Calcium-chelating peptides derived from EF-hand calcium-binding motif

11643449 · 2023-05-09

Assignee

Inventors

Cpc classification

International classification

Abstract

The disclosure pertains to the field of molecular means capable of binding calcium, in particular peptides which are calcium chelators, appropriate for use in vitro or in vivo and preferably capable of targeting specific cellular compartments. Polypeptide comprising a first calcium-binding domain, a peptide linker and a second calcium binding domain, wherein the first and second binding domains are linked through the peptide linker, and wherein: the first calcium-binding domain and the second calcium binding domain each comprise at least one calcium-binding site derived from a EF-hand motif; and, the first calcium-binding domain and the second calcium binding domain differ in at least one calcium-binding site.

Claims

1. A polypeptide comprising a first calcium-binding domain, a peptide linker and a second calcium binding domain, wherein said first and second binding domains are linked through said peptide linker, and wherein: the first calcium-binding domain and the second calcium binding domain each comprises at least one calcium-binding site derived from a EF-hand motif; and the first calcium-binding domain and the second calcium binding domain differ in at least one calcium-binding site, wherein: the first calcium-binding domain comprises at least one calcium-binding site comprising a calcium-binding loop from Parvalbumin chosen in the list consisting of SEQ ID NO: 2 to 5 and the second calcium-binding domain comprises at least one calcium-binding site comprising a calcium-binding loop from Calmodulin chosen in the list consisting of SEQ ID NO: 6 to 9.

2. The polypeptide according to claim 1, wherein the polypeptide further comprises a peptide signal.

3. The polypeptide according to claim 1, wherein the polypeptide further comprises a fluorescent peptide.

4. A pharmaceutical composition comprising at least one polypeptide according to claim 1 and a pharmaceutically acceptable carrier.

5. A method of stabilizing calcium concentration and/or of inhibiting calcium signalization in vivo or in vitro, comprising contacting calcium with an effective amount of the polypeptide of claim 1.

6. A method of treating a disorder in a subject treatable by chelating calcium, comprising administering to the subject an effective amount of the polypeptide of claim 1 or a pharmaceutical composition comprising the polypeptide of claim 1 and a pharmaceutically acceptable carrier.

7. A method of treating a pathology associated with intracellular calcium signaling dysfunction, comprising administering to a subject in need thereof a therapeutic amount of the polypeptide as recited in claim 1 or a pharmaceutical composition comprising the polypeptide of claim 1 and a pharmaceutically acceptable carrier.

8. The method of claim 7, wherein the pathology associated with intracellular calcium signaling dysfunction is retinitis pigmentosa, a neurodegenerative disease, Alzheimer disease, epilepsy, stroke, cardiac dysrhythmia, heart failure, hypertension, diabetes, or cancer.

9. The polypeptide according to claim 2, wherein the peptide signal targets the polypeptide to the plasma membrane.

10. The polypeptide of claim 9, wherein the peptide signal comprises SEQ ID NO: 20 or 21 or a functional variant thereof.

11. The polypeptide according to claim 3, wherein the fluorescent peptide is selected from the group consisting of green fluorescent protein (GFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP) and red fluorescent protein (RFP).

12. The polypeptide according to claim 1, wherein the first calcium-binding domain comprises at least one calcium-binding site consisting of calcium-binding loop from Parvalbumin chosen in the list consisting of SEQ ID NO: 2 to 5.

13. The polypeptide according to claim 1, wherein the second calcium-binding domain comprises at least one calcium-binding site consisting of calcium-binding loop from Calmodulin chosen in the list consisting of SEQ ID NO: 6 to 9.

14. The polypeptide according to claim 1, wherein: the first calcium-binding domain comprising at least two calcium-binding sites comprising calcium-binding loop from Parvalbumin chosen in the list consisting of SEQ ID NO: 2 to 5 and the second calcium-binding domain comprising at least two calcium-binding sites comprising calcium-binding loop from Calmodulin chosen in the list consisting of SEQ ID NO: 6 to 9.

15. The polypeptide according to claim 1, wherein: the calcium-binding loop from Parvalbumin is chosen in the list consisting of SEQ ID NO: 4 or SEQ ID NO: 5 and the calcium-binding loop from Calmodulin is chosen in the list consisting of SEQ ID NO: 6 or SEQ ID NO: 7.

16. The polypeptide according to claim 1, wherein the first calcium-binding domain comprises of at least one calcium-binding site comprising EF-hand motifs from Parvalbumin chosen in the list consisting of SEQ ID NO: 10 to SEQ ID NO: 11, and a functional variant thereof having a sequence which has at least 95% identity with the sequence SEQ ID NO: 10 or SEQ ID NO: 11 and which is a peptide which sequence derives from SEQ ID NO: 10 or SEQ ID NO: 11 by conservative substitutions.

17. The polypeptide according to claim 1, wherein the second calcium-binding domain comprises at least one calcium-binding site comprising EF-hand motifs from Calmodulin chosen in the list consisting of SEQ ID NO: 12 to 15 and a functional variant thereof having a sequence which has at least 95% identity with the sequence chosen in the list consisting of SEQ ID NO: 12 to 15 and which is a peptide which sequence derives from the sequence chosen in the list consisting of SEQ ID NO: 12 to 15 by conservative substitutions.

18. The polypeptide according to claim 1, wherein: the first calcium-binding domain has a sequence comprising the sequence SEQ ID NO: 16 or a functional variant thereof having a sequence which has at least 95% identity with the sequence SEQ ID NO: 16 and which is a peptide which sequence derives from sequence SEQ ID NO: 16 by conservative substitutions and the second calcium-binding domain has a sequence comprising the sequence SEQ ID NO: 17 or functional variant thereof having a sequence which has at least 95% identity with the sequence SEQ ID NO: 17 and which is a peptide which sequence derives from sequence SEQ ID NO: 17 by conservative substitutions.

19. The polypeptide according to claim 1, wherein the polypeptide has the sequence SEQ ID NO: 19.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) In addition to the preceding features, the invention further comprises other features which will emerge from the following description, which refers to examples illustrating the present invention, as well as to the appended figures.

(2) FIG. 1. The polypeptide of the invention is a Ca.sup.2+ scavenger and alters cortical neuron migration in vivo. (A,B) 20 s thapsigargin (Thaps.) exposure induces an increase in the calcium concentration of control H293 cells, monitored by the FRET/CFP ratio from the FRET biosensor Twitch2B. In contrast, this elevation is drastically reduced when cells express .sup.Ca2+Sp/SpiCee. FRET ratio is coded from blue (low Ca.sup.2+) to red (high Ca.sup.2+). (C) E14.5 eGFP and mRFP co-electroporated cortical neurons are packed into a dense layer close to the marginal zone at E18.5 (top row). In contrast .sup.Ca2+Sp/SpiCee-expression prevents the development of this layer, with neurons scattered throughout the depth of the developing cortex, and the formation of heterotopia at the surface of the cortex (bottom row).

(3) FIG. 2. Subcellular restriction of Ca.sup.2+ manipulation using the polypeptide of the invention. A: .sup.Ca2+Sp/SpiCee, B: Lyn-.sup.Ca2+Sp/SpiCee, C: .sup.Ca2+Sp/SpiCee-Kras. .sup.Ca2+Sp/SpiCee was either used to globally alter Ca.sup.2+ signaling when not targeted to any cellular compartment or to target specific compartments. Lyn-.sup.Ca2+Sp/SpiCee aims to target to lipid rafts whether .sup.Ca2+Sp/SpiCee-Kras is intended to be restricted to the non-raft fraction of the plasma membrane. .sup.Ca2+Sp/SpiCee was detected in the cytoplasm whether both Lyn-.sup.Ca2+Sp/SpiCee and .sup.Ca2+Sp/SpiCee-Kras were found at the plasma membrane.

(4) FIG. 3. Plasma membrane fractionation highlighted distinct subcellular localization of Lyn-.sup.Ca2+Sp/SpiCee and .sup.Ca2+Sp/SpiCee-Kras. Presence of proteins of interest in different density gradient fraction. A: Caveolin, B: Lyn-Twitch2B, C: Lyn-.sup.Ca2+Sp/SpiCee, D: Adaptin, E: Twitch2B-Kras, F: .sup.Ca2+Sp/SpiCee-Kras. Lyn-.sup.Ca2+Sp/SpiCee was highly enriched in fraction 3 whether the localization of .sup.Ca2+Sp/SpiCee-Kras was shifted towards higher density fractions (4 to 9).

(5) FIG. 4. (A,B) Control cortical neurons electroporated at E14.5 form a dense layer close to the marginal zone at E18.5. .sup.Ca2+Sp/SpiCee-expression prevents the development of this layer, with (A) neurons scattered throughout the depth of the developing cortex (arrowhead), and (B) the formation of heterotopia at the surface of the cortex (arrowhead). (C) In P10 pups, .sup.Ca2+Sp/SpiCee-electroporated neurons have a wider spread in the cortex than controls and (D) heterotopias induced by .sup.Ca2+Sp/SpiCee are maintained (arrowhead), indicating that altering Ca.sup.2+ signaling interferes with cortical neuron migration. Box-and-whisker plot elements: center line, mean; box limits, upper and lower quartiles; whiskers, s.d. Scale bars, (A) 250 μm, (B) 100 μm, (C) 200 μm, (D) 500 μm. *P custom character0.05; ***P custom character0.001; (A,C) Two-way ANOVA and Bonferroni post hoc tests.

(6) FIG. 5. Biochemical characterization of .sup.Ca2+Sp/SpiCee. (a) .sup.Ca2+Sp/SpiCee.sup.F103W enabled to determine the dissociation constant of Ca.sup.2+ from the EF hand adjacent to the inserted tryptophan (residue 103) by competition with EGTA (Kd=0.3±0.1 nM), whereas direct Ca.sup.2+ titration was used with .sup.Ca2+Sp/SpiCee.sup.F134W to measure the Kd of the calmodulin-derived Ca.sup.2+-binding site in the vicinity of the mutation (Kd=2.8±0.9 μM). Representative titration fits are shown. (b) Stopped-flow experiments were conducted to determine the kinetic dissociation constants of .sup.Ca2+Sp/SpiCee.sup.F103W and .sup.Ca2+Sp/SpiCee.sup.F134W (k.sub.off=529±28 s.sup.−1 and k.sub.off=0.24±0.01 s.sup.−1 respectively).

(7) FIG. 6. .sup.Ca2+Sp/SpiCee does not affect cell survival. HEK293 cells were transfected with either .sup.Ca2+Sp/SpiCee or RFP. Activated Caspase 3 positive cells were immunolabeled to evaluate the number of cells undergoing apoptosis. .sup.Ca2+Sp/SpiCee-expressing cells are not more prone to enter an apoptotic program than their RFP-expressing controls. (a) Scale bar, 50 μm (b) Data are mean±s.e.m., Mann-Whitney test.

(8) FIG. 7. .sup.Ca2+Sp/SpiCee-transfected cells adapt to maintain a resting concentration of Ca.sup.2+ similar to their controls. .sup.Ca2+Sp/SpiCee- or RFP-transfected HEK293 cells were loaded with the ratiometric calcium sensor Fura-2, enabling to evaluate their intracellular calcium concentration. (a) Fura-2 was sequentially excited at 340 nm (Ca.sup.2+ bound) and 380 nm (Ca.sup.2+ free), and the intracellular Ca.sup.2+ concentration was computed based on the fluorescence of calibrated Ca.sup.2+ solutions. No difference in the resting Ca.sup.2+ concentration was detected between .sup.Ca2+Sp/SpiCee- and RFP-transfected cell in culture media containing either (a) 0.2 mM or (b) 2 mM Ca.sup.2+. (c) The Ca.sup.2+ resting concentration is higher in both .sup.Ca2+Sp/SpiCee- and RFP-transfected cells grown in 2 mM extracellular Ca.sup.2+ as compared to cells kept in 0.2 mM Ca.sup.2+, suggesting that .sup.Ca2+Sp/SpiCee does not prevent the regulation of the intracellular resting concentration of this ion. (a, b) Scale bar, 20 μm. scale bar in (b) applies to (a). (c) Box-and-whisker plot elements: center line, mean; box limits, upper and lower quartiles; whiskers, s.d.; ***P custom character0.001, Kruskal-Wallis test followed by Dunn{hacek over ( )}s multiple comparison test.

(9) FIG. 8. .sup.Ca2+Sp/SpiCee reduces the elevation of Ca.sup.2+ concentration induced by brief or longer pulses of thapsigargin. HEK293 cells were bathed with a low Ca.sup.2+ medium and challenged with a 1 min (a-c), 2 min (d-f) and 5 min (g-i) pulse of thapsigargin. .sup.Ca2+Sp/SpiCee-expressing cells display a reduced FRET/CFP ratio elevation compared to controls, and a delayed maximum response. The decay of the response is also delayed in SpiCee-expressing cells, reducing the sharpness of the response. Scale bars, 20 μm. (b, e, h) Data are mean±s.e.m. (c, f, i) Box-and-whisker plot elements: center line, mean; box limits, upper and lower quartiles; whiskers, s.d.; ***P custom character0.001, Mann-Whitney test.

(10) FIG. 9. Massive and sustained elevation of intracellular Ca.sup.2+ concentration is delayed by .sup.Ca2+Sp/SpiCee. A change of extracellular Ca.sup.2+ concentration (from 0.2 mM to 2 mM) generates a massive change in the Twitch2B FRET/CFP ratio in HEK293 cells. Cells expressing .sup.Ca2+Sp/SpiCee exhibit a change in the FRET/CFP ratio of similar magnitude, but delayed as compared to cells devoid of .sup.Ca2+Sp/SpiCee. Scale bar, 20 μm. (b) Data are mean±s.e.m. (c) Box-and-whisker plot elements: center line, mean; box limits, upper and lower quartiles; whiskers, s.d.; ***P custom character0.001, Mann-Whitney test.

(11) FIG. 10. Biochemical characterization of the .sup.Ca2+Sp/SpiCee targeting. (a, b) Lyn-.sup.Ca2+Sp/SpiCee peaks in fractions 3 in a membrane fractionation assay. (a) It coincides with the expression profile of the custom character subunit of cholera toxin (CtB, enriched in fractions 3 and 4, peaks in fraction 3) and (b) differs from the expression of Caveolin (enriched 2+.sub.sp in fraction 4). .sup.Ca2+Sp/SpiCee-Kras is mostly enriched in fraction 4, with a profile resembling (d) Caveolin, and (c) distinct from CtB. Data are mean±s.e.m.; *P custom character0.05, ***P custom character0.01, ***P custom character0.001, Two-way ANOVA and Bonferroni post hoc tests.

(12) FIG. 11. .sup.Ca2+Sp/SpiCee, Lyn-.sup.Ca2+Sp/SpiCee and .sup.Ca2+Sp/SpiCee-Kras do not affect the morphology of growing axons. Non-electroporated RGC axons display a fan-shaped growth cone at their tip which is not affected by the expression of mRFP, .sup.Ca2+Sp/SpiCee, Lyn-.sup.Ca2+Sp/SpiCee or .sup.Ca2+Sp/SpiCee-Kras. Box-and-whisker plot elements: center line, mean; box limits, upper and lower quartiles; whiskers, s.d. Scale bar, 10 μm. No significant differences are detected; Kruskall-Wallis test.

(13) FIG. 12. Cytosolic .sup.Ca2+Sp/SpiCee and Lyn-.sup.Ca2+Sp/SpiCee but not .sup.Ca2+Sp/SpiCee-Kras prevent ephrinA5- and Slit1-induced growth cone collapse. When exposed to (a) ephrinA5 or (e) slit1, mRFP-expressing growth cones exhibit the same collapse response than their non-electroporated neighbors of the same coverslips, (b, f) .sup.Ca2+Sp/SpiCee- and (c, g) Lyn-.sup.Ca2+Sp/SpiCee-expressing axons are resistant to the repellent activity of ephrinA5 and slit1, that is observed in the non-electroporated axons from the same coverslip. (d, h) In contrast, .sup.Ca2+Sp/SpiCee-Kras-expressing axons exhibit similar growth cone remodeling to their controls. Box-and-whisker plot elements: center line, mean; box limits, upper and lower quartiles; whiskers, s.d. Scale bar, 10 μm. *P custom character0.05; ***P custom character0.001; Wilcoxon paired test

EXAMPLE 1

(14) Constructs:

(15) The polynucleotide of sequence SEQ ID NO:22 5{hacek over ( )}ATGTCGATGACAGACTTGCTCAGCGCTGAGGACATCAAGAAGGCGATAG GAGCCTTTACTGCTGCAGACTCCTTCGACCACAAAAAGTTCTTCCAGATGG TGGGCCTGAAGAAAAAGAGTGCGGATGATGTGAAGAAGGTGTTCCACATT CTGGACAAAGACAAAGATGGCTTCATTGACGAGGATGAGCTGGGGTCCAT TCTGAAGGGCTTCTCCTCAGATGCCAGAGACTTGTCTGCTAAGGAAACAAA GACGCTGATGGCTGCTGGAGACAAGGACGGGGATGGCAAGATTGGGGTTG AAGAGTTCTCCACTCTGGTGGCCGAAAGCATCGATCTTAAGATGGCTGATC AGCTGACTGAAGAGCAGATTGCTGAATTTAAGGAGGCTTTCTCCCTATTCG ATAAAGATGGTGACGGCACCATCACAACCAAGGAACTGGGGACCGTCATG CGGTCACTGGGTCAGAACCCAACAGAAGCCGAGCTGCAGGATATGATCAA CGAAGTGGATGCTGATGGCAATGGCACCATTGACTTCCCAGAGTTCTTGAC TATGATGGCTAGAAAAATGAAAGACACACTTAAGGCGGATCCCGCCACCT GTACATACCCATACGATGTTCCAGATTACGCT-3{hacek over ( )}

(16) encoding a polynucleotide according to the invention, was designed in silico in frame with a tandem repeat of the nucleotide sequence encoding the Lyn Kinase N-terminus domain of sequence SEQ ID NO: 23: 5{hacek over ( )} ATGGGCTGCATCAAGAGCAAGCGCAAGGACAAGATGGGCTGCATCAAG AGCAAGCGCAAGGACAAG3:
and the desired sequences obtained as oligonucleotides from Sigma and Invitrogen, respectively. The oligos were annealed and cloned into pcDNA3-mRFP in frame with the reporter sequence. Lipid-raft-excluded and cytosolic forms were obtained by subcloning the above polynucleotide into pcDNA3 with or without the sequence encoding the CaaX-polylysine motif of Kras of sequence SEQ ID NO: 24: 5{hacek over ( )} CAAGAAGAAGAAGAAGAAGAAGAGCAAGACCAAGTGCGTGATCATG3{hacek over ( )} respectively.

(17) For expression on retinal ganglion cell (RGCs), the constructs were subcloned into pcX. Twitch2B was targeted to the membrane microdomains using the In-Fusion HD cloning kit (Clontech) and subcloned into pcDNA3 or pcX.

(18) Cell culture: HEK293T cells were kept in a 37° C., 5% CO2 incubator and transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer{hacek over ( )}s protocol and imaged the day following transfection or fixed and processed for immunocytofluorescence.

(19) Production of purified .sup.Ca2+Sp/SpiCee.sup.F134W and .sup.Ca2+Sp/SpiCee.sup.F103W: The full-length CaSponge cDNA was subcloned into a pGST-Parallel2 vector (derived from pGEX-4T-1; Amersham) in frame with the N-terminal glutathione S-transferase (GST) tag. .sup.Ca2+Sp/SpiCee.sup.F134W and .sup.Ca2+Sp/SpiCee.sup.F103W clones were prepared from .sup.Ca2+Sp/SpiCee using the QuickChange II Site-directed mutagenesis kit (Agilent Technologies). Proteins were produced in BL21 (DE3) pLysS E. coli cells. The GST-tagged proteins were purified using a glutathione Sepharose 4B column. The GST tag was cleaved using recombinant tobacco etch virus NIa proteinase. The recombinant proteins were eluted in a buffer containing 30 mM MOPS (3-Morpholinopropanesulfonic acid), pH 7.2 and 100 mM KCl. Protein concentrations were deduced from A280 measurements using a computed extinction coefficient of 5500 M.sup.−1 cm.sup.−1 for both .sup.Ca2+Sp/SpiCee.sup.F134W and .sup.Ca2+Sp/SpiCee.sup.F103W.

(20) Measurement of Ca.sup.2+ affinity for the labeled site of .sup.Ca2+Sp/SpiCee.sup.F103W (parvalbumin-derived): Ca.sup.2+ binding to the labeled site of .sup.Ca2+Sp/SpiCee.sup.F103W was monitored by measuring tryptophan fluorescence (285 nm excitation, 330 nm emission, 5 nm bandpass) at 20° C. in a 4 mm×10 mm quartz cuvette (Jasco FP-8300 spectrofluorimeter). The protein was diluted to 2.25 μM in standard buffer (30 mM MOPS-KOH pH7.2; 0.1 M KCl) and 254 μL samples were loaded in the cuvette. It was first observed that addition of CaCl.sub.2 did not increase fluorescence, whereas addition of millimolar amounts of EGTA led to large decreases (up to 27% at a final EGTA concentration of 7.5 mM). This showed that the labeled site of .sup.Ca2+Sp/SpiCee.sup.F103W was saturated with Ca.sup.2+. Dissociation constant of Ca.sup.2+ was deduced from a competition experiment in which the protein solution was titrated with EGTA. 2 μl samples of solutions containing increasing concentrations of EGTA (1.95 to 500 mM) were added to the cuvette. Fluorescence was measured after each addition. Fluorescence values were corrected for dilution and plotted as a function of the concentration of EGTA. Data were fitted to the quadratic equation 1 as described previously by Weeks, K. M. & Crothers (D. M. Biochemistry 31, 10281.sup.-10287 (1992)), assuming that the two parvalbumin-derived sites were equivalent for Ca.sup.2+ binding.

(21) Measurement of Ca.sup.2+ affinity for the labeled site of .sup.Ca2+Sp/SpiCee.sup.F134W (calmodulin-derived): Ca.sup.2+ binding to the first calmodulin site of .sup.Ca2+Sp/SpiCee.sup.F134W was monitored by measuring tryptophan fluorescence (285 nm excitation, 340 nm emission, 5 nm bandpass) at 20° C. .sup.Ca2+Sp/SpiCee.sup.F134W was diluted to 1.6 μM in standard buffer and 258 μL samples were loaded in the cuvette. Addition of CaCl.sub.2 increased fluorescence, whereas addition of millimolar amounts of EGTA led to fluorescence decrease, showing that the calmodulin-derived sites of .sup.Ca2+Sp/SpiCee were partially filled with Ca.sup.2+ in the sample. The value of the fluorescence of the protein with Ca.sup.2+-free calmodulin sites was measured in the presence of 2 mM EGTA, a concentration found to be saturating. Total concentration of Ca.sup.2+ in the sample (excluding Ca.sup.2+ bound to the parvalbumin derived sites of .sup.Ca2+Sp/SpiCee) was measured as described above using Quin-2 and found to be 2.5 μM. Dissociation constant of Ca.sup.2+ from the labeled site of .sup.Ca2+Sp/SpiCee.sup.F134W was deduced from an experiment where the protein solution was titrated with increasing amounts of CaCl.sub.2 (2 μL additions of solutions from 0.05 to 6.25 mM). Fluorescence values were corrected for dilution, and plotted as a function of total Ca.sup.2+ concentration (added Ca.sup.2+ plus 2.5 μM). Data were fitted to a binding curve assuming that the two calmodulin sites were equivalent for Ca.sup.2+ binding.

(22) Measurement of kinetic dissociation constants: Values of kinetic dissociation constants (k.sub.off) for the tryptophan-labeled Ca binding sites of .sup.Ca2+/Sp/SpiCee (.sup.Ca2+Sp/SpiCee.sup.F103W and .sup.Ca2+Sp/SpiCee.sup.F134W) were measured by mixing proteins with appropriate amounts of EGTA at 20° C. in an Applied Photophysics stopped flow apparatus. Reacting solutions were excited at 285 nm and fluorescence was measured using a photomultiplier equipped with a 320 nm cutoff filter. For the .sup.Ca2+Sp/SpiCee.sup.F103W, the protein (2.3 μM in standard buffer) was mixed 1:1 with 15 mM EGTA in the same buffer. For .sup.Ca2+Sp/SpiCee.sup.F134W, the protein (1.7 μM in standard buffer plus 50 μM CaCl.sub.2) was mixed 1:1 with 4 mM EDTA in standard buffer plus 50 μM CaCl.sub.2. Fluorescence was recorded as a function of time and data were fitted with single exponential curves from which rate constants were derived. Reported values are the mean±standard deviation from three measurements.

(23) Cell death assay: HEK293 Cells were plated on poly-lysine-coated coverslips and transfected the following day with a pCX-mRFP or a pCX-.sup.Ca2+Sp/SpiCee vector using Lipofectamine 2000 (Thermo Fisher) following the manufacturer{hacek over ( )}s instructions. Three days after plating, cells were either fixed with 4% paraformaldehyde and processed for immunocytochemistry with the antibodies against Cleaved Caspase 3 (Asp175; Cell Signaling; lot #0043) and -tubulin (Sigma) or treated with the CellEvent Caspase 3/7 Green Detection Reagent (Thermo Fisher) for 30 minutes and then fixed and labeled with an-tubulin antibody.

(24) Membrane fractionation by detergent-free method: Electroporated retinas were pelleted (195 g for 5 min at 4° C.) and resuspended in 1.34 mL of 0.5 M sodium carbonate, pH 11.5, with protease inhibitor cocktail and phosphatase inhibitor cocktail 1, 2 and 3 (Sigma-Aldrich). The homogenate was sheared through a 26-gauge needle and sonicated three times for 20 s bursts. The homogenate was adjusted to 40% sucrose by adding 2.06 mL of 60% sucrose in MBS (25 mM MES, pH 6.4, 150 mM NaCl, and 250 mM sodium carbonate), placed under a 5.sup.-30% discontinuous sucrose gradient, and centrifuged at 34,000 rpm for 15.sup.-18 h at 4° C. in a Beckman SW 41Ti rotor. Nine fractions (1.24 mL each) were harvested from the top of the tube mixed with 9 volumes of MBS, and centrifuged at 40,000 rpm for 1 h at 4° C. (Beckman SW-41Ti rotor). Supernatants were discarded, and membrane pellets were resuspended in 100 μl of 1% SDS.

(25) For immunoblotting, samples were separated on 4-15% Mini-Protean TGX Tris-Glycine-buffer SDS PAGE (Biorad) and transferred onto 0.2 μm Trans-Blot Turbo nitrocellulose membranes (Biorad). Membranes were blocked for one hour at room temperature in 1×TBS (10 mM Tris pH 8.0, 150 mM NaCl) supplemented with 5% (w/v) dried skim milk powder. Primary antibody incubation was carried out overnight at 4° C., with the following antibodies: rabbit anti-GFP (1/200; A11122; Life Technologies), rabbit anti-DsRed (1/200; 632476; Clontech), rabbit anti-custom character-Adaptin (1/200; sc-10762; Santa Cruz) and rabbit anti-Caveolin (1/500; 610060; BD Transduction Laboratories). A goat anti-rabbit-HRP coupled secondary antibody was used for detection (Jackson ImmunoResearch, West Grove, Pa.). After antibody incubations, membranes were extensively washed in TBS T (TBS containing 2.5% Tween-20). Western blots were visualized using the enhanced chemiluminescence method (ECL prime Western Blotting detection reagent, Amersham).

(26) Collapse assay: Retinas of E15 mice were electroporated with mRFP, Lyn-Calcium Sponge, Calcium Sponge or Calcium Sponge-Kras using two poring pulses (square wave, 175V, 5 ms duration, with 50 ms interval) followed by four transfer pulses (40V, 50 ms and 950 ms interpulse). Retinas were dissected and kept 24 hours in culture medium (DMEM-F12 supplemented with glutamine (Sigma Aldrich), penicillin/streptomicin (Sigma Aldrich), BSA (Sigma Aldrich) and glucose), in a humidified incubator at 37° C. and 5% CO2. The day after, they were cut into 200 μm squares with a Tissue-Chopper (McIlwan) and explants were plated on glass coverslips coated with poly-L-lysine and Laminin (Sigma Aldrich). Cells were cultured for 24 hours in culture medium supplemented with 0.4% methyl cellulose and treated with rmSlit-1 (R&D Systems) for 1 hour.

(27) Immunodetection: Retinal explants, or Hek cells coexpressing the targeted versions of Calcium Sponge and GFP or the targeted versions of Twitch2B and mRFP, were fixed with 4% PFA in PB for 30 minutes, permeabilyzed blocked and with 1% Triton and 3% BSA in PBS, then immunized against DsRed (Clontech) followed by a secondary antibody coupled to AlexaFluor 594 (Invitrogen) and GFP (invitrogen) or -Tubulin (Sigma) followed by a secondary antibody coupled to AlexaFluor 488 (Invitrogen).

(28) Imaging: Images were acquired with an inverted DMI6000B epifluorescence microscope (Leica) coupled to a 40× oil-immersion objective (N.A. 1.3) and the software Metamorph (Molecular Devices). For live imaging experiments, cells were perfused with HBS buffer with 0.2 or 2 mM CaCl. Thapsigargin was used at 1 mM). Images were acquired simultaneously for the CFP (483/32 nm) and YFP (542/27) channels every 20 seconds. Images were processed in ImageJ, corrected for background and bleedthrough and then the ratio CFP/YFP was calculated. Confocal images were acquired with a 63× oil immersion objective (N.A. 1.45) and a Z-stack containing the whole specimen was sampled at nyquist frequency. Images were rendered in ImageJ and Photoshop.

(29) Statistics: Two-Way ANOVA and Bonferroni post-hoc tests were calculated with GraphPad Prism (GraphPad Software Inc.). **=p<0.001

(30) Results:

(31) An example of a polypeptide according to the invention, hereafter designated .sup.Ca2+Sp, Calcium Sponge, SpiCee, or .sup.Ca2+Sp/SpiCee those three terms referring to the exact same peptide, was designed as a fusion protein containing the Ca.sup.2+ binding domains of both Parvalbumin and Calmodulin.

(32) The fluorescent protein mRFP was fused to this construct for easy identification of sponge-expressing cells in fixed or live cell experiments.

(33) To characterize the Ca.sup.2+ binding properties of .sup.Ca2+Sp/SpiCee, we used the tryptophan fluorescence of two variants of .sup.Ca2+Sp/SpiCee (.sup.Ca2+Sp/SpiCee.sup.F134W and .sup.Ca2+Sp/SpiCee.sup.F103W). Each of these mutants enables the evaluation of the Ca.sup.2+ binding properties of either the calmodulin or the parvalbumin moiety (.sup.Ca2+Sp/SpiCee.sup.F134W and .sup.Ca2+Sp/SpiCee.sup.F103W respectively). Using Ca.sup.2+ titration, we found that .sup.Ca2+Sp/SpiCee.sup.F134W has a Kd for Ca.sup.2+ of 2.8±0.9 μM and stopped-flow experiments were performed to evaluate its dissociation rate, koff=529±28 s.sup.−1 at 20° C. (FIG. 5). The high affinity of the labeled parvalbumin site (.sup.Ca2+Sp/SpiCee.sup.F103W) prevented the use of Ca.sup.2+ titration and the Kd was measured by competition with EGTA. The dissociation constant of .sup.Ca2+Sp/SpiCee.sup.F103W is Kd=0.3±0.1 nM and a koff=0.24±0.01 s.sup.−1 (FIG. 5). These features match the Ca.sup.2+ binding properties of the full length parvalbumin and calmodulin proteins and confirm that .sup.Ca2+Sp/SpiCee is a bimodal Ca.sup.2+ chelator combining sites with low and high affinity for Ca.sup.2+, .sup.Ca2+Sp/SpiCee was expressed in HEK293 cells to evaluate its behavior in cellulo. Expressing .sup.Ca2+Sp/SpCee did not affect cell survival (FIG. 6) nor the resting Ca.sup.2+ concentration (FIG. 7), suggesting that .sup.Ca2+Sp/SpiCee-expressing cells can maintain a resting Ca.sup.2+ concentration compatible with their survival, within the previously reported range. .sup.Ca2+Sp/SpiCee-transfected cells were also able to adapt their resting Ca.sup.2+ concentration to the amount of Ca.sup.2+ in the culture medium (FIG. 7). These observations are similar to the reported properties of pharmacological Ca.sup.2+ buffers.

(34) The buffering properties of .sup.Ca2+Sp/SpiCee were investigated using Twitch2B, an optimized Ca.sup.2+ FRET sensor. The FRET over CFP ratio, reflecting intracellular Ca.sup.2+ concentration, was monitored in Twitch2B-expressing HEK293 cells. The release of intracellular Ca.sup.2+ stores induced by a 20 s pulse of thapsigargin induced an increase in FRET/CFP ratio, that was drastically reduced in cells co-expressing .sup.Ca2+Sp/SpiCee (FIG. 1). The lack of FRET/CFP ratio elevation in presence of thapsigargin reveals that .sup.Ca2+Sp/SpiCee compete with other Ca.sup.2+-binding proteins, including Twitch2B, preventing them to bind efficiently to Ca.sup.2+. To investigate the limits of Ca.sup.2+ buffering by .sup.Ca2+Sp/SpiCee, cells co-expressing .sup.Ca2+Sp/SpiCee and Twitch2B were exposed to longer thapsigargin stimulation (1, 2 or 5 min). In all cases, .sup.Ca2+Sp/SpiCee reduced and delayed the Ca.sup.2+ elevation detected by the biosensor (FIG. 8). Extreme intracellular Ca.sup.2+ elevations were induced by increasing the extracellular Ca.sup.2+ level (from 0.2 mM to 2 mM), after prolonged thapsigargin exposure. .sup.Ca2+Sp/SpiCee induced a delay in the Ca.sup.2+ elevation detected by Twitch2B (FIG. 9). This demonstrate that .sup.Ca2+Sp/SpiCee is able to alter pharmacologically-induced Ca.sup.2+ signaling in a wide range of concentration of this second messenger.

(35) To assess .sup.Ca2+Sp/SpiCee capability to interfere with physiological processes in vivo, .sup.Ca2+Sp/SpiCee was expressed in newly generated cortical neurons using in utero electroporation of the lateral ventricle in 14.5 day-old (E14.5) mice embryos. The migration of early born cortical neurons is a Ca.sup.2+−dependent process. The position of migrating electroporated neurons was assessed at E18.5. The majority of GFP and mRFP co-electroporated neurons reached the cortical plate, and form a dense layer of neuron near the marginal zone (FIG. 4). In contrast, many neurons co-expressing GFP and .sup.Ca2+Sp/SpiCee exhibited reduced migration and were found throughout the neocortex, including the subventricular zone. In addition, several electroporated cells failed to stall at the cortical plate, overshooting towards the marginal zone and causing heterotopias. (FIG. 1). Several electroporated neurons also failed to stall at the cortical plate, overshooting toward the marginal zone and causing heterotopias in 7 out of 9 animals, misplaced neurons were found in only 2 out of 10 mRFP-electroporated embryos (FIG. 4). At postnatal day 10, .sup.Ca2+Sp/SpiCee-expressing neurons covered a thicker layer of the cortex than their mRFP-electroporated controls (FIG. 4). Furthermore, the heterotopias detected during embryonic development were maintained at post-natal stages in .sup.Ca2+Sp/SpiCee-expressing animals (10 out of 12), whereas they were just found in 1 mRFP electroporated pup (5 electroporated animals, FIG. 4). This demonstrates that Ca.sup.2+ buffering by .sup.Ca2+Sp/SpiCee is sufficient to alter the physiological Ca.sup.2+ modulation required for correct neuronal migration in vivo.

(36) Calcium signals in the cell are often restricted to subcellular compartments. Since genetic-encoding confers the ability to restrict the expression of the constructs to a specific organelle, the functionality of .sup.Ca2+Sp/SpiCee in this scenario was assessed. A tandem of palmitoylation-myristoylation motifs from Lyn Kinase was fused to the n-terminus of .sup.Ca2+Sp/SpiCee to target lipid rafts, a compartment of the plasma membrane (Lyn-.sup.Ca2+Sp/SpiCee). Alternatively .sup.Ca2+Sp/SpiCee was excluded from lipid rafts but still targeted to the plasma membrane by the c-terminus fusion of the CaaX-polylysine motif derived from K-Ras (.sup.Ca2+Sp/SpiCee-Kras). These targeting sequences have been previously used and validated. Using detergent-free plasma membrane fractionation methods, Lyn-.sup.Ca2+Sp/SpiCee was found enriched in lipid raft fractions, whereas .sup.Ca2+Sp/SpiCee localization was shifted towards the non-raft fractions (FIG. 2), demonstrating that these variants of.sup.Ca2+Sp/SpiCee are targeted to distinct membrane compartments. Their specific distribution matches the profile of different membrane markers, the custom character subunit of cholera toxin (CtB) and caveolin respectively (FIG. 10).

(37) Using Lyn-.sup.Ca2+Sp/SpiCee and .sup.Ca2+Sp/SpiCee-Kras, the potential of .sup.Ca2+Sp/SpiCee to manipulate specific physiological Ca.sup.2+ dependent cellular processes depending on its subcellular localization was investigated. To this aim the response of retinal axons to the repellent guidance molecules slit1 and ephrinA5 was analyzed, a process requiring calcium signaling. In control conditions, including untransfected axons and mRFP-electroporated axons, slit1 and ephrinA5 induced the collapse of non-electroporated or mRFP-expressing growth cones, characterized by the depolymerization of lamellipodial actin and drastic reduction of the growth cone area (FIGS. 11 and 12). The expression of .sup.Ca2+Sp/SpiCee in the cytosol completely abolished slit1- and ephrinA5-induced growth cone collapse, confirming the requirement of calcium signaling (FIG. 12). Similarly, Lyn-.sup.Ca2+Sp/SpiCee-expressing axons showed no increase in collapse upon Slit-1 treatment (FIG. 12). In contrast, .sup.Ca2+Sp/SpiCee-Kras-expressing axons were indistinguishable from controls (FIG. 12), demonstrating that the collapse-inducing signaling cascades generated by slit1 and ephrinA5 require compartmentalized calcium signaling in lipid rafts, and that targeted versions of .sup.Ca2+Sp/SpiCee achieve specific manipulation of distinct subcellular and Ca.sup.2+ dependent signaling cascades.

(38) In conclusion, the polypeptide of the invention functions as a Ca.sup.2+ scavenger that has the capability to interfere with Ca.sup.2+-dependent physiological functions. The polypeptide of the invention has the potential to alter calcium responses in a cell-specific manner and with subcellular resolution, opening new fields for the precise study of signaling cascades and paving the way for therapeutic implementation.