USE OF A COMPOUND OF THE DIURETICS CLASS FOR TREATING CANCER

Abstract

Disclosed is a cancer treatment method utilizing a compound of the diuretics class. Also disclosed is a pharmaceutical composition used in such cancer treatment method, the compound being althiazide.

Claims

1.-21. (canceled)

22. Method of treatment of cancer comprising administering to a subject a compound of formula (II) ##STR00016## in which: a can represent: nothing, a single bond, a double bond; b represents: nothing if a represents nothing, a single bond if a is either a single bond or a double bond; the value of i being: zero if a represents nothing, equal to 1 if a is a single or a double bond; if a represents nothing, then b represents nothing and i is 0: R.sub.1 and R.sub.5 can represent independently of one another: H; a linear or branched alkyl or alkenyl chain of 1 to 20 carbon atoms, monocyclic, bicyclic or polycyclic of 3 to 20 carbon atoms; an aryl group of 1 to 20 carbons; R.sub.3 and R.sub.7 can represent independently of one another: H; a linear or branched alkyl or alkenyl chain of 1 to 20 carbon atoms, monocyclic, bicyclic or polycyclic of 3 to 20 carbon atoms; an aryl group of 1 to 20 carbonss; R.sub.4 can represent: H; a halogen atom a linear or branched alkyl or alkenyl chain of 1 to 20 carbon atoms, monocyclic, bicyclic or polycyclic of 3 to 20 carbon atoms; if a represents a single bond, then b represents a single bond and i is equal to 1: R.sub.1 can represent: H; a linear or branched alkyl or alkenyl chain of 1 to 20 carbon atoms, monocyclic, bicyclic or polycyclic of 3 to 20 carbon atoms; an aryl group of 1 to 20 carbonss; R.sub.2 can represent: H; a linear or branched alkyl or alkenyl chain of 1 to 20 carbon atoms, monocyclic, bicyclic or polycyclic of 3 to 20 carbon atoms; an aryl group of 1 to 20 carbons; R.sub.3 can represent: H; a linear or branched alkyl or alkenyl chain of 1 to 20 carbon atoms, monocyclic, bicyclic or polycyclic of 3 to 20 carbon atoms; an aryl group of 1 to 20 carbons; R.sub.5 and R.sub.7 represent nothing R.sub.6 represents H R.sub.4 is as defined above if a represents a double bond, then b represents a single bond and i is 1: R.sub.1, R.sub.5, R.sub.6 and R.sub.7 represent nothing; R.sub.2, R.sub.3 and R.sub.4 are as defined above.

23. Method according to claim 22, said compound being of formula (III) ##STR00017## in which: a can represent: nothing; a single bond; a double bond. b represents: nothing if a represents nothing a single bond if a is either a single bond or a double bond the value of i being: zero if a represents nothing, equal to 1 if a is a single or a double bond; if a represents nothing, then b represents nothing and i is 0: R.sub.3 and R.sub.7 can represent independently of one another: H; a linear alkyl chain of 1 carbon atom; R.sub.5 represents H.sub.2; R.sub.4 can represent: H; a halogen atom a linear alkyl chain of 1 carbon atom; if a represents a single bond, then b represents a single bond and i is equal to 1: R.sub.2 can represent: H; a linear or branched alkyl or alkenyl chain of 1 to 10 carbon atoms, monocyclic, bicyclic or polycyclic of 3 to 20 carbon atoms; an aryl group of 1 to 20 carbons; R.sub.3 can represent: H; a linear alkyl chain of 1 carbon atom; R.sub.5 and R.sub.6 represent H; R.sub.7 represents nothing; R.sub.4 is as defined above if a represents a double bond, then b represents a single bond and i is equal to 1: R.sub.5, R.sub.6 and R.sub.7 represent nothing R.sub.2, R.sub.3 and R.sub.4 are as defined above.

24. Method according to claim 22, said compound being of formula (IV) ##STR00018## in which: R.sub.3 can represent: H; a linear alkyl chain of 1 carbon atom; R.sub.4 can represent: H; a halogen atom a linear alkyl chain of 1 carbon atom; or a compound of formula (IVa).

25. Method according to claim 22, said compound being of formula (V) ##STR00019## in which: R.sub.2 can represent: H; a linear or branched alkyl or alkenyl chain of 1 to 10 carbon atoms, monocyclic, bicyclic or polycyclic of 3 to 20 carbon atoms; an aryl group of 1 to 20 carbons; R.sub.3 can represent: H; a linear alkyl chain of 1 carbon atom; R.sub.4 can represent: H; a halogen atom a linear alkyl chain of 1 carbon atom.

26. Method according to claim 22, said compound being of formula (VI) ##STR00020## in which: R.sub.2 can represent: H; a linear or branched alkyl or alkenyl chain of 1 to 10 carbon atoms; an aryl group of 1 to 20 carbons; R.sub.3 can represent: H; a linear alkyl chain of 1 carbon atom; R.sub.4 can represent: H; a halogen atom a linear alkyl chain of 1 carbon atom.

27. Method, according to claim 22, said compound being althiazide of formula (I) in racemic form: ##STR00021##

28. Method according to claim 22, said compound being althiazide of formula (IA) and being in pure form or with a chiral purity greater than 99%: ##STR00022##

29. Method according to claim 22, said compound being althiazide of formula (IB) and being in pure form or with a chiral purity greater than 99%: ##STR00023##

30. Method according to claim 22, said compound being of formula: ##STR00024##

31. Method according to claim 22, wherein the treatment of cancer is the treatment of primary cancer tumors.

32. Method according claim 22, wherein the cancer is in the pre-metastatic state.

33. Method according to claim 22, wherein the compound of formula (II) is an anti-cancer agent or potentiator of an anti-cancer agent, or as an anti-metastatic agent.

34. Method according to claim 22, wherein the compound of formula (II) is in combination with another anti-cancer agent.

35. Method according to claim 22, wherein the compound of formula (II) is an anti-cancer agent or potentiator of an anti-cancer agent, or as an anti-metastatic agent, wherein the compound of formula (II) is in combination with another anti-cancer agent, said other anti-cancer agent being a radiation or a chemical agent, or a chemotherapy agent, a radiotherapy agent, a radio-pharmaceutical or an anti-angiogenic agent.

36. Method according to claim 22, wherein the compound of formula (II) is an anti-cancer agent or potentiator of an anti-cancer agent, or as an anti-metastatic agent, wherein the compound of formula (II) is in combination with another anti-cancer agent, said other anti-cancer agent being chosen from alkylating agents such as alkylsulfonates, or busulfan, dacarbazine, procarbazine, cloretazine, nitrogen mustards such as chlormethine, melphalan, chlorambucil, cyclophosphamide, ifosfamide, nitrosoureas such as carmustine, lomustine, semustine, streptozocin, altretamine, fotemustine; antineoplastic alkaloids such as vincristine, vinblastine, vinorelbine, vindesine; taxanes such as paclitaxel or taxotere; antineoplastic antibiotics such as actinomycin, bleomycin; intercalating agents such as mitoxantrone, etoposide, bleomycin, actinomycin D, amsacrine, alliptinium; antineoplastic antimetabolites: folate antagonists, methotrexate; inhibitors of purine synthesis; purine analogues such as mercaptopurine, 6-thioguanine; inhibitors of pyrimidine synthesis, aromatase inhibitors, capecitabine, pyrimidine analogs such as fluorouracil, gemcitabine, cytarabine and cytosine arabinoside; brequinar, nelarabine; group I and II topoisomerase inhibitors such as irinotecan, exatecan, topotecan, teniposide, camptothecin or etoposide; anticancer hormone agonists and antagonists including tamoxifen; kinase inhibitors, such as imatinib, nilotinib and dasatinib, midaustorin, sorafenib, lestaurtinib, tandutinib, sirolimus, everolimus or tensirolimus; growth factor inhibitors; anti-inflammatories such as pentosan polysulfate, corticosteroids, prednisone, dexamethasone; ceplene (histamine dihydrochloride); antracyclines such as daunorubicin, epirubicin, pirarubicin, idarubicin, zorubicin, aclarubicin, annamycin, doxorubicin, mitomycin and methramycin; anticancer metal complexes, platinum derivatives such as cisplatin, carboplatin, oxaliplatin, satraplatin; alpha interferon; triphenylthiophosphoramide; antiangiogenic agents; thalidomide; inhibitors of farnesyl-tranferase such as tipifarnib; inhibitors of DNA methyltransferase such as MG98; immunotherapy adjuvants such as gemtuzumab ozogamicin, HuM 195; biotherapeutic agents such as CT388-I L3; antisense such as GTI-2040; vaccines.

37. Method according to claim 22, said compound being formulated to be administered to humans or animals at a dosage from 0.016 mg/kg to 16 mg/kg in admixture with pharmaceutically acceptable excipients.

38. Method according to claim 22, wherein the compound of formula (II) is an anti-cancer agent or potentiator of an anti-cancer agent, said compound being used by oral, parenteral, inhalation spray, nasal, vaginal, rectal, sub-lingual or local administration.

39. Method according to claim 22, wherein the cancer is: head and neck cancer lung cancer; digestive cancer; gynecological cancer; a urogenital cancer; ENT cancer; breast cancer cancer of the small intestine; colon cancer; liver cancer; cancer of the bile ducts; gall bladder cancer; pancreatic cancer; kidney cancer; cancers of the endocrine glands including thyroid cancer, pituitary gland, adrenal gland; skin cancers including hemangiomas, melanomas, sarcomas, including Kaposi's sarcoma; tumors of the brain, nerves, eyes, meninges, including astrocytomas, gliomas, glioblastomas, retinoblastomas, neuromas, neuroblastomas, schwannomas, meningiomas; hematopoietic malignancies; leukemias, (Acute Lymphocytic Leukemia (ALL), Acute Myeloid Leukemia (AML), Chronic Myeloid Leukemia (CML), Chronic lymphocytic leukemia (CLL)) Chloromas, Plasmacytomas, T- or B-cell leukemias, Non-Hodgkin's or Hodgkin's lymphomas, Myeloma, various hematological malignancies; any form of cancer at high risk metastatic.

40. Method according to claim 22, wherein the compound of formula (II) is in combination with another anti-cancer agent, said other anti-cancer agent being a radiation, or a radiotherapy agent, said cancer being head cancer a cancer of the neck; lung cancer; a digestive cancer; gynecological cancer; urogenital cancer; ENT cancer; breast cancer cancer of the small intestine; colon cancer; liver cancer; bile duct cancer; gall bladder cancer; pancreatic cancer; kidney cancer; cancers of the endocrine glands including thyroid, pituitary, adrenal gland cancer; skin cancers including hemangiomas, melanomas, sarcomas, including Kaposi's sarcoma; tumors of the brain, nerves, eyes, meninges, including astrocytomas, gliomas, glioblastomas, retinoblastomas, neuromas, neuroblastomas, schwannomas, meningiomas; hematopoietic malignancies; leukemia, (Acute Lymphocytic Leukemia (ALL), Acute Myeloid Leukemia (AML), Chronic Myeloid Leukemia (CML), Chronic Lymphocytic Leukemia (CLL)) Chloromas, Plasmacytomas, T- or B-cell leukemias, Non-Hodgkin's or Hodgkin's lymphomas, Myeloma, various hematological malignancies; any form of cancer at high risk metastatic.

41. Pharmaceutical composition containing a compound of formula (IA) or (IB), in combination with a pharmacologically acceptable carrier, said compound formula (IA) or (IB) being in pure form or with a chiral purity greater than 99% ##STR00025##

Description

FIGURES

[0321] FIG. 1: Similarities of endothelial and epithelial cell migration processes at the EHT and the EMT. The main steps are conserved (loss of polarity and cell junctions, degradation and migration through the extracellular matrix, intravasation and extravasation into the bloodstream and colonization and proliferation in distant tissues).

[0322] FIG. 2: Observation of the exit and local migration of HSCs in the Aorta-Gonad-Mesonephros (AGM) region of the 48 hpf stage zebrafish embryo. After treatment with the thiazide at 10 μM, there is a reduction of the junction loss and the local migration of HSC.

[0323] FIG. 3: Percentage of cells accumulated in CHT after incubation of zebrafish embryos in the presence of molecules of the diuretic or antihypertensive therapeutic classes. Althiazide is the most effective chemical compound on inhibiting the migration of HSCs into distant tissues. Dasatinib is used as a reference molecule. The compounds are tested at the concentration of 10 μM.

[0324] FIG. 4: Validation of the effect of althiazide on the migration of HSCs in the zebrafish embryo in vivo. Decrease in the number of cells that migrated in CHT by 36.2% after treatment with althiazide by balancing at a concentration of 10 μM. The number of embryos is respectively n=64 and n=74. Error bar calculated with the standard error. Statistical test: student test. p-value: 2.9864E-7

[0325] FIG. 5: Comparison of the anti-micratory effects of dasatinib and althiazide on the zebrafish embryo in vivo. Both molecules are diluted at a concentration of 10 μM and tested by balancing on zebrafish embryos. The control solution contains an equivalent amount of DMSO (1%). In this test, the numbers of embryos are respectively n=80, n=79 and n=81. Error bar calculated with the standard error. Statistical test: student test. p-value: 5.6595E-6

[0326] FIG. 6: Curve of the dose effect of althiazide on the zebrafish embryo. Observation of the number of cells migrated in distant tissues (CHT) after treatment with balneation (percentage of effectiveness) with a solution containing althiazide at concentrations of 1 μM, 10 μM, 100 μM, 1000 μM. NOEC: No Observed Effect Concentration. EC50: Effective concentration 50%.

[0327] FIG. 7: Evaluation of the toxicity of althiazide and dasatinib on the zebrafish embryo by measuring the percentage of embryo survival as a function of the concentration of althiazide and dasatinib (A) or the duration of treatment (B). The molecules are diluted at concentrations of 1 μM, 10 μM, 100 μM and 1000 μM and incubated for 24, 48 and 72 hours. The control solution contains an equivalent amount of DMSO (1%). The number of embryos being respectively n=50, n=50 and n=50). Error bar calculated with the standard error. Statistical test: student test. p-value: 1.49852E-7.

[0328] FIG. 8: Migration and cytotoxicity test on 4T1 cells in culture in the presence of althiazide (A) or dasatinib (B) at concentrations of 10 nM, 100 nM, 1 μM, 10 μM and 100 μM. Error bar calculated with the standard error.

[0329] FIG. 9: Percentage of cells accumulated in CHT after incubation of zebrafish embryos in the presence of molecules of the class of thiazide compounds at different concentrations. Althiazide is the most effective chemical compound on inhibiting the migration of CD41 cells into distant tissues. The compounds are tested at a concentration of 10 μM or 25 μM.

[0330] FIG. 10: Rate of cells migrated during a migration test on MDA-MB-231 cells, as a function of the amount of althiazide added (10, 50 or 100 μM) compared to the control test.

[0331] FIG. 11: Impact of althiazide on the expression of transcription factors of genes involved in the epithelio-mesenchymal transition (EMT) under hypoxic conditions. The genes ZEB1, SNAIL, Vimentin and N-cad have a deleterious impact and must be inhibited. The E-cad gene has a beneficial effect and needs to be overexpressed. The white columns mention the control while the black columns are the expression results of these genes with an althiazide concentration of 100 μM.

[0332] FIG. 12: Cell viability and cytotoxicity test on MDA-MB-231 cells in the presence of doxorubicin alone (white columns) or of an althiazide and doxorubicin mixture (black columns), at different concentration (doxorubicin: 0.1, 0.5, 1, 2.5, 5, 10, 25, 50, 100 μM, althiazide: 100 μM).

[0333] FIG. 13: Cytotoxicity test on MDA-MB-231 cells in the presence of doxorubicin alone (Control) or of a mixture of doxorubicin supplemented with a compound of the invention at a concentration of 50 μM.

[0334] FIG. 14: Preparatory separation test between the two enantiomers of althiazide with 5 injections of 2 mL each. The line at the bottom of the peaks indicates the opening moments of the collection of each product. The first peak corresponds to the enantiomer AZ(A) and the second peak to the enantiomer AZ(B).

[0335] FIG. 15: Chromatogram of althiazide AZ-MI15 (racemic form). The first peak with a retention time of 10.15 minutes corresponds to the product AZ(A), and the second peak with a retention time of 13.4 minutes corresponds to the product AZ(B).

[0336] FIG. 16: Chromatogram of the sample EV-VZWOO 1-070-002. The first peak with a retention time of 10.2 minutes corresponds to the product AZ(A), and the second peak with a retention time of 13.5 minutes corresponds to the product AZ(B).

[0337] FIG. 17: Chromatogram sample EV-VZWOO 1-070-005 after 24 h storage under controlled temperature at 5° C. and protected from light. The first peak with a retention time of 10.09 minutes corresponds to the product AZ(A), and no peak near 13.5 minutes is visible.

[0338] FIG. 18: Chromatogram sample EV-VZWOO 1-070-006 after 24 h storage at room temperature without protection against light. The first peak with a retention time of 10.25 minutes corresponds to the product AZ(A), and the second peak with a retention time of 13.79 minutes corresponds to the product AZ(B).

MATERIALS AND METHODS

[0339] The althiazide batch used is noted AZ-M015 and is in racemic form. The first enantiomer of formula (IA) and derived from AZ-M015 is noted AZ(A). The second enantiomer of formula (IB) and derived from AZ-M015 is noted AZ(B).

[0340] The analysis of the chiral purity of the products to be tested was carried out by a supercritical fluid separation (SFC) technique on a Berger prep chromatograph, marketed by Thar Instruments. The mobile phase of the separation consists of a mixture of methanol added. 0.01% acetic acid and CO.sub.2 in a 20/80 ratio. The stationary phase chosen is a Chiralpak IC 59 m column, 250 mm by 20 mm, marketed by sigma aldrich. The injection rate is 50 ml per minute, at 40° C. under a pressure of 100 bar. The product to be analyzed is dissolved in methanol supplemented with 0.01% acetic acid, with a concentration of 1 mg/ml. 10 μl of this product is injected. The detector is a UV detector with a wavelength greater than 275 nm.

[0341] The analysis of the reverse phase purity of the products to be tested was carried out by an ultra-high pressure liquid chromatography (UHPLC) reverse phase chromatography technique on a Waters UPLC2 liquid chromatograph, marketed by Waters. The mobile phase of the separation varies during the method according to the protocol of Table 1.

TABLE-US-00001 TABLE 1 Composition of the mobile phase used for UHPLC analysis. Between each point, the flow varies by gradient (TFA: Trifluoroacetate) The column used is a Waters Acquity column UPLC HSC Cl 8 1.7 μm 2.1 * 100 mm, marketed by Water. The flow of mobile phase is 0.6 ml/minute. The detector is a UV detector with a wavelength of 210 nm. The product to be analyzed is dissolved in acetonitrile, with a concentration of 1 mg/ml, and the injected volume is 1 μl. Time mobile phase (%) (min) water + 0.1% TFA Acetonitrile 0 95 5 4 5 95 5.5 5 95 5.51 95 5 7.3 95 5

[0342] The separation of the two enantiomers of the AZ-M015 AZ(A) and AZ(B) althiazide was carried out by a supercritical fluid separation (SFC) technique on a Berger prep chromatograph. The shift in the retention time of each enantiomer makes it possible to recover, at the separation outlet, first the compound AZ(A) and, secondly, the compound AZ(B). The recovery is indexed to the detector signal for opening and closing the recovery of each compound.

[0343] The mobile phase of the separation consists of a methanol mixture supplemented with 0.01% acetic acid and CO.sub.2 in a 20/80 ratio or a mixture of acetonitrile and CO.sub.2 in a 30/70 ratio. The stationary phase chosen is a Chiralpak IC 5 μm column, 250 mm by 20 mm. The injection rate is 50 ml per minute, at 40° C. under a pressure of 100 bar. The product to be separated is dissolved in a methanol mixture supplemented with 0.01% acetic acid or in acetonitrile. A series of injections is performed. The detector is a UV detector with a wavelength greater than 275 nm. The collection of the respective products is started when the signal exceeds a high threshold detection value and is stopped when the signal falls below a low threshold detection value. The high and low threshold values are chosen during a preparatory test according to a compromise between the quantity of enantiomers recovered, the desired purity and the analysis conditions. The collected products are evaporated before being analyzed for their respective purity.

[0344] Solubilization of althiazide and enantiomers was achieved by solubilization in a solvent of 95% 1M Tris pH 10.8 and supplemented with 5% pure ethanol.

[0345] Althiazide and enantiomers are resuspended at a concentration of 2 mg/ml. Each of the solutions is vortexed for 30 seconds and then placed in an ultrasound bath for a sonication of 5min; this operation is repeated once. The dissolution is complete despite the absence of DMSO.

[0346] The solubilization of althiazide and enantiomers was also obtained by solubilization in a solution consisting of a mixture of 3.7% of NaHCO.sub.3, 0.2M and 21% of Na.sub.2CO.sub.3 0.2M at pH 10.6 and supplemented with pure water. Althiazide and enantiomers are resuspended at a concentration of 2.5 mg/ml. Each of the solutions is vortexed for 30 seconds and then placed in an ultrasound bath for a sonication of 1 min. The dissolution is complete despite the absence of DMSO.

[0347] The stability tests of the enantiomers were performed by comparing the racemization and the degradation of the stored samples either at room temperature without protection against light, or under controlled temperature at 5° C. and protected from light.

[0348] The stored products are analyzed regularly (T=0, 1 h, 2 h, 3 h, 6 h, 24 h) to follow the evolution of the racemization of enantiomers.

[0349] The Tg transgenic zebrafish line (CD41:GFP) is maintained in accordance with the protocols described by the Ethical Committee for Animal Experimentation. The fish are kept at a temperature of 28° C. and their development stage is determined as before. The molecules are tested on zebrafish embryos at the 25 hpf stage. The embryos are decorticated and transferred to a 96-well plate (1 embryo/well) containing the test compounds in a final volume of 100 μl of the embryonic growth medium (60 μg salt for 1 ml H2O). For chemical compounds diluted in DMSO, the final concentration of DMSO does not exceed 1%. The treated embryos are incubated for 24 hours in an incubator at 28° C.

[0350] The embryos are imaged with a plate reader after being anesthetized with 0.16% tricaine (ethyl-3-aminobenzoate). A quantification of the number of fluorescent cells (CD41:GFP) accumulated in the CHT is carried out.

[0351] The toxicity study is carried out over 72 hours. The embryos are treated at 25 hpf with the doses used for the test of chemical compounds of each of the compounds, in a 96-well plate, in a final volume of 100 μl of the embryonic growth medium. The embryos are incubated 72 h at 28° C. The medium is changed every 24 hours. The survival rate of embryos and the appearance of developmental defects are analyzed daily.

[0352] The cell migration assays on the 4T1 cell line are carried out in vitro in 12-well plates on the 4T1 cell line. The cells are maintained in DMEM culture medium supplemented with 10% calf serum (FCS) and incubated at 37° C. and 5% CO.sub.2. The cell monolayer is injured with a 10 μ pipette tip. The medium is aspirated and replaced by a medium containing the compounds to be tested at the concentrations described. The wells are imaged using a microscope and the injured surface is repaired at the indicated times to highlight the cell anti-migratory power of the tested chemical compounds. The average of the measurements obtained is compared with the control wells: (average value of the compounds treated/average value of the controls)*100=% of the average value.

[0353] Cell migration assays on the MDA-MB-231 cell line are performed in vitro in 96-well plates. The MDA-MB-231 cells were seeded at the density of 50000 cells per well, to form a monolayer. The cells are maintained in a DMEM culture medium supplemented with 0.2% fetal calf serum and incubated at 37° C., 5% CO.sub.2 and 1% O.sub.2 for 24 hours. The cell monolayer is injured with a pipette tip. The cells are then rinsed with PB S to remove the cells in suspension and the different treatments are added, as well as DMEM supplemented with 10% FCS. The cells are incubated for 18 hours at 37° C., 5% CO.sub.2 and 20% O.sub.2.

[0354] A first series of images of each well (center of the well) was carried out at the beginning of the experiment (t=0) and after 18 hours of migration (t=18) using a 4× objective Nikon microscope. The images were analyzed using ImageJ software (National Institutes of Health, USA).

[0355] The treatments were carried out in triplicate and the manipulation was carried out 3 times.

[0356] The cytotoxicity tests are carried out in cell culture in 96-well plates, on the 4T1 cell line. The cells are maintained in a DMEM culture medium supplemented with 10% fetal calf serum (control condition) or placed in the presence of an MTT solution (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) at 1 mg/ml in DMEM medium supplemented with 10% fetal calf serum (100 μl per well). The cells are incubated at 37° C. and 5% CO.sub.2 for 4 hours. The reaction is stopped by the addition of 100 μl of a solution containing 10% of SDS and 0.01 M of HCl. The cells are placed in an incubator at 37° C. and 5% CO.sub.2 for 2 hours. The absorbance is measured between 570 and 590 nm. The negative control is performed on a well without cells, containing 200 μl of a 1 mg/ml solution of MTT diluted in DMEM culture medium supplemented with 10% fetal calf serum. The average of the measurements obtained is compared with the control wells: (average value of the compounds treated/average value of the controls)*100=% of the average value.

[0357] The cell cultures are carried out on human breast cancer epithelial cell lines MDA-MB-231 (HTB-26™), resulting from metastases present in a pleural effusion of a patient with a mammary adenocarcinoma. This line is used as a triple negative cancer cell model (no expression of ER-type nuclear estrogen receptors, nuclear progesterone receptors or overexpression of the oncogene encoding HER2 protein (Human Epidermal Growth factor Receptor-2).

[0358] The cells were cultured in DMEM medium (Eurobio, Fance) supplemented with 10% fetal calf serum (FCS) (Eurobio, Fance) at 37° C., 5% CO.sub.2. The medium was changed every 3 days.

[0359] The cells were placed in a controlled atmosphere at 1% oxygen 24 hours before the application of the different treatments.

[0360] Proliferation is measured by crystal violet staining. Cells were seeded in 96-well plates at a density of 10,000 cells per well. After 24 h of culture at 37° C., 5% CO.sub.2 and 1% O.sub.2, the medium was renewed and added with althiazide (at the concentrations described). Cells were incubated for an additional 24, 48 or 72 hours at 37° C., 5% CO.sub.2 and 1% O.sub.2. After rinsing the cells with PBS, 50 μl of a 0.5% crystal violet solution in 20% ethanol was added to each well. The plate was incubated at room temperature with stirring for 15 minutes. The cells were washed and then lysed with a 1% SDS solution in order to solubilize the crystal violet. Absorbance was measured at 570 nm using the Tecan Sunrise spectrophotometer.

[0361] The results are expressed as a percentage of the control.

[0362] The cell viability is determined via the IC50 index, measured by the MTT technique (2-(4,5-dimethyl-2-thiazolyl)-3,5-diphenyl-2H-tetrazolium bromide) (Mosmann, 1983). This colorimetric test is based on the reduction of yellow tetrazolium salts into insoluble purple formazan crystals in aqueous solution. The spectrophotometric measurement of the absorbance at 570 nm is directly proportional to the number of viable cells

[0363] The cells were seeded in 96-well plates at a density of 25,000 cells per well. After 24 h of culture at 37° C., 5% CO.sub.2 and 1% O.sub.2, the medium was renewed and supplemented with increasing doses of doxorubicin+/−althiazide. Cells were incubated for 24 h at 37° C., 5% CO.sub.2 and 1% O.sub.2. The MDA-MB-231 cells were washed and then incubated for 1 hour at 37° C. with 100 μl of a 0.5 mg/ml MTT solution prepared in culture medium. The formazan crystals were dissolved in 100 of DMSO and the absorbance measured at 570 nm using the Tecan Sunrise spectrophotometer. The IC50 was determined using the Graphpad Prism 5.0 software. The treatments were carried out in triplicate and the manipulation was carried out 5 times.

[0364] The expression of the mRNAs is measured by the q-RT-PCR method. The cells were seeded at the density of 500,000 cells/well in 6-well plates. After 24 hours at 37° C., 5% CO.sub.2 and 1% O.sub.2, the medium was renewed and added the various treatments. RNA was isolated using TRI Reagent® (sigma), assayed and retro-transcribed into complementary DNA using the PrimeScript RT Reagent Kit (Takara). The expression levels of the mRNA of the genes of interest were determined by quantitative PCR (LightCycler® 480 Instrument II) with the primers listed in Table 2:

TABLE-US-00002 TABLE 2 List of primers used by qPCR hactin_for CCAACCGCGAGAAGATGACC SEQ ID NO: 1 hactin_rev GATCTTCATGAGGTAGTCAGT SEQ ID NO: 2 hZEB1_for GATGATGAATGCGAGTCAGATGC SEQ ID NO: 3 hZEB1_rev CTGGTCCTCTTCAGGTGCC SEQ ID NO: 4 hSLUG_for GCT CCT TCG TCC TTC TCC TC SEQ ID NO: 5 hSLUG_rev TGA CAT CTG AGT GGG TCT GG SEQ ID NO: 6 hSNAIL_for GGCCTTCAACTGCAAATACT SEQ ID NO: 7 hSNAIL_rev ACATCTGAGTGGGTCTGGAG SEQ ID NO: 8 hVimentin_for GACAATGCGTCTCTGGCACGTCTT SEQ ID NO: 9 hVimentin_rev TCCTCCGCCTCCTGCAGGTTCTT SEQ ID NO: 10 hE-cadh_for CCCACCACGTACAAGGGTC SEQ ID NO: 11 hE-cadh_rev CTGGGGTATTGGGGGCATC SEQ ID NO: 12 hN-cadh_for GCCACCTACAAAGGCAGAA SEQ ID NO: 13 hN-cadh_rev ATGTGCCCTCAAATGAAACC SEQ ID NO: 14

[0365] The results are calculated using the Delta Delta Ct (Δ ΔCt) method.

[0366] The anti-metastatic effects of althiazide in mice are evaluated in immunocompromised mice injected with cells from a tumor line in the mammary gland.

[0367] The mice are treated for 4 weeks with an althiazide injection each day. The mammary tumors of the mice are measured 3 times a week for 4 weeks.

[0368] Mice for which the mammary tumor has reached 2 g are sacrificed and the number of cancerous metastases invading the lung is counted.

[0369] This number is compared to the batch of control mice injected with the same tumor cell line and treated with PBS. A decrease in the number of metastases in the lungs of mice treated with althiazide compared to the control lot in which the mice are treated with PBS makes it possible to validate the anti-metastatic effect of althiazide in vivo in mice.

[0370] The potentiating effects of althiazide on an anti-cancer agent in mice are evaluated in immunocompromised mice injected with cells from a tumor line in the mammary gland.

[0371] The maximum dose of althiazide is given alone or in combination with the anti-cancer agent. Several doses of anti-cancer agent are tested.

[0372] The mice undergo a treatment for 4 weeks with an injection of anticancer agent per week over 4 weeks and an injection of althiazide every day for 4 weeks. The first dose of althiazide is given on the first day after injection of cells from a tumor line into the mammary gland.

[0373] The mammary tumors of the mice are measured 3 times a week and compared to the batches of mice treated with PBS alone or with althiazide alone.

[0374] A reduction in the size of cancerous tumors in the lot of mice treated with althiazide and doxorubicin compared to the control lot or the mice are treated with doxorubicin alone, to validate the potentiating effect of althiazide on the activity of doxorubicin in vivo in mice.

EXAMPLES

Example 1: Anti-Metastatic Action of Althiazide: Test of Initiation and Progression of the Metastatic Process on the Zebrafish Embryo

[0375] Althiazide was tested on the zebrafish embryo according to the method previously described in the international application WO 2011/007259. This method consists in isolating molecules capable of inhibiting the emergence of hematopoietic stem cells from the floor of the aorta without cell division, but by endothelial-to-hematopoietic transition. This emergence involves the loss of cell polarity of emerging cells, the loss of cellular junctions with these neighboring cells and the acquisition of migratory properties. This model is used, in the context of the invention, because it mimics each of the stages of the epithelial-to-mesenchymal transition, the first stage of the cancerous metastasis. The endothelial-to-hematopoietic transition takes place in a region of the embryo called Aorto-Gonado-Mesonephros (AGM).

[0376] The colonization of hematopoietic tissues by hematopoietic stem cells mimics the appearance and/or progression of a metastatic tumor since it involves intravasation, extravasation, or the migration of HSCs following a gradient of SDF1. The first colonized tissue is caudal hematopoietic tissue (CHT). This physiological process is considered, in the context of the invention, as representative of the appearance and/or progression of a metastatic tumor.

[0377] In order to evaluate the inhibition of endothelial-to-hematopoietic transition, CD41: green fluorescent protein (GFP) transgenic embryos, in which hematopoietic stem cells (HSCs) express GFP, were used, allowing them to be monitored in vivo under a fluorescence microscope.

[0378] Each CD41:GFP embryo at the 25-hour post fertilization (hpf) stage was added to a well of a 96-well plate containing one of the compounds to be tested. The treated embryos were incubated 24 hours at 28° C.

[0379] Each well containing the 50 hpf embryos was then imaged using a fluorescence microscope to analyze the number of cells dispersed in the embryo and to quantify their distribution in the different regions of the embryo.

[0380] The read-out is the number of hematopoietic stem cells CD41:GFP accumulated in the AGM (mimicking the initiation of the metastatic process) and/or in the CHT of the zebrafish embryo (mimicking the progression of the metastatic process). The accumulation of CD41:GFP cells in CHT implies that each cell has made an endothelial-to-hematopoietic transition, an intravasation, a CHT extravasation, has settled in a stromal niche and has proliferated (FIG. 1). In parallel, the phenotypic characterization of embryos has made it possible to isolate compounds capable of preventing the endothelial-to-hematopoietic transition and their migration towards the CHT without causing a toxic effect on the developing embryo.

[0381] According to the methodology described above, althiazide has proved effective against the migration of HSC locally and to distant organs (CHT).

[0382] After treatment with the concentration of 10 μl of althiazide (concentration in the embryonic growth medium: 60 g of salt in 1 ml of distilled H2O), the number of HSC accumulated in the AGM is greater than the number of HSC accumulated in reference embryos treated with the althiazide dissolution solution, DMSO (FIG. 2). Althiazide reduces the emergence of HSCs and their local migration.

[0383] After treatment with a concentration of 10 μl of althiazide (concentration in the embryonic growth medium: 60 μg of salt in 1 ml of distilled H.sub.2O), the number of HSCs accumulated in CHT is reduced by 41% compared with number of HSC accumulated in reference embryos treated with the solution of dissolution of althiazide, DMSO (FIG. 3), and this without causing toxic effects. This effect is identical to that observed with dasatinib, a reference molecule in this test, which has been used in various clinical trials for its potential anti-metastatic effects. Although the anti-metastatic effects of dasatinib have been observed in various experimental models, it has not been used as an anti-metastatic treatment in humans, mainly because of its low tolerability (fatigue, hyponatremia, diarrhea, gastrointestinal bleeding, pleural and pericardial effusions and anemia) by the patients. Dasatinib is a potent inhibitor of many kinase enzymes such as BCR-ABL, KIT and PDGFRα/β, and is therefore primarily used for the treatment of chronic myeloid leukemia resistant to imatinib, but also a potent inhibitor of c-SRC, LYN, FY and EPHA2, which may explain its low tolerability.

Example 2 Absence of Anti-Metastatic Effect of Other Diuretics or Antihypertensives: Evaluation of the Progression of the Metastatic Process on the Zebrafish Embryo

[0384] In order to verify the specificity of the action of althiazide, other chemical molecules of the therapeutic classes of diuretic or anti-hypertensive (Chlortalidone, Metolazone, Pentolinium-bitartrate and Hydralazine-hydrochloride) were tested at the same concentration than althiazide (10 μM). These chemical molecules do not cause a decrease in the number of HSCs accumulated in CHT. A decrease of 20% is however observed after treatment with the concentration of 10 μM of Hydrochlorothiazide which has a structure close to althiazide.

[0385] A second test, on a larger number of embryos, confirmed the efficacy of althiazide as an anti-metastatic with a decrease in the number of cells colonized CHT by 36.2% (FIG. 4).

Example 3: In Vivo Anti-Migration Activity: Test of the Progression of the in Vivo Metastatic Process on the Zebrafish Embryo

[0386] Considering that an anti-migratory effect is a good indicator of antimetastatic activity, we assessed the anti-migratory effect of althiazide in vivo on the zebrafish embryo.

[0387] The number of HSCs accumulated in the distant tissues (CHT) of the zebrafish embryo after treatment with the 10 μM concentration of althiazide and dasatinib, the reference molecule in this test, was compared. We concluded that althiazide has an anti-migratory effect as effective as dasatinib, used at the same concentration (FIG. 5).

Example 4: Measurement of the Effectiveness Threshold of the Althiazide: Effectiveness/in Vivo Toxicity Dose Test on the Zebrafish Embryo

[0388] In order to determine the concentration at which the althiazide is not effective (NOEC), the concentration at which the althiazide is 50% effective (EC50) and the concentration at which the althiazide is 100% effective, the number of cells migrated to distant tissues (CHT) after balancing with a solution containing althiazide at concentrations of 1 μM, 10 μM, 100 μM, 1000 μM for 24 hours was quantified.

[0389] At 1 μM, no effect is observed, at 10 μM, an efficiency of 50% is observed, at 100 μM, an efficiency of 100% is observed but also the appearance of toxic effects (FIG. 6).

[0390] At the same time, we analyzed the toxicity of althiazide after balancing with a solution containing althiazide at concentrations of 1 μM, 10 μM, 100 μM, 1000 μM for 24, 48 and 72 hours. The toxicity study was based on analysis of the percentage viability of the embryos after treatment. At concentrations of 1 μM, 10 μM and 100 μM, althiazide causes no toxicity even after 72 hours of treatment. A 50% toxicity is observed after treatment for 24 hours, the althiazide at the concentration of 1 mM. In comparison with the doses evaluated with althiazide, dasatinib has a very high toxicity (FIG. 7).

Example 5: Cytotoxicity: Cytotoxicity Test on 4T1 Cells

[0391] The 4T1 cells are derived from tumors of the mammary gland in mice.

[0392] It is a particularly suitable model and widely used for studies on cancerous tumors and more particularly on metastasis. Indeed, mammalian in vivo efficacy studies are performed on the mouse and the 4T1 model is an orthotopic syngeneic model of murine cells injected into BalbC mice, which promotes dialogue between the tumor and its environment; essential condition for cell migration. Moreover, this model is known to develop a large number of metastases in a relatively short period of time. Metastases appear in the lungs, which facilitates their observation in the visible.

[0393] In order to study the cytotoxic effects of althiazide in vitro, we analyze the cell death induced by treatment with althiazide by tetrazolium salt labeling MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) on 4T1 cells. The amount of living cells in the well is assayed by spectrometry. The results are compared with those obtained after treatment with the control solution (FIG. 8). In this test, we observe a very low mortality of cells after treatment with althiazide (80% of living cells at the highest dose 100 μM). Cells treated with dasatinib have a much higher mortality rate, at much lower doses (80% live cells at the lowest 10 nM dose and 20% live cells at 100 μM).

Example 6: Anti-Metastatic Activity of Althiazide in Vitro: 4T1 Cell Migration Test

[0394] In order to validate the anti-migratory potential of althiazide, we carry out a “scratch test” on 4T1 cells in culture according to the cell migration test protocol on the 4T1 cell line described in the Materials and Methods section. This test is used to evaluate the migratory power of a chemical compound on cells in culture. The experiment consists in studying the capacity of cells to reconstitute a cellular mat (‘cicatrisation’), which implies the migration property of the cells composing the cell monolayer on the injured area. The test is carried out in a 12-well microtiter plate. An injury is performed using a pipette tip of 10 μl, then the cells are treated with dasatinib or althiazide at concentrations of 10 nM, 100 nM, 1 μM, 10 μM and 100 μM. The cells are then placed under normoxic or hypoxic conditions. A photo of the surface of the well is made at t=0 (after the injury) then at t=24 h.

[0395] The area of the injured area is measured for each well and the percentage of migration is calculated under each condition.

[0396] We observe a decrease in cell migration of 40% after treatment with althiazide at the lowest concentration 10 nM (FIG. 8). At the same doses, dasatinib is more effective but causes much more toxicity.

Example 7: Anti-Migratory Action of Other Thiazide Compounds: Test for Initiation and Progression of the Migratory Process on the Zebrafish Embryo

[0397] To determine whether the anti-metastatic action of althiazide is also valid for the entire thiazide family, other thiazide compounds were tested.

[0398] The anti-metastatic efficacy of the thiazide compounds was determined as for the measurement of the anti-metastatic efficacy of athiazide, quantified by the cell migration assay on the 4T1 cell line described in the Materials and Methods section. These compounds were tested at 10 and 25 μM. Each of these compounds makes it possible to reduce the number of cells having colonized CHT (caudal haematopoietic tissue) and thus confirms the anti-metastatic activity of the thiazide compounds. AZ-M015 reduces migration by 30%. However, the most effective compound is MCZ since it reduces migration by 37% when used at 10 μM and 55% when used at 25 μM. In addition, the enantiomers of PAZ-M015, AZ(A) and AZ(B) further reduce the invasion of CHT by CD41:GFP cells. These compounds, by decreasing the accumulation of CD41:GFP cells, altered one or more of the following processes: endothelial-to-hematopoietic transition, intravasation and/or extravasation at the CHT level.

Example 8: Migration Test MDA-MB-231 Cells

[0399] In order to validate the anti-migratory potential of althiazide, we carry out a “scratch test” is carried out on MDA-MB-231 cells in culture according to the protocol of the cell migration test on the MDA-MB-231 cell line described in the Materials and Methods section. This test is used to evaluate the migratory power of a chemical compound on cells in culture. The experiment consists in studying the capacity of cells to reconstitute a cellular mat (‘cicatrisation’), which implies the migration property of the cells composing the cell monolayer on the injured area. The test is carried out in a 96-well microtiter plate. Injury is performed using a pipette tip, and then the cells are treated with althiazide.

[0400] A first series of images of each well (center of the well) is performed at the beginning of the experiment (t=0) and after 18 h of migration (t=18) using a Nikon microscope −4× lens. The images were analyzed using Image J software (National Institute of Health, USA)

[0401] An anti-migratory activity of AZ-M015 is observed at concentrations of 10, 50 and 100 μM. A decrease in the order of 50% of the migration is observed (FIG. 10).

Example 9: Expression of Markers of the Epithelio-Mesenchymal Transition

[0402] The epithelial-mesenchymal transition (EMT) is the first step in the process of formation of cancer metastases. Indeed, epithelial cells begin by performing a EMT (loss of cellular adhesion, loss of cellular polarity and acquisition of migratory properties) and then become invasive (Thiery & Sleeman, 2006).

[0403] TEM is characterized by overexpression of transcription factors

[0404] SNAIL/SLUG/TWIST/ZEB1 that induce gene reprogramming leading to the acquisition of migratory properties, in particular the increase in the expression of VIMENTINE and N-CADHERINE and the decrease in the expression of E-CADHERIN.

[0405] Here, AZ-M015 induces a decrease in the expression of transcription factors ZEB1 (−14%) and SNAIL (−19%), VIMENTIN (−22%) and N-CADHERIN (−33%) as well as an increase in FE-CADHERIN expression of 73% (FIG. 11).

[0406] These modifications are opposite to those observed during the TEM. AZ-M015 is therefore an inhibitor of the TEM. By this inhibition, AZ-M015 acts directly on the metastatic spread by blocking the first stage of this cancerous process.

Example 10: Cytotoxicity Potentiation Tests of Althiazide

[0407] Doxorubicin is a substance widely used in the treatment of many cancers (bronchopulmonary cancers, stomach cancers, ovarian cancers, bladder cancers, breast cancers, leukemias, multiple myeloma, non-Hodgkin's malignant lymphoma, Hodgkin's disease, AIDS-associated Kaposi's sarcomas, bone sarcomas, soft tissue sarcomas and solid tumors in children). The use of anthracyclines and in particular doxorubicin is associated with a risk of cardiotoxicity in a dose-dependent manner that can progress to severe and irreversible heart failure. Thus it is on the one hand, important to improve the effectiveness of this treatment and on the other hand to reduce toxicity. In this test, althiazide was added to doxorubicin and cell viability was then determined.

[0408] The tests are carried out in cell culture in 96-well plates, on the cell line MDA-MB-231. The MDA-MB-231 cells are seeded in 96-well plates at a density of 10,000 cells and incubated 24 h at 37° C., 5% CO.sub.2 and 1% O.sub.2. The medium is then renewed and added with increasing concentrations of doxorubicin+/−100 μM althiazide. The cells are incubated for an additional 24 hours at 37° C., 5% CO.sub.2 and 1% O.sub.2. Treatments were made in triplicas and the experiment was repeated 5 times.

[0409] A cell viability test is then performed according to the method described in Materials and methods.

[0410] Results are normalized to the control condition (FIG. 12)

[0411] Althiazide increases the effects of doxorubicin when it is used between 25 and 2.5 μM of about 15%. In addition, treatment with athiazide reduces the IC50 of doxorubicin by 45% from 6.02 μM to 3.318 μM. Althiazide is therefore a potentiator of the anticancer agent doxorubicin. Thus, AZ-M015 makes it possible to increase the effectiveness of anti-cancer treatments and/or to reduce the dose used and thus reduce the undesirable toxic effects of this anti-cancer drug.

Example 11: Cytotoxicity Potentiation Tests for Althiazide

[0412] The tests are carried out in cell culture in 96-well plates, on the cell line MDA-MB-231. The MDA-MB-231 cells are seeded in 96-well plates at a density of 10,000 cells and incubated 24 h at 37° C., 5% CO.sub.2 and 1% O.sub.2. The medium is then renewed and added with doxorubicin and another compound of the invention (Formula (IA, IB, IVa, Va, Vb, Vc, Vd, Ve, Vf, VIa, VIIa and VIIb) at a concentration of 50 μl. The cells are incubated for an additional 24 hours at 37° C., 5% CO.sub.2 and 1% O.sub.2. Treatments were made in triplicas and the experiment was repeated 5 times.

Example 12: Evaluation of the Anti-Metastatic Effects of Althiazide on the Mouse

[0413] The anti-metastatic effects of althiazide on the mouse are evaluated in immunocompromised mice injected with MDA-MB-231 cells into the mammary gland.

[0414] The mice are treated for 4 weeks with an althiazide injection each day.

[0415] The mammary tumors of the mice are measured 3 times a week for 4 weeks.

[0416] Mice for which the mammary tumor has reached 2 g are sacrificed and the number of cancerous metastases invading the lung is counted. This number is compared to the lot of control mice injected with the MDA-MB-231 cancer cells and treated with PBS.

Example 13: Evaluation of the Potentiating Effects of Althiazide on Doxorubicin in Mice

[0417] The maximum dose of althiazide is given alone or in combination with doxorubicin. 4 doses of doxorubicin are tested.

[0418] MDA-MB-231 cells are injected into the mammary gland of immuno-compromised mice.

[0419] The mice are treated for 4 weeks at a dose of doxorubicin per week over 4 weeks and an injection of althiazide every day for 4 weeks. The first dose of althiazide is given on the first day after injection of MDA-MB-231 cells into the mammary gland.

[0420] The mammary tumors of the mice are measured 3 times a week and compared to the batches of mice treated with PBS alone or with althiazide alone.

Example 14: Separation of Enantiomers from Althiazide AZ-M015

[0421] a. Separation by SFC Acid

[0422] The separation of the two enantiomers was carried out according to the protocol described in the Materials and Methods section, with the following parameters: [0423] Mobile phase: methanol supplemented with 0.01% acetic acid/CO.sub.2 in a ratio 20/80 [0424] Product to be separated: 49.2 mg of AZ-M015 dissolved in 2 ml of methanol supplemented with 0.01% of acetic acid. [0425] Injection: 10 injections of 5 mg each. [0426] Collection: 50 mUA opening threshold, 30 mUA closing threshold.

[0427] The two compounds obtained following this separation were called EV-VZW001-070-001 (19.8 mg) and EV-VZW001-070-002 (20.1 mg).

[0428] b. Separation by SFC Acetonitrile Version 1

[0429] The separation of the two enantiomers was carried out according to the protocol described in the Materials and Methods section, with the following parameters: [0430] Mobile phase: acetonitrile/CO.sub.2 in a ratio 30/70 [0431] Product to be separated: 50.9 mg of AZ-M015 dissolved in 2 ml of acetonitrile. [0432] Injection: 13 injections of 4 mg each. [0433] Collection: Opening threshold 60 mUA, closing threshold 50 mUA.

[0434] The two compounds obtained following this separation were called EV-VZW001-070-003 (21.7 mg) and EV-VZW001-070-004 (22.1 mg). FIG. 14 shows the preparative tests for adjusting the opening and closing of the collection of each enantiomer. This collection mode necessarily leads to a lower purity of the second enantiomer.

[0435] c. Separation by SFC Acetonitrile Version 2

[0436] The separation of the two enantiomers was carried out according to the protocol described in the Materials and Methods section, with the following parameters: [0437] Mobile phase: acetonitrile/CO.sub.2 in a ratio 30/70 [0438] Product to be separated: 74.9 mg of AZ-M015 dissolved in 4 ml of acetonitrile. [0439] Injection: 20 injections of 3.8 mg each. [0440] Collection: 50 mUA opening threshold, 40 mUA closing threshold.

[0441] The two compounds obtained following this separation were called EV-VZW001-070-005 (33.6 mg) and EV-VZW001-070-006 (29.1 mg).

Example 15: Analysis of the Separation

[0442] a. Analysis of the starting product.

[0443] The starting compound, AZ-M015 was analyzed to identify the distribution of the two enantiomers by the chiral purity analysis protocol described in the Materials and Methods section. FIG. 15 shows the chromatograph that was obtained with a 49.8% distribution of AZ enantiomer (A) and 50.2% AZ enantiomer (B). b. Analysis of other compounds EV-VZW001-070-X.

[0444] Table 3 shows the results obtained for the compounds from the three separations according to the chiral purity analysis and reverse phase purity analysis protocols both described in the Materials and Methods section.

TABLE-US-00003 TABLE 3 Result of analysis of the compounds resulting from the separations. UHPLC SFC Composé RP (%) AZ(A) (%) AZ(B) (%) AZ-MO15 100 49.8 50.2 EV-VZWOO1-070-001 95.6 95.5 4.5 EV-VZWOO1-070-002 95.8 4.2 95.8 EV-VZWOO1-070-003 99.5 99.7 0.3 EV-VZWOO1-070-004 99.4 0.9 99.1 EV-VZWOO1-070-005 99.8 100 0 EV-VZWOO1-070-006 100 0.6 99.4

[0445] FIG. 16 shows the chromatogram obtained for the analysis of the sample EV-VZWOO 1 -070-002. Example 16: Stability test of enantiomers

[0446] After separation by SFC acetonitrile version 2, 1.5 mg of EV-VZWOO 1-070-005 and 2.4 mg of EV-VZWOO 1-070-006 are removed for stability testing.

[0447] Sample EV-VZWOO 1-070-005 is stored at a temperature of 5° C. under light protection conditions. Sample EV-VZWOO 1-070-006 is stored at room temperature on the bench without protection against light. FIG. 17 shows the chromatogram obtained during the analysis of sample EV-VZWOO 1-070-005 after 24 h storage.

[0448] FIG. 18 shows the chromatogram obtained during the analysis of sample EV-VZWOO 1-070-006 after 24 hours of storage. Table 4 shows the evolution over time of the quantities of enantiomer present in the samples.

TABLE-US-00004 TABLE 4 Temporal stability of enantiomers stored or not in optimal conditions SFC UHPLC EV-VZWOO1- EV-VZWOO1- Pureté en phase inverse Temps 070-005 070-006 EV-VZWOO1- EV-VZWOO1- (en h) AZ(A) (%) AZ(B) (%) AZ(A) (%) AZ(B) (%) 070-005 070-006 0 100 0 0.6 99.4 99.9 100 1 100 0 1.2 98.8 / / 2 100 0 1.2 98.8 / / 3 100 0 1.7 98.3 / / 6 100 0 3 97 / / 24 100 0 9.7 90.3 94.9 90.5