TUMOR-INTRINSIC NLRP3 INFLAMMASOME SIGNALING PATHWAY AS A GENETIC AND FUNCTIONAL BIOMARKER FOR IMMUNOTHERAPY RESPONSE
20230152324 · 2023-05-18
Inventors
Cpc classification
C12Q2600/106
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure describes methods and markers in the NLRP3-HSP70 axis useful for making treatment decisions regarding cancer.
Claims
1. A method for treating cancer in a subject selected for responsiveness to the treatment, comprising: a. obtaining a biological sample from the subject, b. determining the level or activity of a biomarker in the biological sample, wherein the biomarker comprises markers of activation of the NLRP3-HSP70 axis, c. comparing the level or activity of the biomarker to a control, d. classifying the subject for likelihood of clinical response to anti-cancer immunotherapy, wherein the levels of the biomarker correlates with anti-cancer immunotherapy efficacy; and e. administering anti-cancer immunotherapy to the subject wherein the level of the biomarker indicates the subject is likely to be responsive to the anti-cancer immunotherapy or administering an anti-cancer therapy other than immunotherapy wherein the level of the biomarker indicates the subject is unlikely to be responsive to the anti-cancer immunotherapy.
2. The method of claim 1, wherein the level of biomarker indicates that the subject is likely to be responsive and step e) comprises administering the anti-cancer immunotherapy to the subject.
3. The method of claim 1, wherein the level of biomarker indicates that the subject is unlikely to be responsive and step e) comprises administering an anti-cancer therapy other than immunotherapy.
4. The method of claim 1, wherein the subject is evaluated for the development of disease hyperprogression.
5. The method of claim 1 wherein a marker of activation of the NLRP3-HSP70 axis comprises HSP70.
6. The method of claim 5 wherein a marker of activation of the NLRP3-HSP70 axis further comprises, NLRP3, NLRP3 activity, NLRP3-ACS proximal ligation assay or SEQ ID NO: 1
7. The method of claim 6, wherein the level or activity of the biomarker is determined using Q-RT-PCR, Western blot, RNA sequencing, proteomic studies, sequencing, fluorescent in situ hybridization (FISH), ELISA, immunostaining, or proximal ligation assay.
8. A method of claim 1, wherein the subject has cancer, wherein the cancer comprises melanoma, breast cancer, renal cell carcinoma, non-small cell lung cancer, colorectal cancer, Merkel cell carcinoma, gastroesophageal cancer, gastric cancer or pancreatic cancer.
9. The method of claim 1, wherein the biological sample is tumor tissue, plasma, serum, blood, tissue or peripheral blood mononuclear cells.
10. The method of claim 9, wherein the biological sample comprises serum or plasma and a marker of activation of the NLRP3-HSP70 axis comprises HSP70.
11. The method of claim 1 where in the anti-cancer immunotherapy comprises immune blockade therapy or immune an immune checkpoint inhibitor.
12. The method of claim 11, where in the immune checkpoint inhibitor comprises a PD-1 inhibitor or a PD-L1 inhibitor.
13. The method of claim 1, wherein the method further comprises administering NLRP3 inhibitor.
14. The method of claim 13, wherein the NLRP3 inhibitor comprises a small molecule inhibitor.
15. The method of claim 1, wherein the biomarker is measured prior to any anti-cancer treatment.
16. The method of claim 1, wherein the biomarker is measured after beginning an anti-cancer therapy.
17. The method of claim 1, wherein the biomarker is measured more than once.
18. The method of claim 1, wherein the subject has a diagnosis of stage 3 or stage 4 cancer.
19. A method of treating a subject undergoing anti-cancer immunotherapy, the method comprising: a. obtaining a biological sample from the subject, b. determining the level or activity of a biomarker in the biological sample, wherein the biomarker comprises markers of activation of the NLRP3-HSP70 axis, c. comparing the level or activity of the biomarker to a control and d. ceasing the administration of the anti-cancer immunotherapy if the level or activity of the biomarker is greater than the control.
20. A method of treating a subject who is refractory or not responding to immune checkpoint inhibitor therapy, the method comprising: a. obtaining a biological sample from the subject, b. determining the level or activity of a biomarker in the biological sample, wherein the biomarker comprises markers of activation of the NLRP3-HSP70 axis, c. comparing the level or activity of the biomarker to a control, d. administering an anti-cancer immunotherapy treatment to the subject if the level or activity of the biomarker is lower than that of the control in step (c) or not administering an anti-cancer immunotherapy to the subject if the biomarker is higher than the level in the control sample of step (c).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Non-limiting embodiments of the present invention will be described by way of example with reference to the accompanying figures, which are schematic and are not intended to be drawn to scale. In the figures, each identical or nearly identical component illustrated is typically represented by a single numeral. For purposes of clarity, not every component is labeled in every figure, nor is every component of each embodiment of the invention shown where illustration is not necessary to allow those of ordinary skill in the art to understand the invention.
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
DETAILED DESCRIPTION OF THE INVENTION
[0039] NLRP3 inflammasome has been shown to be involved in tumorigenesis. Germline genetic studies show NLRP3 is associated with elevated plasma HSP70 levels in advanced melanoma patients as well as inferior progress-free survival while undergoing immunotherapy. Importantly, the genetic profile of NLRP3 in a tumor can determine tumor response to anti-PD-1 immunotherapy. As shown herein, baseline markers of the tumor-intrinsic NLRP3-HSP70 signaling pathway correlate with resistance and disease hyperprogression in patients undergoing anti-PD-1 immunotherapy.
[0040] Some embodiments of the present disclosure provide a method for treating cancer in a subject selected for responsiveness to the treatment comprising obtaining a biological sample from the subject, b. determining the level or activity of a biomarker in the biological sample, wherein the biomarker comprises markers of activation of the NLRP3-HSP70 axis, comparing the level or activity of the biomarker to a control, classifying the subject for likelihood of clinical response to anti-cancer immunotherapy, wherein the levels of the biomarker correlates with anti-cancer immunotherapy efficacy; and administering anti-cancer immunotherapy to the subject wherein the level of the biomarker indicates the subject is likely to be responsive to the anti-cancer immunotherapy or administering an anti-cancer therapy other than immunotherapy wherein the level of the biomarker indicates the subject is unlikely to be responsive to the anti-cancer immunotherapy. Such methods may be used for determining whether a subject is at risk for not responding to an anti-cancer treatment.
[0041] In various embodiments, the present methods direct a clinical decision regarding whether a patient is to receive a specific treatment. In one embodiment, the present methods are predictive of a response to an anti-cancer immunotherapy. In various embodiments, the present invention directs the treatment of a cancer patient, including, for example, what type of treatment should be administered or withheld.
[0042] As used herein, the terms “anti-cancer immunotherapy”, “immune blockade therapy”, checkpoint inhibitor therapy” are used interchangeable and refers to those forms of cancer immunotherapies that target immune checkpoints, the key regulators of the immune system that when stimulated can dampen the immune response to an immunologic stimulus. Examples of such therapies include, but are not limited to, the use of anti-CTLA4, anti-PD-1, anti-PD-L1 and the like.
[0043] As is known in the art, a cancer is generally considered as uncontrolled cell growth. The methods of the present invention can be used to treat any cancer, and any metastases thereof, including, but not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, ovarian cancer, cervical cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, liver cancer, bladder cancer, hepatoma, colorectal cancer, uterine cervical cancer, endometrial carcinoma, salivary gland carcinoma, mesothelioma, kidney cancer, vulval cancer, pancreatic cancer, thyroid cancer, hepatic carcinoma, skin cancer, melanoma, brain cancer, neuroblastoma, myeloma, various types of head and neck cancer, acute lymphoblastic leukemia, acute myeloid leukemia, Ewing sarcoma and peripheral neuroepithelioma. In some embodiments, the cancer comprises melanoma, breast cancer, renal cell carcinoma, non-small cell lung cancer, colorectal cancer, Merkel cell carcinoma, gastroesophageal cancer, gastric cancer or pancreatic cancer.
[0044] As used herein, “treatment,” “therapy” and/or “therapy regimen” refer to the clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The aim of treatment includes the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder or condition. As used herein, the terms “prevent,” “preventing,” “prevention,” “prophylactic treatment” and the like refer to reducing the probability of developing a disease, disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disease, disorder or condition. The term “effective amount” or “therapeutically effective amount” refers to an amount sufficient to effect beneficial or desirable biological and/or clinical results.
[0045] For example, treating cancer in a subject includes the reducing, repressing, delaying or preventing cancer growth, reduction of tumor volume, and/or preventing, repressing, delaying or reducing metastasis of the tumor. Treating cancer in a subject also includes the reduction of the number of tumor cells within the subject. The term “treatment” can be characterized by at least one of the following: (a) reducing, slowing or inhibiting growth of cancer and cancer cells, including slowing or inhibiting the growth of metastatic cancer cells; (b) preventing further growth of tumors; (c) reducing or preventing metastasis of cancer cells within a subject; and (d) reducing or ameliorating at least one symptom of cancer. In some embodiments, the optimum effective amount can be readily determined by one skilled in the art using routine experimentation. In some embodiments, the treatment is immunotherapy. As used herein, immunotherapy is treatment that uses a person's own immune system to fight cancer. Immunotherapy can boost or change how the immune system works so it can find and attack cancer cells. Immunotherapy may also use substances made by the body or in a laboratory to boost the immune system and help the body find and destroy cancer cells. Immunotherapy can be used alone or in combination with other cancer treatments. Immunotherapy may also be called immune therapy and may include immune checkpoint therapy or immune blockade therapy. In some embodiments, the immunotherapy comprises a PD-1 inhibitor or a PD-L1 inhibitor. In some embodiments, the therapy may comprise an NLRP3 inhibitor.
[0046] A “subject in need thereof” as utilized herein may refer to a subject in need of treatment for a disease or disorder associated with a suspected tumor, such as a tumor. A subject in need thereof may include a subject having a cancer that is characterized by gross abnormality visible by X-ray, computerized tomography (CT), or magnetic resonance imaging (MM), but which has not been diagnosed as a tumor by histology or immunofluorescence. In some embodiments, the tumor comprises a skin cancer. In some embodiments, the tumor comprises melanoma. In some embodiments, the tumor comprises a primary tumor and one or more tumors in secondary sites. In some embodiments the secondary site are metastatic sites. In some embodiments, the tumor is a melanoma and the metastatic site is the lymph node, brain, bone, liver or lungs.
[0047] The term “subject” may be used interchangeably with the terms “individual” and “patient” and includes human and non-human mammalian subjects.
[0048] Some embodiments of the preset disclosure provide a method of determining whether a subject is at risk for developing disease hyperprogression when undergoing treatment with an anti-cancer immunotherapy. Hyperprogression the accelerated, or more rapid than expected, growth or progression of a cancer after treatment is initiated. Hyperprogression is a tumor response in which the existing underlying tumor grows rapidly after initiating treatment, wherein the treatment is typically an immune checkpoint inhibitor.
[0049] Some embodiments of the preset disclosure provide methods of treating a subject who is refractory or not responding to immune checkpoint inhibitor therapy. These subjects may not respond to immune checkpoint therapy or may develop a secondary resistance to the immune therapy over time.
[0050] Some embodiments of the present disclosure provide a method of determining whether a subject is at risk of not responding to an anti-cancer immunotherapy treatment, at risk for developing disease hyperprogression or a subject who is refractory or not responding to immune checkpoint inhibitor therapy, the method comprising obtaining a biological same from the subject. The term “biological sample” as used herein includes, but is not limited to, a sample containing tissues, cells, and/or biological fluids isolated from a subject. Examples of biological samples include, but are not limited to, tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, mucus and tears. A biological sample may be obtained directly from a subject (e.g., by blood or tissue sampling) or from a third party (e.g., received from an intermediary, such as a healthcare provider or lab technician).
[0051] Some embodiments of the present disclosure provide a method of determining whether a subject is at risk of not responding to an anti-cancer immunotherapy treatment, at risk for developing disease hyperprogression or a subject who is refractory or not responding to immune checkpoint inhibitor therapy, the method comprising obtaining a biological same from the subject and determining the level or activity of a biomarker in the biological sample, wherein the biomarker comprises markers detecting activation of the NLRP3-HSP70 axis. Determining the level or activity of a biomarker in the sample includes, but is not limited to, measuring the amount or expression of biomarker protein, DNA or RNA. Techniques to measure protein, DNA and RNA are known in the art. In addition to the amount or expression, a biomarker may also be measured by a functional or other such property such as its activity, binding, solubility, size, weight, denaturation, amphoteric nature, optical activity, charge, sequence or reactive properties. Markers detecting activation of the NLRP3-HSP70 axis, include but are not limited to HSP70, NLRP3, Wnt5a, TLR4, CXCR2
[0052] In particular embodiments, the biomarker is HSP70. HSP70 is a Heat shock protein (HSP) which are expressed in response to various biological stresses, including high temperatures. There are several major families of HSPs that include HSP70, there are HSP90 and HSP100. The HSP70 family is a set of highly conserved proteins that are induced by a variety of biological stresses, including heat stress, in every organism in which the proteins have been examined. The human HSP70 family members include: HSP70, a protein which is strongly inducible in all organisms but which is also constitutively expressed in primate cells. In conjunction with other heat shock proteins, HSP70 stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and organelles. HSP70 is also involved in the ubiquitin-proteasome pathway through interaction with the AU-rich element RNA-binding protein 1.
[0053] The inventors have found elevated levels of HSP70 in the plasma of melanoma patients undergoing anti-PD-1 immunotherapy to be associated with resistance to this treatment modality. Accordingly, one aspect of the present disclosure provides a method of determining whether a subject is at risk of not responding to an anti-cancer immunotherapy treatment based on HSP70 as a biomarker.
[0054] Additional germline genetic studies performed by the inventors focused on a single nucleotide polymorphism (SNP) of NLRP3. These studies have demonstrated the affect allele of this SNP to be associated with both elevated plasma HSP70 levels in advanced melanoma patients as well as in inferior progress-free survival while undergoing anti-PD-1 immunotherapy. The NLRP3 polymorphism is SNP ID: rs12239046 Polymorphism: C/T, Transition Substitution Context Sequence: TTTTAGGTCACTACTTAGTCTTTCC[C/T]GCTAATGTTATAGCTTCCCCCTCCC (SEQ ID NO: 1). Many genetic alterations involving both NLRP3 itself as well as several of its regulators have been identified and associated with both inflammatory conditions as well as various malignancies. Based on the data provided herein and gathered by the inventors, it is believed that the genetic profile of the NLRP3 inflammasome pathway in any given tumor can determine whether a tumor does or does not respond to anti-PD-1 immunotherapy. Since there can be multiple genetic alterations in numerous regulators of this pathway that ultimately impact the signaling activity of the NLRP3 inflammasome. Embodiments of the present disclosure further comprise functional activity assays capable of measuring the NLRP3 activation state in tumor tissues (for both germline and somatic mutations) as well as in peripheral blood mononuclear cells (germline only). The later assay would be blood-based and significantly more practical for clinical use. We expect for patients demonstrating either elevated NLRP3 activity based on this test and/or to possess genetic alterations in this signaling pathway predicted to enhance it's signaling activity to be less likely to respond to anti-PD-1 immunotherapy.
[0055] Additionally, the data provided herein shows that this same pathway promotes the accumulation of granulocytic myeloid-derived suppressor cells in distant tissues as well, thus establishing a pre-metastatic niche that promotes metastatic progression in distant organs. In line with these findings, the inventors have also found patients demonstrating evidence of disease hyperprogression in response to anti-PD-1 immunotherapy to also have a significant elevation in the baseline levels of plasma HSP70. Thus, other embodiments of the present disclosure provide that elevated NLRP3 activation scores based on the methods provided herein and/or genetic alterations involving this signaling pathway that are predicted to enhance its activation, indicate that a particular patient would be at increased risk for developing disease hyperprogression when undergoing treatment with anti-PD-1 therapy.
[0056] Biomarkers may be measured by any means known in the art. These include, but are not limited to polymerase chain reaction, reverse transcriptase polymerase chain reaction, quantitative reverse transcriptase polymerase chain reaction, Western blot, sequencing, southern blot, northern blot, enzyme linked immunosorbent assay, immunostaining, proximity ligation assay and/or fluorescent in-situ hybridization. A proximity ligation assay may be performed with NLRP3/NALP3 and apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) as targets. In some embodiments, the biomarker may be evaluated or measured using Q-RT-PCR, Western blot, RNA sequencing, proteomic studies, sequencing, fluorescent in situ hybridization (FISH), ELISA, immunostaining, or proximal ligation assay.
[0057] Some embodiments of the present disclosure provide a method of determining whether a subject is at risk of not responding to an anti-cancer immunotherapy treatment, at risk for developing disease hyperprogression or a subject who is refractory or not responding to immune checkpoint inhibitor therapy, the method comprising obtaining a biological same from the subject and determining the level or activity of a biomarker in the biological sample, wherein the biomarker is HSP70 and comparing the level of activity of the biomarker to a control. A control may be a subject who is not undergoing treatment or evaluation for the disease the subject is need it. A control may be a healthy subject, who does not have a diagnosis of cancer, or healthy tissue.
[0058] Some embodiments of the present disclosure provide a method of determining whether a subject is at risk of not responding to an anti-cancer immunotherapy treatment, at risk for developing disease hyperprogression or a subject who is refractory or not responding to immune checkpoint inhibitor therapy, the method comprising obtaining a biological same from the subject and determining the level or activity of a biomarker in the biological sample, wherein the biomarker is HSP70, comparing the level of activity of the biomarker to a control and administering an anti-cancer immunotherapy treatment to the subject if the level or activity of the biomarker is lower than that of the control in or not administering an anti-cancer immunotherapy to the subject if the level of the biomarker is higher than the level in the control sample. An anti-cancer immunotherapy can be any known anti-cancer treatment immunotherapy known in the art. In some embodiments, the anti-cancer immunotherapy comprises immune blockade therapy or an immune checkpoint inhibitor. In some embodiments, the anti-cancer immunotherapy comprises a PD-1 inhibitor or a PD-L1 inhibitor.
[0059] Some embodiments of the present disclosure provide a method of determining whether a subject is at risk of not responding to an anti-cancer immunotherapy treatment, at risk for developing disease hyperprogression or a subject who is refractory or not responding to immune checkpoint inhibitor therapy, the method comprising obtaining a biological same from the subject and determining the level or activity of a biomarker in the biological sample, wherein the biomarker is HSP70, comparing the level of activity of the biomarker to a control and administering an anti-cancer immunotherapy treatment to the subject based on the biomarker. In some embodiments, the method further comprises administering an NLRP3 inhibitor. Examples of a NLRP3 inhibitors include, but are not limited to antibodies, small molecules, peptides, miRNAs, siRNAs, oligonucleotides, cytokines or agonists. NLRP3 inhibitors further include, but are not limited to pembrolizumab, Z-VAD-FMK, MCC950, Resveratrol, Arglabin, CB2R agonist, miRNA-223, beta-hydroxybutyrate (BHB), Type I interferon (IFN-beta), JC124, CY09, dapansutrile (OLT1177).
[0060] The anti-cancer therapies described herein may be combined with other known therapies as necessary to treat the subject in need.
[0061] Another aspect of the present disclosure provides a kit for the prognosis, diagnosis, or prediction of a subject's response to anti-cancer immunotherapy comprising, consisting or, or consisting essentially of: (a) a means for analyzing the biomarker, wherein the biomarker comprises HSP70; (b) a control; and (c) instructions for use.
[0062] In some embodiments, the kits may comprise a plurality of primers or probes, primary or secondary antibodies, oligonucleotides, templates, a negative control, positive control, nucleotides, amplification medium, preservatives or buffers to detect or measure the biomarker.
[0063] In some embodiments, the kit includes a packaging material. As used herein, the term “packaging material” can refer to a physical structure housing the components of the kit. In some instances, the packaging material maintains sterility of the kit components, and is made of material commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampules, etc.). Other materials useful in the performance of the assays are included in the kits, including test tubes, transfer pipettes, and the like. In some cases, the kits also include written instructions for the use of one or more of these reagents in any of the assays described herein.
Miscellaneous
[0064] Unless otherwise specified or indicated by context, the terms “a”, “an”, and “the” mean “one or more.” For example, “a molecule” should be interpreted to mean “one or more molecules.”
[0065] As used herein, “about”, “approximately,” “substantially,” and “significantly” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, “about” and “approximately” will mean plus or minus ≤10% of the particular term and “substantially” and “significantly” will mean plus or minus >10% of the particular term.
[0066] As used herein, the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising.” The terms “comprise” and “comprising” should be interpreted as being “open” transitional terms that permit the inclusion of additional components further to those components recited in the claims. The terms “consist” and “consisting of” should be interpreted as being “closed” transitional terms that do not permit the inclusion additional components other than the components recited in the claims. The term “consisting essentially of” should be interpreted to be partially closed and allowing the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter.
[0067] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0068] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0069] Preferred aspects of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred aspects may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect a person having ordinary skill in the art to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
EXAMPLES
[0070] The following Examples are illustrative and should not be interpreted to limit the scope of the claimed subject matter.
Example 1—Tumor-intrinsic NLRP3-HSP70-TLR4 Axis Drives Pre-Metastatic Niche Development and Hyperprogression During Anti-PD-1 Immunotherapy
[0071] Reference is made to the manuscript: Theivanthiran et al., “Tumor-intrinsic NLRP3-HSP70-TLR4 Axis Drives Pre-Metastatic Niche Development and Hyperprogression During Anti-PD-1 Immunotherapy,” the content of which is incorporated herein by reference in its entirety.
[0072] Tumor-Intrinsic NLRP3 Drives PMN-MDSC Accumulation in Distant Tissues.
[0073] Prior studies have described elevated numbers of circulating neutrophils in tumor-bearing mice relative to healthy controls (22). Consistent with these findings, we also identified a significant increase in a CD45.sup.+CD11b.sup.+Ly6G.sup.+Ly6C.sup.loF4/80.sup.− cell population in the lung tissues of transgenic BRAF.sup.V600EPTEN.sup.−/− mice harboring primary melanomas relative to those BRAF.sup.V600EPTEN.sup.−/− mice with no active disease (
[0074] HSP70 Triggers a TLR4-Wnt5a Signaling Axis in Lung Epithelial Tissues to Promote PMN-MDSC Accumulation in the Lung
[0075] Despite prior reports indicating that the NLRP3 inflammasome can stimulate IL-1β production by melanoma cells, our previous studies have indicated that murine melanoma IL-1β levels are negligible relative to IL-1β production by myeloid cell populations in response to NLRP3 inflammasome activation (
[0076] A TLR4-Wnt5a Signaling Axis in Lung Epithelial Tissues Promotes Pulmonary Metastatic Progression
[0077] Prior studies have shown gain-of-function polymorphisms of TLR4 to associate with increased metastatic progression and inferior survival in cancer patients (13, 30, 31). In addition, recent work has further described a role for PMN-MDSCs in establishing a microenvironment in tissues that is more conducive to metastatic progression (1). Based on these findings, we investigated the role of lung epithelial TLR4 signaling in metastatic progression to the lung. We there implanted the BRAF.sup.V600EPTEN.sup.−/− melanoma cell line by subcutaneous injection into syngeneic SPC-TLR4.sup.−/− and TLR4.sup.fl/fl control hosts and resected the primary melanoma tissues before harvesting the lungs three weeks later. While the primary tumor tissues exhibited no difference in weight between SPC-TLR4.sup.−/− and TLR4.sup.fl/fl control mice, lung tissues derived from SPC-TLR4.sup.−/− mice were associated with diminished expression levels of the tyrosine-related peptide-2 (TRP2) melanoma antigen based on both TRP2 immunohistochemistry (IHC) and a previously developed TRP2-targeted qrt-PCR assay for quantifying melanoma metastases (
[0078] The delivery of tumor cells via tail vein injection circumvents critical steps in the process of metastasis, representing a more artificial system for studying tumor progression. We therefore turned to tumor models capable of spontaneously metastasizing to the lung, including the BRAF.sup.V600ECDKN2A.sup.−/−PTEN.sup.−/− (YUMM1) melanoma model as well as a tumor model of a different histology, the E0771 breast adenocarcinoma model (33, 34). Our findings in each of these additional models further confirmed our prior data, demonstrating a critical role for lung epithelial TLR4 signaling in driving PMN-MDSC accumulation and metastatic progression to the lung and verify that this phenomenon is not restricted to BRAF.sup.V600EPTEN.sup.−/− melanomas (
[0079] Prior studies have shown that the arrival of hematopoietic cell populations (HPC) expressing vascular endothelial growth factor receptor-1 (VEGFR1) in the lung as well as increased fibronectin expression by local fibroblasts contribute to the formation of a pre-metastatic niche that subsequently supports metastatic progression (35). Using multi-parameter flow cytometry, we indeed observed an increase in a c-kit.sup.+CD133.sup.+CD34.sup.+VEGFR1.sup.+ HPC (VEGFR1.sup.+ HPC) population in mice harboring BRAF.sup.V600EPTEN.sup.−/− melanomas relative to non-tumor-bearing controls. The accumulation of this VEGFR1.sup.+ HPC population was also found to be dependent upon lung epithelial TLR4 expression and to be enhanced by tumor-intrinsic NLRP3 inflammasome activation (
[0080] Anti-PD-1 Immunotherapy Drives PMN-MDSC Accumulation in the Lung Via the Tumor-Intrinsic NLRP3-HSP70 Axis
[0081] We previously demonstrated that anti-PD-1 immunotherapy promotes the recruitment of PMN-MDSCs into the primary tumor bed by inducing the activation of a tumor-intrinsic NLRP3 inflammasome-HSP70 signaling axis (
[0082] The Tumor-Intrinsic NLRP3-HSP70 Axis can Facilitate Disease Hyperprogression in Response to Anti-PD-1 Immunotherapy
[0083] Prior studies have described disease hyper-progression (HPD) occurring in response to anti-PD-1 immunotherapy, a phenomenon estimated by some authors to develop in ˜10% of all solid tumors (5). In HPD, tumor burden can dramatically increase in response to exposure to anti-PD-1 immunotherapy. Given our prior data describing a role for the tumor-intrinsic NLRP3-HSP70 signaling axis as an important driver of PMN-MDSC accumulation in distant lung tissues in response to anti-PD-1 immunotherapy, we hypothesized that this same tumor-intrinsic signaling pathway can establish an immunologic environment capable of facilitating HPD. To address this question, we first treated transplanted syngeneic BRAF.sup.V600EPTEN.sup.−/− melanomas with anti-PD-1 therapy. This approach suppressed primary BRAF.sup.V600EPTEN.sup.−/− melanoma growth as previously observed (36, 37). However, if we subsequently transplanted these same mice harboring anti-PD-1-treated BRAF.sup.V600EPTEN.sup.−/− melanomas with the YUMM1 melanoma model, we observed evidence of more rapid disease progression relative to those mice previously treated with IgG control antibody (
[0084] Together, these data suggest that the tumor NLRP3-HSP70 axis can promote metastatic progression in response to anti-PD-1 immunotherapy under select conditions. Our prior work has demonstrated that this signaling axis contributes to an adaptive resistance mechanism to checkpoint inhibitor immunotherapy (19). Therefore, based on these data, we propose that adaptive mechanisms of anti-PD-1 resistance can evolve into HPD when this mechanism overwhelms the cytolytic T cell response. Whether specific germline or somatic genetic alterations impacting the NLRP3 signaling pathway are necessary to facilitate this response to anti-PD-1 therapy is unclear.
[0085] Genetic Amplification of NLRP3 Promotes Disease Hyperprogression in Response to Anti-PD-Immunotherapy
[0086] Many tumors exhibit elevated NLRP3 expression levels relative to their normal tissue counterparts (20). Indeed, amplification of NLRP3 has been identified in several solid tumor types (
[0087] It is noteworthy that we also found BRAF.sup.V600EPTEN.sup.−/− melanomas to exhibit an elevation in NLRP3 expression in response to anti-PD-1 therapy both in vitro and in vivo, an effect that was enhanced by IFN-γ and reversed by the ablation of CD8.sup.+ T cells (
[0088] The HSP70-TLR4 Signaling Axis in Lung Epithelial Tissues Supports Primary Tumor Progression and Anti-PD-1 Immunotherapy Resistance
[0089] During the course of our studies, we found that primary melanomas responded more favorably to anti-PD-1 immunotherapy in SPC-TLR4.sup.−/− hosts relative to TLR4.sup.fl/fl control mice (
[0090] Activation of the Tumor-Intrinsic NLRP3-HSP70 Axis is Associated with Hyperprogression in Melanoma Patients Undergoing Anti-PD-1 Immunotherapy
[0091] Based on our cumulative results suggesting a mechanistic link between the tumor intrinsic NLRP3-HSP70 axis and metastatic progression in response to anti-PD-1 immunotherapy, we measured baseline plasma HSP70 levels in advanced melanoma patients undergoing checkpoint inhibitor immunotherapy and evaluated these levels in terms of treatment response. While previous studies have defined HPD based on differential tumor growth rate (TGR) measurements before and after the initiation of checkpoint inhibitor therapy, prior imaging studies for many of our patients to define TGR prior to treatment initiation were not available. As a result, we utilized RECIST1.1 criteria to define HPD based on a two-fold increase in tumor burden within 2-3 months of anti-PD-1 initiation. This analysis demonstrated a significant increase in baseline HSP70 levels in those melanoma patients experiencing HPD while undergoing anti-PD-1 immunotherapy (
[0092] Discussion
[0093] We previously described an adaptive resistance mechanism driven by the tumor-intrinsic NLRP3-HSP70 signaling axis that promotes the recruitment of PMN-MDSCs into the tumor microenvironment and suppresses local cytolytic CD8.sup.+ T cell activity in response to anti-PD-1 immunotherapy. We now demonstrate that the tumor-intrinsic NLRP3-HSP70 signaling axis can also induce the accumulation of PMN-MDSCs in distant tissues, thereby establishing a niche facilitating metastatic disease progression. Using an inducible lung epithelial cell-specific TLR4 knockout mouse model, we show this effect to be dependent upon tumor-derived HSP70 and its ability to trigger a distant TLR4-dependent Wnt5a-CXCL5/G-CSF signaling cascade capable of driving both PMN-MDSC granulopoiesis and recruitment into pulmonary tissues. Given that this mechanism is activated by anti-PD-1 immunotherapy, we conducted additional studies to determine whether this tumor NLRP3-HSP70-TLR4 axis could support the development of HPD. Indeed, pre-clinical tumor models of both melanoma and breast adenocarcinoma as well as clinical studies in advanced melanoma patients indicates that this pathway serves as a driver of HPD. While this work is consistent with previous findings that have implicated various myeloid cell populations as playing a critical role in promoting metastatic disease progression, it also highlights HSP70 as a previously undescribed soluble factor released by tumors that systemically drive PMN-MDSC accumulation (21). This relationship between circulating PMN-MDSCs or neutrophils and HPD has been described in previous studies although the underlying mechanisms linking these phenomena have not been elucidated (44). Just as we have shown HSP70 to signal through TLR4 to upregulate Wnt5a signaling via an autocrine tumor-intrinsic mechanism in a prior study, this current work shows circulating levels of HSP70 to induce the TLR4-Wnt5a-CXCL5/G-CSF signaling cascade in distant lung epithelial cells (19). These findings are also consistent with prior studies implicating TLR polymorphisms and signaling to support the establishment of pulmonary metastases (13, 45). These findings are interesting to consider in light of a recent retrospective study that found respiratory diseases and elevated neutrophil/lymphocyte ratios to be associated with disease progression in stage IV melanoma patients undergoing anti-PD-1 immunotherapy (46). Overall, these findings suggest that there is a continuum between mechanisms of adaptive resistance and disease hyperprogression in those patients undergoing checkpoint inhibitor immunotherapy.
[0094] While previous work has described several TDSFs capable of harnessing myeloid cell populations for pre-metastatic niche development in distant tissues, the underlying mechanisms driving the release of these factors have not been well described. Even less is understood regarding how therapeutic interventions modulate the release of TDSFs. Herein, we describe the underlying mechanism linking anti-PD-1 immunotherapy with tumor-dependent production of a TDSF capable of promoting metastatic progression in the lung via TLR4-dependent signaling. Whether this same mechanism can generate a pre-metastatic niche in other distant organ tissues requires further experimental investigation. To date, our data indicates that the tumor-intrinsic NLRP3 inflammasome stimulates this pathway in a similar manner across several different tumor types however additional studies based on clinical specimens are necessary to determine whether this same mechanism can also drive metastatic progression in other patient populations.
[0095] It is noteworthy that our work has identified two pathways by which the tumor NLRP3-HSP70-TLR4 pathway promotes the accumulation of PMN-MDSCs in distant tissues to establish the pre-metastatic niche necessary for metastatic progression. Indeed, tumor-dependent HSP70 drives the upregulation of both G-CSF and CXCL5 by triggering TLR4 signaling in the lung epithelium. Together, this mechanism drives the release of PMN-MDSCs into the circulation while also establishing a chemokine gradient capable of recruiting these PMN-MDSCs into pulmonary tissues. Interestingly, these studies also revealed this G-CSF-dependent mechanism to induce significant PD-1 upregulation by this circulating PMN-MDSC population, a finding suggesting the development of a potential sink for therapeutic anti-PD-1 antibodies and an additional mechanism by which the tumor NLRP3-HSP70-TLR4 axis can contribute to adaptive resistance to anti-PD-1 immunotherapy. Previous studies have implicated the accumulation of a c-kit.sup.+CD133.sup.+CD34.sup.+VEGFR1.sup.+ HPC population along with enhanced fibronectin expression in the extra-cellular matrix (ECM) as key components necessary for the evolution of the lung pre-metastatic niche (35). Interestingly, this current study further demonstrates that the tumor NLRP3 inflammasome as well as lung epithelial TLR4 signaling both support the accumulation of this HPC population in pulmonary tissues. Similar to a previous study linking Wnt5a with enhanced fibronectin expression in the lung, this study also shows that lung epithelial TLR4 as well as Wnt ligand signaling both contribute to fibronectin accumulation within the lung ECM (47). Together, these data indicate that the tumor NLRP3-HSP70-TLR4 axis represents an early step in establishing the pre-metastatic niche and therefore highlights this pathway as a target for preventing metastatic progression.
[0096] Prior studies have concluded that NLRP3 activation in melanoma cells elicits the secretion of the IL-1β pro-inflammatory cytokine (26, 27, 48). However, we have found the activation of the tumor-intrinsic NLRP3 inflammasome to promote much higher levels of HSP70 secretion relative to IL-1β based on both in vitro and in vivo studies in mice and humans. Indeed, our work indicates that IL-1β secretion in response to NLRP3 activation is more prominent relative to HSP70 in myeloid cells such as dendritic cells, suggesting that the HSP70 mediator is more specific to tumor NLRP3 inflammasome activity relative to IL-1β. These observations indicate that HSP70 represents a promising pharmacologic target for suppressing metastatic progression and enhancing anti-tumor immunity. This is consistent with our pre-clinical data demonstrating that an antagonistic antibody specific to HSP70 robustly suppresses PMN-MDSC levels in tumor tissues and inhibits disease progression in a treatment refractory autochthonous model of melanoma.
[0097] In addition to characterizing how the tumor-intrinsic NLRP3 inflammasome pathway contributes to metastatic disease progression and demonstrating that this process is driven by PD-1 blockade in various pre-clinical tumor models, we also present data illustrating that quantitative measures of this pathway correlate with disease HPD in advanced melanoma patients undergoing anti-PD-1 immunotherapy. After defining HPD in our patient cohort as a two-fold increase in overall tumor burden by week 12 of therapy, we found that baseline plasma levels of HSP70 were significantly elevated in HPD patients relative to responding patients as well as those patients with stable or progressive disease without evidence of hyperprogression. Importantly, we then interrogated melanoma tissue specimens using a proximity ligation assay capable of quantifying NLRP3-ASC binding as a surrogate for activation of the NLRP3 inflammasome. This approach also verified that those tumors exhibiting enhanced levels of NLRP3 activation at baseline developed HPD following the initiation of anti-PD-1 immunotherapy. Whiles these studies require validation in a larger cohort of patients, these findings 1) further substantiate the NLRP3-HSP70 signaling pathway as an important driver of HPD in response to anti-PD-1 immunotherapy and 2) indicate that assays to quantitate the level of NLRP3-HSP70 signaling activation can be employed to identify those patients at risk for developing HPD as a complication of anti-PD-1 checkpoint inhibitor immunotherapy. While the definition and incidence of HPD associated with anti-PD-1 immunotherapy continues to be debated, it clearly represents a devastating side-effect of our immunotherapy arsenal. By providing an underlying mechanism responsible for driving HPD, these areas of controversy can be resolved by further clinical studies in melanoma as well as other solid tumors.
[0098] It is tempting to speculate that genetic alterations that serve to enhance the activity of the tumor-intrinsic NLRP3 inflammasome will promote the described adaptive resistance mechanism and perhaps drive HPD in response to checkpoint inhibitor immunotherapies (49, 50). In light of the percentage of tumors exhibiting NLRP3 amplification, this genetic alteration may contribute to the development of this phenotype in various solid tumors treated with anti-PD-1 immunotherapy (38). Our pre-clinical modeling studies presented here have confirmed that this mechanism could contribute to such a response to checkpoint inhibitor immunotherapy. Whether other somatic or germline mutations involving NLRP3 itself or its various regulators may also enhance the activation of this pathway in response to checkpoint blockade remains unknown but is currently under investigation.
[0099] Together, this work provides insight into the importance of the tumor-intrinsic NLRP3-HSP70 signaling axis in regulating PMN-MDSCs within distant tissues while also highlighting its critical role in modulating responses to immunotherapy. Additional studies are now ongoing to 1) better understand the regulation of this pathway in tumors and how these mechanisms may dictate how a tumor responds to anti-PD-1 immunotherapy and 2) determine whether targeting HSP70 may be an effective strategy for overcoming resistance to anti-PD-1 immunotherapy. Overall, these data describe an adaptive resistance mechanism to anti-PD-1 immunotherapy capable of supporting HPD in select settings. Future clinical studies are warranted to test whether markers associated with the NLRP3-HSP70 signaling axis can be used to predict those melanoma patients at risk for developing HPD in response to anti-PD-1 immunotherapy while also investigating the role of the tumor NLRP3-HSP70 signaling axis in other cohorts of cancer patients.
[0100] Materials and Methods
[0101] Study Design
[0102] The primary objective of this work was to investigate the role of the tumor-intrinsic NLRP3 inflammasome and its downstream effector, HSP70, in PMN-MDSC-mediated pre-metastatic niche development in distant tissues and to determine whether this pathway may also contribute to the development of HPD in response to checkpoint inhibitor immunotherapy. The overall goal was to identify novel pharmacologic targets as well as biomarkers capable of improving our ability to detect those patients at risk for developing HPD and to improve our management of this complication associated with checkpoint inhibitor immunotherapy. The study included laboratory-controlled in vitro cell culture experiments, in vivo animal experiments, studies utilizing clinical specimens derived from stage IV melanoma patients undergoing anti-PD-1 immunotherapy, as well as in silico analysis of an existing tumor tissue database. The impact of the tumor-intrinsic NLRP3 inflammasome on 1) PMN-MDSCs was measured based on both flow cytometry, cytology, IHC, IF, and qrt-PCR analysis, 2) tumor progression and metastasis was measured based on primary tumor size measurements, primary tumor weight, lung weight, H&E microscopy, qrt-PCR, IHC, cell proliferation, and cell invasion assays. Activation of the NLRP3 pathway was measured using Western blot, qrt-PCR, ELISA, and a NLRP3-ASC PLA. Mice were treated with pharmacologic inhibitors of the NLRP3 inflammasome and HSP70 while PMN-MDSCs were ablated by antibody-dependent cellular cytotoxicity. The NLRP3-HSP70 signaling axis was manipulated using both CRISPR/Cas9 and CRISPRa while TLR4 was genetically deleted specifically in lung epithelial cells and NLRP3 was deleted systemically using transgenic mouse systems. For animal experiments, an even distribution of male and female mice was randomly assigned into treatment groups. Sample size was determined based on an alpha probability of 0.05, a power of 0.8 and an effect of at least 1.2×SD. Preliminary in vivo studies have shown that sample sizes need to be at least 6 or greater per group in syngeneic tumor model systems while 8 or greater are necessary in autochthonous tumor model systems. Notably, fewer sample numbers per group were found to be sufficient depending on analysis endpoints. All experiments were performed independently at least three times. All experiments were conducted in a blinded fashion where analysis was independent of any intervention when feasible. All outliers have been included in the data presented.
[0103] Clinical Samples
[0104] All patients provided written informed consent for use of biological specimens on an ongoing institutional review board-approved clinical specimen acquisition protocol at Duke Cancer Institute designed to investigate immunotherapy resistance (NCT02694965). Baseline (week 0) FFPE tissues were collected from 35 untreated stage IV melanoma patients and baseline plasma samples were collected from 80 untreated stage IV melanoma patients prior to initiating anti-PD-1 monotherapy at Duke Cancer Institute. Treatment response at week 12 and every 12 weeks thereafter was determined based on independent radiologic review of computed tomography (CT) imaging using RECIST1.1 criteria. HPD was defined as a ≥2-fold increase in total tumor burden by week 12 CT imaging.
[0105] Animal Studies
[0106] C57BL/6J (C57, H-2.sup.b) (Stock number: 000664), B6.CgBraf.sup.tm1MmcmPten.sup.tm1HwuTg(Tyr-cre/ERT2)13Bos/BosJ (Braf.sup.V600EPten.sup.−/−, H-2.sup.b) (Stock number 012328), B6(Cg)-Tlr4.sup.tm1.2Karp/J(TLR4.sup.fl/fl; Stock number: 24872), B6.129S-Sftpc.sup.tm1(cre/ERT2)Blh/J(SPC-CreER.sup.T2) (Stock number: 28054) and C57BL/6Tg(TcraTcrb)1100Mjba (OT-1, H-2.sup.b) (Stock number: 003831) mice were obtained from Jackson Labs. Dr. Mari Shinohara (Duke University) generously provided B6.129S6-Nlrp3.sup.tm1Bhk/J(NLRP3KO) mice. SPC-Cre-ER.sup.T2 mice were crossed with TLR4.sup.fl/fl mice to generate SPC-Cre-ER.sup.T2/TLR4.sup.fl/fl offspring (SPC-TLR4.sup.−/−). Conditional knock-out of Tlr4 was confirmed via PCR per protocol provided by Jackson Laboratory as well as flow cytometry. Mice were treated with 100 μl tamoxifen (Sigma-Aldrich, CAS #10540-29-1, 20 mg/mL) via i.p. delivery daily×5 consecutive days for a total dose of 75 mg/kg (51). All experimental groups included randomly chosen littermates of both sexes, ages 6-10 weeks, and of the same strain. All animal experiments were performed based on a protocol approved by the Institutional Animal Care and Use Committee at Duke University Medical Center.
[0107] Autochthonous Tumor Studies
[0108] B6.Cg-Braf.sup.tm1Mmcm Pten.sup.tm1Hwu Tg(Tyr-cre/ERT2 H-2.sup.b)13Bos/BosJ transgenic mice were subdermally injected with 4-Hydroxytamoxifen (4-HT) (Sigma, H6278-50MG CCF, 38.75 μg/mouse) to induce primary melanoma development at the base of the tail. Mice were randomly assigned to treatment cohorts until tumor volumes reached 64 mm.sup.3 (36, 37, 52). For select experiments, mice were treated with the following agents: NLRP3 inhibitor, MCC950 (Invivogen, inh-mcc) 10 mg/kg intra-peritoneal injection (i.p.) every other day, anti-PD1 ab (BioXCell, BE0146) or rat IgG2a isotype control (BioXCell, BE0089) at 200 μg i.p. every 3 days, anti-Ly6G ab (BioXCell, BE0075-1), initial dose at 200 μg/mouse followed by 100 μg/mouse/day×2, HSP70 monoclonal antibody (3A3, MA3-006) at 5 μg i.p. every 3 days. Primary tumor volumes were monitored by orthogonal caliper measurements every 3 days. Tumor volume was calculated according to the formula: cm.sup.3=[(length, cm)×(width, cm).sup.2]/2.
[0109] Syngeneic Tumor Studies.
[0110] BRAF.sup.V600EPTEN.sup.−/−, BRAF.sup.V600EPTEN.sup.−/−NTC, BRAF.sup.V600EPTEN.sup.−/−-NLRP3.sup.KD, BRAF.sup.V600EPTEN.sup.−/−-NLRP3a, BRAF.sup.V600EPTEN.sup.−/−-Ctrl, BRAF.sup.V600ECDKN2A.sup.−/−PTEN.sup.−/− cell lines (0.5×10.sup.5 to 1×10.sup.6 cells) were implanted by s.c. injection into the base of the tail or chest of syngeneic C57BL/6 mice. The E0771 cell line (0.25×10.sup.6 to 0.5×10.sup.6) was injected into the mammary fat pad of syngeneic C57BL/6 mice in 0.1 mL sterile saline using a 27G needle. Tumor growth was monitored by caliper measurement every 3 days, and treatment was initiated when tumor volumes reached 64 mm.sup.3 or 90 mm.sup.3 depending on the study. Once tumor volume reached 500-600 mm.sup.3 in select experiments, mice were anesthetized using 2% isoflurane via an anesthesia mask and primary tumor tissues were resected as previously described (53). Wounds were managed with surgical clips and an antiseptic iodine solution was applied to the site. Following surgery, animals were monitored under a heat lamp until fully recovered.
[0111] Cell Lines and Culture Conditions
[0112] BRAF.sup.V600EPTEN.sup.−/−-NLRP3a and BRAF.sup.V600EPTEN.sup.−/−-Ctrl cell lines were generated using the established CRISPR amplification technique (54). The NLRP3 and control CRISPR activation plasmids (SantaCruz, sc-432122-ACT) were packaged into a lentiviral vector in HEK293T cells as previously prescribed (55). Clones were selected using a combination of antibiotics including puromycin (SantaCruz, sc-108071), hygromycin B (SantaCruz, sc-29067), and blasticidin S HCL (SantaCruz, sc-495389). BRAF.sup.V600EPTEN.sup.−/−-NLRP3.sup.KD and BRAF.sup.V600EPTEN.sup.−/−-NTC cell lines were generated as described previously (19). The BRAF.sup.V600EPTEN.sup.−/− (male, BPD6) cell line was also generated previously (36). Stable cell lines were selected by puromycin resistance (Sigma-Aldrich, P8833). MLE12(CRL-2110) and BRAF.sup.V600ECDKN2A.sup.−/−PTEN.sup.−/− (YUMM1, CRL-3363) cell lines were purchased from ATCC. The EO771 mammary tumor cell line was generously provided by Dr. Donald McDonnell (Duke University). All BRAF.sup.V600EPTEN.sup.−/− cell lines and E0771 were maintained at 37° C. in DMEM (Invitrogen) with 2 mM L-glutamine, supplemented with 10% fetal bovine serum (FBS), 100 units/ml penicillin. MLE12 cell line was maintained in HITES medium supplemented with 2% FBS. For select in vitro experiments, cell lines were treated with Wnt5a (100-200 ng/ml, R&D Systems/Bio-techne, 645-WN-010), IFNγ (100 ng/ml, BioAbChem, 42-IFNg), anti-PD-L1 ab (1-2 μg/ml, TLR4 inhibitor (3 μM-10 Invivogen, tlrl-cli95) and MCC950 NLRP3 inhibitor (2.5 μM-10 Invivogen, inh-MCC). All cell lines were tested Mycoplasma-free by Duke University Cell Culture Facility shared services.
[0113] Tumor Cell-CD8+ T Cell Co-Culture Assays and CD8.sup.+ T Cell Proliferation Assays
[0114] Naïve CD8.sup.+ T cells were isolated from the spleens of OT-1 transgenic mice by magnetic bead CD8 purification according to the manufacturer's instructions (Miltenyi Biotec, 130-104-075) and activated with IL-2 (100 U/ml, PeproTech, 212-12) and SIINFEKL peptide (1 μg/ml, New England Peptide, BP10-915) for 3 days. Activated OT-1 CD8.sup.+ T cells were incubated with BRAF.sup.V600EPTEN.sup.−/−-OVA cells in the presence and absence of anti-PD1 ab (1 μg/ml) and/or IFNγ ab (MAB4851, 4-20 ng/mL) for 72 hrs at a tumor cell:CD8.sup.+ T cell ratio of 1:5. For the ex vivo CD8.sup.+ T cell proliferation assay, splenocytes were isolated from IgG isotype control- and anti-Ly6G ab-treated mice. Then single cells were labeled with CFSE (ThermoFisher, C34554) and cultured in 96-well flat-bottom plates for either 3 or 6 days at 37° C. in RPMI medium supplemented with 10% FBS, penicillin and streptomycin. Cells were harvested and activated CD8.sup.+ T cells were quantitated based on flow cytometry. For in vitro PMN-MDSC suppression T cell proliferation assays, naïve CD8.sup.+ T cells were purified from lymph nodes, labeled with CFSE, stimulated with anti-CD3/anti-CD28 beads (Thermo fisher, 1116D) by 1:1 bead to cell ratio, in the presence or absence of PMN-MDSCs (1:3 T cell/PMN-MDSC ratio) for 4 days. Cells were harvested on day 4 and activated CD8.sup.+ T cells were quantitated based on flow cytometry.
[0115] Cell Invasion Assay
[0116] A Matrigel invasion chamber with an 8 um transwell membrane (CORNING, 354480) was utilized to examine the relative invasion properties of cell lines. BRAF.sup.V600EPTEN.sup.−/−-NLRP3a and BRAF.sup.V600EPTEN.sup.−/−-Ctrl cell lines (5×10.sup.4 cells) seeded in the upper chamber in serum-free conditions while FBS was added to the lower chamber. After 48 hrs, transwell inserts were washed and cells were fixed with methanol and stained with crystal violet (1% w/v) for 10 mins before microscopic quantification.
[0117] Tumor and Lung Tissue Cell Isolation
[0118] Tumors were resected at a similar size and mechanically disaggregated by a gentleMACS dissociator (Miltenyi) and then digested with serum-free RPMI containing collagenase IV (1 mg/mL, Sigma-Aldrich), hyaluronidase (0.1 mg/mL, Sigma-Aldrich), and deoxyribonuclease (20 U/mL, Sigma-Aldrich) on a shaker at 250 rpm at 37° C. for 30 mins (36). Resected lung tissues were mechanically separated by gentleMACS (lung mode) and enzymatically digested using the same enzyme digestion solution and the same conditions for 20 mins. Cell suspensions were filtered using a 70 μm filter, washed with flow buffer (PBS, 2 mM EDTA, 2% FBS/BSA), and red blood cells were lysed using lysis buffer (Sigma) for 10 mins at room temperature (RT).
[0119] RNA Isolation and Qrt-PCR Analysis
[0120] Small representative tissue specimens were harvested from tumors and lungs and stored in RNAlater at −80° C. Tissues were lysed in RLT buffer by using a gentleMACS dissociator (Miltenyi) while cell lines were lysed in RLT buffer and stored at −80° C. Lung tissue-derived cells were sorted by flow cytometry based on their surface marker expression and lysed in RLT buffer before storing at −80° C. Total RNA was isolated by RNeasy Plus Mini Kit (Qiagen, 74134) and RNA was quantified by NanoDrop. RNA (500 ng-1000 ng) was used in cDNA synthesis (iScript Reverse Transcription Supermix, BioRad, 1708841). Real-time PCR was performed using an ABI7500 Real-Time PCR system (Life Technologies). All qPCR reactions were performed using validated primers and SsoAdvanced Universal SYBR Green Super Mix (BioRad, 1725271) or SsoAdvance Universal Probes Supermix (BioRad, 1725281). For developing a TRP2 qrt-PCR assay to measure melanoma metastases in lung tissues, 1×10.sup.2-1×10.sup.6 BRAF.sup.V600EPTEN.sup.−/− melanoma cells were admixed with a single cell suspension generated from a single lung lobe and processed for qrt-PCR analysis using Trp2-specific TaqMan probes. Relative Trp2 mRNA levels were correlated with the number of admixed melanoma cells and both high sensitivity and specificity were achieved. All data were normalized to Actb expression and relative gene expression was quantitated based on the 2ΔΔCt method. Relative mRNA levels of the following genes were measured: Cxcl5, Cxcl1, Cxcl2, Trp2, Csf3, Il1b, Fn1, Tgfb, Tgfbr2, Spp1, and Hsp70.
[0121] Western Blot Analysis
[0122] Tissues or cells were lysed in NP40 lysis buffer (Sigma-Aldrich) supplemented with a complete protease inhibitor and phosphatase inhibitor (Roche). After lysing in Laemmli sample buffer, equal volumes of lysates were separated using 10% or 15% SDS-PAGE and then transferred to a PVDF membrane (Bio-Rad Laboratories Inc., 162017). After blocking for 30 mins in tris-buffered saline containing 0.1% Tween-20 and 5% milk, the membranes were probed with various primary antibodies followed by HRP-conjugated secondary antibodies. Primary antibodies included: Anti-β-actin mouse monoclonal (clone c4, 1:3000, Santa Cruz Biotechnology, sc-47778), anti-NLRP3 rabbit monoclonal (clone D4D8T, 1:1000, Cell Signaling, 15101S; clone EPR23073-96, 1:1000, Abcam, 270499), anti-Caspase-1-p20, mouse monoclonal (clone Casper-1, 1:500, Adipogen, AG-20B-0042-C100), anti-HSP70, mouse monoclonal (clone C92F3A-5, 1:1000, Santa Cruz Biotechnology, sc-66048), anti-CXCL5, goat polyclonal (clone P50228, 1:1000, R&D Systems, AF433), anti-Wnt5a, mouse monoclonal (clone A5, 1:1000, Santa Cruz Biotechnology, sc-365370), anti-G-CSF, rabbit monoclonal (clone ABAC-3, M02280-1, Bosterbio), and anti-IL-1-β, mouse monoclonal (clone 3A6, 1:1000, Cell Signaling, 12242). Immunoreactivity was visualized using chemiluminescence substrate (ThermoFisher, 34095/34075) and imaged by a ChemiDoc XRSplus System (BioRad).
[0123] ELISA
[0124] CXCL5, HSP70, GCSF and IL-1β concentrations in culture supernatants and mouse plasma samples were determined by appropriate mouse ELISA kits (CXCL5: R&D Systems, MX000; HSP70: R&D Systems, DYC1663-2; G-CSF: R&D Systems, DY414-05; IL-1β: R&D Systems, DY401-05) according to the manufacturer's instructions. Human plasma HSP70 and IL-1β concentrations were measured using the human DuoSet assay (R&D Systems, HSP70: DY1663, IL-1β: DY201-05) according to manufacturer's protocol.
[0125] Flow Cytometry Analysis
[0126] Cells (1-2×10.sup.6) were diluted in 150 μl flow buffer per well of V bottom culture plates, incubated with Live/Dead Stain (Sigma) on ice for 20 mins, washed twice, and incubated with Fc Block (anti-CD16/CD32, 2 ug/mL) before staining with appropriate conjugated antibodies. Cells were washed, resuspended in 2% paraformaldehyde for 15 mins at 4° C., and analyzed using a BD FACSCanto flow cytometry system. Compensation was performed using (FMO) controls. Cells were characterized using the following combinations of cell surface markers after gating on viable single cell populations. All antibodies were obtained from commercial vendors: Anti-Mouse CD11b, PE-conjugated, clone: MIH5 (BD Pharmingen, 558091), Anti-Mouse Ly6G-GR1, FITC conjugated, clone: RB6-8C5 (BD Pharmingen, 5532127), Anti-Mouse Ly6G, FITC conjugated, clone: 1A8 (BioLegend, 127605), Anti-mouse Ly-6G Antibody, FITC conjugated, clone 1A8-Ly6g, (ThermoFisher, 11-9668-82), Anti-mouse F4/80 Antibody, APC conjugated, clone: BM8 (BD Pharmingen, 560408), Anti-Mouse CD45, PerCP-Cy5.5 conjugated, clone: 145-2C11 (BD Pharmingen, 551163), Anti-mouse CD326/Ep-CAM antibody, FITC conjugated, clone: G8.8, (Bio Legend, 118207), Anti-mouse CD326, APC conjugated, clone: G8.8 (BD Bioscience, 563478), Anti-mouse CD90.2 antibody, FITC conjugated, clone: 53-2.1, (BD Bioscience, 553003), Anti-Mouse CD8a, BV510 conjugated, clone: 53-6.7 (BD Pharmingen, 563068), Anti-Mouse CD3e, PerCP-Cy5.5 conjugated, clone: 145-2C11 (BD Pharmingen, 551163), Anti-Mouse CD8a, APC conjugated, clone: 53-6.7 (BD Bioscience, 553035), Anti-Mouse PD1/CD279, PE-conjugated, clone: 29F.1A12 (BD Bioscience, 568250), and Anti-Mouse Ly6C, PE-Cy7 conjugated, clone: AL-21 (BD Pharmingen, 560593), Anti-Mouse VEGFR1, PE-conjugated, clone: 141522 (Novus Biologicals, FAB4711P), Anti-Mouse CD133, PE-Cy7-conjugated, clone: 315-2C11 (BioLegend, 141209), Anti-Mouse CD34, FITC-conjugated, clone: RAM34 (BD Bioscience, 560238), and Anti-Mouse CD117/C-KIT, PerCP-Cy5.5-conjugated, clone: 2B8 (BD Bioscience, 560557). Cell populations were characterized based on the following marker profiles: Ly6G+ PMN-MDSCS cells: CD45+CD11b+Ly6G.sup.hiLy6C.sup.lo F4/80.sup.− Tumor-associated Macrophages: CD45+CD11b+Ly6G−F4/80+; Type II Lung Epithelial Cells: CD45.sup.−CD90.2.sup.−EPCAM.sup.+; CD8.sup.+ T Cells: CD45.sup.+CD3e.sup.+CD8a.sup.+CD44.sup.+/−; bone marrow-derived hematopoietic cells: c-kit.sup.+VEGR1.sup.+CD133.sup.+CD34.sup.+. Flow cytometry data was analyzed using Flowjo software v10.3.
[0127] Immunohistochemistry and Immunofluorescence Analysis
[0128] Paraffin-Sections (5-μm) from primary melanomas and lung tissues were processed using standard protocols for immunohistochemistry (IHC) and immunofluorescence (IF) staining. Tissues was permeabilized by incubation in 0.4% Triton-X in TBS for 20 min. The following primary antibodies were used: anti-Wnt5a, mouse monoclonal (clone: A-5, 1:200, Santa Cruz, 365370), anti-Ly6G, rabbit monoclonal (clone: EPR22909-135, 1:100, Abcam, ab238132), S100beta, rabbit polyclonal (clone: 6285, 1:500/1:250, Novus biological, NBP1-87102), anti-NLRP3, rabbit polyclonal (clone: 114548, 1:500, Novus biological, NBP2-12446), anti-GCSF, rabbit monoclonal (clone: ABAC-3, M02280-1), anti-Fibronectin, mouse monoclonal (clone: TV-1, NBP2-32849), and rabbit-specific HRP/AEC IHC Detection Kit-Micro-polymer (Abcam, ab236468). Anti-rat polymers were used as secondary antibodies and chromogen detection system for immunohistochemistry. For IF, goat anti-rabbit conjugated to AlexaFluor564 and goat anti-mouse Alexa488 were used as secondary antibodies for the appropriate primary antibody. Sections were imaged with an Axio Imager upright microscope. PMN-MDSC quantitation by Ly6G-staining, and CD8.sup.+ T cell quantitation by CD8a-staining were performed at 20× magnification and 6-8 random fields were averaged per section over 3-4 sections per specimen. Area calculations for lung tumor burden based on S100β-staining was performed at 20× magnification of 2-3 sections per specimen and quantified using ImageJ software (tumor burden area/total lung area).
[0129] Proximity Ligation Assay
[0130] Human tumor tissues (5 μm) were deparaffinized, rehydrated, and subjected to antigen retrieval using standard procedures. Tissues were permeabilized by incubation in 0.4% Triton-X in TBS for 20 min, incubated with a blocking solution containing 0.1% BSA in TBS, and 0.05% Tween solution for 30 min at RT. Slides were then incubated overnight with a cocktail of human NLRP3/NALP3 (aa 540-689) antibody (R&D Systems, AF7010) and anti-human ASC, mouse monoclonal antibody (Santa Cruz Biotechnology, sc-514414) at 4° C. Then a mixture of 1× DuoLink in situ PLA probe anti-mouse PLUS and 1× DuoLink PLA probe anti-goat MINUS (Sigma-Aldrich, DU092001-30RXN) was added to the section and incubated for 1 h in a humidity chamber preheated to 37° C. Ligase solution is added to each sample and incubated for an additional 30 min in a humidity chamber at 37° C. Amplification solution (35 μl) was added to each slide and incubated for 100 min in the humidity chamber at 37° C. Finally, mounting medium with DAPI was added and a cover slip was placed. Images were taken by a SP5 Leica confocal microscope. ImageJ software was used to quantify fluorescent spots in 3 fields per tissue section at 40× magnification and averaged over 2 tissue sections per tissue sample.
[0131] TCGA Data Analysis
[0132] NLRP3 amplification was quantitated in different cancer types using the TCGA database. Data was visualized using cBioPortal.
[0133] Statistics
[0134] Specific statistical tests are reported in the Figure Legends. GraphPad Prism 9 Windows version was used for all statistical analyses. Unpaired t-test was used to compare mean differences between control and treatment groups. One- or two-way ANOVAs followed by Tukey's multiple comparisons test or Sidak's multiple comparisons test, respectively, were performed to analyze data containing three or more groups. Progression-free and overall survival in stage IV melanoma patients undergoing anti-PD-1 immunotherapy was analyzed using a log-rank test. A P value of less than 0.05 was considered significant. All quantitative data are presented as the mean±SEM.
[0135] Study Approval
[0136] Mouse tumor experiments were performed according to a protocol approved by the IACUC of Duke University. All stage IV melanoma patients provided written informed consent under approval from the Institutional Review Board at Duke University (NCT02694965).
REFERENCES
[0137] 1. Y. Liu, X. Cao, Characteristics and Significance of the Pre-metastatic Niche. Cancer Cell 30, 668-681 (2016). [0138] 2. H. Peinado, H. Zhang, I. R. Matei, B. Costa-Silva, A. Hoshino, G. Rodrigues, B. Psaila, R. N. Kaplan, J. F. Bromberg, Y. Kang, M. J. Bissell, T. R. Cox, A. J. Giaccia, J. T. Erler, S. Hiratsuka, C. M. Ghajar, D. Lyden, Pre-metastatic niches: organ-specific homes for metastases. Nat Rev Cancer 17, 302-317 (2017). [0139] 3. S. Champiat, R. Ferrara, C. Massard, B. Besse, A. Marabelle, J. C. Soria, C. Ferte, Hyperprogressive disease: recognizing a novel pattern to improve patient management. Nat Rev Clin Oncol 15, 748-762 (2018). [0140] 4. R. Ferrara, L. Mezquita, M. Texier, J. Lahmar, C. Audigier-Valette, L. Tessonnier, J. Mazieres, G. Zalcman, S. Brosseau, S. Le Moulec, L. Leroy, B. Duchemann, C. Lefebvre, R. Veillon, V. Westeel, S. Koscielny, S. Champiat, C. Ferte, D. Planchard, J. Remon, M. E. Boucher, A. Gazzah, J. Adam, E. Bria, G. Tortora, J. C. Soria, B. Besse, C. Caramella, Hyperprogressive Disease in Patients With Advanced Non-Small Cell Lung Cancer Treated With PD-1/PD-L1Inhibitors or With Single-Agent Chemotherapy. JAMA Oncol 4, 1543-1552 (2018). [0141] 5. S. Champiat, L. Dercle, S. Ammari, C. Massard, A. Hollebecque, S. Postel-Vinay, N. Chaput, A. Eggermont, A. Marabelle, J. C. Soria, C. Ferte, Hyperprogressive Disease Is a New Pattern of Progression in Cancer Patients Treated by Anti-PD-1/PD-L1. Clin Cancer Res 23, 1920-1928 (2017). [0142] 6. S. Kato, A. Goodman, V. Walavalkar, D. A. Barkauskas, A. Sharabi, R. Kurzrock, Hyperprogressors after Immunotherapy: Analysis of Genomic Alterations Associated with Accelerated Growth Rate. Clin Cancer Res 23, 4242-4250 (2017). [0143] 7. T. Kamada, Y. Togashi, C. Tay, D. Ha, A. Sasaki, Y. Nakamura, E. Sato, S. Fukuoka, Y. Tada, A. Tanaka, H. Morikawa, A. Kawazoe, T. Kinoshita, K. Shitara, S. Sakaguchi, H. Nishikawa, PD-1(+) regulatory T cells amplified by PD-1 blockade promote hyperprogression of cancer. Proc Natl Acad Sci USA 116, 9999-10008 (2019). [0144] 8. D. H. Kang, C. Chung, P. Sun, D. H. Lee, S. I. Lee, D. Park, J. S. Koh, Y. Kim, H. S. Yi, J. E. Lee, Circulating regulatory T cells predict efficacy and atypical responses in lung cancer patients treated with PD-1/PD-L1 inhibitors. Cancer Immunol Immunother, (2021). [0145] 9. G. Lo Russo, M. Moro, M. Sommariva, V. Cancila, M. Boeri, G. Centonze, S. Ferro, M. Ganzinelli, P. Gasparini, V. Huber, M. Milione, L. Porcu, C. Proto, G. Pruneri, D. Signorelli, S. Sangaletti, L. Sfondrini, C. Storti, E. Tassi, A. Bardelli, S. Marsoni, V. Toni, C. Tripodo, M. P. Colombo, A. Anichini, L. Rivoltini, A. Balsari, G. Sozzi, M. C. Garassino, Antibody-Fc/FcR Interaction on Macrophages as a Mechanism for Hyperprogressive Disease in Non-small Cell Lung Cancer Subsequent to PD-1/PD-L1 Blockade. Clin Cancer Res 25, 989-999 (2019). [0146] 10. I. Matos, J. Martin-Liberal, A. Garcia-Ruiz, C. Hierro, M. Ochoa de Olza, C. Viaplana, A. Azaro, M. Vieito, I. Brana, G. Mur, J. Ros, J. Mateos, G. Villacampa, R. Berche, M. Oliveira, M. Alsina, E. Elez, A. Oaknin, E. Munoz-Couselo, J. Carles, E. Felip, J. Rodon, J. Tabernero, R. Dienstmann, R. Perez-Lopez, E. Garralda, Capturing Hyperprogressive Disease with Immune-Checkpoint Inhibitors Using RECIST 1.1 Criteria. Clin Cancer Res 26, 1846-1855 (2020). [0147] 11. S. Hiratsuka, A. Watanabe, Y. Sakurai, S. Akashi-Takamura, S. Ishibashi, K. Miyake, M. Shibuya, S. Akira, H. Aburatani, Y. Maru, The S100A8-serum amyloid A3-TLR4 paracrine cascade establishes a pre-metastatic phase. Nat Cell Biol 10, 1349-1355 (2008). [0148] 12. S. Hiratsuka, S. Ishibashi, T. Tomita, A. Watanabe, S. Akashi-Takamura, M. Murakami, H. Kijima, K. Miyake, H. Aburatani, Y. Maru, Primary tumours modulate innate immune signalling to create pre-metastatic vascular hyperpermeability foci. Nat Commun 4, 1853 (2013). [0149] 13. A. Gast, J. L. Bermejo, R. Claus, A. Brandt, M. Weires, A. Weber, C. Plass, A. Sucker, K. Hemminki, D. Schadendorf, R. Kumar, Association of inherited variation in Toll-like receptor genes with malignant melanoma susceptibility and survival. PLoS One 6, e24370 (2011). [0150] 14. L. M. Booshehri, H. M. Hoffman, CAPS and NLRP3. J Clin Immunol 39, 277-286 (2019). [0151] 15. K. V. Swanson, M. Deng, J. P. Ting, The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol 19, 477-489 (2019). [0152] 16. M. Moossavi, N. Parsamanesh, A. Bahrami, S. L. Atkin, A. Sahebkar, Role of the NLRP3 inflammasome in cancer. Mol Cancer 17, 158 (2018). [0153] 17. Y. Wang, H. Kong, X. Zeng, W. Liu, Z. Wang, X. Yan, H. Wang, W. Xie, Activation of NLRP3 inflammasome enhances the proliferation and migration of A549 lung cancer cells. Oncol Rep 35, 2053-2064 (2016). [0154] 18. H. Wang, Q. Luo, X. Feng, R. Zhang, J. Li, F. Chen, NLRP3 promotes tumor growth and metastasis in human oral squamous cell carcinoma. BMC Cancer 18, 500 (2018). [0155] 19. B. Theivanthiran, K. S. Evans, N. C. DeVito, M. Plebanek, M. Sturdivant, L. P. Wachsmuth, A. K. Salama, Y. Kang, D. Hsu, J. M. Balko, D. B. Johnson, M. Starr, A. Nixon, A. Holtzhausen, B. A. Hanks, A tumor-intrinsic PD-L1/NLRP3 inflammasome signaling pathway drives resistance to anti-PD-1 immunotherapy. J Clin Invest 130, 2570-2586 (2020). [0156] 20. B. Theivanthiran, T. Haykal, L. Cao, A. Holtzhausen, M. Plebanek, N. C. DeVito, B. A. Hanks, Overcoming Immunotherapy Resistance by Targeting the Tumor-Intrinsic NLRP3-HSP70 Signaling Axis. Cancers (Basel) 13, (2021). [0157] 21. Y. Wang, Y. Ding, N. Guo, S. Wang, MDSCs: Key Criminals of Tumor Pre-metastatic Niche Formation. Front Immunol 10, 172 (2019). [0158] 22. M. E. Shaul, Z. G. Fridlender, Tumour-associated neutrophils in patients with cancer. Nat Rev Clin Oncol 16, 601-620 (2019). [0159] 23. V. Bronte, S. Brandau, S. H. Chen, M. P. Colombo, A. B. Frey, T. F. Greten, S. Mandruzzato, P. J. Murray, A. Ochoa, S. Ostrand-Rosenberg, P. C. Rodriguez, A. Sica, V. Umansky, R. H. Vonderheide, D. I. Gabrilovich, Recommendations for myeloid-derived suppressor cell nomenclature and characterization standards. Nat Commun 7, 12150 (2016). [0160] 24. J. Stackowicz, N. Gaudenzio, N. Serhan, E. Conde, O. Godon, T. Marichal, P. Starkl, B. Balbino, A. Roers, P. Bruhns, F. Jonsson, P. Moguelet, S. Georgin-Lavialle, L. Broderick, H. M. Hoffman, S. J. Galli, L. L. Reber, Neutrophil-specific gain-of-function mutations in Nlrp3 promote development of cryopyrin-associated periodic syndrome. J Exp Med 218, (2021). [0161] 25. S. D. Brydges, J. L. Mueller, M. D. McGeough, C. A. Pena, A. Misaghi, C. Gandhi, C. D. Putnam, D. L. Boyle, G. S. Firestein, A. A. Horner, P. Soroosh, W. T. Watford, J. J. O'Shea, D. L. Kastner, H. M. Hoffman, Inflammasome-mediated disease animal models reveal roles for innate but not adaptive immunity. Immunity 30, 875-887 (2009). [0162] 26. I. W. Tengesdal, D. R. Menon, D. G. Osborne, C. P. Neff, N. E. Powers, F. Gamboni, A. G. Mauro, A. D'Alessandro, D. Stefanoni, M. A. Henen, T. S. Mills, D. M. De Graaf, T. Azam, B. Vogeli, B. E. Palmer, E. M. Pietras, J. DeGregori, A. C. Tan, L. A. B. Joosten, M. Fujita, C. A. Dinarello, C. Marchetti, Targeting tumor-derived NLRP3 reduces melanoma progression by limiting MDSCs expansion. Proc Natl Acad Sci USA 118, (2021). [0163] 27. M. Okamoto, W. Liu, Y. Luo, A. Tanaka, X. Cai, D. A. Norris, C. A. Dinarello, M. Fujita, Constitutively active inflammasome in human melanoma cells mediating autoinflammation via caspase-1 processing and secretion of interleukin-1beta. J Biol Chem 285, 6477-6488 (2010). [0164] 28. H. Jia, C. P. Sodhi, Y. Yamaguchi, P. Lu, L. Y. Martin, M. Good, Q. Zhou, J. Sung, W. B. Fulton, D. F. Nino, T. Prindle, Jr., J. A. Ozolek, D. J. Hackam, Pulmonary Epithelial TLR4 Activation Leads to Lung Injury in Neonatal Necrotizing Enterocolitis. J Immunol 197, 859-871 (2016). [0165] 29. Y. S. Gui, L. Wang, X. Tian, R. Feng, A. Ma, B. Cai, H. Zhang, K. F. Xu, SPC-Cre-ERT2 transgenic mouse for temporal gene deletion in alveolar epithelial cells. PLoS One 7, e46076 (2012). [0166] 30. I. Omrane, O. Baroudi, N. Kourda, Y. J. Bignon, N. Uhrhammer, A. Desrichard, I. Medimegh, H. Ayari, N. Stambouli, A. Mezlini, H. Bouzayenne, R. Marrakchi, A. Benammar-Elgaaid, K. Bougatef, Positive link between variant Toll-like receptor 4 (Asp299Gly and Thr399Ile) and colorectal cancer patients with advanced stage and lymph node metastasis. Tumour Biol 35, 545-551 (2014). [0167] 31. L. Apetoh, F. Ghiringhelli, A. Tesniere, M. Obeid, C. Ortiz, A. Criollo, G. Mignot, M. C. Maiuri, E. Ullrich, P. Saulnier, H. Yang, S. Amigorena, B. Ryffel, F. J. Barrat, P. Saftig, F. Levi, R. Lidereau, C. Nogues, J. P. Mira, A. Chompret, V. Joulin, F. Clavel-Chapelon, J. Bourhis, F. Andre, S. Delaloge, T. Tursz, G. Kroemer, L. Zitvogel, Toll-like receptor 4-dependent contribution of the immune system to anticancer chemotherapy and radiotherapy. Nat Med 13, 1050-1059 (2007). [0168] 32. L. Kyjacova, R. Saup, M. Rothley, A. Schmaus, T. Wagner, A. Bosserhoff, B. K. Garvalov, W. Thiele, J. P. Sleeman, Quantitative Detection of Disseminated Melanoma Cells by Trp-1 Transcript Analysis Reveals Stochastic Distribution of Pulmonary Metastases. J Clin Med 10, (2021). [0169] 33. A. Ewens, E. Mihich, M. J. Ehrke, Distant metastasis from subcutaneously grown E0771 medullary breast adenocarcinoma. Anticancer Res 25, 3905-3915 (2005). [0170] 34. J. H. Cho, J. P. Robinson, R. A. Arave, W. J. Burnett, D. A. Kircher, G. Chen, M. A. Davies, A. H. Grossmann, M. W. VanBrocklin, M. McMahon, S. L. Holmen, AKT1 Activation Promotes Development of Melanoma Metastases. Cell Rep 13, 898-905 (2015). [0171] 35. R. N. Kaplan, R. D. Riba, S. Zacharoulis, A. H. Bramley, L. Vincent, C. Costa, D. D. MacDonald, D. K. Jin, K. Shido, S. A. Kerns, Z. Zhu, D. Hicklin, Y. Wu, J. L. Port, N. Altorki, E. R. Port, D. Ruggero, S. V. Shmelkov, K. K. Jensen, S. Rafii, D. Lyden, VEGFR1-positive haematopoietic bone marrow progenitors initiate the pre-metastatic niche. Nature 438, 820-827 (2005). [0172] 36. A. Holtzhausen, F. Zhao, K. Evans, M. Tsutsui, C. Orabona, D. S. Tyler, B. A. Hanks, Melanoma-derived Wnt5a Promotes Local Dendritic-Cell Expression of IDO and Immunotolerance: Opportunities for Pharmacologic Enhancement of Immunotherapy. Cancer Immunol Res 3, 1082-1095 (2015). [0173] 37. F. Zhao, K. Evans, C. Xiao, N. DeVito, B. Theivanthiran, A. Holtzhausen, P. J. Siska, G. Blobe, B. A. Hanks, Stromal Fibroblasts Mediate Anti-PD-1 Antibody Resistance via MMP-9 and Dictate TGF-β Inhibitor Therapy Sequencing in Melanoma. Cancer Immunology Research 6, (2018). [0174] 38. Z. Kan, B. S. Jaiswal, J. Stinson, V. Janakiraman, D. Bhatt, H. M. Stern, P. Yue, P. M. Haverty, R. Bourgon, J. Zheng, M. Moorhead, S. Chaudhuri, L. P. Tomsho, B. A. Peters, K. Pujara, S. Cordes, D. P. Davis, V. E. Carlton, W. Yuan, L. Li, W. Wang, C. Eigenbrot, J. S. Kaminker, D. A. Eberhard, P. Waring, S. C. Schuster, Z. Modrusan, Z. Zhang, D. Stokoe, F. J. de Sauvage, M. Faham, S. Seshagiri, Diverse somatic mutation patterns and pathway alterations in human cancers. Nature 466, 869-873 (2010). [0175] 39. J. L. Benci, B. Xu, Y. Qiu, T. J. Wu, H. Dada, C. Twyman-Saint Victor, L. Cucolo, D. S. M. Lee, K. E. Pauken, A. C. Huang, T. C. Gangadhar, R. K. Amaravadi, L. M. Schuchter, M. D. Feldman, H. Ishwaran, R. H. Vonderheide, A. Maity, E. J. Wherry, A. J. Minn, Tumor Interferon Signaling Regulates a Multigenic Resistance Program to Immune Checkpoint Blockade. Cell 167, 1540-1554 e1512 (2016). [0176] 40. S. Koyama, E. Sato, T. Masubuchi, A. Takamizawa, K. Kubo, S. Nagai, T. Izumi, Alveolar type II-like cells release G-CSF as neutrophil chemotactic activity. Am J Physiol 275, L687-693 (1998). [0177] 41. Y. M. Kim, H. Kim, S. Lee, S. Kim, J. U. Lee, Y. Choi, H. W. Park, G. You, H. Kang, S. Lee, J. S. Park, Y. Park, H. S. Park, C. S. Park, S. W. Lee, Airway G-CSF identifies neutrophilic inflammation and contributes to asthma progression. Eur Respir J 55, (2020). [0178] 42. L. Strauss, M. A. A. Mahmoud, J. D. Weaver, N. M. Tij aro-Ovalle, A. Christofides, Q. Wang, R. Pal, M. Yuan, J. Asara, N. Patsoukis, V. A. Boussiotis, Targeted deletion of PD-1 in myeloid cells induces antitumor immunity. Sci Immunol 5, (2020). [0179] 43. M. S. Alam, Proximity Ligation Assay (PLA). Curr Protoc Immunol 123, e58 (2018). [0180] 44. R. Varnier, T. Garrivier, E. Hafliger, A. Favre, C. Coutzac, C. Spire, P. Rochefort, M. Sarabi, F. Desseigne, P. Guibert, A. Cattey-Javouhey, P. Funk-Debleds, C. Mastier, A. Buisson, D. Perol, O. Tredan, J. Y. Blay, J. M. Phelip, C. de la Fouchardiere, Hyperprogressive Disease After Combined Anti-PD-L1 and Anti-CTLA-4 Immunotherapy for MSI-H/dMMR Gastric Cancer: A Case Report. Front Oncol 11, 756365 (2021). [0181] 45. Y. Liu, Y. Gu, Y. Han, Q. Zhang, Z. Jiang, X. Zhang, B. Huang, X. Xu, J. Zheng, X. Cao, Tumor Exosomal RNAs Promote Lung Pre-metastatic Niche Formation by Activating Alveolar Epithelial TLR3 to Recruit Neutrophils. Cancer Cell 30, 243-256 (2016). [0182] 46. F. R. Di Pietro, S. Verkhovskaia, S. Mastroeni, M. L. Carbone, D. Abeni, C. Z. Di Rocco, N. Sama, A. R. Zappala, P. Marchetti, F. De Galitiis, C. M. Failla, C. Fortes, Clinical Predictors of Response to Anti-PD-1 First-Line Treatment in a Single-Centre Patient Cohort: A Real-World Study. Clin Oncol (R Coll Radiol) 34, e18-e24 (2022). [0183] 47. K. Kumawat, M. H. Menzen, I. S. Bos, H. A. Baarsma, P. Borger, M. Roth, M. Tamm, A. J. Halayko, M. Simoons, A. Prins, D. S. Postma, M. Schmidt, R. Gosens, Noncanonical WNT-5A signaling regulates TGF-beta-induced extracellular matrix production by airway smooth muscle cells. FASEB J 27, 1631-1643 (2013). [0184] 48. I. W. Tengesdal, A. Dinarello, N. E. Powers, M. A. Burchill, L. A. B. Joosten, C. Marchetti, C. A. Dinarello, Tumor NLRP3-Derived IL-1beta Drives the IL-6/STAT3 Axis Resulting in Sustained MDSC-Mediated Immunosuppression. Front Immunol 12, 661323 (2021). [0185] 49. Q. Liang, J. Wu, X. Zhao, S. Shen, C. Zhu, T. Liu, X. Cui, L. Chen, C. Wei, P. Cheng, W. Cheng, A. Wu, Establishment of tumor inflammasome clusters with distinct immunogenomic landscape aids immunotherapy. Theranostics 11, 9884-9903 (2021). [0186] 50. S. Angelicola, F. Ruzzi, L. Landuzzi, L. Scalambra, F. Gelsomino, A. Ardizzoni, P. Nanni, P. L. Lollini, A. Palladini, IFN-gamma and CD38 in Hyperprogressive Cancer Development. Cancers (Basel) 13, (2021). [0187] 51. D. S. Sohal, M. Nghiem, M. A. Crackower, S. A. Witt, T. R. Kimball, K. M. Tymitz, J. M. Penninger, J. D. Molkentin, Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circ Res 89, 20-25 (2001). [0188] 52. F. Zhao, C. Xiao, K. S. Evans, T. Theivanthiran, N. DeVito, A. Holtzhausen, J. Liu, X. Liu, D. Boczkowski, S. Nair, J. W. Locasale, B. A. Hanks, Paracrine Wnt5a-beta-Catenin Signaling Triggers a Metabolic Program that Drives Dendritic Cell Tolerization. Immunity 48, 147-160 e147 (2018). [0189] 53. B. A. Pulaski, S. Ostrand-Rosenberg, Mouse 4T1 breast tumor model. Curr Protoc Immunol Chapter 20, Unit 20 22 (2001). [0190] 54. L. S. Qi, M. H. Larson, L. A. Gilbert, J. A. Doudna, J. S. Weissman, A. P. Arkin, W. A. Lim, Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173-1183 (2013). [0191] 55. J. Joung, P. C. Kirchgatterer, A. Singh, J. H. Cho, S. P. Nety, R. C. Larson, R. K. Macrae, R. Deasy, Y. Y. Tseng, M. V. Maus, F. Zhang, CRISPR activation screen identifies BCL-2 proteins and B3GNT2 as drivers of cancer resistance to T cell-mediated cytotoxicity. Nat Commun 13, 1606 (2022).
Example 2—Activity of the Tumor-Intrinsic NLRP3 Inflammasome Pathway Predicts for Response to Checkpoint Inhibitor Immunotherapy in Melanoma Patients
[0192] Reference is made to the abstract: Haykal et al., “Activity of the Tumor-intrinsic NLRP3 Inflammasome Pathway Predicts for Response to Checkpoint Inhibitor Immunotherapy in Melanoma Patients,” the content of which is incorporated herein by reference in its entirety.
Background: We have previously determined that activation of a novel tumor-intrinsic NOD-, LRR- and pyrin domain-containing protein-3 (NLRP3) inflammasome-heat shock protein-70 (HSP70) signaling axis in response to PD-1 blockade triggers the recruitment of granulocytic myeloid-derived suppressor cells (PMN-MDSCs) into the tumor microenvironment, suppresses anti-tumor immunity and, in select settings, promotes tumor hyperprogression. We, therefore, sought to determine whether the activity of the tumor-intrinsic NLRP3-HSP70 pathway may correlate with anti-PD-1 response by interrogating clinical specimens derived from advanced melanoma patients undergoing anti-PD-1 monotherapy.
Methods: Three independent approaches were utilized to measure the activity of the tumor-intrinsic NLRP3-HSP70 signaling pathway in 60 advanced melanoma patients undergoing either pembrolizumab or nivolumab monotherapy: 1. baseline week 0 plasma HSP70 levels were measured by ELISA, 2. germline PCR-based genotyping was performed to detect the single-nucleotide polymorphism (SNP), rs12239046, previously associated with enhanced NLRP3 expression, 3. PCR-based proximity ligation assay (PLA) analysis targeting the NLRP3-ASC proteins in baseline formalin-fixed paraffin-embedded tumor tissue specimens. Detection of the rs12239046 SNP was correlated with progression-free survival (PFS) while plasma HSP70 and NLRP3-ASC PLA levels were correlated with objective response (OR) based on RECIST1.1 assessment of week-12 CT imaging as well as PFS and overall survival (OS).
Results: Our studies demonstrate that elevated baseline plasma HSP70 levels (P=0.0008) and elevated baseline tissue NLRP3-ASC PLA levels (P=0.0014) independently correlate with resistance to anti-PD-1 immunotherapy (ICI) based on week-12 OR in melanoma patients. Importantly, melanoma patients developing disease hyperprogression in response to ICI exhibited elevations in baseline plasma HSP70 levels (P=<0.0001) and baseline tissue NLRP3-ASC PLA levels (P=<0.0001) relative to patients with week-12 disease progression. Above median baseline tissue NLRP3-ASC PLA levels were determined to correlate with both inferior PFS (HR 0.12, P=0.0008) and OS (HR 0.16, P=0.0456) in advanced melanoma patients undergoing ICI. Germline PCR detection of the rs12239046 SNP was found to be associated with elevated plasma HSP70 levels and trended toward a correlation with inferior PFS (HR 0.50, P=0.07).
Conclusion: Baseline markers of the tumor-intrinsic NLRP3-HSP70 signaling pathway correlate with resistance and disease hyperprogression in melanoma patients undergoing anti-PD-1 immunotherapy. These data strongly support the important role of the tumor-intrinsic NLRP3 inflammasome in regulating responses to anti-PD-1 therapy and verify its relevance as a pharmacologic target to enhance immunotherapy efficacy. Expanded studies are warranted to confirm these findings in a larger patient cohort.