and purified by flash chromatography (silica type, A solvent: chloroform/B solvent: 25% methanol chloroform, gradient: 0.fwdarw.20% B solvent for 15 minutes) to obtain the target Compound 117 as colorless oil (30 mg)(Isolated yield: 6%).
(331) m/z 572.34[M+H]+(ES Positive mode), Theoretical value: 571.279[M]
(332) Step 5
(333) Compound 118 was synthesized from Compound 117 in a similar method to Step 1 of 16-1).
(334) m/z 572.34[M+H]+(ES Positive mode), Theoretical value: 571.279[M]
(335) Step 6
(336) Compound 119 was synthesized from Compound 118 in a similar method to Step 4 of 3-1).
(337) m/z 1024.34[M+Na]+ (ES Positive mode), Theoretical value: 1024.52[M+Na]+
(338) Step 7
(339) Compound 120 whose supported amount of Compound 119 is 32 μmol/g was synthesized in a similar method to Step 5 of 3-1).
(340) 27) About the Other Compounds
(341) ##STR00078##
(342) Compound 121 was synthesized according to the methods described in U.S. Pat. No. 6,153,737.
(343) ##STR00079##
(344) Compound 122 was synthesized according to the methods described in Non-Patent Document Journal of the American Chemical Society, 2008, 130, 11467-11476.
(345) ##STR00080##
(346) Compound 123 was purchased from Sigma-Aldrich.
(347) ##STR00081##
(348) Compound 124 was purchased from Link-Technologies Ltd.
(349) B) Synthesis of Oligonucleotides
(350) Oligonucleotides used in examples of this description were synthesized using phosphoramidite method by AKTA Oligopilot10 (GE Healthcare), NS-8-I (Dainippon Seiki co., ltd.) or NS-8-II (Dainippon Seiki co., ltd.). A monomer was prepared in 0.1 M acetonitrile solution using the amidite derived from the above amidite synthesis. The coupling time was 32 seconds to 10 minutes, and 8 to 10 equivalents of the amidite unit were used to condense with one monomer. 0.02 M Oxidizer (Sigma-Aldrich) and iodine/pyridine/water/=12.7/9/1 (w/v/v) were used for PO oxidation. 50 mM DDTT ((dimethylamino-methylidyne) amino-3H-1,2,4-dithiazoline-3-thion) in acetonitrile/3-picoline 1/1(v/v) or 1/4(v/v) and acetonitrile/pyridine 1/4 (v/v) solution were used for PS oxidation. ETT activator (5-ethylthio)-1H-tetrazole) (Sigma-Aldrich) was used as an activator, CapA and CapB (Sigma-Aldrich) was used as a capping reagent. Deb (3 w/v % TCA CH.sub.2C12 solution) (Wako Pure Chemical Industries, Ltd.) or Deb (3 w/v % Dichloroacetic acid, Toluene Solution) was used as a detritylation reagent.
(351) NA-6, NA-7, NA-21 and NA-23 were derived by consigning synthesis and purification of oligonucleotides to GeneDesign Inc.
(352) C) Synthesis of Lipid Conjugated Oligonucleotides
(353) 1) Synthesis-1 from a Synthesized Amidite Unit
(354) With a synthesized amidite (e.g., Compound 5-n′) synthesized in the above A), the target lipid conjugated oligonucleotides were synthesized in a similar way as the above B).
(355) 2) Synthesis-2 from a Synthesized Amidite Unit
(356) A stirrer, Molecular Sieves 4A 1/16 and the amidite synthesized in the above A) (e.g., Compound 5-n′. 10 to 100 equivalents of an oligonucleotide) were put in a microwave tube (2-5 ml, 10-20 ml) made by Biotage, and the solution was adjusted to 0.2 M with chloroform (added 2-methyl-2-butane as a stabilizer). After drying for five hours, oligonucleotides supported to solid phase (CPG resin or polystyrene resin) and 0.25 M ETT activator, which is ((5-ethylthio)-1H-tetrazole) in dichloromethane, (the same amount of chloroform) were added, sealed and heated at 40° C. for 10 minutes to one hour. After cooling to room temperature, the reaction mixture was diluted twice with chloroform, and the resin was collected by filtration. The resulting resin was used in PS oxidization in NS-8-I (Dainippon Seiki co., ltd.) or NS-8-II (Dainippon Seiki co., ltd.). Then the dried resin was subject to deprotection of the following D) to synthesize the target lipid conjugated oligonucleotide.
(357) 3) Synthesis from Lipid-Supported Resin
(358) Using a lipid-supported resin synthesized in the above A) (e.g., Compound 13-n′, Compound 27-n′ and Compound 33-s′-t′-u′), the target lipid conjugated oligonucleotides were synthesized in a similar method to the above B).
(359) 4) Synthesis from an Activator
(360) A single-stranded oligonucleotide comprising an amino linker (e.g., NA-23 or NA-24) was put in a microfuge tube (1.5 ml), DMSO (addition of 0.5% DIEA) and sodium bicarbonate solution (0.2 M NaHCO.sub.3) were added as 1:5 to prepare in 1 mM. The compound synthesized in the above A) (e.g., Compound 14-n′. 2 to 10 equivalents of an oligonucleotide as DMSO solution) was added thereto and the mixture was allowed to stand from a room temperature to 70° C. for two hours to synthesize the target lipid conjugated oligonucleotide.
(361) 5) Synthesis from Lipid Conjugated Amino Acid
(362) A single-stranded oligonucleotide comprising an amino linker (e.g., NA-23, NA-24) (1.2 μmol) and 6-maleimidohexanoic acid N-hydroxysuccinimide ester (26 μmol) were mixed and reacted under the presence of 0.1% DIEA in DMSO (1 mL) at room temperature for two to four hours. The reaction mixture was ultrafiltered, and then lyophilizated to obtain white solid.
(363) The resulting white solid and a compound synthesized in the above A) (e.g., Compound 100 or Compound 101. 2 to 50 equivalents of an oligonucleotide) were dissolved in 4 mL of the solvent (DMSO/acetonitrile (1:1) or DMSO) and reacted at room temperature to synthesize the target lipid conjugated oligonucleotide.
(364) 6) Synthesis from Lipid-Peptide
(365) To a single-stranded oligonucleotide comprising an amino linker (e.g., NA-23 or NA-24) in 25 mM phosphate buffer solution (pH 7.4), 10 equivalents of NHS-PEG4-Maleimide (ThermoFisher Scientific) was added and the mixture was stirred at room temperature for five hours. The excess NHS-PEG4-Maleimide was removed from the reaction mixture with Ultrafiltration kit (molecular weight cut off: 3,000). Then, a compound synthesized in the above A) (e.g., Compound 123. 3 to 10 equivalents of an oligonucleotide) was added and reacted at 40° C. for one hour to synthesize the target lipid conjugated oligonucleotide.
(366) D) Cleavage/Deprotection
(367) 1) Cleavage from the Resin, and Phosphate Deprotection and Base Deprotection
(368) For cutting out DNA oligonucleotide, 28% ammonia water/40% methylamine solution/EtOH=4/4/1(v/v) was used and the solution was shaken at room temperature for four hours. 1 ml, 5 ml or 10 ml of ammonia solution was used for 1 μmol, 5 μmol or 10 μmol synthesis, respectively, for cutting out reaction. After the resin was washed with 50% ethanol water, the filtrate was concentrated under reduced pressure to about 1 to 5 mL.
(369) 2) Fmoc and Phosphate Deprotection on the Resin
(370) After completion of synthesis of 5) of C), the resin was washed with 20% piperidine in DMF solution.
(371) E) Purification
(372) Oligonucleotides without a lipid were purified by reversed phase HPLC in Condition 1.
(373) Condition for Reversed Phase HPLC
(374) Condition 1
(375) Mobile Phases
(376) Buffer A: 100 mM TEAA (triethylammonium acetate, pH 7.0) aqueous solution or 100 mM AcONa aqueous solution (pH5.4)
(377) Buffer B: acetonitrile
(378) B concentration gradient: 10-30%
(379) (Condition 1-1)
(380) Column: Hydrosphere C18 (YMC co., ltd.) 100×20 mm I.D, S-5 μm, 12 nm
(381) Flow rate: 10 mL/min
(382) Column temperature: room temperature
(383) Detection UV: 260 nm
(384) (Condition 1-2)
(385) Column: Hydrosphere C18 (YMC co., ltd.) 150×10 mm I.D, S-5 μm, 12 nm
(386) Flow rate: 4 mL/min
(387) Column temperature: room temperature
(388) Detection UV: 260 nm
(389) Oligonucleotides with a lipid were purified by reversed phase HPLC in Condition 2.
(390) Condition 2
(391) Condition for reversed phase HPLC
(392) According to lipid solubility of the compound, B concentration at the beginning was adjusted from 20% to 50%.
(393) Mobile Phases
(394) Buffer A: 100 mM TEAA (Triethylammonium acetate pH 7.0) aqueous solution or 100 mM AcONa aqueous solution (pH 5.4)
(395) Buffer B: acetonitrile
(396) B concentration gradient: 20-80%
(397) (Condition 2-1)
(398) Column: YMC-Pack C4 (YMC co., ltd.) 100×20 mm I.D, S-5 μm, 12 nm
(399) Flow rate: 10 mL/min
(400) Column temperature: room temperature
(401) Detection UV: 260 nm
(402) (Condition 2-2)
(403) Column: YMC-Pack C4 (YMC co., ltd.) 150×10 mm I.D, S-5 μm, 12 nm
(404) Flow rate: 4 mL/min
(405) Column temperature: room temperature
(406) Detection UV: 260 nm
(407) F) Desalting and freeze-drying of the purified oligonucleotide
(408) Using VivaSpin20 (MWCO 3000) (Sartorius) and Amicon Ultra-4 Centrifugal Filter Units-3K, ultrafiltration was repeated for the resulting oligonucleotide to remove salt component from the fraction. Then, it was lyophilized to obtain the target oligonucleotide as powder. For the oligonucleotides purified using TEAA solvent, the desalting procedure was carried out after transforming the salt form with 100 mM sodium acetate solution (20 mL).
(409) G) Structural Elucidation of Oligonucleotides
(410) The resulting oligonucleotides were confirmed as the target sequences by matching the found molecular weights determined by UPLC/MS measurement and the calculated molecular weights.
(411) Condition 1 (The oligonucleotides without lipid)
(412) Xevo G2 Tof System (Waters)
(413) Column: Aquity OST C18 (2.1×50 mm) (Waters)
(414) Mobile Phases
(415) Buffer A: 200 mM 1,1,1,3,3,3-hexafluoro-2-propanol/8 mM triethylamine
(416) Buffer B: methanol
(417) B concentration gradient: 10-30% (10 min)
(418) Temperature: 50° C.
(419) Flow rate: 0.2 mL/min
(420) Condition 2 (The oligonucleotides with lipid)
(421) Xevo G2 T of System (Waters)
(422) Column: ACQUITY UPLC Protein BEH C4 Column, 300 Å, 1.7 μm, 2.1 mm×100 mm, 1/pkg (Waters)
(423) Mobile Phases
(424) Buffer A: 200 mM 1,1,1,3,3,3-hexafluoro-2-propanol/8 mM triethylamine
(425) Buffer B: methanol
(426) B concentration gradient: 10-95% (10 min)
(427) Temperature: 50° C.
(428) Flow rate: 0.2 mL/min
(429) The synthesized oligonucleotides are shown in Tables 1 to 10.
(430) TABLE-US-00001 TABLE 1 ID 5′ end 3′ end (SEQ modifi- Oligonucleotide modifi- ID) cation (5′ .Math. 3′) cation NA-1 U*u*A*a*A*g*u*u*G*a* *dT{circumflex over ( )}dT (1) G*A*G*a*U*c*A*u*C NA-2 *g*A*u*G*a*U*c*u*c* *dT{circumflex over ( )}dT{circumflex over ( )}M.sub.27-12 (2) U*c*A*A*C*u*U*u*A*a NA-3 g*A*u*G*a*U*c*u*c*U* *dT{circumflex over ( )}dT*M.sub.27-12 (2) c*A*A*C*u*U*u*A*a NA-4 L.sub.5-12{circumflex over ( )} g*A*u*G*a*U*c*u*c*U* *dT{circumflex over ( )}dT (2) c*A*A*C*u*U*u*A*a NA-5 L.sub.5-12* g*A*u*G*a*U*c*u*c*U* *dT{circumflex over ( )}dT (2) c*A*A*C*u*U*u*A*a NA-6 U*u*A*a*A*g*u*u*G*a* {circumflex over ( )}dT{circumflex over ( )}dT (1) G*A*G*a{circumflex over ( )}U{circumflex over ( )}c{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}C NA-7 U{circumflex over ( )}u*A{circumflex over ( )}a*A{circumflex over ( )}g*u{circumflex over ( )}u*G{circumflex over ( )}a* {circumflex over ( )}dT{circumflex over ( )}dT (1) G{circumflex over ( )}A*G{circumflex over ( )}a*U{circumflex over ( )}c*A{circumflex over ( )}u*C NA-8 g*A*u*G*a*U*c*u*c*U* *dT{circumflex over ( )}dT (2) c*A*A*C*u*U*u*A*a NA-9 -P(O) U{circumflex over ( )}u{circumflex over ( )}A*a*A*g*u*u*G*a* {circumflex over ( )}dT{circumflex over ( )}dT (1) (OH).sub.2 G*A*G*a*U*c*A*u*C NA-10 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13-6 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-11 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13-8 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-12 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13-10 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a
(431) TABLE-US-00002 TABLE 2 ID 5′ end 3′ end (SEQ modifi- Oligonucleotide modifi- ID) cation (5′ .Math. 3′) cation NA-13 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* {circumflex over ( )}M.sub.13-12 (2) A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-14 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* {circumflex over ( )}M.sub.13-14 (2) A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-15 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* {circumflex over ( )}M.sub.13-16 (2) A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-16 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* {circumflex over ( )}M.sub.13-18 (2) A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-17 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* {circumflex over ( )}M.sub.13-20 (2) A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-18 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* {circumflex over ( )}M.sub.13-22 (2) A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-19 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* {circumflex over ( )}M.sub.33-7-7-7 (2) A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-20 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* (2) A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-21 rG*rU*rA*rG*rG*rA*rG*rU* (3) rA*rG*rU*rG*rA*rA*rA*rG* rG*rC*rC*rA*rG NA-22 L.sub.NA-22* rG*rG*rC*rC*rU*rU*rU*rC* (4) rA*rC*rU*rA*rC*rU*rC*rC* rU*rA*rC*rG*rA NA-23 L.sub.NA-23* rG*rG*rC*rC*rU*rU*rU*rC* (4) rA*rC*rU*rA*rC*rU*rC*rC* rU*rA*rC*rG*rA
(432) TABLE-US-00003 TABLE 3 ID 5′ end 3′ end (SEQ modifi- Oligonucleotide modifi- ID) cation (5′ .Math. 3′) cation NA-24 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.NA-24 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-25 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}Bu*Bu*Bu*Bu* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a Bu*Bu*M.sub.42 NA-26 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}Bu*Bu*Bu*Bu* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a Bu*Bu*M.sub.48-8 NA-27 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}Bu*Bu*Bu*Bu* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a Bu*Bu*M.sub.48-12 NA-28 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}Bu*Bu*Bu*Bu* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a Bu*Bu*M.sub.55-5-7 NA-29 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.124{circumflex over ( )}M.sub.13a-.sub.14 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-30 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dT*dT*dT*dT* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dT*dT*M.sub.13-14 NA-31 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dT*dT*dT*dT* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dT*dT*M.sub.124* M.sub.13a-.sub.14 NA-32 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.48-12 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-33 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13b-(a6) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-34 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13b-(a10) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-35 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13b-(a18) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a
(433) TABLE-US-00004 TABLE 4 ID 5′ end 3′ end (SEQ modifi- Oligonucleotide modifi- ID) cation (5′ .fwdarw. 3′) cation NA-36 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13b-(b) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-37 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13b-(c) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-38 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13b-(d) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-39 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *A*A*A*A*A* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a A*M.sub.13-14 NA-40 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *a*a*a*a*a* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a a*M.sub.13-14 NA-41 G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c*A*A* *u*u*u*u*u* (13) C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a u*M.sub.13-14 NA-42 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dA*dA*dA*dA* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA*dA*M.sub.13-14 NA-43 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dG*dG*dG*dG* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dG*dG*M.sub.13-14 NA-44 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dC*dC*dC*dC* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dC*dC*M.sub.13-14 NA-45 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112-12 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-46 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.100-3-18 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a
(434) TABLE-US-00005 TABLE 5 ID 5′ end 3′ end (SEQ modifi- Oligonucleotide modifi- ID) cation (5′ .fwdarw. 3′) cation NA-47 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *Ab*Ab*Ab (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a *M.sub.13-14 NA-48 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *Ab*Ab*Ab*Ab* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a Ab*Ab*M.sub.13-14 NA-49 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *Ab*Ab*Ab*Ab* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a Ab*Ab*Ab*Ab* Ab*M.sub.13-14 NA-50 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *rA*rA*rA*rA* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a rA*rA*M.sub.13-14 NA-51 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13b-(e) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-52 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13b-(f) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-53 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.69-1 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-54 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.74-3 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-55 L.sub.65-12{circumflex over ( )} g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-56 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.13b-(g) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-57 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dA*dA*dA*dA* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a M.sub.13-14 NA-58 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dA*dA*dA*dA* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA*M.sub.13-14
(435) TABLE-US-00006 TABLE 6 ID 5′ end 3′ end (SEQ modifi- Oligonucleotide modifi- ID) cation (5′ .fwdarw. 3′) cation NA-59 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dA*dA*dA*dA* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA*dA*dA*M.sub.13-14 NA-60 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dA*dA*dA*dA* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA*dA*dA*dA *M.sub.13-14 NA-61 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.97 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-62 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112-14 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-63 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112-16 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-64 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dA*dA*dA*dA* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA*dA*M.sub.13-14 NA-65 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(a2) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-66 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(a6) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-67 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(a10) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-68 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(a12) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-69 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(a18) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-70 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(h) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a
(436) TABLE-US-00007 TABLE 7 ID 5′ end 3′ end (SEQ modifi- Oligonucleotide modifi- ID) cation (5′ .fwdarw. 3′) cation NA-71 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(b) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-72 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(c) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-73 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(d) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-74 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b(i) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-75 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(e) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-76 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.112b-(g) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-77 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.90a (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-78 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.90b-(j) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-79 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.90b-(k) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-80 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.90b-(l) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-81 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )} (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA{circumflex over ( )}dA{circumflex over ( )}M.sub.112-12 NA-82 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )} (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA{circumflex over ( )}dA{circumflex over ( )}M.sub.13-14
(437) TABLE-US-00008 TABLE 8 ID 5′ end 3′ end (SEQ modifi- Oligonucleotide modifi- ID) cation (5′ .fwdarw. 3′) cation NA-83 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dA*dA*dA{circumflex over ( )}dA{circumflex over ( )} (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA{circumflex over ( )}dA{circumflex over ( )}M.sub.13-14 NA-84 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dA*dA*dA*dA* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA{circumflex over ( )}dA{circumflex over ( )}M.sub.13-14 NA-85 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )} (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA*dA*M.sub.13-14 NA-86 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}dA{circumflex over ( )}dA*dA*dA* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dA*dA*M.sub.13-14 NA-87 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}dA{circumflex over ( )}dA*dT*dT* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dT*dT*M.sub.13-14 NA-88 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}dA{circumflex over ( )}dA*dT*dT* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dT*dT*dT*dT* M.sub.13-14 NA-89 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.NA-89 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-90 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.105-14 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a
(438) TABLE-US-00009 TABLE 9 ID 5′ end 3′ end (SEQ modifi- Oligonucleotide modifi- ID) cation (5′ .fwdarw. 3′) cation NA-91 L.sub.65-12{circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )} g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* (2) dT{circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )} c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a
(439) TABLE-US-00010 TABLE 10 ID 5′ end 3′ end (SEQ modifi- Oligonucleotide modifi- ID) cation (5′ .fwdarw. 3′) cation NA-92 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )} (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dT{circumflex over ( )}dT{circumflex over ( )}M.sub.48-12 NA-93 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.95-3-(m) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-94 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.95-3-(n) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-95 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.NA-95 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-96 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dT*dT*dT*dT* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dT*dT*M.sub.112-12 NA-97 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* *dT*dT*dT*dT* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dT*dT*M.sub.112-14 NA-98 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.95-3-(o) (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-99 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}dT{circumflex over ( )}dT*dT*dT* (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a dT*dT*M.sub.NA-95 NA-100 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.NA-100 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-101 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.NA-101 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-102 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.NA-102 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-103 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.62 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-104 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.120 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-105 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.120-6 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a NA-106 g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* {circumflex over ( )}M.sub.120-12 (2) c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a
(440) In Tables 1 to 10, n (small letter) is 2′-F-RNA, N (capital letter) is 2′-OMe-RNA, rN is RNA, and dN is DNA. {circumflex over ( )} is —P(S)OH—, and * is —P(O)OH—.
(441) ##STR00082##
(442) Ab (Abasic) is the following group.
(443) ##STR00083##
(444) Bu is the following group.
(445) ##STR00084##
(446) L means a compound introduced at the 5′ end of an oligonucleotide (optionally comprising an oligonucleotide linker), and each compound covalently binds with a substituted or unsubstituted methylene of the 5′ end of an oligonucleotide. M means a compound introduced at the 3′-end of an oligonucleotide (optionally comprising an oligonucleotide linker), and each compound covalently binds with a sugar of the 3′-end of an oligonucleotide.
(447) Specifically, L.sub.x-n′ binds at the 5′-end of an oligonucleotide, which may also include an oligonucleotide linker, as below. In the following formula, OL5′ means that the terminal bond of L.sub.x-n′ binds at 5′-end of an oligonucleotide having suppressing activity of the target gene expression or an oligonucleotide linker via “{circumflex over ( )}(—P(S)OH—)” or “*(—P(O)OH—)” as described in the above tables.
(448) ##STR00085##
wherein n′ is an integer of 5 to 29.
(449) L.sub.5-n′ is a group derived from Compound 5-n′ which is synthesized in the above A), L.sub.65-n′ is a group derived from Compound 65-n′.
(450) M.sub.x-n′ binds at 3′-end of an oligonucleotide, which may also include an oligonucleotide linker, as below. In the following formula, OL3′ means that the terminal bond of M.sub.x-n′ binds at 3′-end of an oligonucleotide having suppressing activity of the target gene expression or an oligonucleotide linker via “{circumflex over ( )}(—P(S)OH—)” or “*(—P(O)OH—)” as described in the above tables.
(451) ##STR00086##
wherein n′ is an integer of 5 to 29.
(452) M.sub.13-n′ is a group derived from Compound 13-n′ which is synthesized in the above A).
(453) M.sub.13a-n′ is a group which binds to a group except for an oligonucleotide. For example, it means that M.sub.13-n′ binds to M.sub.124 which is a group derived from Compound 124 which is synthesized in the above A).
(454) ##STR00087##
wherein r1 is a group selected from the following Substituent (an″) to (g).
(455) ##STR00088##
wherein n″ is an integer of 2 to 29.
(456) M.sub.13b-r1 is a group synthesized in a similar method as Compound 13-n′ in the above A) and derived from Compound 75-n″ (Substituent (an″)), Compound 77 (Substituent (b)), Compound 78 (Substituent (c)), Compound 80 (Substituent (d)), Compound 83 (Substituent (e)), Compound 82 (Substituent (f)) or Compound 86 (Substituent (g)).
(457) ##STR00089##
wherein n′ is an integer of 5 to 29, and s′, t′ and u′ are each independently an integer of 3 to 20.
(458) M.sub.27-n′ is a group derived from Compound 27-n′ which is synthesized in the above A), and M.sub.33-s′-t′-u′ is a group derived from Compound 33-s′-t′-u′.
(459) ##STR00090##
wherein m′ and n′ are each independently an integer of 5 to 29.
(460) M.sub.42 is a group derived from Compound 42 which is synthesized in the above A), M.sub.48-n′ is a group derived from Compound 48-n′, and M.sub.55-m′-n′ is a group derived from Compound 55-m′-n′.
(461) ##STR00091##
(462) M.sub.NA-102 is a group derived from the following NA-24 and Compound 103 according to the above 4) of C). M.sub.NA-89 is a group derived from the NA-102 and Compound 75-12 according to the above 4) of C).
(463) ##STR00092##
wherein n′ is an integer of 5 to 29.
(464) M.sub.120 is a group derived from Compound 120 which is synthesized in the above A), and M.sub.120-n′ is a group derived from NA-104 and Compound 75-n″ according to the above 4) of C).
(465) ##STR00093##
wherein n′ is integer of 5 to 29.
(466) M.sub.112-n′ is a group which is synthesized and derived in a similar method as Compound 112 which is synthesized in the above A), and M.sub.9 7 is a group derived from Compound 97.
(467) ##STR00094##
wherein j is an integer of 1 to 3, and n′ is an integer of 5 to 29.
(468) M.sub.100-j-n′ is a group which is synthesized and derived in a similar method as Compound 100-j-n′ which is synthesized in the above A).
(469) ##STR00095##
wherein r2 is a group selected from Substituent (an″) to (e), (g) of r1 and the following (h) and (i).
(470) ##STR00096##
(471) M.sub.112b-r2 is a group which is synthesized in a similar method as Compound 112 in the above A) and derived from Compound 75-n″ (Substituent (an″)), Compound 77 (Substituent (b)), Compound 78 (Substituent (c)), Compound 80 (Substituent (d)), Compound 83 (Substituent (e)), Compound 86 (Substituent (g)), Compound 76 (Substituent (h)) or Compound 81 (Substituent (i)).
(472) ##STR00097##
wherein k is an integer of 0 to 4, and n′ is an integer of 1 to 4.
(473) M.sub.69-n′ is a group derived from Compound 69-n′ which is synthesized in the above A), M.sub.74-k is a group derived from Compound 74-k-14, and M.sub.NA-95 is a group derived from Compound 95-2-14 which is synthesized in the above A).
(474) ##STR00098##
wherein r3 is a group selected from the following Substituent (j) to (1).
(475) ##STR00099##
(476) M.sub.90a and M.sub.90b-r3 are groups derived from Compound 90-k-n′ which is synthesized in the above A) and Compound 121 (Substituent (j)), Compound 122 (Substituent (k)) or Compound 123 (Substituent (1)) according to the above 6) of C).
(477) ##STR00100##
wherein n′ is an integer of 5 to 29.
(478) M.sub.105-n′ is a group derived from Compound 105-n′ which is synthesized in the above A).
(479) ##STR00101##
wherein k is an integer of 0 to 4, and r4 is a group selected from the following Substituent (m) to (o).
(480) ##STR00102##
(481) M.sub.95-r4 is a group derived from Compound 95-k-14 which is synthesized in the above A) and Compound 88 (Substituent (m)), Compound 3-14 (Substituent (n)) or hexyl isocyanate (Substituent (o)).
(482) ##STR00103##
(483) M.sub.NA-100 is a group derived from Compound 101 according to the above 5) of C), and M.sub.NA-101 is a group derived from Compound 102 according to the above 5) of C).
(484) ##STR00104##
(485) M.sub.62 is a group derived from Compound 62 which is synthesized in the above A).
(486) Substituents for NA-22 to 24 in the comparative examples binds to an oligonucleotide as below.
(487) ##STR00105##
(488) A substituent for L.sub.NA-22 was synthesized with reference to the description of Patent Document 8.
(489) A substituent for M.sub.NA-24 was purchased from Link Technology Co., Ltd. Nucleic acid derivatives comprising an amino linker at 3′-end were synthesized by synthesizing an oligonucleotide in a similar method to the above B) with the resin for nucleic acid resin (3′-amino CPG).
(490) The results of purity analysis of the synthesized single-stranded oligonucleotide are shown in Tables 11 to 13.
(491) TABLE-US-00011 TABLE 11 Theoretical Mw Found Mw Oligonucleotide [M − H].sup.− [M − H].sup.− NA-1 6853.31 6854 NA-2 7525.28 7527 NA-3 7509.21 7510 NA-4 7328.07 7328 NA-5 7312.00 7312 NA-8 6738.18 6739 NA-9 6981.50 6983 NA-10 6868.18 6869 NA-11 6924.29 6925 NA-12 6980.40 6982 NA-13 7036.50 7037 NA-14 7092.61 7094 NA-15 7148.72 7150 NA-16 7204.83 7206 NA-17 7260.94 7262 NA-18 7317.04 7318 NA-19 6934.41 6935 NA-20 6274.41 6276 NA-22 7537.19 7537 NA-24 6499.65 6501
(492) TABLE-US-00012 TABLE 12 Theoretical Mw Found Mw Oligonucleotide [M − H].sup.− [M − H].sup.− NA-25 8108.26 8108 NA-26 8405.57 8405 NA-27 8573.90 8575 NA-28 8004.11 8002 NA-29 7437.05 7437 NA-30 8901.67 8902 NA-31 9230.09 9230 NA-32 7663.40 7663 NA-33 6980.40 6981 NA-34 7036.50 7037 NA-35 7148.72 7149 NA-36 6980.40 6981 NA-37 7092.61 7093 NA-38 7020.46 7021 NA-39 9135.92 9137 NA-40 9063.70 9065 NA-41 7878.67 7879 NA-42 8955.76 8955 NA-43 9051.76 9052 NA-44 8811.61 8812 NA-45 7048.51 7049 NA-46 7507.15 7508 NA-47 7616.80 7618 NA-48 8157.10 8157 NA-49 8697.40 8698 NA-50 9051.80 9052 NA-51 7036.42 7039 NA-52 7116.63 7117 NA-53 6854.20 6855 NA-54 6866.25 6867 NA-55 7005.41 7007 NA-56 6993.40 6996 NA-57 8329.34 8330 NA-58 8642.55 8643 NA-59 9268.97 9268 NA-60 9582.18 9582 NA-61 7104.62 7105 NA-62 7104.62 7105 NA-63 7160.73 7163 NA-64 8911.71 8912 NA-65 6936.34 6938 NA-66 6992.45 6994 NA-67 7048.56 7050 NA-68 7076.61 7078 NA-69 7160.78 7162 NA-70 6978.42 6980 NA-71 6992.45 6994 NA-72 7104.67 7106 NA-73 7032.52 7034 NA-74 7035.43 7037 NA-75 7048.47 7051 NA-76 7005.45 7007 NA-77 7164.70 7166 NA-78 7447.10 7448 NA-79 7588.10 7590 NA-80 8269.90 8272 NA-81 9024.10 9026 NA-82 9068.20 9070 NA-83 9020.00 9021 NA-84 8987.90 8989 NA-85 9036.10 9037 NA-86 8987.90 8989
(493) TABLE-US-00013 TABLE 13 Theoretical Mw Found Mw Oligonucleotide [M − H].sup.− [M − H].sup.− NA-87 8969.90 8971 NA-88 9596.30 9598 NA-89 7048.50 7050 NA-90 7140.66 7142 NA-91 8927.04 8930 NA-92 9584.04 9585 NA-93 7322.96 7325 NA-94 7403.09 7406 NA-95 7090.60 7093 NA-96 8857.60 8860 NA-97 8913.70 8916 NA-98 6993.44 6995 NA-99 8931.82 8934 NA-100 7689.20 7692 NA-101 7774.40 7777 NA-102 6627.80 6630 NA-103 8825.39 8825 NA-104 6831.19 6833 NA-105 6957.39 6959 NA-106 7041.55 7043
H) Preparation of the Double-Stranded Oligonucleotide
(494) After mixing the equimolecular amount of 100μM solution of each oligonucleotide, the solution was heated at 75° C. for 5 minutes, and naturally cooled to room temperature to obtain the double-stranded nucleic acids. Conformation of the double-stranded formation was carried out with size exclusion chromatography.
(495) Column: YMC-PAC Diol-120 (4.6×300 mm) (YMC co., ltd.)
(496) Mobile phases: 40% acetonitrile in 1×PBS solution
(497) Flow rate: 0.5 mL/min
(498) Temperature: room temperature
(499) The synthesized oligonucleotides (siRNAs) are shown in Tables 14 to 15.
(500) TABLE-US-00014 TABLE 14 siRNA ID siRNA-1 NA-1 NA-8 siRNA-2 NA-1 NA-2 siRNA-3 NA-1 NA-3 siRNA-4 NA-1 NA-4 siRNA-5 NA-1 NA-5 siRNA-6 NA-6 NA-2 siRNA-7 NA-7 NA-2 siRNA-8 NA-9 NA-10 siRNA-9 NA-9 NA-11 siRNA-10 NA-9 NA-12 siRNA-11 NA-9 NA-13 siRNA-12 NA-9 NA-14 siRNA-13 NA-9 NA-15 siRNA-14 NA-9 NA-16 siRNA-15 NA-9 NA-17 siRNA-16 NA-9 NA-18 siRNA-17 NA-9 NA-19 siRNA-18 NA-9 NA-20 siRNA-19 NA-21 NA-22 siRNA-20 NA-21 NA-23 siRNA-21 NA-9 NA-24 siRNA-22 NA-9 NA-25 siRNA-23 NA-9 NA-26 siRNA-24 NA-9 NA-27 siRNA-25 NA-9 NA-28 siRNA-26 NA-9 NA-29 siRNA-27 NA-9 NA-30 siRNA-28 NA-9 NA-31 siRNA-29 NA-9 NA-32 siRNA-30 NA-9 NA-33 siRNA-31 NA-9 NA-34 siRNA-32 NA-9 NA-35 siRNA-33 NA-9 NA-36 siRNA-34 NA-9 NA-37 siRNA-35 NA-9 NA-38 siRNA-36 NA-9 NA-39 siRNA-37 NA-9 NA-40 siRNA-38 NA-9 NA-41 siRNA-39 NA-9 NA-42 siRNA-40 NA-9 NA-43 siRNA-41 NA-9 NA-44 siRNA-42 NA-9 NA-45 siRNA-43 NA-9 NA-46 siRNA-44 NA-9 NA-47 siRNA-45 NA-9 NA-48 siRNA-46 NA-9 NA-49 siRNA-47 NA-9 NA-50 siRNA-48 NA-9 NA-51 siRNA-49 NA-9 NA-52 siRNA-50 NA-9 NA-53 siRNA-51 NA-9 NA-54 siRNA-52 NA-9 NA-55 siRNA-53 NA-9 NA-56 siRNA-54 NA-9 NA-57 siRNA-55 NA-9 NA-58 siRNA-56 NA-9 NA-59 siRNA-57 NA-9 NA-60 siRNA-58 NA-9 NA-61 siRNA-59 NA-9 NA-62 siRNA-60 NA-9 NA-63
(501) siRNA-1, 18, 19 and 20 are the comparative examples.
(502) TABLE-US-00015 TABLE 15 siRNA ID siRNA-61 NA-9 NA-64 siRNA-62 NA-9 NA-65 siRNA-63 NA-9 NA66 siRNA-64 NA-9 NA-67 siRNA-65 NA-9 NA-68 siRNA-66 NA-9 NA-69 siRNA-67 NA-9 NA-70 siRNA-68 NA-9 NA-71 siRNA-69 NA-9 NA-72 siRNA-70 NA-9 NA-73 siRNA-71 NA-9 NA-74 siRNA-72 NA-9 NA-75 siRNA-73 NA-9 NA-76 siRNA-74 NA-9 NA-77 siRNA-75 NA-9 NA-78 siRNA-76 NA-9 NA-79 siRNA-77 NA-9 NA-80 siRNA-78 NA-9 NA-81 siRNA-79 NA-9 NA-82 siRNA-80 NA-9 NA-83 siRNA-81 NA-9 NA-84 siRNA-82 NA-9 NA-85 siRNA-83 NA-9 NA-86 siRNA-84 NA-9 NA-87 siRNA-85 NA-9 NA-88 siRNA-86 NA-9 NA-89 siRNA-87 NA-9 NA-90 siRNA-88 NA-9 NA-91 siRNA-89 NA-9 NA-92 siRNA-90 NA-9 NA-93 siRNA-91 NA-9 NA-94 siRNA-92 NA-9 NA-95 siRNA-93 NA-9 NA-96 siRNA-94 NA-9 NA-97 siRNA-95 NA-9 NA-98 siRNA-96 NA-9 NA-99 siRNA-97 NA-9 NA-100 siRNA-98 NA-9 NA-101 siRNA-99 NA-9 NA-105 siRNA-100 NA-9 NA-106 siRNA-101 NA-9 NA-103
(503) siRNA-101 is a comparative example.
Example 2: Evaluation of siRNAs by Free Uptake (Transfection without Gene Transfection Reagents)
Experiment 1
(504) HeLa cells, human cervical cancer cell line, were cultured in DMEM Low Glucose (Sigma)+10% Fetal Bovine Serum (FBS)+Penicillin (100 units/mL)+Streptomycin (100 ug/mL). The cells were maintained at 37° C., 95 to 98% humidity and 5% CO.sub.2. In all cells for this experiment, siRNAs were transfected into cells without any gene transfection reagent. To a culture supernatant of the HeLa cells, the complex of the present invention comprising siRNA as a nucleic acid medicine or siRNA without a lipid (siRNA-1) as a comparative example was added to be at final concentration of 1 μM. After 72 hours, the cells were collected with CellAmp RNA Prep Kit (Takara) and quantitative PCR was performed with One Step SYBR PrimeScript PLUS RT-PCR Kit (Takara). GAPDH was used as an endogenous control. The primer sequences for measuring the level of human HPRT1 expression are
(505) TABLE-US-00016 Fw primer: (SEQ ID NO: 5) CTACCCTCTGGTAGATTGTCG; and Rv primer: (SEQ ID NO: 6) TCGAGAGCTTCAGACTCGTCTA.
(506) The primer sequences for measuring the level of human GAPDH expression are
(507) TABLE-US-00017 Fw primer: (SEQ ID NO: 7) GCACCGTCAAGGCTGAGAAC; and Rv primer: (SEQ ID NO: 8) TGGTGAAGACGCCAGTGGA.
(508) The results are shown in Table 16. In the table, the ratios of the amount of Hprt1 mRNA normalized with Gapdh compared to untreated cells were shown as the knockdown efficiency.
(509) TABLE-US-00018 TABLE 16 siRNA % mRNA siRNA-1 96 siRNA-2 10 siRNA-3 7 siRNA-4 28 siRNA-5 30
Experiment 2
(510) Hepa1c1c7 cells, mouse hepatoma cell line, were cultured in MEM Alpha (Thermo Fisher Scientific)+10% Fetal Bovine Serum (FBS)+Penicillin (100 units/mL)+Streptomycin (100 ug/mL). The cells were maintained at 37° C., 95 to 98% humidity and 5% CO.sub.2. In all cells for this experiment, siRNAs were transfected into cells without any gene transfection reagent. To a culture supernatant of the Hepa1c1c7 cells, the complex of the present invention comprising siRNA as a nucleic acid medicine was added to be at final concentration of 2 μM. After 72 hours, the cells were collected with CellAmp RNA Prep Kit (Takara) and quantitative PCR was performed with One Step SYBR PrimeScript PLUS RT-PCR Kit (Takara). Gapdh was used as an endogenous control.
(511) The primer sequences for measuring the level of mouse Hprt1 expression are
(512) TABLE-US-00019 Fw primer: (SEQ ID NO: 9) TTGTTGTTGGATATGCCCTTGACTA; and Rv primer: (SEQ ID NO: 10) AGGCAGATGGCCACAGGACTA.
(513) The primer sequences for measuring the level of mouse Gapdh expression are
(514) TABLE-US-00020 Fw primer: (SEQ ID NO: 11) TGTGTCCGTCGTGGATCTGA; and Rv primer: (SEQ ID NO: 12) TTGCTGTTGAAGTCGCAGGAG.
(515) The results are shown in Table 17. In the table, the ratios of the amount of Hprt1 mRNA normalized with Gapdh compared to untreated cells were shown as the knockdown efficiency.
(516) TABLE-US-00021 TABLE 17 siRNA % mRNA siRNA-22 45 siRNA-23 45 siRNA-24 20 siRNA-27 11 siRNA-28 36 siRNA-29 25 siRNA-31 35 siRNA-32 45 siRNA-36 14 siRNA-37 16 siRNA-38 18 siRNA-39 13 siRNA-40 33 siRNA-41 16 siRNA-42 18 siRNA-44 26 siRNA-45 17 siRNA-46 18 siRNA-47 19 siRNA-49 37 siRNA-50 36 siRNA-51 29 siRNA-52 27 siRNA-54 16 siRNA-55 16 siRNA-56 18 siRNA-57 17 siRNA-59 19 siRNA-60 44 siRNA-61 16 siRNA-62 37 siRNA-63 31 siRNA-64 20 siRNA-65 21 siRNA-66 42 siRNA-67 44 siRNA-68 49 siRNA-69 51 siRNA-70 32 siRNA-71 41 siRNA-72 54 siRNA-73 50 siRNA-74 20 siRNA-75 49 siRNA-76 39 siRNA-77 23 siRNA-78 29 siRNA-79 30 siRNA-80 22 siRNA-81 21 siRNA-82 28 siRNA-83 23 siRNA-84 19 siRNA-85 21 siRNA-86 25 siRNA-89 32 siRNA-92 21 siRNA-93 20 siRNA-94 20 siRNA-95 35 siRNA-96 25 siRNA-97 27 siRNA-98 38 siRNA-99 36 siRNA-100 19 siRNA-101 104
(517) As the above, both the complexes of the present invention whose lipid was bound at the 3′-end of the second strand (siRNA-2, siRNA-3, etc.) and the complexes of the present invention whose lipid was bound at the 5′-end of the second strand (siRNA-4, siRNA-5, etc.) showed higher knockdown activities against HPRT1 compared to the comparative example without lipid (siRNA-1) or the comparative example with the eight-branched lipid (siRNA-101). It is thought that the complexes of the present invention with high knockdown activity without any gene transfection reagent are capable of fully exerting the effects of the comprised nucleic acid medicines and are very useful in drug discovery.
Experiment 3
(518) As Experiment 1, to a culture supernatant of the HeLa cells, the complex of the present invention (siRNA-2, siRNA-6 or siRNA-7) or siRNA without a lipid (siRNA-1) as a comparative example was added to be at final concentration of 0.5 μM. After 72 hours, the cells were collected, and quantitative PCR was performed. GAPDH was used as an endogenous control. The primer sequences for measuring the level of HPRT1 and GAPDH are the same as Experiment 1. The results are shown in Table 18.
(519) TABLE-US-00022 TABLE 18 siRNA % mRNA siRNA-1 67 siRNA-2 21 siRNA-6 10 siRNA-7 16
(520) As a result, the complexes of the present invention whose comprised nucleic acid medicine were modified (the oligonucleotide of the first strand comprises phosphorothioates) (siRNA-6 and siRNA-7) also showed higher knockdown activities against HPRT1.
Example 3: Evaluation of In Vivo Activity
(521) (Animal)
(522) C57BL/6JJcl mice (8 weeks old male and 8 weeks old female mice) were introduced from CLEA Japan, Inc. Tumor-bearing model mice were produced as follows. The cell line A431 from human epithelioid cell carcinoma was cultured in DMEM Low Glucose (Sigma)+10% Fetal Bovine Serum (FBS)+Penicillin (100 units/mL)+Streptomycin (100 ug/mL). Approximately 100,000 cells were implanted in the back of nude mouse, Balbc-nu/nu (5 weeks old male mice). After about 10 days, the tumor diameters were reached about 1 cm, then the mice were subjected to the experiments.
(523) Approximately 0.2 mL of the complex of the present invention (siRNA-8 to siRNA-17) dissolved in saline (OTSUKA NORMAL SALINE, Otsuka Pharmaceutical Factory, Inc.), or siRNA without lipid (siRNA-18) or siRNA which has an only linker bound to the second strand (siRNA-21) as a comparative example was administered intravenously to each mouse at a dose of 50 mg/kg or 25 mg/kg. Three days after administration to male mice, approximately 0.5 mL of whole blood and tissue of liver, kidney, lung, spleen, fat, muscle, small intestine, large intestine, testis, bone, bone marrow, thymus, respiratory tract, skin, dorsal root ganglia, spinal cord and brain were collected under isoflurane anesthesia. Three days after administration to female mice, uteri and ovaries were collected under isoflurane anesthesia. Tumor tissues were collected from the tumor-bearing model mice 3 days after administration. The RNAs were extracted according to the manufacturer's recommended protocols using RNeasy 96 Universal Tissue Kit (Qiagen) from the collected tissues and QIAamp RNA Blood Mini Kit (Qiagen) from the blood cells comprising whole blood. Quantitative PCR was performed with One Step SYBR PrimeScript PLUS RT-PCR Kit (Takara) using 20 ng (dorsal root ganglion and blood cells) or 100 ng (the other tissues) of the obtained RNAs. Gapdh was used as an endogenous control. The primer sequences for measuring the level of mouse Hprt1 and mouse Gapdh are the same as Experiment 2.
(524) The results are shown in Tables 19 to 21 (Dose: 50 mg/kg) and Tables 22 and 23 (Dose: 25 mg/kg). In the tables, the ratios of the amount of Hprt1 mRNA normalized with Gapdh compared to the saline group were shown as the knockdown efficiency.
(525) TABLE-US-00023 TABLE 19 siRNA % mRNA (Liver) % mRNA (Heart) % mRNA (Muscle) siRNA-18 86 86 102 siRNA-21 59 75 74 siRNA-8 20 35 39 siRNA-9 12 30 34 siRNA-10 10 25 27 siRNA-11 9 21 17 siRNA-12 7 23 24 siRNA-13 7 29 27 siRNA-14 8 29 59 siRNA-15 7 30 72 siRNA-16 8 31 78 siRNA-17 12 21 28
(526) TABLE-US-00024 TABLE 20 siRNA % mRNA (Liver) siRNA-22 8 siRNA-24 6 siRNA-25 6 siRNA-26 6 siRNA-27 7 siRNA-28 8 siRNA-29 11 siRNA-30 7 siRNA-31 5 siRNA-32 7 siRNA-33 8 siRNA-34 5 siRNA-35 7 siRNA-42 6 siRNA-43 6 siRNA-76 9 siRNA-90 9 siRNA-91 10 siRNA-95 11 siRNA-93 9 siRNA-101 130
(527) TABLE-US-00025 TABLE 21 siRNA % mRNA (Muscle) siRNA-22 44 siRNA-25 39 siRNA-26 35 siRNA-27 24 siRNA-28 29 siRNA-29 39 siRNA-30 35 siRNA-31 19 siRNA-32 30 siRNA-33 34 siRNA-34 34 siRNA-35 27 siRNA-42 23 siRNA-76 24 siRNA-90 55 siRNA-95 21 siRNA-101 100
(528) TABLE-US-00026 TABLE 22 siRNA % mRNA (Liver) siRNA-36 13 siRNA-37 9 siRNA-39 10 siRNA-40 12 siRNA-41 14 siRNA-44 10 siRNA-45 10 siRNA-46 11 siRNA-47 11 siRNA-48 12 siRNA-49 14 siRNA-50 22 siRNA-51 13 siRNA-52 13 siRNA-53 33 siRNA-63 12 siRNA-79 15 siRNA-80 12 siRNA-81 10 siRNA-82 15 siRNA-83 13 siRNA-86 11 siRNA-87 13 siRNA-88 30 siRNA-89 15 siRNA-54 13 siRNA-57 15 siRNA-58 18 siRNA-59 11 siRNA-60 13 siRNA-61 15 siRNA-92 9
(529) TABLE-US-00027 TABLE 23 siRNA % mRNA (Muscle) siRNA-36 33 siRNA-37 33 siRNA-39 35 siRNA-41 33 siRNA-44 31 siRNA-45 44 siRNA-46 42 siRNA-47 37 siRNA-49 48 siRNA-50 46 siRNA-51 38 siRNA-52 31 siRNA-63 38 siRNA-79 40 siRNA-80 42 siRNA-81 43 siRNA-82 36 siRNA-83 36 siRNA-86 31 siRNA-87 43 siRNA-88 42 siRNA-89 33 siRNA-54 36 siRNA-57 48 siRNA-59 39 siRNA-61 30 siRNA-92 35 siRNA-93 26
(530) As a result, the complexes of the present invention whose lipid were bound at the 3′-end of the second strand showed activity with higher efficiency not only in liver but also in skeletal muscle, heart and fat compared to the comparative example without lipid (siRNA-18) and the comparative example with the eight-branched lipid (siRNA-101). About 40% knockdown was also observed in lung, spleen, small intestine, large intestine, bone, ovary, uterus, and tumor.
(531) For example, because of “the ability to knock down with high efficiently in skeletal muscle” of the above results, it is thought that the complex of the present invention comprising a nucleic acid medicine with activity against diseases with muscle lesions, particularly diseases such as muscular dystrophy, myotonic dystrophy, myopathy, amyotrophic lateral sclerosis, age-related amyotrophy, cancerous amotorism, spinal muscular atrophy, myasthenia gravis, Guillain Valley's syndrome and polymyositis, can deliver the nucleic acid medicine and exert effects on skeletal muscle. Therefore, the complexes of the present invention are very useful.
Example 4: Evaluation of Lipolytic Enzyme Resistant
(532) 20 nmol of the complex of the present invention (siRNA-11), and siRNA without lipid (siRNA-18) or the compound described in Patent Document 8 (siRNA-19 and siRNA-20) as a comparative example were reacted with 0.27 units of phospholipase A2 (Wako Pure Chemical Industries, Ltd.) in 10 111 of a reaction buffer. 10 mM Tris HCl, 10 mM CaCl.sub.2) and 150 mM NaCl.sub.2 (pH 8.5) were used as the reaction buffer. Samples were taken 5, 15 and 60 minutes after the initiation of the reactions, and the free fatty acid concentrations (uM) in the solutions were measured with NEFA measuring kit Wako (Wako Pure Chemical Industries, Ltd.).
(533) The results are shown in Table 24.
(534) TABLE-US-00028 TABLE 24 siRNA 0 min 5 min 15 min 60 min siRNA-20 0 14.9 14.2 8.8 siRNA-19 0 332.3 428.1 854.3 siRNA-18 0 1.8 4.9 0 siRNA-11 0 2.6 0 0
(535) The release of fatty acids by phospholipase A2 was not detected for siRNA-18 or siRNA-20, which is a siRNA without lipid. For siRNA-19, which is siRNA with phosphatidylethanolamine, fatty acids were degraded over time and released. On the other hand, for the complex of the present invention whose lipid was bound at the 3′-end of the second strand (siRNA-11), fatty acids were not released. Based on the above results, it is thought that the complexes of the present invention have resistant to degradation by many lipolytic enzymes in vivo, and this is one of the reasons why the nucleic acid medicines comprised in the complex of the present invention can exhibit a highly efficient knockdown effect in vivo.
INDUSTRIAL APPLICABILITY
(536) As the above examples, the complexes of the present invention show excellent knockdown activity. In addition, they are resistant to degradation by lipolytic enzymes and suggested to have metabolic stability. Therefore, the activity of a nucleic acid medicine in vivo can be improved by comprising the nucleic acid medicine in the complex of the present invention.