SiRNA molecule inhibiting the expression of the PCSK9 gene and use thereof

20230139322 · 2023-05-04

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided are a small interfering RNA (siRNA) molecule which inhibits the expression of the PCSK9 gene and a pharmaceutical composition thereof, as well as a method for reducing the expression level of the PCSK9 gene by using the siRNA molecule or the pharmaceutical composition thereof. The siRNA molecules may be used to treat and/or prevent PCSK9 gene-mediated diseases.

    Claims

    1. An siRNA molecule for inhibiting expression of PCSK9 gene comprising a sense strand and an antisense strand complementary to form a double strand, wherein the sense strand and/or the antisense strand comprises or consists of 15-27 nucleotides, and the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleotides of SEQ ID NO:1, and wherein at least one nucleotide in the siRNA molecule is modified.

    2. The siRNA molecule of claim 1, wherein the sense strand of the siRNA molecule comprises the nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence of SEQ ID NO: 2; and the antisense strand of the siRNA molecule comprises a nucleotide sequence of SEQ ID NO: 3.

    3. The siRNA molecule of claim 1, wherein the modification comprises locked nucleic acid (LNA), unlocked nucleic acid (UNA), 2′-methoxyethyl, 2′-O-alkyl, 2′-O-methyl, 2′-O-allyl, 2′-C-allyl, 2′-fluoro, 2′-deoxy, 2′-hydroxy, phosphate backbone, DNA, fluorescent probe, ligand modification or combination thereof, preferably 2′-O-methyl, DNA, 2′-fluoro, thio-modified phosphate backbone or combination thereof.

    4. The siRNA molecule of claim 3, wherein the sense and antisense strands are selected from the following combinations: strands 1 and 2; strands 3 and 5; strands 3 and 6; strands 3 and 7; strands 3 and 8; strands 9 and 4; strands 9 and 5; strands 9 and 6; strands 9 and 7; and strands 9 and 8.

    5. The siRNA molecule of claim 3, wherein the ligand modification is performed at the 3′ end, 5′ end or in the middle of the sequence of the siRNA molecule; wherein the ligand moiety is Xm, wherein X is the same or different ligand selected from cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, N-acetylglucosamine derivatives or analogs, and any combination thereof, m is the number of ligands, preferably m=any integer from 1 to 5, more preferably m=any integer from 2 to 4, most preferably m is 3.

    6. The siRNA molecule of claim 5, wherein X has structure Z: ##STR00007## wherein the n value of the CH.sub.2 group in structure Z is independently selected from 1-15; preferably, n in structure Z is 3 or 8; more preferably, when m is 2, 3 or 4, the ligand moiety is (Z).sub.2, (Z).sub.3 or (Z).sub.4, respectively, most preferably each n value in (Z).sub.2, (Z).sub.3 or (Z).sub.4 is equal.

    7. The siRNA molecule of claim 4, further comprising a ligand and/or a fluorescent modification, wherein the ligand modification moiety is Xm, wherein X is the same or different ligand selected from cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, N-acetylglucosamine derivatives or analogs, and any combination thereof, m is the number of ligands, preferably m=any integer from 1 to 5, more preferably m=any integer from 2 to 4, most preferably m is 3.

    8. The siRNA molecule of claim 7, wherein the sense and antisense strands are selected from the following combinations: strands 13 and 8; strands 17 and 8; strands 19 and 8; strands 20 and 8; strands 13 and 10; strands 17 and 10; strands 19 and 10; strands 20 and 10; strands 14 and 10; strands 18 and 10; strands 21 and 10; and strands 22 and 10.

    9. The siRNA molecule of claim 7, having structures: TABLE-US-00026 A: SEQ ID NO: 4 GACGAUGCCUGCCUCUACU-(X)m;, SEQ ID NO: 5 fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC(s)dAfUfCmGfUfC(s)mC(s)mC;, or B: SEQ ID NO: 6 mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUmAmCmU-(X)m;, SEQ ID NO: 5 fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC(s)dAfUfCmGfUfC (s)mC(s)mC;, wherein X has a structure of Z: ##STR00008## m has a value of 2 or 3 or 4; independently, the n value of the CH.sub.2 group in Z is selected from 1-15; preferably, when m is 2, 3 or 4, the ligand moiety is (Z).sub.2, (Z).sub.3 or (Z).sub.4, respectively, and each n value in (Z).sub.2, (Z).sub.3 or (Z).sub.4 is equal.

    10. The siRNA molecule of claim 9 having an n value of 3 or 8.

    11. The siRNA molecule of claim 1, for inhibiting the expression of the PCSK9 gene in humans and monkeys.

    12. A pharmaceutical composition comprising an siRNA molecule of claim 1 and pharmaceutically acceptable other components.

    13. A method for inhibiting or reducing the expression level of the PCSK9 gene in a cell in vivo or in vitro, comprising introducing into the cell the siRNA molecule of claim 1.

    14. Use of the siRNA molecule of claim 1 for the manufacture of a medicament for inhibiting or reducing the expression level of the PCSK9 gene in a cell in vivo or in vitro or for the manufacture of a medicament for treating diseases or symptoms mediated by the PCSK9 gene in a subject.

    15. The use of claim 14, wherein the diseases or symptoms mediated by the PCSK9 gene comprises a cardiovascular disease or a neoplastic disease, preferably the cardiovascular disease is selected from hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia and the neoplastic disease is selected from melanoma, hepatocellular carcinoma, and metastatic liver cancer.

    16. A kit comprising an siRNA molecule of claim 1.

    17. A method for treating diseases or symptoms mediated by the PCSK9 gene in a subject, comprising administering to the subject the siRNA molecule of claim 1.

    18. The method of claim 17, wherein the diseases or symptoms mediated by the PCSK9 gene comprises a cardiovascular disease or a neoplastic disease, preferably the cardiovascular disease is selected from hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia and the neoplastic disease is selected from melanoma, hepatocellular carcinoma, and metastatic liver cancer.

    19. Use of an siRNA molecule of claim 1 in the manufacture of a medicament for inhibiting or reducing the level of expression of the PCSK9 gene in a cell in vivo or in vitro.

    20. Use of an siRNA molecule of claim 1 for inhibiting or reducing the expression level of the PCSK9 gene in cells in vivo or in vitro.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0039] FIGS. 1A-C show binding curves of GalNAc-siRNAs of the present disclosure to receptors.

    [0040] FIG. 2 shows ex vivo organ imaging after euthanasia 6 hours after the administration.

    [0041] FIG. 3 shows ex vivo organ imaging after euthanasia 6 hours after the administration.

    SEQUENCE INFORMATION

    [0042] Information about the sequences to which the present disclosure relates is provided in the following table:

    [0043] The basic sequences (unmodified) are as follows:

    TABLE-US-00002 Sequence No (SEQ ID NO:) 1 GACGAUGCCUGCCUCUACUUU (sense strand) 2 GACGAUGCCUGCCUCUACU (sense strand) 3 AGUAGAGGCAGGCAUCGUCCC (antisense strand)

    [0044] Each strand in each siRNA molecule involved in the present application and the composition thereof are as follows:

    TABLE-US-00003 Strand No Strand composition  1 SEQ ID NO: 7, GACGAUGCCUGCCUCUACUmU(s)mU  2 SEQ ID NO: 8, AGUAGAGGCAGGCAUCGUCmC(s)mC  3 SEQ ID NO: 2, GACGAUGCCUGCCUCUACU  4 SEQ ID NO: 3, AGUAGAGGCAGGCAUCGUCCC  5 SEQ ID NO: 9, fA(s)dGfU(s)dA(s)dGdAmGGfCAGGFCAfUfCGfUfC(s)mC(s)mC  6 SEQ ID NO: 10, fA(s)dGfU(s)dA(s)dG(s)dA(s)dGfGfCmAmGmGfCfAfUfCmGfUfC(s)m C(s)mC  7 SEQ ID NO: 11, A(s)dGfU(s)dA(s)dG(s)dAmGmGmCmAfGfGCmAfUmCfGfUfC(s)m C(s)mC  8 SEQ ID NO: 5, fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC(s)dAfUfCmGfUfC(s) mC(s)mC  9 SEQ ID NO: 12, mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUmAmCmU 10 SEQ ID NO: 13, Cy5-fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC(s)dAfUfCmGfUf C(s)mC(s)mC 11 SEQ ID NO: 14, GACGAUGCCUGCCUCUACU-L 12 SEQ ID NO: 15, GACGAUGCCUGCCUCUACU-LL 13 SEQ ID NO: 16, GACGAUGCCUGCCUCUACU-LLL 14 SEQ ID NO: 17, GACGAUGCCUGCCUCUACU-LLLL 15 SEQ ID NO: 18, GACGAUGCCUGCCUCUACU-S 16 SEQ ID NQ: 19, GACGAUGCCUGCCUCUACU-SS 17 SEQ ID NO: 20, GACGAUGCCUGCCUCUACU-SSS 18 SEQ ID NO: 21, GACGAUGCCUGCCUCUACU-SSSS 19 SEQ ID NO: 22, mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUmAmCmU-LLL 20 SEQ ID NO: 23, mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUmAmCmU-SSS 21 SEQ ID NO: 24, mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUmAmCmU-LLLL 22 SEQ ID NO: 25, mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUmAmCmU-SSSS 23 SEQ ID NO: 1, GACGAUGCCUGCCUCUACUUU Note: ″G″, “C”, “A”, “T” and “U” each generally represent a nucleotide that contains guanine, cytosine, adenine, thymine and uracil as a base, respectively. Modifications: d = DNA; m = 2′-O-methyl; f = 2′-fluoro; (s) = PS backbone (i.e. thio-modified phosphate backbone); L = L-type ligand; S = S-type ligand; Cy5 = fluorescently labeled Cy5.

    DETAILED DESCRIPTION OF THE EMBODIMENTS

    [0045] Embodiments of the present disclosure are described in more detail below.

    [0046] The present disclosure provides an siRNA molecule for inhibiting the expression of the PCSK9 gene, which contains a sense strand and an antisense strand complementary to form a double strand, wherein the sense strand and/or the antisense strand contains or consists of 15-27 nucleotides, and the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleotides of SEQ ID NO:1, and wherein at least one nucleotide in the siRNA molecule is modified.

    [0047] As used herein, the term “antisense strand” refers to a strand of siRNA including a region that is completely or substantially complementary to a target sequence. As used herein, the term “complementary region” refers to a region of the antisense strand that is completely or substantially complementary to the target mRNA sequence. Where the complementary region is not fully complementary to the target sequence, the mismatch may be in an internal or terminal region of the molecule. Typically, the most tolerated mismatch is in the terminal region, e.g., within 5, 4, 3, 2, or 1 nucleotide of the 5′ and/or 3′ end. The portion of the antisense strand that is most sensitive to mismatches is referred to as the “seed region”. For example, in siRNA containing a 19 nt strand, the 19th position (from 5′ to 3′) can tolerate some mismatch.

    [0048] As used herein, the term “complementary” refers to the ability of a first polynucleotide to hybridize to a second polynucleotide under certain conditions, such as stringent conditions. For example, stringent conditions may include 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA at 50° C. or 70° C. for 12-16 hours.

    [0049] As used herein, the term “sense strand” refers to a strand of siRNA that includes a region that is substantially complementary to a region of the term antisense strand as defined herein.

    [0050] The antisense and sense strands of the siRNA may be of the same or different lengths, as described herein and as known in the art.

    [0051] The siRNA molecules promote sequence-specific degradation of PCSK9 mRNA by RNAi to achieve inhibition the expression of the PCSK gene or reduction of the expression level of the PCSK9 gene, e.g., by 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%.

    [0052] At least 70%, 80%, 90%, 95%, or 100% of the nucleotides of each strand of the siRNA molecule are ribonucleotides, but may also contains one or more non-ribonucleotides, such as deoxyribonucleotides.

    [0053] In some embodiments, at least one nucleotide in the siRNA molecule of the present disclosure is modified. Although many modifications can be attempted to improve the performance of siRNA, these attempts are often difficult to address both mediating RNA interference and improving stability in serum (e.g., increased resistance to nucleases and/or prolonged duration). The modified siRNA of the present disclosure has high stability while maintaining high inhibitory activity.

    [0054] Modifications suitable for the present disclosure may be selected from the group containing: locked nucleic acid (LNA), unlocked nucleic acid (UNA), 2′-methoxyethyl, 2′-O-methyl, 2′-C-allyl, 2′-fluoro, 2′-deoxy, 2′-hydroxy, phosphate backbones, fluorescent probes, ligand modifications, or combinations thereof. Preferred modifications are 2′-O-alkyl groups such as 2′-O-methyl, DNA, 2′-fluoro, thio-modified phosphate backbones, and combinations thereof.

    [0055] In particular embodiments of the present disclosure, preferred modifications include: (1) for the antisense strand: the first nucleotide at the 5′ end is modified by 2′-fluorine, the second nucleotide is modified by 2′-O-methyl, the middle region is a repeat structure of fNfNfN(s)dN(s)dN(s)dNfNfNfN(s)dN(s)dN(s)dN, and the 3′ end has a 5′(s)mN(s)mN 3′ pendant structure; the nucleotides between the pendant structure and the intermediate region are modified with 2′-O-methyl or 2′-fluoro, with up to 2 consecutive 2′-fluoro or 2′-O-methyl modifications. (2) the sense strand is not modified, or all nucleotides of the sense strand are modified: the nucleotide with 12nt at the 5′ end is modified by mNmNmNfNfNfNmNmNmNfNfNfN, and the nucleotide with 3 nt at the 3′ end is modified by 2′-O-methyl; the intermediate nucleotides are modified with 2′-O-methyl or 2′-fluoro, with up to 2 consecutive 2′-fluoro or 2-O-methyl modifications. In some embodiments, the siRNA molecules provided herein are selected from RBP9-005-P1G1, RBP9-005-P2G2, RBP9-005-P2G3, RBP9-005-P2G4, RBP9-005-P2G5, RBP9-005-P2G6, RBP9-005-P3G2, RBP9-005-P3G3, RBP9-005-P3G4, RBP9-005-P3G5, and RBP9-005-P3G6 shown in Table 5.

    [0056] In some embodiments, the chemically modified siRNA molecule is preferably RBP9-005-P2G6 or RBP9-005-P3G6.

    [0057] In some embodiments, ligand modification may be performed at the 3′ end, 5′ end, or in the middle of the sequence of the siRNA molecule. In some embodiments, the ligand may be a moiety that is taken up by the host cell. Ligands suitable for the present disclosure include cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, N-acetylglucosamine derivatives or analogs, or combinations thereof. Preferably, the ligand modification is an N-acetylgalactosamine derivative or analogue modification.

    [0058] The ligand modification may improve cellular uptake, intracellular targeting, half-life, or drug metabolism or kinetics of siRNA molecules. In some embodiments, the ligand-modified siRNA has enhanced affinity or cellular uptake for a selected target (e.g., a particular tissue type, cell type, organelle, etc.), preferably a hepatocyte, as compared to the siRNA without ligand modification. Preferred ligands do not interfere with the activity of the siRNA.

    [0059] In some embodiments, the siRNAs of the present disclosure may contains one or more, preferably 1-5, 2-4 or 3, ligand modifications, preferably N-acetylgalactosamine derivatives/analogs.

    [0060] In some embodiments, the N-acetylgalactosamine derivative ligand modification moiety has structure Z:

    ##STR00003##

    [0061] In some embodiments, the ligand-modified siRNA molecule is selected from any of P2G6-03L, P2G6-03S, P3G6-03L, and P3G6-03S shown in Table 8, and P2G6-13L, P2G6-13S, P3G6-13L, and P3G6-13S shown in Table 10.

    [0062] In some embodiments, the ligand-modified siRNA molecular has the following structures:

    TABLE-US-00004 SEQ ID NO: 42 GACGAUGCCUGCCUCUACU-ZZZ:, SEQ ID NO: 5, fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC(s)dAfUfCmGfUfC(s)mC(s)mC; or SEQ ID NO: 43 mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUmAmCmU-zZZ;, SEQ ID NO: 5 fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC(s)dAfUfCmGfUfC(s)mC(s)mC,

    [0063] wherein structure ZZZ is connected with the nucleotide at 3′-end of the siRNA sense strand through a phosphodiester bond, and each Z is connected with the adjacent Z through a phosphodiester bond; wherein structure ZZZ linked to siRNA is as follows:

    ##STR00004##

    [0064] the n value of the CH.sub.2 group in each Z is independently selected from 1-15; preferably, the n values in structure ZZZ are equal.

    [0065] In one embodiment, the n values in structure ZZZ are all 3. When the n value is 3, Z can be represented by L.

    [0066] In one embodiment, the n values in structure ZZZ are all 8. When the n value is 8, Z can be represented by S. The siRNA molecules of the present disclosure may have from 0% to 100%, such as 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or more than 95% modified nucleotides in each strand. The modification may be in the pendant region or in the double-stranded region. The modifications of the present disclosure can be used to improve in vitro or in vivo characteristics of siRNA molecules, such as stability, biodistribution, inhibitory activity, etc. Modifications of the present disclosure may be used in combination.

    [0067] Each strand of the siRNA molecules of the present disclosure has a pendant end or a blunt end. The 5′ and/or 3′ ends of either or both of the antisense or sense strands may be pendant ends. The pendant end may have 1-8 pendencies, preferably 2, 3, 4, 5, or 6 pendencies, wherein the pendency is selected from any of U, A, G, C, T, and dT.

    [0068] In some embodiments, the siRNA molecules of the present disclosure inhibit PCSK9 gene expression in humans or monkeys.

    [0069] In some embodiments, the present disclosure also provides a vector for inhibiting the expression of the PCSK9 gene in a cell, which expresses at least one strand of an siRNA molecule of the present disclosure. As used herein, the term “vector” refers to a nucleic acid molecule capable of amplifying or expressing another nucleic acid to which it is linked.

    [0070] In some embodiments, the present disclosure also provides a kit containing an siRNA molecule or vector of the present disclosure.

    [0071] In some embodiments, the present disclosure also provides a pharmaceutical composition containing an siRNA molecule or vector of the present disclosure and a pharmaceutically acceptable other component. In one embodiment, the compositions of the present disclosure comprise a pharmacologically effective amount of the siRNA molecule or vector of the present disclosure and pharmaceutically acceptable other components. As used herein, the term “effective amount” refers to an amount of the siRNA molecule effective to produce the desired pharmacological therapeutic effect. “Other components” include water, saline, dextrose, buffers (e.g., PBS), excipients, diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, preservatives, or any combination thereof.

    [0072] In some embodiments, the present disclosure also provides a method for inhibiting or reducing the expression level of the PCSK9 gene in a cell in vivo or in vitro, containing introducing into the cell an siRNA molecule, vector, kit or pharmaceutical composition of the present disclosure such that the expression level of the PCSK9 gene is inhibited or reduced by at least 95%, at least 90%, at least 85%, at, least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at, least 20%, at least 10%, at least 5%. As used herein, the term “introducing” refers to facilitating uptake or absorption into a cell, which may occur through non-assisted diffusion or active cellular processes, or through an ancillary agent or device. When introduced into cells in vivo, siRNA can be injected into the target tissue or administered systemically. Introduction to cells in vitro may be by methods known in the art, such as electroporation.

    [0073] The cell is preferably a mammalian cell expressing PCSK9, for example a primate cell, such as a human cell. Preferably, the PCSK9 gene is expressed at a high level in the target cell. More preferably, the cells are derived from brain, salivary gland, heart, spleen, lung, liver, kidney, intestinal tract or tumor. Even more preferably, the cell is a hepatoma cell or a cervical cancer cell. Still even more preferably, the cells are selected from HepG2 and HeLa cells.

    [0074] In an in vitro method, the final cellular concentration of the siRNA molecule is 0.1-1000 nM, preferably 10-500 nM, 25-300 nM, or 50-100 nM.

    [0075] Detection of the level of the target gene, target RNA, or target protein can be used to predict or assess the activity, efficacy, or therapeutic outcome of the siRNA. Detection of target gene, target RNA or target protein levels can be carried out using methods known in the art.

    [0076] In some embodiments, the present disclosure provides an in vivo method containing alleviating or treating diseases or symptoms mediated by a PCSK gene in a subject, the diseases or symptoms containing cardiovascular disease, dyslipidemia; cardiovascular diseases may include atherosclerotic cardiovascular diseases, and dyslipidemia may include elevated cholesterol and/or triglyceride levels, elevated low density lipoprotein cholesterol, or elevated apolipoprotein B (ApoB) in the serum. The diseases or symptoms is preferably hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia. The subject may be a mammal, preferably a human.

    [0077] As used herein, the term “hypercholesterolemia” refers to a condition characterized by elevated serum cholesterol. The term “hyperlipidemia” refers to a condition characterized by elevated serum lipids. The term “non-familial hypercholesterolemia” refers to a condition characterized by increased cholesterol that is not caused by a single genetic mutation. The term “polygenic hypercholesterolemia” refers to a condition characterized by increased cholesterol resulting from the effects of a variety of genetic factors. The term “familial hypercholesterolemia (FH)” refers to an autosomal dominant metabolic disorder characterized by mutations in the LDL-receptor (LDL-R), significantly increased LDL-C, and premature onset of atherosclerosis. The term “homozygous familial hypercholesterolemia” or “HoFH” refers to a condition characterized by mutations in the maternal and paternal LDL-R genes. The term “heterozygous familial hypercholesterolemia” or “HoFH” refers to a condition characterized by mutations in the maternal or paternal LDL-R gene.

    [0078] PCSK gene-mediated diseases or symptoms may result from overexpression of the PCSK9 gene, overproduction of the PCSK9 protein, and may be modulated by down-regulation of PCSK9 gene expression. As used herein, the term “treatment” refers to alleviation, relieving, or cure of the PCSK9 gene-mediated diseases or symptoms, such as a decrease in blood lipid levels, including serum LDL, LDL-C levels. In some embodiments, the levels or concentrations of serum LDL, serum LDL-C are reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, or 90%.

    [0079] In an in vivo method, the pharmaceutical composition may be administered by any suitable means, such as parenteral administration, including intramuscular, intravenous, arterial, intraperitoneal, or subcutaneous injection. Modes of administration include, but are not limited to, single administration or multiple administrations. The dosage administered may range from 0.1 mg/kg to 100 mg/kg, 0.5 mg/kg to 50 mg/kg, 2.5 mg/kg to 20 mg/kg, 5 mg/kg to 15 mg/kg, preferably 3 mg/kg, 10 mg/kg, 33 mg/kg, more preferably 10 mg/kg, most preferably 33 mg/kg.

    [0080] In another aspect, the present disclosure also provides a method of combination therapy containing co-administration of one or more siRNAs of the present disclosure or pharmaceutical compositions containing the same with one or more other therapeutic agents or in combination with other therapeutic methods. Other therapeutic agents may include agents known to prevent, alleviate or treat lipid disorders such as hypercholesterolemia, atherosclerosis or dyslipidemia, such as cholesterol absorption inhibitors, lipid lowering agents, analgesics, anti-inflammatory agents, antineoplastic agents, and the like. Other methods of treatment include radiation therapy, immunotherapy, hormonal therapy, surgical therapy, and the like.

    [0081] The siRNA molecule provided by the present disclosure has multiple beneficial effects: 1, the modified siRNA molecule has high stability and high inhibition activity; 2, the siRNA molecule modified by the ligand not only keeps high inhibition activity and stability, but also has good liver targeting property and capability of promoting endocytosis, can reduce the influence on other tissues or organs and the use amount of the siRNA molecule, thereby achieving the purposes of reducing toxicity and reducing cost; and 3, the ligand-modified siRNA molecules can enter target cells and target tissues without a transfection reagent, reducing the negative influence of the transfection reagent, such as cell or tissue toxicity. Thus, the ligand-modified siRNA molecules of the present disclosure provide the potential for targeted therapy.

    [0082] Abbreviations, Acronyms, and Numbers

    [0083] “G”, “C”, “A”, “T” and “U” each generally represents a nucleotide with guanine, cytosine, adenine, thymine and uracil as bases, respectively.

    [0084] REL(Relative expression level): relative expression level of mRNA.

    [0085] GalNAc: N-acetylgalactosamine.

    [0086] Modifications: N=RNA; dN=DNA; mN=2′-O-methyl modification; fN=2′-fluoro modification; (s)=PS backbone (i.e. 5′-thio modified phosphate backbone).

    [0087] Abbreviations: RBP9-005-P3G6 may be referred to simply as P3G6, and so on.

    [0088] Numbers: the first position following the broken line of P3G6 indicates whether there is, a fluorescent label (0 indicates “none”, 1 indicates “yes”), the second position indicates the number of ligands, and the third position indicates the type of ligands, e.g., P3G6-13L indicates that P3G6 is fluorescently labeled, and 3 L ligands are modified; and so on.

    EXAMPLES

    Example 1 Activity Screening of PCSK9-siRNA

    [0089] SiRNA Design

    [0090] Multiple of pairs of PCSK9-siRNAs were designed by selecting different sites according to human pcsk9mRNA sequences, all designed single siRNAs could target all transcripts of target genes (such as table 1), and the multiple pairs of siRNAs had the lowest homology with all other non-target gene sequences through alignment by a sequence similarity software. The sequence design method is referred to Elbashir et al. 2002; Paddison et al. 2002; Reynolds et al. 2004; Ui-Tei et al. 2004, and so on.

    TABLE-US-00005 TABLE 1 Target genes Target gene Species Gene ID NM_ID PCSK9 Homo sapiens (human) 255738 NM_174936.3

    [0091] Synthesis of siRNA

    [0092] The oligonucleotides of the 1′-hydroxyl-containing ribonucleotides of the present disclosure were all completed according to the theoretical yield of 1 μmol synthesis specifications. In anhydrous acetonitrile, the weighed 1 μmol of standard universal solid support CPG or 3′-cholesterol modified CPG (purchased from Chemgenes), 2′-O-TBDMS protecting RNA phosphoramidite monomer, DNA monomer, 2′-methoxy monomer and 2′-fluoro monomer (purchased from Sigma Aldrich) were dissolved to a concentration of 0.2 M. For phosphorothioate backbone modified oligonucleotides, 0.2 M PADS solution was used as the thionating reagent. A solution of 5-ethylthio-IH-tetrazole (purchased from Chemgenes) in acetonitrile as the activator (0.25 M), a 0.02 M solution of iodine in pyridine/water as the oxidant, and a 3% solution of trichloroacetic acid in dichloromethane as the deprotecting reagent were placed at the designated position of the reagent corresponding to the ABI 394 DNA/RNA automated synthesizer. A synthesis procedure was set up and the designated oligonucleotide base sequence was entered. After error checking, cycle oligonucleotide synthesis was started. The coupling time for each step, was 6 minutes and the coupling time for the galactose ligand for the L and S monomers was 10-20 minutes. After automatic circulation, oligonucleotide solid-phase synthesis was completed. The CPG was blown dry with dry nitrogen, transferred to a 5 ml EP tube, added with 2 ml ammonia/ethanol solution (3/1) and heated at 55° C. for 16-18 hours. Centrifugation was carried out at 10,000 rpm for 10 min, the supernatant was taken and concentrated aqueous ammonia/ethanol was pumped off to dryness to give a white gummy solid. The solid was dissolved in 200 μL of 1 M TBAF in THF and shaken at room temperature for 20 h. Then 0.5 ml of 1 M Tris-HCl buffer (pH 7.4) was added, shaken for 15 minutes at room temperature and placed on a centrifugal pump to a volume of ½ of the original volume to remove THF. The resulting solution was extracted twice with 0.5 ml of chloroform, 1 ml of 0.1 M TEAA loading solution was added, the mixed solution was poured into a solid phase extraction column to remove excess salt in the solution. The resulting oligonucleotide concentration was determined by micro-UV spectrophotometer (KO5500). The mass spectrometric analysis was performed on an Oligo HTCS LC-MS system (Novatia) system. Nucleic acid molecular weights were calculated by normalization using Promass software after primary scanning.

    [0093] Only deoxyribonucleotide- or 2′-methoxy- or 2′-fluoro- or LNA- or 2′-MOE-containing modified oligonucleotides according to the present disclosure were carried out according to a theoretical yield of 1 μmol synthetic specifications. In anhydrous acetonitrile, the weighed 1 μmol of standard universal solid support CPG or 3′-cholesterol modified CPG (purchased from Chemgenes), DNA monomer, 2′-methoxy monomer and 2′-fluoro monomer (purchased from Sigma Aldrich) were dissolved to a concentration of 0.2 M. For phosphorothioate backbone modified oligonucleotides, 0.2 M PADS solution was used as the thionating reagent. A solution of 5-ethylthio-IH-tetrazole (purchased from Chemgenes) in acetonitrile as the activator (0.25 M), a 0.02 M solution of iodine in pyridine/water as the oxidant, and a 3% solution of trichloroacetic acid in dichloromethane as the deprotecting reagent were prepared and placed at the designated position of the reagent corresponding to the ABI 394 DNA/RNA automated synthesizer. A synthesis procedure was set up and the designated oligonucleotide base sequence was entered. After error checking, cycle oligonucleotide synthesis was started. The coupling time for each step was 6 minutes and the coupling time for the galactose ligand for the monomers was 6-10 minutes. After automatic circulation, oligonucleotide solid-phase synthesis was completed. The CPG was blown dry with dry nitrogen, transferred to a 5 ml EP tube, added with 2 ml ammonia solution and heated at 55° C. for 16-18 hours. Centrifugation was carried out at 10,000 rpm for 10 min the supernatant was taken, and concentrated aqueous ammonia/ethanol was pumped off to dryness to give a white or yellow gummy solid. Followed by adding 1 ml of 0.1 M TEAA loading solution, the mixed solution was poured onto a solid phase extraction column to remove excess salt from the solution. The resulting oligonucleotide concentration was determined by micro-UV spectrophotometer (KO5500). The mass spectrometric analysis was performed on an Oligo HTCS LC-MS system (Novatia) system. Nucleic acid molecular weights were calculated by normalization using Promass software after primary scanning.

    [0094] Transfection of Different Cells with PCSK9-siRNA

    [0095] All cells were from ATCC or other publicly available sources; other reagents are commercially available.

    TABLE-US-00006 TABLE 2 Cell names and species Cell names Huh7 HePG2 MHCC97H HeLa Cell species Liver cancer Liver cancer Liver cancer Cervical cancer cells cells cells cells

    [0096] Cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO.sub.2, 37° C. constant temperature incubator. Transfection with the transfection reagents was performed when the cells were in logarithmic growth phase and in a good condition (70% confluence). The cell concentration was adjusted to 1×10.sup.6/mL, and 1 mL of cell solution and 5 μL of riboFect transfection reagent were added to each well of a 6-well plate. After standing for 5 min at room temperature, 5 μL of 100 nM siRNA were added and incubated at 37° C. and 5% CO.sub.2 for 48 h.

    [0097] For each cell plating, the following control groups were set up in addition to the experimental group: NC as negative control (irrelevant siRNA), Mock as transfection reagent control group, and untreated control group (UT group, no siRNA added). The test group and the control group were repeated 3 times.

    [0098] Real-Time Quantitative PCR Analysis of Target mRNA Levels

    [0099] 1, Cells were lysed 48 h after transfection and total RNA was extracted by Trizol method.

    [0100] 2, A reverse transcription kit Reverse Transcription mix was used for reverse transcription (Guangzhou RiboBio Co., Ltd.).

    [0101] 3, Fluorescent quantitative PCR:

    [0102] Using β-actin gene as internal reference gene, real-time fluorescence quantitative PCR was performed using SYBR Premix (2×), a real-time PCR kit. PCR reactions were performed using a CFX96 fluorescent quantitative PCR instrument of the Bio-Rad, USA, The primers used were as follows:

    TABLE-US-00007 TABLE 3 Primers PCSK9-QPCR-F(5′-3′) SEQ ID NO: 26, AAGCCAAGCCTCTTCTTACTTCA PCSK9-qPCR-R(5′-3′) SEQ ID NO: 27, CCTGGGTGATAACGGAAAAAG

    [0103] 4, Data Analysis

    [0104] At the end of the PCR reaction, 9 replicates of one sample (3 transfection replicates per sample, 3 qPCR replicates) had a Ct error of ±0.5. CFX 2.1 was used for relative quantitative analysis. Table 4 is a mean value of the target gene expression level relative to group NC (the mRNA relative expression level of group NC is 1). The results of real-time quantitative PCR detection of preferred siRNAs are shown in the following table.

    TABLE-US-00008 TABLE 4 Real-time quantitative PGR detection results HePG2 HeLa (relative (relative Strand expression expression Names Sequence (5′-3′) No levels) levels) NC SEQ ID NO: 28, 1 1 UGAAGAGCCUGAUCAAAUAdTdT SEQ ID NO: 29, UAUUUGAUCAGGCUCUUCAdTdT RBP9-001 SEQ ID NO: 30, 0.75 0.35 CAGAGACUGAUCCACUUCUmU(s)mU SEQ ID NO: 31, AGAAGUGGAUCAGUCUCUGmC(s)mC RBP9-003 SEQ ID NO: 32, 0.71 0.08 CGUGGAGUUUAUUCGGAAAmU(s)mU SEQ ID NO: 33, UUUCCGAAUAAACUCCAGGmC(s)mC RBP9-004 SEQ ID NO: 34, 0.73 0.26 CUGCUGAGGUGCUGCAGUUmU(s)mU SEQ ID NO: 35, AACUGGAGCAGCUCAGCAGmC(s)mU RBP9-005 SEQ ID NO: 7, 1 0.55 0.10 GACGAUGCCUGCCUCUACUmU(s)mU SEQ ID NO: 8, 2 AGUAGAGGCAGGCAUCGUCmC(s)mC RBP9-007 SEQ ID NO: 36, 0.78 0.18 GCAGCCUGGUGGAGGUGUAmU(s)mU SEQ ID NO: 37, UACACCUCCACCAGGCUGCmC(s)mU RBP9-013 SEQ ID NO: 38, 1.15 0.28 CACGAGGUGAGCCCAACCAmU(s)mU SEQ ID NO: 39, UGGUUGGGCUGACCUCGUGmG(s)mC RBP9-022 SEQ ID NO: 40, 0.76 0.08 GCCUGGAGUUUAUUCGGAAmU(s)mU SEQ ID NO: 41, UUCCGAAUAAACUCCAGGCmC(s)mU

    [0105] PCSK9 siRNA screenings in HepG2 and HeLa reveal a highly active siRNA molecule, i.e. RBP9-005, in HeLa and HePG2 cells.

    Example 2 PCSK9-siRNA Optimization

    [0106] Different modifications and optimizations were performed on RBP9-005. The steps of synthesis, transfection, and quantitative PCR were the same as in Example 1. The transfected cells were HeLa and HePG2 cells, and the results are shown in Table 5 (REL-H: relative expression level of PCSK9 mRNA in HeLa cells; REL-2: relative expression level of PCSK9 mRNA in HePG2 cells). Table 5 is a mean value of the target gene expression level relative to group NC (the mRNA relative expression level of group NC is 1). Wherein, NC was an irrelevant siRNA negative control group, Mock was a transfection reagent control group, and UT was an untreated cell control group.

    TABLE-US-00009 TABLE 5 RBP9-005 Optimization Strand REL- REL- Samples Modified sequences (5′-3′) No H SD 2 SD NC SEQ ID NO: 28, 1 0.05 1 0.06 UGAAGAGCCUGAUCAAAUAdTdT SEQ ID NO: 29, UAUUUGAUCAGGCUCUUCAdTdT Mock / 1.03 0.07 1.05 0.03 / UT / 0.97 0.04 0.95 0.06 / RBP9-005- SEQ ID NO: 7, 1 0.10 0.04 0.53 0.04 P1G1 GAGGAUGCCUGCCUCUACUmU(s)mU SEQ ID NO: 8, 2 AGUAGAGGCAGGCAUCGUCmC(s)mC RBP9-005- SEQ ID NO: 2, 3 0.10 0.03 0.51 0.05 P2G2 GACGAUGCCUGCCUCUACU SEQ ID NO: 3, 4 AGUAGAGGCAGGCAUCGUCCC RBP9-005- SEQ ID NO:2, 3 0.09 0.04 0.46 0.03 P2G3 GACGAUGCCUGCCUCUACU SEQ ID NO: 9, 5 fA(s)dGfU(s)dA(s)dGdAmGGfCA GGfGAfUfCGfUfC(s)mG(s)mC RBP9-005- SEQ ID NO: 2, 3 0.16 0.07 0.50 0.03 P2G4 GACGAUGCCUGCCUCUACU SEQ ID NO: 10, 6 fA(s)dGfU(s)dA(s)dG(s)dA(s)dGf GfGmAmGmGfGfAfUfCmGfUfC(s)mC(s)mC RBP9-005- SEQ ID NO: 2, 3 0.15 0.06 0.55 0.03 P2G5 GACGAUGCCUGCCUCUACU SEQ ID NO: 11, 7 fA(s)dGfU(s)dA(s)dG(s)dAmGm GmCmAfGfGfCmAfUmCfGfUfC(s)mC(s)mC RBP9-005- SEQ ID NO: 2, 3 0.06 0.01 0.46 0.05 P2G6 GACGAUGCCUGCCUCUACU fAmGFUfAfG(s)dA(s)dG(s)dGfCfAfG (s)dG(s)dC(s)dAfUfCmGfUfC(s)mC(s)mC RBP9-005- SEQ ID NO: 12, 9 0.13 0.05 0.47 0.05 P3G2 mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCf UmAmCmU SEQ ID NO: 3, 4 AGUAGAGGCAGGCAUCGUCCC RBP9-005- SEQ ID NO: 12, 9 0.13 0.03 0.52 0.02 P3G3 mGmAmCfGfAfUmGmCmCfUfG fCfCmUfCfUmAmCmU SEQ ID NO: 9, 5 fA(s)dGfU(s)dA(s)dGdAmGGfCA GGfGAfUfCGfUfC(s)mG(s)mC RBP9-005- SEQ ID NO: 12, 9 0.17 0.04 0.50 0.04 P3G4 mGmAmCfGfAfUmGmCmCfUfG fCfCmUfCfUmAmCmU SEQ ID NO: 10, 6 fA(s)dGfU(s)dA(s)dG(s)dA(s)dGf GfGmAmGmGfGfAfUfGmGfUfC(s)mC(s)mC RBP9-005- SEQ ID NO: 12, 9 0.18 0.04 0.52 0.03 P3G5 mGmAmCfGfAfUmGmCmCfUfG fCfCmUfCfUmAmCmU SEQ ID NO: 11, 7 fA(s)dGfU(s)dA(s)dG(s)dAmGm GmCmAfGfGfCmAfUmCfGfUfC(s)mC(s)mC RBP9-005- SEQ ID NO: 12, 9 0.09 0.03 0.41 0.03 P3G6 mGmAmCfGfAfUmGmCmCfUfG fCfCmUfCfUmAmCmU SEQ ID NO: 5, 8 fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG (s)dG(s)dC(s)dAfUfCmGfUfC(s)mC(s)mC

    [0107] The results showed that the inhibitory activities of chemically modified RBP9-005-P2G6 and RBP9-005-P3G6 are higher in HeLa and HePG2 cells.

    Example 3 Targeting Assay of GalNAc-siRNA Cells

    [0108] First. Preparation of Ligand-Modified siRNAs

    [0109] 1, Synthesis of Galactose Modified Monomer L

    ##STR00005##

    [0110] 1) Synthesis of Compound 1

    [0111] In a 1 L round bottom flask, δ-valerolactone (100 g, 1 mol), sodium hydroxide (40 g, 1 mol) and 400 mL of deionized water were mixed, reacted for 6 hours at 70° C., and monitored by TCL until the reaction was completed. The reaction was spin-dried, added with 200 ml of toluene, followed by spin drying to get 140 g of a white solid.

    [0112] 2) Synthesis of Compound 2

    [0113] In a 1 L round bottom flask, compound 1 (140 g, 1 mol), anhydrous acetone 500 mL, benzyl bromide (205.2 g, 1.2 mol), and catalyst tetrabutylammonium bromide (16.2 g, 0.05 mol) were added and refluxed under heating. The reaction was monitored by TLC and was complete after 24 h. After the reaction liquid was cooled to room temperature, acetone was removed under reduced pressure. The residue was dissolved in 500 mL of ethyl acetate and washed successively with 200 mL of saturated sodium bisulfate, 200 mL of saturated sodium bicarbonate and 200 mL of saturated brine. The organic phase was dried over anhydrous sodium sulfate, concentrated and passed through a silica gel column (petroleum ether:ethyl acetate V:V=1:1) to isolate 175 g of a clear oily liquid with a yield of 84%.

    [0114] 3) Synthesis of Compound 3

    [0115] In a 1 L round bottom flask, D-galactose hydrochloride (100 g, 0.46 mol) and 450 mL of anhydrous pyridine were added, and 325 mL of acetic anhydride, triethylamine (64.5 mL, 0.46 mol) and DMAP (2 g, 0.016 mol) were slowly added under an ice bath. After overnight reaction at room temperature, a large amount of solid was precipitated. Suction filtration was carried out to give a filter cake, which was rinsed with 200 mL of 0.5 N HCl solution to get 162.5 g of a white solid with a yield of 90%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.88 (d, J=9.2 Hz, 1H), 5.63 (d, J=8.8 Hz, 1H), 5.26 (d, J=3.1 Hz, 1H), 5.05 (d, J=11.3, 3.3 Hz, 1H), 4.36 (m, 4H), 2.11 (s, 3H), 2.03 (s, 3H), 1.98 (s, 3H), 1.90 (s, 3H), 1.78 (s, 3H).

    [0116] 4) Synthesis of Compound 4

    [0117] In a 250 mL round bottom flask, compound 3 (10 g, 25.7 mmol) and 100 mL of anhydrous dichloromethane was added. After stirring for 10 minutes trimethylsilyl trifluoromethanesulfonate (7 mL, 38.7 mmol) was added. The reaction was then allowed to proceed overnight at room temperature. The reaction solution was slowly poured into an aqueous solution (200 mL) of sodium bicarbonate (7 g, 79.5 mmol) and stirred for 0.5 hours. The organic phase was separated and dried over anhydrous sodium sulfate. After concentration under reduced pressure, 7.78 g of light yellow colloid was obtained with a yield of 92%.

    [0118] 5) Synthesis of Compound 5

    [0119] In a 100 mL round bottom flask, compound 4 (5 g, 15.2 mmol) and compound 2 (3.8 g, 18.25 mmol) were dissolved in 50 mL of anhydrous1, 2-dichloroethane, stirred for 10 minutes, and added with trimethylsilyl trifluoromethanesulfonate (0.55 mL, 3 mmol). Reaction was allowed to proceed overnight. The reaction liquid was extracted with dichloromethane. The obtained organic phase was washed twice with 50 mL of saturated sodium bicarbonate, dried over anhydrous sodium sulfate, then concentrated under reduced pressure and passed through a silica gel column (petroleum ether:ethyl acetate V:V=3:2) to isolate 6.94 g of a clear oily liquid with a yield of 85%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.69 (d, J=9.3 Hz, 1H), 7.33-7.16 (m, 5H), 5.28 (d, J=5.3 Hz, 1H), 4.95 (s, 2H), 4.93 (q, J=4.2 Hz, 1H), 4.40 (d, J=8.6 Hz, 1H), 4.00-3.86 (m, 3H), 3.73-3.56 (m, 2H), 3.36-3.21 (m, 1H), 2.53 (t, J=8.2 Hz, 2H), 2.11 (s, 3H), 1.89 (s, 3H), 1.83 (s, 3H), 1.65 (s, 3H), 1.59-1.36 (m, 4H). MS(ESI), m/z: 560.2 ([M+Na].sup.+).

    [0120] 6) Synthesis of Compound 6

    [0121] In a 50 mL round bottom flask, compound 5 (3.3 g, 6.1 mmol), Pd/C (0.33 g, 10%) were dissolved in 5 mL of methanol and 20 mL of ethyl acetate, then introduced with a hydrogen balloon and reacted overnight at room temperature. The reaction liquid was filtered through diatomite, and the diatomite was then rinsed with methanol. The filtrate was concentrated under reduced pressure and spin-dried to get 2.8 g of a white solid with a yield of 95.5%. .sup.1H NMR (400 MHz, DMSO-d6) δ: 11.98 (s, 1H), 7.79 (d, J=8.9 Hz, 1H), 5.20 (s, 1H), 5.0-4.95 (q, J=4.2 Hz, 1H), 4.51-4.46 (d, J=7.2 Hz, 1H), 4.15-3.97 (m , 3H), 3.89-3.79 (m, 1H), 3.80-3.69 (m, 1H), 3.46-3.36 (m, 1H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.59-1.42 (m, 4H), MS(ESI), m/z: 470.5 ([M+Na].sup.+).

    [0122] 7) Synthesis of Compound 7

    [0123] With serine as raw material, compound 7, a white solid, was synthesized referred to Choi J Yet al with a yield of 89%. MS(ESI), m/z: 248.2 ([M+Na].sup.+).

    [0124] (8) Synthesis of Compound 8

    [0125] Compound 8 was synthesized from compound 2 with reference to US 2011/0077389 A1. A white solid was obtained with a yield of 56%. .sup.1H NMR (400 MHz, DMSO-d6) δ: 7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.16 (s, 2H), 4.63-4.58 (m, 1H), 4.05-3.97 (m, 1H), 3.74 (s, 6H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H). MS(ESI), m/z: 416.3 ([M+Na].sup.+).

    [0126] (9) Synthesis of Compound 9

    [0127] In a 250 mL round bottom flask, compound 6 (10 g, 22.35 mmol), 1-ethyl-(3-dimethylaminopropyl) carbonyldiimine hydrochloride (EDC. HCL) (5.14 g, 26.82 mmol), N-hydroxysuccinimide (2.83 g, 24.59 mmol), and dichloromethane 100 mL were added. After reacting under stirring at room temperature for 0.5 h, compound 8 (8.79 g, 22.35 mmol) was added. The reaction was monitored by TLC and was complete after 4 h. The reaction liquid was washed successively with 50 mL of saturated sodium bicarbonate and 50 mL of saturated brine, the organic phase was dried over anhydrous sodium sulfate, then concentrated, and passed through a silica gel column (dichloromethane:methanol V:V=20:1) to isolate 15.8 g of a white solid with a yield of 86%. MS(ESI), m/z: 845.2 ([M+Na].sup.+).

    [0128] (10) Synthesis of Compound Monomer L

    [0129] In a 250 mL two-necked flask, compound 1 (5 g, 6.08 mmol) under nitrogen protection, 100 mL anhydrous acetonitrile, and bis (diisopropylamino)(2-cyanoethoxy) phosphine (3.66 g, 12.16 mmol) were added, and a solution of ethylthiotetrazole in acetonitrile (2.5 M) (1.22 mL, 3.04 mmol) was slowly added dropwise with stirring. Reaction was carried out for 0.5 h. The reaction was monitored by TLC and was complete after 0.5 h. The acetonitrile was removed by concentration under reduced pressure. 100 ML of dichloromethane was added to dissolve the concentrate, followed by washing with 100 mL of saturated brine. The organic phase was dried over anhydrous sodium sulfate, concentrated and passed through a silica gel column (petroleum ether:ethyl acetate V:V=1:3) to isolate 5.16 g of a white solid with a yield of 83%. .sup.1H NMR (400 MHz, DMSO-d6) δ: 7.84-7.79 (d, J=8.9 Hz, 1H), 7.65-7.60 (d, J=8.9 Hz, 1H), 7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.20 (s, 1H), 5.0-4.95 (q, J=4.2 Hz, 1H), 4.51-4.46 (d, J=7.2 Hz, 1H), 4.15-3.97 (m, 3H), 4.05-3.96 (m, 1H), 3.84-3.80 (m, 2H), 3.89-3.79 (m, 1H), 3.74 (s, 6H), 3.71-3.69 (m, 1H), 3.46-3.36 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.84 (m, 2H), 2.59-2.54 (m, 2H), 2.22-2.14 (t, J=7.2 Hz, 2H), 2.15 (s, 3H), 2.00 (s, 3H), 1.95 (s, 3H), 1.87 (s, 3H), 1.77 (s, 12H), 1.59-1.42 (m, 4H). MS(ESI), m/z: 1045.5 ([M+Na].sup.+).

    [0130] 2. Synthesis of Galactose Monomer S

    ##STR00006##

    [0131] (1) Synthesis of Compound 10

    [0132] In a 100 mL round bottom flask, compound 4 (5 g, 15.2 mmol) and 10-undecenol (3.1 g, 18.24 mmol) dissolved in 50 ml of anhydrous dichloromethane were added. After stirring for 10 minutes trimethylsilyl trifluoromethanesulfonate (0.55 mL, 3.0 mmol) was added. Reaction was allowed to proceed overnight. The reaction liquid was extracted with dichloromethane. The resulting organic phase was washed twice with 50 mL of saturated sodium bicarbonate, then dried over anhydrous sodium sulfate, concentrated under reduced pressure and passed through a silica gel column (petroleum ether:ethyl acetate V:V=3:2) to isolate 6.59 g of a white solid with a yield of 87%. .sup.1H NMR (400 MHz, DMSO-d6) δ:7.82 (d, J=3.3 Hz, 1H), 5.86-5.73 (m, 1H), 5.22 (s, 1H), 5.02-4.9 (m, 3H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 1H), 3.73-3.65 (m, 1H), 3.48 -3.38 (m, 1H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z: 522.4 ([M+Na].sup.+).

    [0133] (2) Synthesis of Compound 11

    [0134] In a 100 mL round bottom flask, compound 10 (4 g, 8.02 mmol), 50 mL of dichloromethane, 50 mL of acetonitrile, and 70 mL of deionized water were added. NaIO.sub.4 (6.86 g, 32.1 mmol) was added portion-wise. The reaction was carried out at room temperature for 48 h. The completion of the reaction was monitored by TCL. The reaction solution was added with 100 ML of deionized water, and then extracted three times with dichloromethane (50 mL×3). The organic phases were combined, dried over anhydrous sodium sulfate, concentrated under reduced pressure and spin-dried to get 4.1 g of a pale brown gummy product with a yield of 99%. .sup.1H NMR (400 MHz, DMSO-d6) δ:11.99 (s, 1H), 7.82 (d, J=3.3 Hz, 1H), 5.22 (s, 1 H), 5.02-4.9 (m, 1H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 3.9-3.88 (m, 1H), 3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1 .66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z: 540.26 ([M+Na].sup.+).

    [0135] (3)Synthesis of Compound 12

    [0136] Referring to the synthesis of compound 1, a white solid was obtained with a yield of 85.6%. MS (ESI), m/z: 915.5 ([M+Na]+).

    [0137] (4) Synthesis of Compound S

    [0138] Referring to the synthesis of compound L, a white solid was obtained with a yield of 82.1%.

    [0139] .sup.1H NMR (400 MHz, DMSO-d6) δ:7.82-7.78 (d, J=7.3 Hz, 1H), 7.69-7.63 (d, J=7.3 Hz, 1H), 7.41-7.37 (d, J=7.2 Hz, 2H), 7.33-7.28 (t, J=6.9 Hz, 2H), 7.27-7.19 (m, 5H), 6.91-6.86 (d, J=8.2 Hz, 4H), 5.22 (s, 1H), 5.02-4.9 (m, 1H), 4.5-4.98 (s, J=3.5 Hz, 1H), 4.08-3.99 (m, 3H), 4.05-3.97 (m, 1H), 3.9-3.88 (m, 1H), 3.84-3.80 (m, 2H), 3.74 (s, 6H), 3.73-3.73-3.65 (m, 1H), 3.48-3.38 (m, 1H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H) 2.88-2.84 (m, 2H), 2.61-2.55 (m, 2H), 2.12 (s, 3H), 2.05-2.01 (m, 2H), 2.00 (s, 3H), 1.88 (s, 3H), 1.77 (s, 12H), 1.66 (s, 3H), 1.5-1.4 (m, 2H), 1.39-1.3 (m, 2H), 1.29-1.19 (m, 10H). MS(ESI), m/z: 1115.2 ([M+Na].sup.+).

    [0140] 3, Synthesis of GalNac-siRNA

    [0141] See Example 1.

    [0142] Second. Isolation of Primary Mouse Hepatocytes

    [0143] Mice were anesthetized and the skin and muscle layers were excised to expose the liver. A perfusion catheter was inserted into the portal vein, and the inferior vena cava was cut open, to prepare for liver perfusion. Perfusion solutions Solution I (Hank's, 0.5 mM EGTA, pH 8) and Solution II (low glucose DMEM, 100 U/mL Type IV, pH 7.4) were preheated at 40° C. Solution I of 37° C. was perfused into the liver via the portal vein cannula at a flow rate of 7 mL/min for 5 min until the liver turned off-white. Solution II of 37° C. was perfused into the liver at a flow rate of 7 mL/min for 7 min. After perfusion was complete, the liver was removed and placed in Solution III (10% FBS-low glucose DMEM, 4° C.) to stop digestion, then the liver capsule was cut by the forceps, and the hepatocytes was released by gently shaking. The hepatocytes were filtered through a 70 μm cell filter, centrifuged at 50 g for 2 min with the supernatant discarded. The cells were resuspended with Solution IV (40% percoll low glucose DMEM, 4° C.), then centrifuged at 100 g for 2 min with the supernatant discarded. Cells were added with 2% FBS-low glucose DMEM and resuspended in for use. Cell viability was identified by Trypan blue staining.

    [0144] Third, Determinations of GalNAc Binding Curves and Kd Values

    [0145] Freshly isolated mouse primary hepatocytes were plated in 96-well plates at 2×10.sup.4 cells/well, 100 μl/well. GalNAc-siRNA was added to each well, respectively. Each GalNAc-siRNA was set to a final concentration of 0.9 nM, 8.3 nM, 25 nM, 50 nM, 100 nM, 150 nM, respectively. The suspensions were incubated at 4° C. for 2 h, and centrifuged at 50 g for 2 min with the supernatant discarded. The cells were resuspended in 10 μg/ml Pl, stained for 10 min and centrifuged at 50 g for 2 min. Cells were washed with pre-cooled PBS and centrifuged at 50 g for 2 min with the supernatant discarded. The cells were resuspended in PBS. The mean fluorescence intensity MFI of living cells was measured by a flow cytometry, and nonlinear fitting and Kd value calculation were performed by the GraphPad Prism 5 software. The data in Tables 6A-C and FIGS. 1A-C show that ligand-modified GalNAc-siRNAs promote in vitro hepatocyte endocytosis/uptake without the addition of transfection reagents, achieving delivery of hepatocytes. Meanwhile, GalNAc-siRNAs with different GalNac structures show different endocytosis and receptor binding abilities. According to B max and Kd values, GalNAc-siRNA with structures 3S, 4S and 3L, 4S have better affinity to hepatocytes.

    TABLE-US-00010 TABLE 6 A Kd Values and Bmax values for each experimental group P2G6-12L P2G6-13L P2G6-14L Bmax 57245 77943 85917 Kd 37.9 10.4 10.9

    TABLE-US-00011 TABLE 6 B Kd Values and Bmax values for each experimental group P2G6-12S P2G6-13S P2G6-14S Bmax 52542 79308 83928 Kd 29.4 9.2 7.1

    TABLE-US-00012 TABLE 6C Kd values and Bmax values for each experimental group P3G6-13L P3G6-14L P3G6-13S P3G6-14S Bmax 80242 82685 78521 81661 Kd 9.6 6.8 8.9 8.8

    TABLE-US-00013 TABLE 7 GalNAc-siRNA Sequence structures for targeting assays Strand No Structures (5′-3′) No Descriptions P2G6-10 SEQ ID NO: 2,  3 Cy5+, GACGAUGCCUGCCUCUACU Targeting- SEQ ID NO: 13, 10 Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GFCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P2G6-11L SEQ ID NO: 14, 11 Cy5+, 3′ L GACGAUGCCUGCCUCUACU- L SEQ ID NO: 13, 10 Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GFCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P2G6-12L SEQ ID NO: 15, 12 Cy5+, 3′ GACGAUGCCUGCCUCUACU- LL LL SEQ ID NO: 13, 10 Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GFCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P2G6-13L SEQ ID NO: 16, 13 Cy5+,3′ GACGAUGCCUGCCUCUACU- LLL SEQ ID NO: 13, 10 Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GfCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P2G6-14L SEQ ID NO: 17, 14 Cy5+, 3′ GACGAUGCCUGCCUCUACU- LLLL LLLL SEQ ID NO: 13, 10 Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GFCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P2G6-11S SEQ ID NO: 18, 15 Cy5+, 3′ S GACGAUGCCUGCCUCUACU- S SEQ ID NO: 13, 10 Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GfCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P2G6-1 SEQ ID NO: 19, 16 Cy5+ 3′ 2S GACGAUGCCUGCCUCUACU- SS SS Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GfCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P2G6-13S SEQ ID NO: 20, 17 Cy5+, 3′ GACGAUGCCUGCCUCUACU- SSS SSS SEQ ID NO: 13, 10 Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GfCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P2G6-14S SEQ ID NO: 21, 18 Cy5+, 3′ GACGAUGCCUGCCUCUACU- SSSS SSSS SEQ ID NO: 13, TO Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GfCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P3G6-10 SEQ ID NO: 12,  9 Cy5+, mGmAmCfGfAfUmGmCmCfUfG Targeting- fCfCmUfCfUmAmCmU SEQ ID NO: 13, 10 GFCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P3G6-13L SEQ ID NO: 22, 19 Cy5+, 3′ mGmAmCfGfAfUmGmCmCfUfG LLL fCfCmUfCfUmAmCmU-LLL SEQ ID NO: 13, 10 Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GFCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P3G6-13S SEQ ID NO: 23, 20 Cy5+, 3′ mGmAmCfGfAfUmGmCmCfUfG SSS fCfCmUfCfUmAmCmU-SSS SEQ ID NO: 13, 10 Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GFCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P3G6-14L SEQ ID NO: 24, 21 Cy5+,3′ mGmAmCfGfAfUmGmCmCfUfG LLLL fCfCmUfCfUmAmCmU-LLLL SEQ ID NO: 13, 10 Cy54AmGfUfAfG(s)dA(s)dG(s)d GfCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC P3G6-14S SEQ ID NO: 25, 22 Cy5+, 3′ mGmAmCfGfAfUmGmCmCfUfG SSSS fCfCmUfCfUmAmCmU-SSSS SEQ ID NO: 13, 10 Cy5-fAmGfUfAfG(s)dA(s)dG(s)d GfCfAfG(s)dG(s)dC(s)dAfUfCm GfUfC(s)mC(s)mC

    [0146] Note: 1 following the broken line in P2G6-10 indicates that the modification is carried out through a fluorescent label, and 0 following the broken line indicates that the modification is not carried out through a targeting ligand; 1 following the broken line in P2G6-13L indicates that the modification is carried out through a fluorescent label, and 3 L following the broken line indicates that the targeting ligand is modified into 3 L (LLL); other annotations and so on.

    Example 4 In Vitro Efficacy Test of GalNAc-siRNAs

    [0147] Referring to the procedure of Example 1, mRNA expression levels in HePG2 cells were measured. The final concentration of GalNAc-siRNA transfection was 50 nM. The results are shown in Table 8.

    TABLE-US-00014 TABLE 8 In vitro inhibitory activity of GalNAc-siRNAs HePG2 Cells (with transfection reagent) REL P2G6 0.47 P2G6-03L 0.50 P2G6-03S 0.51 P3G6 0.40 P3G6-03L 0.38 P3G6-03S 0.36

    TABLE-US-00015 TABLE 9 GaINAc-siRNA Sequence structures for efficacy test No Structures (5′-3′) Strand No P2G6-03L SEQ ID NO: 16, 13 GACGAUGCCUGCCUCUACU-LLL SEQ ID NO: 5,  8 fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC (s)dAfUfCmGfUfC(s)mC(s)mC P2G6-03S SEQ ID NO: 20, 17 GACGAUGCCUGCCUCUACU-SSS SEQ ID NO: 5,  8 fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC (s)dAfUfCmGfUfC(s)mC(s)mC P3G6-03L SEQ ID NO: 22, 19 mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUm AmCmU-LLL SEQ ID NO: 5,  8 fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC (s)dAfUfCmGfUfC(s)mC(s)rnC P3G6-03S SEQ ID NO: 23, 20 mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUm AmCmU-SSS SEQ ID NO: 5,  8 fAmGfUfAfG(sjdA(sjdG(s)dGfCfAfG(s)dG(s)dC (s)dAfUfCmGfUfC(s)mC(s)mC Note: 0 following the broken line in P2G6-13L indicates that the modification is not carried out through a fluorescent label, and 3L following the broken line indicates that the targeting ligand is modified into 3L (LLL); other annotations and so on.

    Example 5 In Vivo Liver Targeting Assay

    [0148] Twenty-four (24) Male, 6-7 week old SPF grade Balb/c-nu mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were used for this study. The mice were randomly divided into 7 groups, including blank control group, group P2G6-10, group P3G6-10, group. P2G6-13L, group P2G6-13S, group P3G6-13L and group P3G6-13S. The number of animals in each group was 2, 3, 3, 4, 4, 4 and 4 respectively. Mice were administered by caudal vein injection at a dose of approximately 10 mg/kg (see Table 10 for experimental design), All animals were subjected to in vivo imaging, including white light and X-ray imaging, before dosing, and 5 min, 30 min, 1 h, 2 h, 4 h, 6 h after dosing. After euthanasia 6 hours after the administration, the brain, salivary glands, heart, spleen, lung, liver, kidney, and intestinal tract were removed for imaging analysis of isolated organs (FIGS. 2 and 3).

    TABLE-US-00016 TABLE 10 Liver targeting experimental design Sequence Injection Dosing Dosing Volume No Groupings products (mg/kg) (mL) 1 Blank control Saline 0 0.2 2 NC1 P2G6-10 10 0.2 3 NC2 P3G6-10 10 0.2 4 Positive group P2G6-13L 10 0.2 5 Positive group P2G6-13S 10 0.2 6 Positive group P3G6-13L 10 0.2 7 Positive group P3G6-13S 10 0.2

    [0149] Ex vivo imaging analyses were performed and the results are shown in Tables 11 and 12. The results showed that the fluorescence intensities of the livers of the groups P2G6-13L, P2G6-13S, P3G6-13L, and P3G6-13S were significantly higher than that of the negative control group (NC) 6 hours after administration (see fluorescence intensity ratio results in Table 12), indicating that P2G6-13L, P2G6-13S, P3G6-13L, and P3G6-13S have significantly higher targeting to the liver.

    TABLE-US-00017 TABLE 11 Statistics of ex vivo organ fluorescence intensity values after background subtraction (×10.sup.8 ps/mm.sup.2) Salivary Intestinal Groupings Animal No gland Liver Kidney tract P2G6-10 Average values 9728 3556 45038 17644 SD 1023 570 4725 819 P2G6-13L Average values 9247 8280 33232 17246 SD 1257 2078 559 1911 P2G6-13S Average values 7278 12957 39642 20212 SD 2053 3619 1212 3002 P3G6-10 Average values 9253 3867 45519 13020 SD 1073 324 1418 809 P3G6-13L Average values 9148 8580 63770 15740 SD 2855 2550 3125 1688 P3G6-13S Average values 10640 11876 45647 17098 SD 2318 451 1325 1650

    TABLE-US-00018 TABLE 12 Fluorescence intensity ratio results Organs Salivary gland Liver Kidney Intestinal tract P2G6-13L/P2G6-10 0.95 2.89 0.74 0.98 P2G6-13S/P2G6-10 0.75 4.52 0.88 1.15 P3G6-13L/P3G6-10 0.99 2.22 1.40 1.20 P3G6-13S/P3G6-10 1.15 3.07 1.00 1.31

    Example 6. In Vivo Efficacy Assay of GalNAc-siRNA

    [0150] SPF grade male, 6-8 week old C57BL/6 mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.) were randomly divided into groups. C57/B16 mice were administered via caudal vein. The mouse livers were taken on the 3rd and 7th days and cryopreserved at −80° C. respectively. The levels of PCSK9 mRNA in liver tissue were, detected. Blood samples were, collected from mice on day 3, day 7, day 14, day 21 and day 30, respectively (0.25 ml blood was collected by retrobulbar exsanguination and sent for examination within 1 h after blood collection) for detecting the levels of LDL-c, Tc and TG. All animals showed no signs of death or dying during the experiment. No significant abnormalities were observed in all animals.

    [0151] First. Detection of Expression Level of PCSK9 mRNA in Mouse Liver

    [0152] Twenty-eight (28) mice were randomly divided into seven groups, four in each group, and the animals grouping and administration are as shown in Table 13. The mouse liver tissue was cryopreserved, and ground by a full-automatic grinding machine. Total RNA was extracted from the mouse liver tissue by Trizol method, and the purity and concentration of RNA were determined by K5500 method to meet the requirements of qPCR. The mRNA expression level of PCSK9 gene was detected by qRT-PCR Starter Kit (Guangzhou RiboBio Co., Ltd.). In the qPCR experiment, three wells were set up for each sample, and the relative expression of PCSK9 mRNA was calculated by 2-ΔΔ Ct method with 18 s RNA as an internal reference. The, vehicle group was the control group. The relative expression of PCSK9 mRNA was analyzed by the Excel software.

    TABLE-US-00019 TABLE 13 Animal Grouping Table Sequence sample Dosing Volume No Groupings for test (mg/kg) (mL/kg) 1. Vehicle control group Saline — 0.2 2. Low dose group C P3G6-03L 3 0.2 3. Medium dose group C P3G6-03L 10 0.2 4. High dose group C P3G6-03L 33 0.2 5. Low dose group D P3G6-03S 3 0.2 6. Medium dose group D P3G6-03S 10 0.2 7. High dose group D P3G6-03S 33 0.2

    [0153] The results showed (Table 14) that expression levels of PCSK9 mRNA in liver tissues of mice in dosing groups C and D were reduced with a certain dose-dependent compared to the vehicle control group from 3 days to 7 days after dosing. The results showed that the target drugs C and D were effective and stable, and could down-regulate the expressions of PCSK9 mRNA in liver tissues of mice.

    TABLE-US-00020 TABLE 14 QPCR quantification for 3-7 day samples Relative Standard Relative Standard expression deviation expression deviation No Groupings on day 3 on day 3 on day 7 on day 7 1 Vehicle control 1.00 0.17 1.00 0.23 2 Low dose group C 0.85 0.16 0.82 0.10 3 Medium dose group 0.72 0.12 0.70 0.19 4 High dose group C 0.53 0.11 0.51 0.12 5 Low dose group D 0.95 0.21 0.80 0.21 6 Medium dose group 0.75 0.07 0.67 0.12 7 High dose group D 0.57 0.04 0.53 0.08

    [0154] Second. Detection of Mouse Serum Biochemical Indicators

    [0155] One hundred and twelve (112) mice were randomly divided into seven groups, sixteen (16) in each group, and the animals grouping and administration are shown in Table 13. 200 μL of blood was collected and centrifuged at 4000 rpm, the supernatant was taken for detection of the serum biochemical indexes by Mairui BS-490 biochemical analyzer.

    [0156] The results are shown in Tables 15-19.

    TABLE-US-00021 TABLE 15 Statistical table of blood biochemical indexes for animals administered for 3 days LDL-C TC TG Groupings mmol mmol mmol Vehicle control group 0.18 ± 0.01 2.54 ± 0.17 0.85 ± 0.05 (0 mg/kg) Drug C low dose group 0.17 ± 0.03 2.21 ± 0.30 0.64 ± 0.19 (3 mg/kg) Drug C middle dose group 0.16 ± 0.02 2.10 ± 0.13 0.53 ± 0.03 (10 mg/kg) Drug C high dose group 0.15 ± 0.01 2.08 ± 0.17 0.49 ± 0.07 (33 mg/kg) Drug D low dose group 0.18 ± 0.06 2.47 ± 0.15 0.74 ± 0.16 (3 mg/kg) Drug D medium dose group 0.17 ± 0.02 2.33 ± 0.11 0.58 ± 0.05 (10 mg/kg) Drug D high dose group 0.16 ± 0.02 2.25 ± 0.09 0.52 ± 0.04 (33 mg/kg)

    TABLE-US-00022 TABLE 16 Statistical table of blood biochemical indexes for animals administered for 7 days LDL-C TC TG Groupings mmol mmol mmol Vehicle control group 0.16 ± 0.01 2.54 ± 0.23 0.84 ± 0.17 (0 mg/kg) Drug C low dose group 0.14 ± 0.02 2.44 ± 0.16 0.82 ± 0.18 (3 mg/kg) Drug C middle dose group 0.14 ± 0.02 2.15 ± 0.16 0.75 ± 0.21 (10 mg/kg) Drug C high dose group 0.13 ± 0.02 2.04 ± 0.21 0.68 ± 0.15 (33 mg/kg) Drug D low dose group 0.15 ± 0.03 2.49 ± 0.23 0.84 ± 0.17 (3 mg/kg) Drug D medium dose group 0.14 ± 0.03 2.28 ± 0.10 0.78 ± 0.18 (10 mg/kg) Drug D high dose group 0.13 ± 0.01 2.17 ± 0.08 0.73 ± 0.12 (33 mg/kg)

    TABLE-US-00023 TABLE 17 Statistical table of blood biochemical indexes for animals administered for 14 days LDL-C TC TG Groupings mmol mmol mmol Vehicle control group 0.25 ± 0.04 2.93 ± 0.16 1.60 ± 0.36 (0 mg/kg) Drug C Low dose group 0.22 ± 0.08 2.50 ± 0.16 1.44 ± 0.34 (3 mg/kg) Drug C Middle dose group 0.20 ± 0.03 2.48 ± 0.14 1.40 ± 0.24 (10 mg/kg) Drug C High dose group 0.18 ± 0.02 2.38 ± 0.09 1.09 ± 0.33 (33 mg/kg) Drug D Low dose group 0.24 ± 0.07 2.80 ± 0.15 1.57 ± 0.22 (3 mg/kg) Drug D medium dose group 0.21 ± 0.05 2.55 ± 0.13 1.49 ± 0.19 (10 mg/kg) Drug D High dose group 0.19 ± 0.02 2.44 ± 0.11 1.23 ± 0.20 (33 mg/kg)

    TABLE-US-00024 TABLE 18 Statistical table of blood biochemical indexes for animals administered for 21 days LDL-C TC TG Groupings mmol mmol mmol Vehicle control group 0.24 ± 0.02 2.78 ± 0.14 1.50 ± 0.76 (0 mg/kg) Drug C low dose group 0.22 ± 0.03 2.68 ± 0.10 1.15 ± 0.38 (3 mg/kg) Drug C middle Dose Group 0.21 ± 0.02 2.65 ± 0.23 1.10 ± 0.36 (10 mg/kg) Drug C high dose group 0.20 ± 0.03 2.49 ± 0.15 1.07 ± 0.27 (33 mg/kg) Drug D low dose group 0.24 ± 0.05 2.82 ± 0.13 1.27 ± 0.25 (3 mg/kg) Drug D medium dose group 0.23 ± 0.02 2.75 ± 0.16 1.19 ± 0.21 (10 mg/kg) Drug D high dose group 0.21 ± 0.02 2.63 ± 0.12 1.05 ± 0.13 (33 mg/kg)

    TABLE-US-00025 TABLE 19 Statistical Table of Blood Biochemical Indexes for Animals Administered for 30 Days LDL-C TC TG Groupings mmol mmol mmol Vehicle control group 0.19 ± 0.02 2.84 ± 0.20 0.72 ± 0.16 (0 mg/kg) Drug C low dose group 0.18 ± 0.02 2.74 ± 0.16 0.71 ± 0.22 (3 mg/kg) Drug C middle dose group 0.16 ± 0.02 2.73 ± 0.15 0.67 ± 0.17 (10 mg/kg) Drug C high dose group 0.16 ± 0.03 2.65 ± 0.18 0.60 ± 0.13 (33 mg/kg) Drug D low dose group 0.18 ± 0.02 2.80 ± 0.21 0.70 ± 0.18 (3 mg/kg) Drug D middle dose group 0.17 ± 0.02 2.78 ± 0.12 0.68 ± 0.17 (10 mg/kg) Drug D high dose group 0.16 ± 0.01 2.69 ± 0.17 0.63 ± 0.12 (33 mg/kg)

    [0157] The results showed that (Tables 15-19), after 3-30 days of administration, the expression of LDL-C, TC, TG in animals of both groups C and D were decreased, and the inhibitory effect on the expression of LDL-C, TC, TG gradually increased with the increasing, dose; partial doses (e.g., medium and high dose groups) have a more pronounced lipid lowering effect. Therefore, the siRNA molecules of the present disclosure, which inhibit PCSK9 gene expression, represented by the target drugs C and D, have a significant lipid-lowering effect and can be used for the treatment of diseases or symptoms mediated by PCSK9 genes such as cardiovascular diseases or neoplastic diseases.

    [0158] Although specific embodiments of the present disclosure have been described in detail, those skilled in the art will appreciate that various modifications and variations of the details are possible in light of the above teachings and are within the purview of this disclosure. The full scope of the present disclosure is indicated by the appended claims and any equivalents thereof.

    REFERENCES

    [0159] Hutvágner G, Mclachlan J, Pasquinelli A E, et al. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7small temporal RNA[J]. Science, 2001, 293(5531):834-8.

    [0160] Elbashir S M, Harborth J, Lendeckel W, et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. [J]. Nature, 2001, 411(24):494-8.

    [0161] Choi J Y, Borch R F. Highly efficient synthesis of enantiomerically enriched2-hydroxymethylaziridines by enzymatic desymmetrization [J]. Cheminform, 2010, 38(18):215-8.

    [0162] Zamore P D. RNA interference: listening to the sound of silence [J]. Nature Structural Biology, 2001, 8(9):746-50.