DNA aptamers, method for inhibiting human galectin-1 and method of treating a mammal in need thereof

Abstract

DNA aptamers that recognize the human galectin-1 hGal1 with a very high degree of binding affinity and specificity, and inhibit hGal1-induced hemagglutination, besides presenting antiproliferative effects in seven human solid tumor cell lines are disclosed. The cytotoxicity tests demonstrated that, among 41 sequences tested, four of them (SEQ ID NO.: 04, SEQ ID NO.: 09, SEQ ID NO.:10 and, SEQ ID NO.:12) have the best capacity of inhibiting the cell growth in tumor cell. Additionally, the aptamers developed in the present invention will be used, for example, in the treatment of disorders related to the binding of human galectin-1 to a ligand in a mammal, wherein said disorder is selected from the group consisting of inflammation, fibrosis, septic shock, cancer, autoimmune diseases, metabolic disorders, heart disease, heart failure, pathological angiogenesis, and eye diseases, mainly cancer.

Claims

1. Aptamers of nucleic acid comprising formula (1) TABLE-US-00011 AGCTGACACAGCAGGTTGGTGCXan.sub.1Xan.sub.2Xan.sub.3Xan.sub.4Xan.sub.5Xan.sub.6Xan.sub.7 Xan.sub.8Xan.sub.9Xan.sub.10Xan.sub.11Xan.sub.12Xan.sub.13Xan.sub.14Xan.sub.15Xan.sub.16Xan.sub.17Xan.sub.18 Xan.sub.19Xan.sub.20Xan.sub.21Xan.sub.22Xan.sub.23Xan.sub.24Xan.sub.25Xan.sub.26Xan.sub.27Xan.sub.28Xan.sub.29 Xan.sub.30Xan.sub.31Xan.sub.32Xan.sub.33Xan.sub.34Xan.sub.35Xan.sub.36Xan.sub.37Xan.sub.38Xan.sub.39Xan.sub.40 Xan.sub.41Xan.sub.42Xan.sub.43Xan.sub.44Xan.sub.45Xan.sub.46Xan.sub.47Xan.sub.48Xan.sub.49Xan.sub.50Xan.sub.51 Xan.sub.52CCGAGTCGAGCAATCTCGAAAT formula (1) (SEQ ID NO: 46) wherein: Xan.sub.1, Xan.sub.6, Xan.sub.7, Xan.sub.8, Xan.sub.9, Xan.sub.10, Xan.sub.11, Xan.sub.12, Xan.sub.16, Xan.sub.17, Xan.sub.18, Xan.sub.26, Xan.sub.28, Xan.sub.29, Xan32, Xan.sub.34, Xan.sub.35, Xan.sub.36, Xan.sub.40, Xan.sub.41, Xan.sub.42, Xan.sub.48, Xan.sub.49, Xan.sub.50, Xan.sub.51 and Xan.sub.52 are A, T, C, G or absent; Xan.sub.2, Xan.sub.3, Xan.sub.4, Xan.sub.5, Xan.sub.13, Xan.sub.14, Xan.sub.15, Xan.sub.19, Xan.sub.20, Xan.sub.21, Xan.sub.22, Xan.sub.23, Xan.sub.24, Xan.sub.25, Xan.sub.27, Xan.sub.30, Xan.sub.31, Xan.sub.33, Xan.sub.37, Xan.sub.38, Xan.sub.39, Xan.sub.43, Xan.sub.44 and Xan.sub.45 are A, T, C, G; Xan.sub.46 is A, T, C or absent; and Xan.sub.47 is T, C, G or absent, wherein the aptamers are chemically modified or not.

2. Aptamers according to claim 1, wherein the sequence of formula 1 is represented by any one of SEQ ID NO: 1 to SEQ ID NO: 20 or variants thereof with the same or highly similar tertiary structure that bind to the amino acid sequence SEQ ID NO. 42.

3. Aptamers according to claim 1, wherein the aptamers inhibit the binding of human Galectin-1 to a ligand in a human, and or inhibiting the human Galectin-1 dimer formation, and/or causing the dissociation of human Galectin-1 dimeric form.

4. A method for treating a disorder relating to the binding of human galectin-1 to a ligand in a human, wherein said disorder is cancer, the method comprising administering the aptamers according to claim 1.

5. The method according to claim 4, wherein the pathological angiogenesis is neovascularization related to cancer.

6. The method according to claim 4, wherein the cancer is selected from the group consisting of ovarian cancer, squamous cell carcinoma, a cancer of the digestive system, stomach cancer, liver cancer, colon cancer, a cancer of the thyroid, a cancer of the endometrium, adenocarcinoma of the endometrium, uterine cancer, uterine adenocarcinoma, a uterine smooth muscle tumor, breast cancer, prostate cancer, bladder cancer, a head cancer, a neck cancer, a glioma, a kidney cancer, pancreatic cancer, pancreatic ductal adenocarcinoma, nonsmall-cell lung cancer, and melanoma.

7. A method for inhibiting human Galectin-1, wherein the method comprises contacting a human cancer cell with an effective amount of a galectin-1-targeting compound comprising the aptamers according to claim 1.

8. The method of claim 7, wherein said aptamers have an affinity for the hydrophobic dimerization interface of galectin-1.

9. The method of claim 7, wherein the method inhibits growth of the human cancer cell, proliferation of the human cancer cell, and/or inhibits tumor metastasis.

10. The method of claim 7, wherein the method comprises the association of the galectin-1 targeting compound with chemotherapy drugs.

11. A method for treating cancer in a human in need thereof comprising administering a therapeutically effective amount of aptamers according to claim 1.

12. Aptamers of nucleic acid comprising formula (2) TABLE-US-00012 AGCTGACACAGCAGGTTGGTGCXan.sub.1Xan.sub.2Xan.sub.3Xan.sub.4Xan.sub.5AXan.sub.6Xan.sub.7 Xan.sub.8Xan.sub.9Xan.sub.10Xan.sub.11Xan.sub.12Xan.sub.13Xan.sub.14Xan.sub.15Xan.sub.16Xan.sub.17Xan.sub.18 Xan.sub.19Xan.sub.20Xan.sub.21Xan.sub.22Xan.sub.23Xan.sub.24Xan.sub.25Xan.sub.26Xan.sub.27Xan.sub.28Xan.sub.29 Xan.sub.30Xan.sub.31Xan.sub.32Xan.sub.33Xan.sub.34Xan.sub.35Xan.sub.36Xan.sub.37Xan.sub.38Xan.sub.39Xan.sub.40 Xan.sub.41Xan.sub.42Xan.sub.43Xan.sub.44AXan.sub.45Xan.sub.46Xan.sub.47Xan.sub.48CCGAGTCGAGCAA TCTCGAAAT formula (2) (SEQ ID NO: 47) wherein: Xan.sub.1 and Xan.sub.45 are C or is absent; Xan.sub.2, Xan.sub.14, Xan.sub.17, Xan.sub.27, Xan.sub.30, Xan.sub.34, Xan.sub.36 and Xan.sub.48 are A, C or G; Xan.sub.3, Xan.sub.4, Xan.sub.9, Xan.sub.10, Xan.sub.16, Xan.sub.25, Xan.sub.33 and Xan.sub.40 are A or C; Xan.sub.5, Xan.sub.7, Xan.sub.20, Xan.sub.22, Xan.sub.32, Xan.sub.37 and Xan.sub.38 are A, C or T; Xan.sub.6, Xan.sub.8, Xan.sub.11, Xan.sub.29, Xan.sub.41 and Xan.sub.47 are A or G; Xan.sub.12, Xan.sub.24, Xan.sub.31 and Xan.sub.46 are A, G or T; Xan.sub.15, Xan.sub.21, Xan.sub.23 and Xan.sub.35 are C or G; Xan.sub.18 and Xan.sub.43 are G or T; Xan.sub.19, Xan.sub.39 and Xan.sub.44 are A or T; Xan.sub.26 and Xan.sub.42 are C, G or T; Xan.sub.28 is C or T, wherein the aptamers are chemically modified or not.

13. Aptamers according to claim 12, wherein the sequence of formula 2 is represented by any one of SEQ ID NO: 4, 9, 10 and 12 or variants thereof with the same or highly similar tertiary structure that bind to the amino acid sequence SEQ ID NO. 42.

14. Aptamers according to claim 12, wherein the aptamers inhibit the binding of human Galectin-1 to a ligand in a human; inhibit the human Galectin-1 dimer formation; and/or cause the dissociation of human Galectin-1 dimeric form.

15. A method for treating a disorder relating to the binding of human galectin-1 to a ligand in a human, wherein said disorder is cancer, the method comprising administering the aptamers according to claim 12.

16. The method according to claim 15, wherein the pathological angiogenesis is neovascularization related to cancer.

17. The method according to claim 15, wherein the cancer is selected from the group consisting of ovarian cancer, squamous cell carcinoma, a cancer of the digestive system, stomach cancer, liver cancer, colon cancer, a cancer of the thyroid, a cancer of the endometrium, adenocarcinoma of the endometrium, uterine cancer, uterine adenocarcinoma, a uterine smooth muscle tumor, breast cancer, prostate cancer, bladder cancer, a head cancer, a neck cancer, a glioma, a kidney cancer, pancreatic cancer, pancreatic ductal adenocarcinoma, nonsmall-cell lung cancer, and melanoma.

18. A method for inhibiting human Galectin-1, wherein the method comprises contacting a human cancer cell with an effective amount of a galectin-1-targeting compound comprising the aptamers according to claim 12.

19. The method of claim 18, wherein said aptamers have an affinity for the hydrophobic dimerization interface of galectin-1.

20. The method of claim 18, wherein the method inhibits growth of the human cancer cell, proliferation of the human cancer cell, and/or inhibits tumor metastasis.

21. The method of claim 18, wherein the method comprises the association of the galectin-1 targeting compound with chemotherapy drugs.

22. A method for treating cancer in a human in need thereof comprising administering a therapeutically effective amount of aptamers according to claim 12.

23. Aptamers of nucleic acid comprising formula (3) TABLE-US-00013 ATTTCGAGATTGCTCGACTCGGXan.sub.1Xan.sub.2Xan.sub.3Xan.sub.4Xan.sub.5Xan.sub.6Xan.sub.7 Xan.sub.8Xan.sub.9Xan.sub.10Xan.sub.11Xan.sub.12Xan.sub.13Xan.sub.14Xan.sub.15Xan.sub.16Xan.sub.17Xan.sub.18 Xan.sub.19Xan.sub.20Xan.sub.21Xan.sub.22Xan.sub.23Xan.sub.24Xan.sub.25Xan.sub.26Xan.sub.27Xan.sub.28Xan.sub.29 Xan.sub.30Xan.sub.31Xan.sub.32Xan.sub.33Xan.sub.34Xan.sub.35Xan.sub.36Xan.sub.37Xan.sub.38Xan.sub.39Xan.sub.40 Xan.sub.41Xan.sub.42Xan.sub.43Xan.sub.44Xan.sub.45Xan.sub.46Xan.sub.47Xan.sub.48Xan.sub.49Xan.sub.50Xan.sub.51 GCACCAACCTGCTGTGTCAGCT formula (3) (SEQ ID NO: 48) wherein: Xan.sub.1, Xan.sub.2, Xan.sub.5, Xan.sub.6, Xan.sub.15, Xan.sub.22, Xan.sub.23, Xan.sub.34, Xan.sub.35, Xan.sub.49, Xan.sub.50 and Xan.sub.51 are A, T, C, G or absent; Xan.sub.3, Xan.sub.4, Xan.sub.7, Xan.sub.8, Xan.sub.9, Xan.sub.10, Xan.sub.11, Xan.sub.12, Xan.sub.13, Xan.sub.14, Xan.sub.16, Xan.sub.17, Xan.sub.18, Xan.sub.19, Xan.sub.20, Xan.sub.24, Xan.sub.25, Xan.sub.26, Xan.sub.27, Xan.sub.28, Xan.sub.29, Xan.sub.30, Xan.sub.31, Xan.sub.32, Xan.sub.33, Xan.sub.36, Xan.sub.37, Xan.sub.38, Xan.sub.39, Xan.sub.40, Xan.sub.41, Xan.sub.42, Xan.sub.43, Xan.sub.44, Xan.sub.45, Xan.sub.46 and Xan.sub.48 are A, T, C, G; Xan.sub.21 is C, G or T; and Xan.sub.47 is A, G or T, wherein the aptamers are chemically modified or not.

24. Aptamers according to claim 23, wherein the sequence of formula 3 is represented by any one of SEQ ID NO: 21 to SEQ ID NO: 41 or variants thereof with the same or highly similar tertiary structure that bind to the amino acid sequence SEQ ID NO. 42.

25. Aptamers according to claim 23, wherein the aptamers inhibit the binding of human Galectin-1 to a ligand; inhibit the human Galectin-1 dimer formation; and/or cause the dissociation of human Galectin-1 dimeric form.

26. A method for treating a disorder relating to the binding of human galectin-1 to a ligand in a human, wherein said disorder is cancer, the method comprising administering the aptamers according to claim 23.

27. The method according to claim 26, wherein the pathological angiogenesis is neovascularization related to cancer.

28. The method according to claim 26, wherein the cancer is selected from the group consisting of ovarian cancer, squamous cell carcinoma, a cancer of the digestive system, stomach cancer, liver cancer, colon cancer, a cancer of the thyroid, a cancer of the endometrium, adenocarcinoma of the endometrium, uterine cancer, uterine adenocarcinoma, a uterine smooth muscle tumor, breast cancer, prostate cancer, bladder cancer, a head cancer, a neck cancer, a glioma, a kidney cancer, pancreatic cancer, pancreatic ductal adenocarcinoma, nonsmall-cell lung cancer, and melanoma.

29. A method for inhibiting human Galectin-1, wherein the method comprises contacting a human cancer cell with an effective amount of a galectin-1-targeting compound comprising the aptamers according to claim 23.

30. The method of claim 29, wherein said aptamers have an affinity for the hydrophobic dimerization interface of galectin-1.

31. The method of claim 29, wherein the method inhibits growth of the human cancer cell, proliferation of the human cancer cell, and/or inhibits tumor metastasis.

32. The method of claim 29, wherein the method comprises the association of the galectin-1 targeting compound with chemotherapy drugs.

33. A method for treating cancer in a human in need thereof comprising administering a therapeutically effective amount of aptamers according to claim 23.

34. A nucleotide sequence being at least 80% or more, similar to a nucleotide sequence selected from SEQ ID NOs. 1 to 41 or variants thereof or highly similar to their tertiary structure that bind specifically to the amino acid sequence SEQ ID NO. 42 (hGal1), with an affinity (Kd) of less than 70 uM.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) In order to obtain a complete and full overview of the object of this invention, reference figures are presented, as follows:

(2) FIG. 1 shows the Analysis of interaction between hGal1 and AptaGal1 by Thermal Shift Assay (TSA) and Fluorescence methods, wherein FIG. 1A represents the Tm variation and FIG. 1B represents the thermal displacement profile at melting temperature of the native galectin-1 human as a function of aptamer concentration. 0-40 μM of SEQ ID NO.: 4 were incubated with 5 μM of hGal1, and fluorescence was monitored by Sypro Orange fluorescence upon thermal denaturation of gall. Decrease in thermal stability of native hGal1 was observed. Figure C represents the Fluorescence Emission Spectra of hGal1 when it was titrated with 0 to 7.2 μM of aptamer. All concentrations reduced the intensity of fluorescence of hGal1. Figure D represents the Plotter of fluorescence quenching caused by aptmer SEQ ID NO.: 4 versus aptamer log concentration. The apparent KD and the interacting number sites were estimated by Stern-Volmer equation, log((F0−F)/F)=Log(1/kd)+n.Math.log Q.

(3) FIG. 2 shows the Inhibitory effect on hemagglutination promoted by aptamer SEQ ID NO.: 4, wherein FIG. 2A represents the erythrocytes that were incubated with 5 μM of rhgal in a presence of 0, 5, 10, 15, 20, 30 and 40 μM of AptaGal1. From 10 to 40 μM of AptaGal1, Gal1 lost the ability to form erythrocyte lattice and this effect occurs in a dose-dependent manner. The positive hemagglutination control is represented by 0 μM of SEQ ID NO.: 4. FIG. 2B shows the data expressed as a relative hemagglutination (%) in relation to the positive control.

(4) FIG. 3 shows a 4-parameter logistic regression to define the IC50 values (concentration to inhibit 50% of cell growth). TGI (concentration for total cell growth inhibition) and LC50 (concentration for 50% cell death) of the reference item Cisplatin against tumor lines MCF-7 (A). DU-145 (B). A-375 (C). HT-29 (D). HCT 116 (E). SK-BR-3 (F). OVCAR-3 (G) and normal human NHF fibroblasts (H).

(5) FIG. 4 shows a 4-parameter logistic regression to define the IC50 values (concentration for 50% inhibition of cell growth). TGI (concentration for total cell growth inhibition) and LC50 (concentration for 50% cell death) of the reference item Paclitaxel against tumor lines MCF-7 (A). DU-145 (B). A-375 (C). HT-29 (D). HCT 116 (E). SK-BR-3 (F). OVCAR-3 (G) and normal human NHF fibroblasts (H).

(6) FIG. 5 illustrates a 4-parameter logistic regression to define the IC50 values (concentration for 50% inhibition of cell growth). TGI (concentration for total cell growth inhibition) and LC50 (concentration for 50% cell death) of the test items against the DU-145 tumor line.

(7) FIG. 6 shows a 4-parameter logistic regression for defining the IC50 values (concentration for 50% inhibition of cell growth). TGI (concentration for total cell growth inhibition) and LC50 (concentration for 50% cell death) of the test items against the MCF-7 tumor line.

(8) FIG. 7 shows a logistic regression of 4 parameters to define the IC 50 values (concentration for inhibition of 50% of cell growth). TGI (concentration for total cell growth inhibition) and LC50 (concentration for 50% cell death) of the test items against the tumor line A-375.

(9) FIG. 8 shows a 4-parameter logistic regression for defining IC50 values (concentration for inhibiting 50% cell growth). TGI (concentration for total cell growth inhibition) and LC50 (concentration for 50% cell death) of the test items against the HT-29 tumor line.

(10) FIG. 9 shows a 4-parameter logistic regression to define the IC50 values (concentration for 50% inhibition of cell growth), TGI (concentration for total inhibition of cell growth) and LC50 (concentration for 50% cell death) of test items against the HCT 116 tumor line.

(11) FIG. 10 shows a 4-parameter logistic regression to define the IC50 values (concentration for 50% cell growth inhibition), TGI (concentration for total cell growth inhibition) and LC50 (concentration for 50% cell death) of test items against the SK-BR-3 tumor line.

(12) FIG. 11 shows a 4-parameter logistic regression to define the IC50 values (concentration for inhibition of 50% cell growth), TGI (concentration for total inhibition of cell growth) and LC50 (concentration for 50% cell death) of test items against the tumor line OVCAR-3.

(13) FIG. 12 shows a 4-parameter logistic regression to define the IC50 values (concentration for 50% inhibition of cell growth), TGI (concentration for total inhibition of cell growth) and LC50 (concentration for 50% cell death) of test items against the NHF cell line.

(14) FIG. 13 illustrates the putative binding mode between hGal-1 and SEQ ID NO.: 4. The protein is shown as green cartoon with surface with the hydrophobic dimerization interface highlighted in gray. Galactose is shown as yellow sticks, Glucose is shown as orange sticks, solvent exposed cysteine side chains are shown as red spheres and the aptamer is shown as blue cartoon; wherein FIG. 13 A illustrates an angle showing the carbohydrate recognition site; FIG. 13B illustrates an angle showing the dimerization interface; and FIG. 13C illustrates an angle showing the interaction between the cysteine side chains and the aptamer.

(15) FIG. 14 illustrates the physicochemical complementarity in the putative binding mode between hGal-1 and aptamer 4. The protein is shown as a solvent accessible surface colored according to the electrostatic potential in which blue represents +1 kT/e or more, white is zero potential and red is −1 kT/e or less. Galactose is shown as yellow spheres, Glucose is shown as orange spheres and the aptamer is shown as green cartoon. Wherein FIG. 14A illustrates an angle showing the carbohydrate recognition site; FIG. 14B illustrates an angle showing the dimerization interface and FIG. 14C illustrates an angle showing the interaction between the cysteine side chains and the aptamer.

(16) FIG. 15 illustrates the hemagglutination test with constant protein concentration at 5 μM and titration of aptamers SEQ ID NO.: 4 and SEQ ID NO.: 9. (a) Titration with aptamer 4. The hemagglutination of native Gal1 was inhibited from the concentration of 10 μM of this compound. There was no observed effect on the alkylated Gal1; (b) Titration with aptamer SEQ ID NO.: 9. Hemagglutination was also inhibited from the concentration of 10 μM of the compound and there was no effect on the alkylated Gal1; (c) Titration with random single stranded DNA sequences. No inhibitory effect was observed. Lactose (positive control) inhibited hemagglutinating activity as expected.

(17) FIG. 16 illustrates the variations in the denaturation temperature caused by aptamer 4. The ΔTm caused by the interaction of aptamer SEQ ID NO.: 4 with native galectin (red bars) and alkylated galectin (blue bars), in different concentrations of aptamer (0 μM, 10 μM, 35 μM, 40 μM). The lectin concentration was 5 μM in all measures.

(18) FIG. 17 illustrates the variations in the denaturation temperature caused by aptamer SEQ ID NO.: 9. The ΔTm caused by the interaction of aptamer SEQ ID NO.: 4 with native galectin (red bars) and alkylated galectin (blue bars), in different concentrations of aptamer (0 μM, 10 μM, 35 μM, 40 μM). The lectin concentration was 5 μM in all measures.

DETAILED DESCRIPTION OF THE INVENTION

(19) The present invention relates to DNA aptamers that recognize hGal1 with a very high degree of binding affinity and specificity, and inhibit hGal1-induced hemagglutination, besides presenting antiproliferative effect in tumor lines. Said aptamers were identified and selected from a library of synthetic aptamers using a modified SELEX protocol and furthermore were characterized using DNA sequence, thermal exchange assay, fluorescence spectroscopy and hemagglutination inhibition assay.

(20) The structure of said aptamers is a three-dimensional structure. Said structure plays a crucial role for their specific interaction and functioning of their molecule, since that it allows a target protein recognize the chemical signature of DNA aptamers sequence as well as the intrinsic aptamer structure (shape recognition).

(21) Said aptamers consist of a variable central region, flanked by two sites of primers interaction, denominated primers forward and reverse, which have the sequences 5′-AGC TGA CAC AGC AGG TTG GTG-3′ and 5′-ATT TCG AGATTG CTC GAC TCG TG-3′, respectively, and were selected from the following SEQ IDs.:

(22) TABLE-US-00001 SEQ ID NO. 1: AGCTGACACAGCAGGTTGGTGCAAAATGGTCGAAAAAAGGAAAAAGGAAGATAAGATAA TAAGAAAAGGACCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 2: AGCTGACACAGCAGGTTGGTGCTTTTTTTACCCTGGGTTTTAAGTTTATTAGAATCGTC ATACTGAATTTACCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 3: ANNGANACAGCAGGTTGGTGCCTAAAACACCCCCACACACAATCCCCGACCGACCCACC GCACTGCCACCCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 4: CTGACACAGCAGGTTGGTGCCAACTAACACCATAAGAATACCCCGCTCCAAATAAGCCC ACACGTAAACCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 5: AGCTGACACAGCAGGTTGGTGCGGAATTAAGAACAGAAGGGGTAGGGAGAAGACCACGG ACAAGCAAAAGCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 6: AGCTGACACAGCAGGTTGGTGCCTCTACACCCGTAAGTACCTTTGACCAACGGCACTAT TCACCATCTGACCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 7 AGCTGACACAGCAGGTTGGTGCCAATGGTGGAATAGAAAAAGTATGTGTAAGGTGGTTG GTGTGGGTTGACCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 8: AGGGAACAGGAGGTTGGTGCGCGGAAAGGAAAGGGAAGCAAGGAGGAGAAAGAAGAGGA GTGAGGACTCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 9: AGCTGACACAGCAGGTTGGTGCCCAAAAGAGCCAATCCACGACGACACCCCAAAAACCA TATCACGAATACCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 10: AGCTGACACAGCAGGTTGGTGCCAACAAGAAAAGAAACCGTTACAGAAGACACTACAGA ATAAGTGAAAAGCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 11: AGCTGACACAGCAGGTTGGTGCCATAGCCCACACATCACCGAACAACCGCCACTAGTTC AACATCCCATCCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 12: AGCTGACACAGCAGGTTGGTGCGCCCAATACAGGCGCAGTATCTGTCCGTGGGCCGGGT AAAAGTTACGGACCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 13: AGCTGACACAGCAGGTTGGTGCTTTTAGGGTCTTGTTTATAGTCATTGCCAATGGTTTT TGTTTGGATGGGCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 14: AGCTGACACAGCAGGTTGGTGCCAAGACAAACGCAAAACCCACCCCACACCCACAACCA AATCACCAAACCCCCAATCCAGGAATCTCCAAATAACAACCATCACCACTTATACCACC TCTTTCCCACCTGCACCAACCTGGTGTGGCAGCT SEQ ID NO. 15: AGCTGACACAGCAGGTTGGTGCCTTAAAAACCCCAAAACCTAAACAAATCCAGACAAAA ACTCTCACCAAACCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 16: AGCTGACACAGCAGGTTGGTGCCAACGCACACTCAAACCCCACCCTCCCCCAAGCCTCG GGCCTAAATAATCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 17: AGCTGACACAGCAGGTTGGTGCCAAAAAGGGAGAAAAAAAAAGAAAAGAACAAAAAAAA GAAAGAAATAAACCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 18: AGCTGACACAGCAGGTTGGTGCCCACCCGACAACCCTCCCTCCCCCTAACTCCCCCCCT CTACTTTTGCACCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 19: AGCTGACACAGCAGGTTGGTGCTCCCACGATCCCCACATACCTCCTCCCCACTGCTATA CAGTACCTACCCCCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 20: AGCTGATACAGCAGGTTAGAGGAAAAAAGAATAAAAAAAAAAATAAAAAATCGAACGGA AAAATTAAAAAACCGAGTCGAGCAATCTCGAAAT SEQ ID NO. 21: ATTTAGAGGGGCTCGACTCGGACTACAAAGCCAAAAGAAATAGAATAGACGAAGAAAAA AAACCAAACTGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 22: ATTTNGAGATTGCTCGACTCGGGATGGGATGTTGAACTAGTGGCGGTTGTTCGGTGATG TGTGGGCTATGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 23: ATTTCGAGATTGCTCGACTCGGGTTTACGTGTGGGCTTATTTGGAGCGGGGTATTCTTA TGGTGTTAGTTGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 24: ATTTCGAGATTGCTCGACTCGGCCCATCCAAACAAAAACCATTGGCAATGACTATAAAC AAGACCCTAAAAGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 25: ATTTNGAGNTTGNTCGACTCGGGTATTCGTGATATGGTTTTTGGGGAGACGACGTGGAT TGGCTCTTTTGGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 26: ATTTCGAGATTGCTCGACTCGGCTTTTCACTTATTCTGTAGTGTCTTCTGTAACGGTTT CTTTTCTTGTTGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 27: ATTTAGAGATTGCTCGACTCGGTCCGTAACTTTTACCCGGCCCACGGACAGATACTGCG CCTGTATTGGGCGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 28: ATTTCGAGATTGCTCGACTCGGGTTGGGGAGAGTTTTTGTCTGGATTTGTTTAGGTTTT GGGGTTTTTAAGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 29: ATTTCGAGATTGCTCGACTCGGATTATTTAGGCCCGAGGCTTGGGGGAGGGTGGGGTTT GAGTGTGCGTTGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 30: ATTNCGAGATTGCTCGACTCGGTTTATTTCTTTCTTTTTTTTGTTTTTTTCTTTTTTTT TCTCCCTTTTTGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 31: ATTTNGAGATTGCTCGACTCGGGTGATGAGGCTTCTGTAGGGGTACTAAGTCAGGTGCA GAGTTTGAGTTGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 32: ATTTNGAGATTGCTCGACTCGGGTGCAAAAGTAGAGGGGGGGAGTTAGGGGGAGGGAGG GTTGTCGGGTGGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 33: ATTNCGAGNTTGCTCGACTCGGGGGAAGGTACTGTATAGCAGGGGGGAGGAGGGATGTG GGGATCGTGGGAGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 34: ATTGGGAGATTGCTCGACTCGGTTTTTTAATTTTTCCGTTCGTTTTTTTATTTTTTTTT TTATTCTTTTTGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 35: ATTTCGAGATTGCTCGACTCGGGTCCTTTTCTTATTATCTTATCTTCCTTTTTCCTTTT TTCGACCATTTTGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 36: ATTTCGAGATTGCTCGACTCGGTAAATTCAGTATGACGATTCTAATAAACTTAAAACCC AGGGTAAAAAAAGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 37: ATTTCGAGATTGCTCGACTCGGGGTGGCAGTGCGGTGGGTCGGTCGGGGATTGTGTGTG GGGGTGTTTTAGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 38: ATTTCGAGATTGCTCGACTCGGCTTTTGCTTGTCTGTGGTCTTCTCCCTACCCCTTCTG TTCTTAATTCCGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 39: ATTNNAGATTGCTCGACTCGGGTCAGATGGTGAATAGTGCCGTTGGTCAAAGGTACTTA CGGGTGTAGAGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 40: ATTTCGAGATTGCTCGACTCGGTCAACCCACACCAACCACCTTACACATACTTTTTCTA TTCCACCATTGGCACCAACCTGCTGTGTCAGCT SEQ ID NO. 41: ATTTCGAGATTGAGCAAAACGGAGTCCTCACTCCTCTGCTTTCTCCTCCTTGCTTCCCT TCCCTTTCCGCGCACCAACCTGCTGTGTCACCT

(23) Initially, it should be noted that all 41 sequences are functional and have great interaction and inhibition effects, as they were obtained from the SELEX process. However, in an initial scan, the 4 main sequences (SEQ ID NO. 4, SEQ ID NO 9, SEQ ID NO 10 and SEQ ID NO 12) showed a greater variation in the denaturation temperature (Tm) of hGal1 and a better effect on the inhibition of hemagglutination induced by galectin, therefore, they were chosen for in vitro tests. The Tm scan and hemagglutination inhibition data are shown in FIGS. 15, 16 and 17. Those figures refer to the SEQ ID NO 4 and SEQ ID NO 9, but the results are similar for the SEQ ID NO 10 and SEQ ID NO 12.

(24) From the sequences above it was possible to group said sequences in order to assign a Markush formula to each group:

(25) Group 1 selected from SEQ ID NOs 1 to 20, where said aptamer has the following formula (1) SEQ ID NO 46:

(26) TABLE-US-00002 AGCTGACACAGCAGGTTGGTGCXan.sub.1Xan.sub.2Xan.sub.3Xan.sub.4Xan.sub.5Xan.sub.6Xan.sub.7 Xan.sub.8Xan.sub.9Xan.sub.10Xan.sub.11Xan.sub.12Xan.sub.13Xan.sub.14Xan.sub.15Xan.sub.16Xan.sub.17Xan.sub.18 Xan.sub.19Xan.sub.20Xan.sub.21Xan.sub.22Xan.sub.23Xan.sub.24Xan.sub.25Xan.sub.26Xan.sub.27Xan.sub.28Xan.sub.29 Xan.sub.30Xan.sub.31Xan.sub.32Xan.sub.33Xan.sub.34Xan.sub.35Xan.sub.36Xan.sub.37Xan.sub.38Xan.sub.39Xan.sub.40 Xan.sub.41Xan.sub.42Xan.sub.43Xan.sub.44Xan.sub.45Xan.sub.46Xan.sub.47Xan.sub.48Xan.sub.49Xan.sub.50Xan.sub.51 Xan.sub.52CCGAGTCGAGCAATCTCGAAAT

(27) wherein:

(28) Xan.sub.1, Xan.sub.6, Xan.sub.7, Xan.sub.8, Xan.sub.9, Xan.sub.10, Xan.sub.11, Xan.sub.12, Xan.sub.16, Xan.sub.17, Xan.sub.18, Xan.sub.26, Xan.sub.28, Xan.sub.32, Xan.sub.34, Xan.sub.35, Xan.sub.36, Xan.sub.40, Xan.sub.41, Xan.sub.42, Xan.sub.48, Xan.sub.49, Xan.sub.50, Xan.sub.51 and Xan.sub.52 are A, T, C, G or absent;

(29) Xan.sub.2, Xan.sub.3, Xan.sub.4, Xan.sub.5, Xan.sub.13, Xan.sub.14, Xan.sub.15, Xan.sub.19, Xan.sub.20, Xan.sub.21, Xan.sub.22, Xan.sub.23, Xan.sub.24, Xan.sub.25, Xan.sub.27, Xan.sub.30, Xan.sub.31, Xan.sub.33, Xan.sub.37, Xan.sub.38, Xan.sub.39, Xan.sub.43, Xan.sub.44 and Xan.sub.45 are A, T, C, G;

(30) Xan.sub.46 is A, T, C or absent; and

(31) Xan.sub.47 is T, C, G or absent.

(32) Group 2 selected from SEQ ID NOs 4, 9, 10 and 12, where said aptamer has the following formula (2) SEQ ID NO 47:

(33) TABLE-US-00003 AGCTGACACAGCAGGTTGGTGCXan.sub.1Xan.sub.2Xan.sub.3Xan.sub.4Xan.sub.5AXan.sub.6Xan.sub.7 Xan.sub.8Xan.sub.9Xan.sub.10Xan.sub.11Xan.sub.12Xan.sub.13Xan.sub.14Xan.sub.15Xan.sub.16Xan.sub.17Xan.sub.18 Xan.sub.19Xan.sub.20Xan.sub.21Xan.sub.22Xan.sub.23Xan.sub.24Xan.sub.25Xan.sub.26Xan.sub.27Xan.sub.28Xan.sub.29 Xan.sub.30Xan.sub.31Xan.sub.32Xan.sub.33Xan.sub.34Xan.sub.35Xan.sub.36Xan.sub.37Xan.sub.38Xan.sub.39Xan.sub.40 Xan.sub.41Xan.sub.42Xan.sub.43Xan.sub.44AXan.sub.45Xan.sub.46Xan.sub.47Xan.sub.48CCGAGTCGAGCAA TCTCGAAAT

(34) wherein:

(35) Xan.sub.1 and Xan.sub.45 are C or is absent;

(36) Xan.sub.2, Xan.sub.14, Xan.sub.17, Xan.sub.27, Xan.sub.30, Xan.sub.34, Xan.sub.36 and Xan.sub.48 are A, C or G;

(37) Xan.sub.3, Xan.sub.4, Xan.sub.9, Xan.sub.10, Xan.sub.16, Xan.sub.25, Xan.sub.33 and Xan.sub.40 are A or C;

(38) Xan.sub.5, Xan.sub.7, Xan.sub.20, Xan.sub.22, Xan.sub.32, Xan.sub.37 and Xan.sub.38 are A, C or T;

(39) Xan.sub.6, Xan.sub.8, Xan.sub.11, Xan.sub.29, Xan.sub.41 and Xan.sub.47 are A or G;

(40) Xan.sub.12, Xan.sub.24, Xan.sub.31 and Xan.sub.46 are A, G or T;

(41) Xan.sub.15, Xan.sub.21, Xan.sub.23 and Xan.sub.35 are C or G;

(42) Xan.sub.18 and Xan.sub.43 are G or T;

(43) Xan.sub.19, Xan.sub.39 and Xan.sub.44 are A or T;

(44) Xan.sub.26 and Xan.sub.42 are C, G or T;

(45) Xan.sub.28 is C or T;

(46) Group 3 selected from SEQ ID NOs 21 to 31, where said aptamer has the following formula (3) SEQ ID NO 48:

(47) TABLE-US-00004 ATTTCGAGATTGCTCGACTCGGXan.sub.1Xan.sub.2Xan.sub.3Xan.sub.4Xan.sub.5Xan.sub.6Xan.sub.7 Xan.sub.8Xan.sub.9Xan.sub.10Xan.sub.11Xan.sub.12Xan.sub.13Xan.sub.14Xan.sub.15Xan.sub.16Xan.sub.17Xan.sub.18 Xan.sub.19Xan.sub.20Xan.sub.21Xan.sub.22Xan.sub.23Xan.sub.24Xan.sub.25Xan.sub.26Xan.sub.27Xan.sub.28Xan.sub.29 Xan.sub.30Xan.sub.31Xan.sub.32Xan.sub.33Xan.sub.34Xan.sub.35Xan.sub.36Xan.sub.37Xan.sub.38Xan.sub.39Xan.sub.40 Xan.sub.41Xan.sub.42Xan.sub.43Xan.sub.44Xan.sub.45Xan.sub.46Xan.sub.47Xan.sub.48Xan.sub.49Xan.sub.50Xan.sub.51 GCACCAACCTGCTGTGTCAGCT

(48) wherein:

(49) Xan.sub.1, Xan.sub.2, Xan.sub.5, Xan.sub.6, Xan.sub.15, Xan.sub.22, Xan.sub.23, Xan.sub.34, Xan.sub.35, Xan.sub.49, Xan.sub.50 and Xan.sub.51 are A, T, C, G or absent;

(50) Xan.sub.3, Xan.sub.4, Xan.sub.7, Xan.sub.8, Xan.sub.9, Xan.sub.10, Xan.sub.11, Xan.sub.12, Xan.sub.13, Xan.sub.14, Xan.sub.16, Xan.sub.17, Xan.sub.18, Xan.sub.19, Xan.sub.20, Xan.sub.24, Xan.sub.25, Xan.sub.26, Xan.sub.27, Xan.sub.28, Xan.sub.29, Xan.sub.30, Xan.sub.31, Xan.sub.32, Xan.sub.33, Xan.sub.36, Xan.sub.37, Xan.sub.38, Xan.sub.39, Xan.sub.40, Xan.sub.41, Xan.sub.42, Xan.sub.43, Xan.sub.44, Xan.sub.45, Xan.sub.46 and Xan.sub.48 are A, T, C, G;

(51) Xan.sub.21 is C, G or T; and

(52) Xan.sub.47 is A, G or T.

(53) It is important to note that any new nucleotide sequence, chemically modified or not (aptamer), which has at least 80% or more of its sequence similar to one of the sequences of the 41 aptamers or their tridimensional structure disclosed in the present application will be considered analogous to the aptamers described herein.

(54) In order to make it possible to select and identify the aptamers previously described, the following procedures were performed:

(55) Preparation of Purified hGal-1

(56) The purification of human recombinant galectin-1 was done as previously described using transformed E. coli strain (M-15) containing the plasmid expressing human galectin-1 and affinity chromatography on lactosyl-Sepharose.

(57) SELEX

(58) Oligonucleotides were purchased as lyophilized oligonucleotide. Before use, distilled water dissolved ssDNA library and aptamers were heated at 95° C. for 2 min and immediately cooled on ice. All the other reagents used for chemical and biological characterization were of analytical grade. The library and primer details are as follows: library: 5′-AGCTGACACAGCAGGTTGGTGC N49 CCGAGTCGAGCAATCTCGAAAT-3′ (SEQ ID NO: 43); forward: 5′AGCTGACACAGCAGGTTGGTGC3′ (SEQ ID NO: 44); reverse: 5′ATTTCGAGATTGCTCGACTCGG3′ (SEQ ID NO: 45). Libraries were amplified by PCR before selection.

(59) Polypropylene microtubes (0.2 mL) were coated and blocked with 2 mg/mL hGal1 in coating buffer (20 mM HEPES, pH 7.4, 200 μL) overnight at 4° C. Previously selections steps, microtubes were washed 3 times with coating buffer. In the first round of selection, 1 nmol of ssDNA library (theoretically 1014 different oligonucleotides) was distributed in hGal1-coated microtubes and incubated at room temperature for 2 h. After incubation, the supernatant was discarded and the microtubes were washed 3 times with 200 μL of washing buffer. To elute the bound ssDNA, 100 μL of ddH2O was added to a microtube and placed in a dry bath heat block at a temperature of 95° C. for 15 min. The supernatant was collected and used as the template for PCR amplification of hGal1 bound ssDNA. After the fourth selection round, the collected aptamers were amplified by PCR. The dsDNA product was resolved on 3% agarose gel and the corresponding bands on the gel were purified, cloned, and sequenced.

(60) Selection of DNA Aptamers

(61) A ssDNA library comprising around 5×10.sup.14 molecules was applied in hGal1 DNA aptamers selection. Following 4 rounds of selection, sixteen different sequences from twenty-one clones were collected. The classical SELEX process involves multiple rounds of selection and amplification. Here, a modified SELEX selection was performed, and all selection and amplification steps took place in one single vial, without using a conventional blocking step, as described above. Briefly, immobilized galectin was incubated with the aptamer library. Thereafter, unbound aptamers were wiped out and PCR reagents were added to the microtube, and aptamers bound to the lectin were amplified. The protein denaturation caused by the high temperature through the first PCR cycle releases the bound aptamers and allowed for their amplification in successive PCR cycles. These aptamers were cloned and sequenced; 41 sequences were obtained. None of the sequences were identical and some sequences were truncated, hence they were not further analyzed. Aptamers were selected for further analysis if they induced a thermoshift exhibited ΔTm (in TSA experiments) higher than 2.0° C. One of the oligonucleotides, named SEQ ID NO.: 4 showed the best performance via TSA screening and therefore was analyzed in more detail.

(62) SEQ ID NO.: 4 Induces Thermostability Decreasing of Native hGal1

(63) In an attempt to screen among the selected aptamers that better interact with hGal1, differential scanning fluorimetry (Termofluor) was used to characterize their binding to its target. Among all the selected aptamers, SEQ ID NO.: 4 seemed to have a more intense effect on hGal1 thermoshift and so was chosen for further analysis. The selected aptamer had its interaction evaluated with native and alkylated galectin-1. The reference curve for each protein showed a sigmoidal profile with Tm values of 57.8±0.7° C. for native galectin-1 and 64.68±0.04° C. for alkylated galectin-1. The respective thermal displacements were evaluated as a function of an increasing concentration of SEQ ID NO.: 4 (FIG. 1). The inventors observed that for the native protein there is a marked decrease in Tm for SEQ ID NO.: 4, but not in a dose-response manner. On the other hand, the temperature variation for the alkylated protein was not significant, which implies that the alkylation process protects the protein from the destabilizing effect of the aptamer. This suggests that the aptamer and protein interaction occur mainly in the convex region of the lectin CRD, where the major electronic and steric modifications occur after the addition of acetamide groups (alkylation). This result together with the hemagglutination data indicates that the aptamer may interact at the dimerization interface causing a destabilization of the structure which leads to a decrease in Tm.

(64) Thermofluor Assays (TSA)

(65) Thermofluor experiments were performed on an Mx3005 RT-PCR (Agilent Technologies) using the SYPRO® Orange dye (492/610 nm) (Invitrogen) as fluorescent probe. The purified (native and alkylated) protein samples were incubated for 30 min with increasing concentration of the molecules of interest, centrifuged, and submitted to the thermal denaturation assay, totalizing four distinct experiments. In a 96-well plate (Agilent Technologies) 20 μl of the reaction containing 5 μM of each protein in buffer PBS 1× and 5× SYPRO® Orange were heated from 25° C. to 95° C. at a rate of 1° C./min. The experimental result was processed as in the protocol previously described and the melting temperature was obtained using GraphPad Prism software (www.graphpad.com).

(66) Fluorescence Quenching

(67) Fluorescence measurements were taken by a spectrofluorimeter HITACHI F-4500, the spectra were collected by excitation and emission at a rate of 240 nm per min, using a 5 nm slit widths and recorded at room temperature. A total of 5 μM hGal1 solution was incubated for 10 hours with aptamer aliquots as quencher, from 0 to 7.2 μM, in PBS 1× buffer. The spectra were obtained between 300-450 nm after excitation at 295 nm and all buffer contributions were corrected for measurements. As previously described, the log of fluorescence quenching was evaluated by plotting it versus log of aptamer concentration. The Stern-Volmer equation was used to estimate the number of interacting sites (n) and the apparent kD.

(68) The hGal1/SEQ ID NO. 4 Interaction Promotes Fluorescence Quenching

(69) Human galectin-1 tryptophan residue has an emission peak at 348 nm after 280 nm exited. SEQ ID NO.: 4 promotes changes the fluorescence spectrum of Trp68, which is the sole Trp in the subunit of hGal1 and is one of the residues constituting its CRD. Upon the aptamer addition, fluorescence emission decreased (FIG. 1C). The fluorescence quenching log versus aptamer concentration log measurements was plotted and it was fitted with Stern-volmer equation. The best fit established apparent dissociation constant of approximately 31.9 nM and a binding site of 1.5 (FIG. 1D).

(70) Hemagglutination Inhibition Assay

(71) Hemagglutination assay was adopted to assess the capacity of SEQ ID NO.: 4 in inhibiting the lectin cross-linking aggregation of red blood cells (RBC), as previously described. Briefly, using a 96-well microplates appropriate amounts of 5 μM hGal1 were blended with 50 μL of aptamer in an increasing concentrations manner (0-40 μM) in PBS 1× buffer (pH 7.4). Following, 50 μL of 3% purified type B+ RBC in PBS. After 2 h of room temperature incubation, the plate was photographed and the hemagglutination area was estimated by area calculator Sketchandcalc™ and the results were expressed as relative agglutination.

(72) SEQ ID NO. 4 Inhibits hGal1-Induced Hemagglutination

(73) Later, in vitro functional properties of SEQ ID NO.: 4 were evaluated. The aptamer potential of interfering with the RBC agglutination mediated by hGal1 was assessed (FIG. 2A). Because hemagglutination occurs by the cross-linking among lectin to the glycans of the cell surface, reducing in agglutination levels by SEQ ID NO.: 4 addition might be justified by diminished glycan binding caused by the aptamer interaction with hGal1. FIG. 2A illustrates the extensive network by the hGal1-RBC cross-link formation, as expected in the aptamer absence. SEQ ID NO.: 4 was capable to inhibit the lattice formation, and upon addition of an increasing concentration, it became clear that hemagglutination is extremely reduced, indicating that the addition of 10 μM of SEQ ID NO.: 4 has approximately 75% of inhibition effect over RBC agglutination (FIG. 2B). These data indicate that SEQ ID NO.: 4 can somehow block hGal1 function, thereby reducing multivalent interactions of this lectin on the cell surface.

(74) Cytotoxicity Assay

(75) The antiproliferative effects of aptamers were in vitro evaluated on seven cell lines of solid human tumors, and the 50% growth inhibitory concentrations (IC50) ranged from 9.45 to 74.02 μM (Table 1 to 5). On average, higher concentrations of OTX008 and anginex, well-known galectin-1 inhibitors, are needed to obtain antiproliferative effects equivalent to those of aptamers (>100 uM IC50 in most assessed cell lines). For the analysis of cell proliferation, the non-clonogenic method of sulforodamine B (SRB) was used, a protein dye that binds to the basic amino acid residues of cell proteins that were viable at the time of the fixation process. Therefore, the greater the amount of SRB bound per compartment, the less the antiproliferative activity of the item under study.

(76) The XLSTAT software was used to determine the IC50, TGI and LC50 values using the four-parameter logistic curve equation.

(77) Table 1 and FIG. 3 show the results of the reference items Cisplatin and Paclitaxel evaluated in 8 concentrations against the human tumor lines SK-BR-3, MCF-7, DU-145, OVCAR-3, HT-29, HCT 116, A-375 and normal human NHF fibroblasts. As can be observed, Table 1 shows that both cisplatin and paclitaxel presented a very low IC50 and TGI 50 values for all tumor lines evaluated. These data that are accordantly with the literature, and corroborate their applications in oncology therapies, as well as their use as reference drugs (positive control) in the present invention.

(78) The results for the test items evaluated against the tumor lines Du-145 and MCF-7 are described in Table 2. The graphs represented in FIGS. 4 and 5 correspond to the logistic regression of 4 parameters for calculating the IC50 parameters. TGI and LC50 of the test items when evaluated in the DU-145 and MCF-7 lines respectively.

(79) Tables 2, 3, 4 and 5 show that all aptamers evaluated (SEQ. ID NO 4, 9, 10 and 12) in the relative cell viability assay against tumor lines (DU-145, MCF-7, A-375, HT-29, HCT-116, SKBR-3, and OVCAR-3) presented IC50 values much lower than the reference galectin-1 inhibitors previously described, proving their high and improved efficiencies concerning antiproliferative activity in tumor cells, as well as a notorious potential for therapeutic application.

(80) It is also observed that the negative control did not show lethality for the tumor cell lines within the concentrations range evaluated in the assay, as well as IC50 or TGI50 values, always much higher than those presented by aptamers, especially SEQ. ID NO 10 and 12. These data support the non-specificity of the molecule concerning the observed antiproliferative effects, as expected.

(81) It is also significant to observe that the aptamer SEQ. ID NO 10 presented IC50 values below 25 μM when tested against all tumor cell lines assessed. This value is much lower than that of any other galectin-1 inhibitor already described. These data make clear of its exceptional antitumor effect, as well as its high potential for application in cancer therapy.

(82) TABLE-US-00005 TABLE 1 Results of relative viability and IC50, ITG and LC50 values of the reference items Cisplatin and Paclitaxel. Positive Control Relative cell viability (%) Item Concentration MCF-7 DU-145 A-375 HT-29 HCT 116 SK-BR-3 OVCAR-3 NHF Cisplatin 500.000 μM −12.2 1.4 −33.3 −2.9 −64.7 −23.6 −48.5 −7.1 250.000 μM −21.6 2.5 −30.8 0.6 −57.4 −19.7 −37.9 1.7 125.000 μM −40.1 −13.4 −42.2 0.1 −58.9 −21.8 −40.9 −4.2 62.500 μM −22.1 −43.8 −33.8 1.3 −53.8 −24.3 −45.3 −3.8 31.250 μM 14.6 −48.2 −47.4 1.4 −55.0 −21.1 −62.8 −0.7 15.625 μM 27.5 0.0 −43.2 6.9 0.5 −20.3 −64.6 0.2 7.812 μM 38.7 3.6 15.1 21.4 11.8 −14.8 −73.4 27.8 3.906 μM 56.3 13.1 38.6 38.1 28.8 6.8 −52.8 53.4 IC.sub.50 (μM) N.D. <3.906 N.D. <3.906 N.D. <3.906 N.D. 4.774 TGI (μM) 35.869 <3.906 7.96 64.977 15.550 4.491 N.D. 16.139 LC.sub.50 (μM) N.D. N.D. N.D. N.D. 28.242 N.D. 52.739 N.D. Paclitaxel 100.000 nM 24.7 −25.6 69.0 5.0 4.7 13.9 −57.5 16.9 50.000 nM 23.6 −15.7 91.2 6.7 3.4 12.3 −45.1 28.7 25.000 nM 25.7 −36.7 108.2 15.1 10.1 16.8 −48.7 48.9 12.500 nM 29.3 8.4 112.9 24.5 17.5 68.3 31.1 58.6 6.250 nM 36.9 58.9 98.8 48.8 50.6 105.7 69.6 61.9 3.125 nM 47.6 97.3 99.4 80.8 90.9 119.4 89.6 72.1 1.562 nM 65.5 95.5 96.3 99.1 96.6 112.9 90.1 79.7 0.781 nM 87.9 103.7 117.1 102.1 96.2 112.8 96.9 86.6 IC.sub.50 (nM) 2.817 7.197 N.D. 6.312 6.459 14.808 10.008 18.658 TGI (nM) N.D. 13.021 N.D. N.D. N.D. N.D. 15.402 >100 LC.sub.50 (nM) N.D. N.D. N.D. N.D. N.D. N.D. 35.137 >100 MCF-7: human breast adenocarcinoma cell line; Du-145: human prostate carcinoma cell line; A-375: human malignant melanoma; HT-29: human colorectal adenocarcinoma; HCT 116: human colorectal carcinoma; SK-BR-3: human breast adenocarcinoma; OVCAR-3: human ovarian adenocarcinoma cell line; NHF: human foreskin skin fibroblasts; IC50: Concentration to inhibit 50% of cell growth; TGI: Concentration for total inhibition of cell growth; LC50: Concentration for 50% cell death; N.D.: not determined.

(83) TABLE-US-00006 TABLE 2 Results of relative viability and IC50, TGI and LC50 values of the test items against the tumor lines DU-145 and MCF-7. Relative viability (%) of test items SEQ ID SEQ ID SEQ ID SEQ ID SEQ Cell line Concentration NO. 4 NO. 9 NO. 10 NO. 12 CONTROL Du-145 100.000 μM 36.0 36.6 −39.4 −57.3 43.1 50.000 μM 68.4 68.0 32.5 −17.5 69.9 25.000 μM 88.5 82.5 72.4 50.8 74.2 12.500 μM 104.3 98.7 92.2 75.1 84.4 6.250 μM 109.6 103.6 105.3 92.2 90.3 3.125 μM 104.7 106.4 104.4 99.1 93.4 1.562 μM 100.6 92.3 106.3 103.4 95.7 0.781 μM 109.3 106.1 94.8 94.0 113.4 IC.sub.50 (μM) 72.642 74.020 39.264 23.403 89.365 TGI (μM) N.D. >100 69.568 42.423 >100 LC.sub.50 (μM) N.D. N.D. >100 83.501 >100 MCF-7 100.000 μM 0.7 −19.5 −29.0 −72.5 20.0 50.000 μM 43.4 37.5 25.6 2.0 31.1 25.000 μM 60.9 55.1 47.1 38.6 37.7 12.500 μM 72.7 73.6 63.0 56.5 53.6 6.250 μM 86.2 84.8 74.2 67.4 59.0 3.125 μM 95.8 97.8 83.0 81.2 62.4 1.562 μM 96.7 95.5 85.8 91.5 62.8 0.781 μM 110.4 103.8 86.4 87.4 54.9 IC.sub.50 (μM) 35.098 31.963 24.335 17.791 15.040 TGI (μM) >100 80.767 70.609 48.434 N.D. LC.sub.50 (μM) >100 >100 >100 84.144 N.D. MCF-7: human breast adenocarcinoma cell line; Du-145: human prostate carcinoma cell line; IC50: Concentration to inhibit 50% of cell growth; TGI: Concentration for total inhibition of cell growth; LC50: Concentration for 50% cell death; N.D.: not determined.

(84) TABLE-US-00007 TABLE 3 Results of relative cell viability and IC50, TGI and LC50 values of the test items against tumor lines A-375 and HT-29. Relative cell viability (%) of test items Cell line Concentration SEQ ID NO. 4 SEQ ID NO. 9 SEQ ID NO. 10 SEQ ID NO. 12 SEQ. CONTROL A-375 100.000 μM −72.3 −19.4 −72.1 −79.2 46.7 50.000 μM −69.0 70.6 51.6 −47.3 70.7 25.000 μM 35.7 92.5 65.8 56.3 65.4 12.500 μM 85.8 97.7 81.1 85.6 81.5 6.250 μM 97.3 114.0 74.2 81.4 78.1 3.125 μM 103.0 107.0 87.7 90.4 86.2 1.562 μM 100.6 107.1 84.5 92.7 92.2 0.781 μM 109.5 121.2 92.6 97.7 94.4 IC.sub.50 (μM) 22.748 61.116 47.908 26.263 >100 TGI (μM) 29.656 90.397 74.279 36.326 >100 LC.sub.50 (μM) 41.088 >100 93.069 51.456 >100 HT-29 100.000 μM −61.1 0.2 −71.9 −72.1 0.2 50.000 μM −84.0 14.4 15.7 −44.8 5.7 25.000 μM 5.8 32.7 32.7 24.2 40.9 12.500 μM 47.4 83.1 78.3 49.4 68.8 6.250 μM 74.6 92.5 94.2 81.2 73.4 3.125 μM 88.6 97.2 103.0 100.3 81.6 1.562 μM 90.7 95.9 93.7 93.5 85.3 0.781 μM 93.5 92.0 90.8 93.7 91.9 IC.sub.50 (μM) 13.497 20.424 25.113 14.630 19.369 TGI (μM) 22.932 N.D. 53.711 30.010 81.579 LC.sub.50 (μM) 40.871 N.D. 85.816 60.311 N.D. Cell lines: A-375: human malignant melanoma; HT-29: human colorectal adenocarcinoma; IC50: Concentration to inhibit 50% of cell growth; TGI: Concentration for total inhibition of cell growth; LC50: Concentration for 50% cell death; N.D.: not determined.

(85) TABLE-US-00008 TABLE 4 Results of relative cell viability and IC50, TGI and LC50 values of the test items against the tumor lines HCT 116 and SK-BR-3. Relative cell viability (%) of test items SEQ ID SEQ ID SEQ ID SEQ ID SEQ. Cell line Concentration NO. 4 NO. 9 NO. 10 NO. 12 CONTROL HCT 116 100.000 μM −70.2 −19.5 −47.3 −55.9 0.1 50.000 μM 3.6 11.5 6.3 1.3 10.0 25.000 μM 24.4 33.3 27.9 17.4 29.4 12.500 μM 57.1 72.2 69.4 56.5 49.0 6.250 μM 85.0 88.9 96.1 84.0 59.6 3.125 μM 85.5 87.9 99.9 105.2 80.9 1.562 μM 95.4 94.6 97.5 93.2 86.8 0.781 μM 103.6 99.9 95.9 98.0 89.0 IC.sub.50 (μM) 16.790 20.100 20.210 15.983 11.261 TGI (μM) 45.410 58.519 47.447 41.730 97.076 LC.sub.50 (μM) 84.372 N.D. >100 96.324 N.D. SK-BR-3 100.000 μM −86.3 −70.0 −66.5 −77.1 −27.4 50.000 μM −34.6 3.1 −8.6 −36.3 14.4 25.000 μM 47.0 48.7 50.2 53.1 47.3 12.500 μM 96.1 98.5 90.0 84.3 79.5 6.250 μM 106.2 109.1 95.4 103.3 79.1 3.125 μM 98.6 111.1 113.9 117.5 86.9 1.562 μM 103.4 99.9 99.1 109.9 85.7 0.781 μM 101.9 107.5 98.0 102.2 89.4 IC.sub.50 (μM) 24.953 28.316 25.981 24.313 25.701 TGI (μM) 37.515 49.017 45.137 37.529 61.419 LC.sub.50 (μM) 56.934 80.714 78.599 60.225 >100 Cell lines: HCT 116: human colorectal carcinoma; SK-BR-3: Human breast adenocarcinoma; IC50: Concentration to inhibit 50% of cell growth; TGI: Concentration for total inhibition of cell growth; LC50: Concentration for 50% cell death; N.D.: not determined.

(86) TABLE-US-00009 TABLE 5 Results of relative cell viability and IC50, TGI and LC50 values of the test items against the OVCAR-3 and NHF cell lines. Relative viability (%) of test items SEQ ID SEQ ID SEQ ID SEQ ID SEQ Cell line Concentration NO. 4 NO. 9 NO. 10 NO. 12 CONTROL OVCAR-3 100.000 μM −68.1 −62.0 −51.1 −57.9 −7.7 50.000 μM −14.6 8.1 −3.7 −18.5 12.0 25.000 μM 37.7 23.4 16.9 27.5 31.5 12.500 μM 48.0 50.2 34.7 38.4 56.7 6.250 μM 67.2 84.3 59.2 65.8 80.2 3.125 μM 89.4 93.9 77.9 75.0 82.0 1.562 μM 93.9 99.6 90.2 87.7 87.2 0.781 μM 99.6 105.9 79.9 81.8 99.2 IC.sub.50 (μM) 14.235 16.093 9.455 11.088 15.619 TGI (μM) 41.931 45.952 39.740 37.711 72.599 LC.sub.50 (μM) 82.361 91.419 >100 87.809 N.D. NHF 100.000 μM −25.4 −12.8 −32.9 −54.1 −49.2 50.000 μM 19.8 44.6 24.3 8.8 19.4 25.000 μM 73.4 84.6 66.8 70.0 60.5 12.500 μM 106.6 114.0 101.4 101.4 98.3 6.250 μM 100.7 92.7 96.1 109.0 99.5 3.125 μM 98.4 95.7 93.5 97.7 107.4 1.562 μM 94.2 96.2 101.8 99.8 113.8 0.781 μM 95.3 104.0 103.3 99.4 107.7 IC.sub.50 (μM) 35.554 46.864 35.702 33.728 32.629 TGI (μM) 63.101 83.697 64.820 53.452 60.658 LC.sub.50 (μM) N.D. N.D. >100 93.611 >100 OVCAR-3: human ovarian adenocarcinoma cell line; NHF: human foreskin skin fibroblasts; IC50: Concentration to inhibit 50% of cell growth; TGI: Concentration for total inhibition of cell growth; LC50: Concentration for 50% cell death; N.D.: not determined.

(87) Table 6 shows the cell viability results obtained for the test item SEQ ID NO. 12 compared to the cell viability results of the same test item associated with the reference item cisplatin at a concentration of 3 μM. At this concentration, the cisplatin reference item showed a relative cell viability of 19.1%.

(88) TABLE-US-00010 TABLE 6 Viability results of the OVCAR-3 cell line in the synergism test. Relative viability (%) SEQ ID NO. 12 + Concentration SEQ ID NO. 12 Cisplatin 100,000 μM −57.9 −67.9  50,000 μM −18.5 −64.9  25,000 μM 27.5 5.3  12,500 μM 38.4 7.7  6,250 μM 65.8 11.5  3,125 μM 75.0 13.9  1,562 μM 87.7 15.0

(89) As can be seen, Table 6 presents the results of the cellular viability of the aptamer SEQ. ID NO 12 when associated with cisplatin, a reference drug in cancer therapy. It is possible to observe that the SEQ. ID NO 10 substantially improved the antiproliferative activity profile against the OVCAR-3 cell line, in comparison to both the aptamer and cisplatin profiles, both individually evaluated. This data highlights the considerable and innovative therapeutic potential of SEQ. ID NO 12 as a disruptive synergistic agent in cancer therapy.

(90) All put together, the present data makes the point that DNA aptamers, as anti-galectin inhibitors, represent a promising innovative approach in cancer therapy, in particular to those which display a high metastasis and angiogenesis rate associated with high hGal1 expression. In this way, galectin inhibitors may restore the immunological system sensitivity against cancer cells, and thus, act as synergistic drugs in oncology therapy.

(91) Numerous reports describe that high hGal1 expression is highly associated with a poor prognostic criterion, as low survival rate or cytotoxic drug resistance in many human cancers.

(92) New approaches in oncology therapy, such as combination therapies are crucial in the future clinical development of galectin-1 inhibitors strategies. Synergistic effects between reference therapeutics drugs, like cisplatin, and DNA aptamers, as described in table 6, are a disruptive approach in cancer treatment, and will be of tremendous impact in combination therapies, improving on going oncology protocols treatments. In the present invention is notably demonstrated that besides DNA aptamers stand-alone in vitro treatment displays unequivocal antiproliferative effects in several cancer cell lines with much higher effectiveness over traditional antigalectin compounds, its association with preferred chemotherapy drugs, such as cisplatin among others, is an encouraging way to positioning these molecules in clinical development.

(93) The data presented here for SEQ. NO 12 support the validness of using these new class of galectin-1 inhibitor as a novel and promising clinical approach to inhibit cancer cell proliferation, while also enhancing the efficiency of a current anticancer drug when used in association.

(94) The aptamer SEQ ID NO 12 when associated with the reference item cisplatin at a concentration of 3 μM, potentiated the profile of antiproliferative activity against the cell line OVCAR-3 when compared to the profile of this same test item evaluated individually. Cisplatin alone has 19.1% cell viability for OVCAR-3 strain, at a concentration of 3 μM, and when associated with SEQ ID NO 4, it is at a concentration of 12.5 μM, the cell viability of the composition drops to 7, 7%, a decrease of almost 60%. Thus, the aptamer enhances the antiproliferative activity profile of cisplatin against the OVCAR-3 cell line, showing the synergistic effect of that with cisplatin, a reference drug in oncology.

(95) It is important to note that the same cell line, when evaluated alone with SEQ ID NO 4 at a concentration of 12.5 μM, showed cell viability of 38.4%. Thus, the synergistic effect occurs in both the aptamer for cisplatin and the latter for the aptamer.

(96) According to the results: Concentrations between 15 and 35 μM of aptamers promoted 50% inhibition of the growth of the MCF-7 cell line, while concentrations between 23 and 89 μM of the test items promoted a 50% reduction in cell growth of the Du-145 cell line; Concentrations between 22.7 μM and 61.1 μM of aptamers promoted 50% inhibition of cell line A-375 growth, whereas concentrations between 13.5 and 25.1 μM of test items reduced 50% cell growth of the HT-29 strain; Concentrations between 11.2 μM and 20.2 μM of aptamers inhibited 50% of the growth of the HCT 116 cell line and concentrations between 24 μM and 25 μM of the test items promoted a 50% reduction in the cell growth of the SK-BR-3; Concentrations between 37 and 72 μM of aptamers promoted total growth inhibition of the OVCAR-3 cell line, while concentrations between 53 and 83 μM of the test items promoted total growth inhibition of the NHF cell line; The aptamer SEQ ID NO. 12 when associated with the reference item cisplatin at a concentration of 3 μM, potentiated the profile of antiproliferative activity against the cell line OVCAR-3 when compared to the profile of this same test item evaluated individually.

(97) According to the experimental conditions and methodologies used in the present study, it is concluded for the test items SEQ ID NO. 4, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 12 and SEQ CONTROL:

(98) A: General Conclusions:

(99) I. The test items SEQ ID NO. 4, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 12 and SEQ CONTROL reduce the viability of human tumor lines SK-BR-3, MCF-7, DU-145, OVCAR-3, HT-29, HCT-116, A-375 and the non-tumor line NHF as a function of the analyzed concentration.

(100) B: Specific Conclusions

(101) I. The test items show more intense antiproliferative/cytotoxic activity in tumor lines than in normal cells;

(102) II. The test item SEQ. ID NO.:12 enhances the profile of cisplatin's antiproliferative activity against the OVCAR-3 cell line.

(103) Molecular Modeling

(104) In order to predict the 3D structure of the ssDNA aptamer (SEQ ID NO. 4) the overall protocol described was followed:

(105) The secondary structure of the aptamer was predicted by the Mfold webserver using temperature of 25° C. and ionic strength derived from the PBS buffer, 0.195 mol/L, to mimic the experimental folding conditions. Three possibilities for the secondary structure were retrieved and used as input for the RNA composer webserver that predicts the 3D structure of RNA aptamers. The output structures were converted to DNA by methylation of all Uracil nucleobases to turn them into Thymines and by removing the 2′ hydroxyl group from all riboses.

(106) The initial structure for the human Galectin-1 protein was taken from PDB ID 1GZW. All ligands and water molecules were removed. Hydrogens were added to both the protein and the DNA aptamer using GROMACS 2016.3 and docking was performed using the NPDock webserver, which is specialized in nucleic acid-protein docking.

(107) FIGS. 13 and 14 were made with open source PyMOL 1.8.6.0 and the electrostatic potential was calculated with APBS.

(108) Results & Discussion of the Molecular Modeling

(109) Docking calculations revealed a putative binding mode between the aptamer and the monomeric form of hGal-1 that provides a molecular mechanism for the experimentally observed effects of their interaction. According to this putative binding mode, the aptamer-protein interaction involves the hydrophobic dimerization interface of the monomer (FIG. 13A and FIG. 13B). This is in agreement with experimental data from ThermoFluor showing that there is increased hydrophobic area exposure when the aptamer is added to a solution of hGal-1. This interaction mode also explains the observed anti-hemagglutination activity because, even though the carbohydrate recognition site is not disrupted by the presence of the aptamer, it blocks the dimerization interface leads to disruption of the galectin networks that would result in hemagglutination.

(110) It was observed that treating hGal-1 with Iodoacetamide, which covalently binds the acetamide group in all solvent accessible cysteines sulfhydryl side chain, abolishes the anti-hemagglutinating activity of the aptamer. According to the proposed binding mode, this happens because Cysteines 2, 88 and 130 interact directly with the aptamer and adding the acetamide group to their side chains would disrupt specific aptamer-protein interactions (FIG. 13C). The only solvent accessible cysteine that does not interact with the aptamer is Cys-16. Interestingly, excellent physicochemical complementarity was observed: the aptamer, which is negatively charged, interacts only with the sites of hGal-1 which have positive electrostatic potential (FIG. 14).

(111) The molecular modeling was used to suggest that the molecular interaction between hGal-1 and aptamer 4 involves the dimerization interface of the monomer of hGal-1. This putative binding mode agrees with all experimental data about the aptamer-protein recognition.

(112) Uses of the Developed Aptamers

(113) It appears that the discovery of such potential new hGal1 inhibitors will help in the development of new diagnostic strategies and therapeutic strategies for diseases correlated with hGal1. Thus, the aptamers developed can be used in the treatment of a disorder relating to the binding of human galectin-1 to a ligand in a mammal, wherein said disorder is selected from the group consisting of inflammation, fibrosis, septic shock, cancer, autoimmune diseases, metabolic disorders, heart disease, heart failure, pathological angiogenesis, as neovascularization related to cancer, and eye diseases.

(114) The cancer is selected from the group consisting of ovarian cancer, squamous cell carcinoma, a cancer of the digestive system, stomach cancer, liver cancer, colon cancer, a cancer of the thyroid, a cancer of the endometrium, adenocarcinoma of the endometrium, uterine cancer, uterine adenocarcinoma, a uterine smooth muscle tumor, breast cancer, prostate cancer, bladder cancer, a head cancer, a neck cancer, a glioma, a kidney cancer, pancreatic cancer, pancreatic ductal adenocarcinoma, nonsmall-cell lung cancer, and melanoma.

(115) Additionally, it is worth noting that the majority of aptamers still has the ability to inhibit the cancer growth process, namely metastasis, that is also related to human galectin-1.