Product for obesity treatment
11638719 · 2023-05-02
Assignee
Inventors
Cpc classification
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K47/24
HUMAN NECESSITIES
International classification
Abstract
A product containing a boron compound for use in obesity treatment. By means of the present invention, a product can be obtained for obesity treatment which is not toxic to the other tissues and organs of the body. In obtaining the said product, sodium pentaborate pentahydrate, which is a poloxamer derivative, are used.
Claims
1. A method for treating obesity comprising administering to a person in need of treatment thereof a composition for obesity treatment, the composition comprising: a combination of a triblock copolymer with a nominal chemical formula of HO(CH.sub.2CH.sub.2O).sub.20(CH.sub.2CH(CH.sub.3)O).sub.70(CH.sub.2CH.sub.2O).sub.20H and molecular weight of 5800 g/mol, and a boron compound selected from the group consisting of lithium borates, potassium borates, calcium borates, magnesium borates, and ammonium borates, wherein the boron compound suppresses expression levels of adipogenesis-promoting genes, and wherein the triblock copolymer solution is 1%, 0.7%, 0.5%, 0.3%, 0.1%, 0.05%, or 0.01% by weight/volume and the boron compound is at a dose of 5, 10, 20, 50, 100, 200 or 300 μg/ml.
2. The method for treating obesity according to claim 1, wherein the triblock copolymer reduces cytotoxic effects of the boron compound on adipose cells, wherein the triblock copolymer increases cell viability of adipose cells by at least 101%.
3. A method of using a composition effective on human adipose stem cells (HASC) for obesity treatment, the composition comprising a combination of a triblock copolymer with a nominal chemical formula of HO(CH.sub.2CH.sub.2O).sub.20(CH.sub.2CH(CH.sub.3)O).sub.70(CH.sub.2CH.sub.2O).sub.20H and molecular weight of 5800 g/mol, and a boron compound selected from the group consisting of lithium borates, potassium borates, calcium borates, magnesium borates, and ammonium borates, the method comprising: dissolving the boron compound at a dose of 5, 10, 20, 50, 100, 200, or 300 μg/ml and the triblock copolymer at a concentration of 1%, 0.7%, 0.5%, 0.3%, 0.1%, 0.05%, or 0.01% by weight/volume to form the composition and then applying the composition to the adipose cells.
4. The method of using a composition effective on human adipose stem cells (HASC) for obesity treatment according to claim 3, wherein the triblock copolymer reduces cytotoxic effects of the boron compound on the adipose cells, wherein the triblock copolymer increases cell viability of adipose cells by at least 101%.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) “A product for obesity treatment” developed to fulfill the objectives of the present invention is illustrated in the accompanying figures wherein
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(10) A boron compound and a Pluronic® poloxamer are essentially used for obtaining the product. In particular, preferably sodium pentaborate pentahydrate (NaB) was used as the boron component, and preferably Pluronic® F68 was used as the Pluronic®. The effect of the product of the present invention, which was obtained separately and in combination with these two substances, on fat differentiation was investigated. In this study, laboratory studies were carried out using human adipose stem cells (HASC).
(11) Experimental Study
(12) Preparation of Pluronic® F68 and Boron
(13) Pluronic® block copolymer F68 was supplied from BASF Corporation. F68 (BASF, USA, cat. #52389638). According to the protocol described in Exner et al, 2005; F68 put in PBS on ice was dissolved with 10% (weight/volume) vortex and then filtered through a 0.2 micron filter and held at 4° C. until use [32]. In this study, F68 copolymer was tested at 1%, 0.7%, 0.5%, 0.3%, 0.1%, 0.05%, 0.01% (weight/volume).
(14) NaB (Sodium Borate) was supplied from National Boron Research Institute BOREN (Ankara-TURKEY) and was prepared by being dissolved in DMEM medium containing 10% fetal bovine serum and 1% PSA. The stock solution of NaB dissolved at 10 mg/mL was filtered through a 0.2 micron filter and then diluted to 1 mg/ml. In this study, NaB was tested at doses of 5, 10, 20, 50, 100, 200 and 300 μg/ml.
(15) Isolation of Human Adipose Stem Cells (HASC)
(16) The primary human stem cells used in this study were isolated from the abdomen and upper inner thigh subcutaneous adipose tissues of two healthy female donors aged 26 and 59 years. Ethical approval of this study (decision no. 2013-529) was given by “Acibadem University Ethics Committee” and the patients were informed and their consent was taken. The adipose tissue and collagenase solution were mixed at a ratio of 1:1 and allowed to digest for 1 hour at 37° C. with shaking at 170 rpm. Then the erythrocyte lysis buffer was applied to the digested tissue and centrifuged at 2500 rpm for 7 minutes at room temperature. The pellet was re-suspended in erythrocyte lysis buffer. The cell suspension was incubated for 10 minutes at 37° C. in erythrocyte lysis buffer with continuous shaking at 170 rpm and then centrifuged at 1400 rpm for 7 minutes at room temperature. The pellet (1× without Ca/Mg) was washed with PBS and then centrifuged at 1400 rpm for 7 minutes at room temperature. The cell pellet was re-suspended in Dulbecco's Modified Eagle's Medium (DMEM) (supplemented with 10% fetal bovine serum (FBS), 1% PSA-10,000 units/ml potassium penicillin, 10,000 μg/ml streptomycin sulfate, 25 μg/ml amphotericin B-). Finally, the cells were passed through a 100 μm cell strainer and seeded in T150 plates. The cells were maintained at 37° C. and 5% CO.sub.2 and were used in experiments at passages 1-5.
(17) Characterization of HASC
(18) The cells were trypsinized and then incubated with primary antibodies. For characterization, primary antibodies were used against CD29 (Cat #BD556049), CD34 (Cat #SC-51540), CD45 (Cat #SC-70686), CD90 (Cat #SC-53456), CD105 (Cat #SC-71043), CD14 (Cat #SC-9150), (Santa Cruz Biotechnology Inc., SantaCruz, Calif., USA) and CD73 (Cat #BD550256) (Zymed, S. San Francisco, Calif., USA). The cells were then washed with PBS to remove excess primary antibodies and incubated with fluorescein-isothiocyanate (FITC) secondary antibody (cat. no SC-2989) at 4° C. for 1 hour. For CD29, the conjugated phycoerythrin (PE)-red light-harvesting protein chromophore-conjugated monoclonal antibody was used. The flow cytometry analysis of the cells was carried out by using Becton Dickinson FACS Calibur flow cytometry system. (Becton Dickinson, San Jose, Calif., USA). 20,000 cells were counted for each sample.
(19) Cytotoxicity Analysis for F68 Pluronic® and NaB
(20) Cytotoxicity of Pluronic® F68 and NaB were dissolved and tested at 7 different concentrations in DMEM (W %, 0.7%, 0.5%, 0.3%, 0.1%, 0.05%, 0.01% (w/v) for F68 and 5, 10, 20, 50, 100, 200 and 300 ug/ml for NaB).
(21) HASCs were seeded into 96-well culture plates (Corning Plasticware, Corning, N.Y., cat. no. CLS3360) at 5,000 cells/well. The next day, the cells were treated with F68 and NaB solutions that were prepared at different concentrations. In accordance with the manufacturer's instructions, cell viability was measured by the MTS assay (Promega, Southampton, UK CellTiter 96 AqueousOne solution). After 24, 48 and 72 hours of incubation, 10 ul of MTS reagent and 100 ul of DMEM medium were applied to the cells and then, after incubation at 37° C. for 2 hours, their absorbances at 409 nm were measured with the ELISA plate reader (BioTek Instruments, Inc., Vt., USA).
(22) Adipocyte Differentiation
(23) The cells were seeded into 6-well culture plates at 100,000 cells/well in an adipogenic differentiation medium. Content of the medium was as follows. 10% (v/v) FBS, 1 uM dexamethasone, 100 uM indomethacin (Sigma, USA), 500 uM IBMX (Calbiochem Merck Millipore, Germany) and 0.01 mg/mL insulin (Gibco, UK). 5 different groups were prepared; only F68, only NaB, F68 and NaB combination, PC and NC. Adipogenic differentiation was applied for 10 days by changing the medium every other day. While only DMEM, 10% (v/v) FBS and 1% (v/v) PSA were applied to the negative control group, the positive control group was cultured with adipogenic differentiation medium.
(24) Immunocytochemical Analysis—
(25) Human adipose stem cells were seeded into 48-well plates at 8,000 cells/well. Following the differentiation experiment, the cells were fixed in 2% (w/v) paraformaldehyde at 4° C. for 30 minutes and then blocked with 2% (v/v) goat serum (Sigma, USA) for 20 minutes. The cells incubated at 4° C. overnight with PPAR-γ (ab8934, Abcam, UK, 1: 100), FABP4 (SC-30088, Santa Cruz Biotechnology, Tex., USA, 1:100) and adiponectin (ab22554, Abcam, UK, 1:50) primary antibodies were then incubated with secondary antibodies (goat anti-rabbit IgG Alexa Fluor 488, goat anti-mouse IgGAlexaFluor 488, 1:1000) at 4° C. for 2 hours. DAPI (AppliChem, Germany) was used for staining the cell nuclei, and the cells were incubated for 5 minutes at room temperature. Immunocytochemical analysis results were observed under fluorescence microscope (NiconEclipse TE200).
(26) Real Time Polymerase Chain Reaction (RT-PCR) Analysis
(27) Following differentiation, RNA isolation was carried out using High Pure RNA Isolation Kit (Roche, Germany) in accordance with the manufacturer's instructions. After performance of cDNA synthesis (High Fidelity cDNA synthesis kit, Roche, Germany) from isolated RNA samples, RT-PCR was performed in three replicates using iCycler RT-PCR detection system (Bio-Rad, Hercules, Calif.). Synthesis levels were normalized to GAPDH.
(28) The following primers were used in this study:
(29) TABLE-US-00001 GAPDH, forward TTGCCATCAATGACCCCTTCA, as shown in SEQ ID NO: 1; reverse CGCCCCACTTGATTTTGGA, as shown in SEQ ID NO: 2. Adiponectin, forward TATCCCCAACATGCCCATTCG, as shown in SEQ ID NO: 3; reverse TGGTAGGCAAAGTAGTACAGCC, as shown in SEQ ID NO: 4. PPARy, forward CCTATTGACCCAGAAAGCGATT, as shown in SEQ ID NO: 5; reverse CATTACGGAGAGATCCACGGA, as shown in SEQ ID NO: 6. FABP4, forward AACCTTAGATGGGGGTGTCCT, as shown in SEQ ID NO: 7; reverse TCGTGGAAGTGACGCCTTTC, as shown in SEQ ID NO: 8.
(30) For each sample the fold changes in the expression levels were determined using the method 2 (-Delta Delta C (t)).
(31) ‘Oil Red O’ Staining
(32) The ‘Oil Red O’ solution was prepared by dissolving 0.5 grams of ‘Oil Red O’ (Sigma, USA) in 100 ml of isopropanol. After being fixed with 2% paraformaldehyde (weight/volume) for 30 minutes, the cells were incubated in ‘Oil Red O’ solution (diluted in PBS at 6:4) for 1 hour. The cells were observed under light microscope.
(33) Statistical Analysis
(34) Statistical analysis of the results was performed with the unpaired t-test and the graphs were drawn using GraphPad Prism 5 software Statistical significance was accepted as p<0.05. In addition, a graphical representation of the results obtained from immunocytochemistry and ‘Oil red O’ staining was obtained using the Adobe Creative Suite 6 program
(35) Experimental Results
(36) First of all, the stem cell characterization studies were carried out before testing the effects of the boron compound and Pluronic® copolymer combination, which inhibits the differentiation of human adipose stem cells (hASCs) thereby reducing fat storage capacity, on cell viability. As noted in the literature, positive cells were selected by the mesenchymal stem cell markers and negative cells were selected by the hematopoietic stem cell markers (
(37) The effect of the F68 copolymer on cell viability was tested for 3 days and a ratio of 0.05% (101%, 103% and 105%, respectively at the end of day 1, day 2 and day 3), which was not toxic and which increased cell viability within this period, was selected for further experiments (
(38) 20 μg/ml dosage of the sodium pentaborate pentahydrate (NaB) boron compound: which increased cell viability of hASCs by 101% at the end of day 1, 106% at the end of day 2, and 109% at the end of day 3; was selected for the ongoing experiments (
(39) Expression levels of adipogenesis-promoting genes such as Peroxisome proliferator-activated receptor-γ (PPARγ), fatty acid binding protein (FABP4) and adiponectin were analyzed by real-time polymerase chain reaction. When the specified dosages of F68 copolymer and NaB were administered alone, the expression levels of these three genes increased significantly compared to the positive control. However, it was shown that gene expression with the combination of F68 and NaB was significantly suppressed relative to positive control (
(40) PPARγ, FABP4 and adiponectin protein expression levels were examined by immunocytochemistry method (
(41) ‘Oil Red O’ staining is used to determine the amount of fat retained by adipogenic cells. In this study, it was shown that while the F68 and NaB administered alone at the doses determined in this study increased the amount of fat accumulation in the cells, the combination of NaB and F68 inhibited the adipogenic transcriptional program that causes fat accumulation in the cells (
(42) The following basic boron compounds can be used for application of the invention: boric acid, alkaline or alkaline earth metal borates (lithium borates such as lithium tetra borate, lithium metaborate, lithium pentaborate; sodium borates such as sodium metaborate, sodium hexaborate, sodium tetraborate, sodium octaborate; potassium borates such as potassium tetraborate, potassium metaborate, potassium hexaborate, potassium octaborate; calcium borates such as calcium diborate, calcium metaborate, calcium tetraborate, tricalcium tetraborate, pentacalcium tetraborate, calcium hexaborate; magnesium borates such as magnesium metaborate, magnesium diborate, trimagnesium tetraborate, pentamagnesium tetraborate) or all hydrate forms thereof, ammonium borates (ammonium metaborate, ammonium tetraborate, ammonium pentaborate and ammonium octaborate), boric acid esters (monomethyl borate, dmethyl borate, trimethyl borate, monoethyl borate, diethyl borate, triethyl borate, monopropyl borate, dipropyl borate, tripropyl borate, monobutyl borate, dibutyl borate or tributyl borate).
(43) In application of the invention, particularly F68 but also F127, P106, P407, P85, P123 can be used as the Pluronic®.
(44) Pluronic® P123 is the tradename for a triblock copolymer manufactured and/or sold by the BASF Corporation among others. The nominal chemical formula is HO(CH.sub.2CH.sub.2O).sub.20(CH.sub.2CH(CH.sub.3)O).sub.70(CH.sub.2CH.sub.2O).sub.20H, which corresponds to a molecular weight of around 5800 g/mol. Triblock copolymers based on poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) are known generically as poloxamer, and similar materials are manufactured by other companies. Poloxamers have behaviors similar to those of hydrocarbon surfactants, and will form micelles when placed in a selective solvent such as water.