MODIFIED SALMON WHICH PRODUCE STERILE OFFSPRING

Abstract

The present invention relates, inter alia, to processes for making modified fish zygotes or early-stage fish embryos (particularly salmon zygotes and salmon embryos). The invention also provides fish zygotes, fish embryos, juvenile fish, mature fish and sterile fish which are produced by the processes of the invention.

Claims

1.-6. (canceled)

7. A juvenile or sexually-mature fish: (a) whose cell genomes collectively comprise one or more mutations in a germ cell survival factor gene, wherein the one or more mutations render all copies of the germ cell survival factor gene or gene product in the fish non-functional, wherein the germ cell survival factor gene is a piwil gene or a piwi gene; and (b) which has gonads which are capable of producing viable sperm or eggs.

8. Sperm or eggs from the sexually-mature fish as claimed in claim 7.

9. A fish zygote: (a) whose genome comprises one or more mutations which render one or more or all copies of a germ cell survival factor gene non-functional, wherein the germ cell survival factor gene is a piwil gene or a piwi gene; and (b) wherein the zygote does not comprise functional RNA or functional protein encoded by the germ cell survival factor gene.

10. (canceled)

11. A sterile fish: (a) whose cell genomes collectively comprise one or more mutations which render one or more or all copies of a germ cell survival factor gene in the fish non-functional, wherein the germ cell survival factor gene is a piwil gene or a piwi gene; and (b) wherein the physiological and/or anatomical features of the fish are characteristic of a fish that has developed from a zygote which was lacking in maternally-derived mRNA encoded by the germ cell survival factor gene.

12. The sterile fish of claim 11, wherein the fish has: (i) no germ cells; (ii) testes or ovaries without germ cells; (iii) testicular spermatogenic tubules without germ cells; or (iv) gonads which lack ovarian follicles.

13.-16. (canceled)

17. The juvenile or sexually-mature fish of claim 7: (a) whose cell genomes collectively comprise from 3-20 mutations in the germ cell survival factor gene, wherein the 3-20 mutations render all copies of the germ cell survival factor gene or gene product in the fish non-functional.

18. The fish zygote of claim 9: (a) whose genome comprises 1-2 mutations which render one or more or all copies of the germ cell survival factor gene non-functional.

19. The sterile fish of claim 11: (a) whose cell genomes collectively comprise 1-2 mutations which render one or more or all copies of the germ cell survival factor gene in the fish non-functional.

20. The juvenile or sexually-mature fish of claim 7, wherein the fish is from the family Salmonidae or the fish is a salmon.

21. The fish zygote of claim 9, wherein the fish is from the family Salmonidae or the fish is a salmon.

22. The sterile fish of claim 11, wherein the fish is from the family Salmonidae or the fish is a salmon.

23. The juvenile or sexually-mature fish of claim 7, wherein the germ cell survival factor gene is a piwil1 gene.

24. The fish zygote of claim 9, wherein the germ cell survival factor gene is a piwil1 gene

25. The sterile fish of claim 11, wherein the germ cell survival factor gene is a piwil1 gene.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0151] FIG. 1. Gross morphology (A and C) and section of gonad (E) of a rescued dndKO female (VIRGIN female) with germ cells produced by transient injection of dnd mRNA into the zygote. Gross morphology (B and D) and section of gonad (F) of a dndKO female.

[0152] FIG. 2. Gross morphology (A and D) and section of gonad (G) of a control immature male. Gross morphology (B and E) and section of gonad obtained from a rescued dndKO male (VIRGIN male) with germ cells (H) produced by transient injection of dnd mRNA into the zygote. Gross morphology (C and F) and section of a dndKO male gonad (I), lacking germ cells and containing numerous Sertoli cells.

[0153] FIG. 3. Expression of vasa (a germ cell specific marker) in gonads obtained from one year old control immature fish, dndKO fish and dndKO rescued fish. dndKO fish were produced by transient injection of dnd mRNA into the zygote. A and B illustrate expression of vasa in gonads obtained from females and males, respectively.

[0154] FIG. 4. Mutational analysis of fin clips obtained from the dnd knockout (dndKO) fish, control and dndKO rescued fish produced by transient injection of dnd mRNA into the zygote. The top sequence is the genomic region of dnd and below is the target gRNA. This is followed by the dndKO and dndKO rescued animals and at the bottom wildtype sequences for dnd in male and female control are shown. (SEQ ID NOs: 3-9; some sequences are repeated.)

[0155] FIG. 5. Deep sequencing of dnd CRISPR target site, using DNA obtained from fin clips of wt, germ cell free (GCF) and rescued males and females. Each fin clip were sequenced to a depth ranging between 50,000-400,000.

[0156] FIG. 6. Histology and gross morphology of a control (A and C) and rescued maturing male with 100% dnd mutation rate (B and D). The rescued male displayed normal gross morphology and histology, and showed the characteristic spermatogonial stages.

[0157] FIGS. 7A and 7B. Histology of piwil1.sup.−/− and piwil1.sup.+/+ immature salmon testis.

[0158] FIGS. 8A and 8B: Histology of piwil1.sup.−/− and piwil1.sup.+/+ immature salmon ovary.

EXAMPLES

[0159] Examples 1-4 are not examples of the invention. They are provided for enablement purposes in order to demonstrate how the invention may be worked using a diffferent germ cell survival factor gene, i.e. dead end (dnd).

Example 1

Materials and Methods

[0160] Preparation of Salmon Zygotes

[0161] Salmon eggs and sperm were obtained from Aquagen (Trondheim, Norway). These were sent overnight to Matre Aquaculture station, Norway. Eggs were subsequently fertilized with sperm in fresh water (6-8° C.) containing 0.5 mM reduced gluthathione as described for rainbow trout [13]. After fertilization, embryos were incubated 2-3 hours at 6-8° C. until the first cell was visible.

[0162] Preparation of CRISPR sgRNA and dnd RNA

[0163] BamHI-HF (NEB) linearized pT7-gRNAs including the respective cloned target sites were cleaned up using a QIAprep column (Qiagen) and transcribed using the MEGAscript T7 kit (Ambion) according to the manufacturer's protocol. The mirVana miRNA Isoltation Kit was used to purify gRNAs.

[0164] For producing Cas9 nuclease mRNA, we used the pTST3-nCas9n vector optimized for Zebrafish (Jao et al., 2013; Addgene ID #46757). Prior to in-vitro transcription, the plasmid was linearized using XbaI (NEB) and cleaned up via a QIAprep Spin column. Cas9 mRNA was produced using the mMessage mMachine T3 kit (Ambion) and purified using an RNeasy MiniKit spin column (Qiagen).

[0165] Full length dnd mRNA was PCR amplified from salmon ovary using q5 polymerase, using a forward primer with T7 attached to it. The PCR product was gel-purified (Qiagen gel purification kit) and sequenced. The dnd PCR product was in vitro transcribed into a functional dnd mRNA using T7 ARCA mRNA kit (NEB).

[0166] Micro-Injection of CRISPR sgRNA and dnd RNA into Zygotes

[0167] Eggs were micro-injected with 2-8 nl of a mix containing 50 ng/ml gRNA, 100 ng/ml mRNA for dnd and 150 ng/ml Cas9 mRNA in MilliQ H.sub.2O using the picospritzer III (Parker Automation, UK) and needles from Narishige (Japan). After injection, eggs were incubated at 6° C. until hatching.

[0168] Testing for the Results Using Fin Clips

[0169] DNA was obtained from embryos, juveniles and fin clips using DNeasy Blood & Tissue kit (Qiagen) or AllPrep DNA/RNA kit (Qiagen) with the following modifications: Juveniles (separated from the yolk sac) and fin clips were homogenized using Zirconium oxide beads and a homogenizer (Precellys) in buffer ATL or buffer RLTplus/β-mercaptoethanol prior to DNA extraction. PCR was performed on genomic DNA to obtain a fragment that covered the targeted mutagenesis site [7]. Fragments were both directly sequenced, and sub-cloned into pCR4-TOPO using the TOPO TA cloning kit for sequencing (Invitrogen) to either measure the general effect in the target site in the whole preparation or in single sequences from clones to assess the level of mutation rate in each individual or sample.

Example 2

Production of Broodstock Fish

[0170] To establish a dnd KO stable broodstock line, FO fish were obtained following the methods given in Example 1. Essentially, salmon zygotes were micro-injected with a gRNA (SEQ ID NO: 1) which targeted dnd and CRISPR Cas9 together with mRNA (SEQ ID NO: 2) coding for Dnd.

TABLE-US-00001 The gRNA sequence was: (SEQ ID NO: 1) 5′-GGGCCCACGGCACGGAACAGCGG-3′. mRNA sequence for Dnd >JN712911.1 Salmo salar Dead end mRNA, complete cds (SEQ ID NO: 2) GAAAGTTGCTACTTTTTCGAGACCTAGGATAATGGAGGAGCGTTCAAGTCAGGTGTTGAACCCGGAGCGA CTGAAGGCGCTGGAGATGTGGCTGCAGGAGACTGACGTCAAACTGACCCAGGTCAATGGCCAGAGGAAAT ATGGAGGTCCACCTGATGACTGGCTTGGCGCCCCCCCTGGGCCGGGCTGTGAGGTGTTCATCAGCCAGAT CCCGCGGGATGTCTTTGAGGACCAGCTGATTCCGCTGTTCCGTGCCGTGGGCCCTCTCTGGGAGTTCCGC CTCATGATGAACTTCAGCGGACAGAACCGTGGCTTTGCCTACGCCAAGTACGACAGCCCTGCCTCGGCCG CTGCCGCCATCCGCTCGTTGCATGGCCGTGCCCTCGAGTCAGGGGCACGCCTCGGTGTACGGCGCAGCAC GGAGAAACGTCAGCTCTGTCTTGGGGAGCTGCCCACCAGCACAAGGAGGGAGCAACTGCTGCAGGTGCTG CTGGACTTCTCTGAGGGGGTAGAGGGCGTGTCCCTGAGAGCAGGGCCTGGGGAACAGGGGATGTCTGCAG TGGTGGTCTATGCCTCCCACCATGCAGCTTCCATGGCCAAGAAGGTGCTGATTGAAGCCTTTAAAAAACG CTTCGGGCTGGCCATCACTTTGAAGTGGCAGTCCTCTTCTAGGCCCAAGCACGAAGAGCCTCCCAGACCC TCCAAAACCCCTCCTTCCTCTCCTCCCAAACCTCCTCGCTGCTCCCTCCTGGACAGCCCCCGGCCTCCCC TGCACCTCGCCCAGCGTCAGCTCCCTGCCTTCTCCCGGGCTGTGAGGGCGCCCTCTCCCATGGTGCACGC TGCTCCTGAATCCCCCAGGGGGGCGACCATGGTGCCTCCTGTGGATGCAGCAGCCCTGCTCCAGGGTGTG TGTGAGGTGTACGGGCAGGGGAAGCCCCTCTATGACCTGCAGTACCGCCACATGGGGCCTGACGGGTTCC TGTGCTTCAGCTACCGGGTGTATGTGCCGGGGCTGGCCACACCCTTCACTGGGATGGTGCAGACTCTGCC CGGCCCCACCCCTGGAGCCATACAGGAAGAGGCTCGCAGAGCTACAGCCCAGCAGGTCCTCAGCGCTCTG TACAGGGCCTGATGGTGTTGAAGCACAGATCCCCTACTTTGTTTTAATTATGAAAATACTTAAATGTTTT GCACTCTTTTATATTTAGTAAGTAGATGCATGATTTTACTTTTTTTTTTGAACCACTTTTGCATGTTTCT GCACCATTTAATTGTTTCTCATTATAATAAAATGAGATTTGTCAAAAAAAAAAAAAAAAAAAAAAA

[0171] The fish were grown to a size suitable for pit-tag and fin-clip e.g. 10-15 g. DNA was extracted fom fin clips, to be able to determine if fish were mutated in the dnd gene (FIGS. 4 and 5). Fish with mutations in; the dnd gene, mutations in the dnd gene+mRNA for dnd and control, were sampled for gonad gross morphology, histology and gene expression in ˜25 g fish (FIGS. 1, 2 and 3).

[0172] As shown in FIGS. 4 and 5, the rescued fish had mutations in the dnd gene, while at the same time having germ cells (FIGS. 1 and 2) and expressing the germ cell marker vasa (FIG. 3). The results demonstrate that it is possible to produce fish with germ cells from a fish with double allelic mutations in the dnd gene (FIG. 5). The results also show that dnd is not essential for further development of germ cells beyond the embryonic stage up to 2.5 years of age. We have also observed that dnd-rescued males can enter into puberty (FIG. 6). Dnd is therefore a suitable target as a germ cell survival factor and is not necessary for normal puberty in males (FIG. 6).

Example 3

Production of Farmed Fish

[0173] Gametes from the broodstock fish produced in Example 2 are used to produce salmon zygotes which have dnd biallelic knockouts. The fish which result from these zygotes have no PGCs and hence are sterile.

[0174] Each broodstock female can produce between 5,000-10,000 eggs and males can fertilize an immense number of eggs. The salmonids are used for farming and at the juvenile stage they are sampled to confirm lack of germ cells. The genomes of some individuals are sequenced to exclude fish with off-target mutations and to fully characterize the broodstock mutation.

Example 4

Production of Further Broodstock Fish

[0175] Gametes from the broodstock fish produced in Example 2 are used to produce salmon zygotes which have dnd biallelic mutations.

[0176] These zygotes are micro-injected with 0.2-0.5 ng of mRNA coding for dnd, in order to produce further broodstock fish (having viable PGCs and capable of producing gametes).

[0177] These “rescued” F1 broodstock fish are grown to a size suitable for pit-tag and fin-clip, and the specific mutations are characterized by sequencing of fin clips. Some of the fish are histologically and molecularly characterised in order to ensure that the rescue effect is successful.

Example 5

Production of Piwil1 Knockout (KO) Salmon Embryos

[0178] To elucidate the function of piwil1 in salmon, we knocked-out the piwil1 gene in salmon using CRISPR-Cas9. We detected a high mutation rate in F0 and the histology of gonads of piwil1 KO mutants was evaluated in comparison to controls. In F0, no apparent differences between controls and mutants were detected. In fact, in histological sections from immature, maturing and mature gonads from salmon piwil1 KO, no irregular phenotypes were detected. Also, at maturation in both sexes, no apparent reduction in the number of mature animals was detected for each sex: for males, 100% (n=11) of the control and 87.5% of piwil1KO (n=16); while for females 34% of piwil1KO females (n=26) and 45% of control females (n=15).

[0179] To elucidate a potential effect in the F1 generation, we intercrossed four piwil1 KO fish: 2 males and 2 females. At one year of age, we opened fish of both sexes which were either piwil1.sup.−/−, piwil1.sup.−/+ and piwil1.sup.+/+. The phenotype was evaluated with histology and genotyped with Sanger sequencing. All piwil1.sup.+/+ fish displayed normal germ cells in both sexes (FIGS. 7B and 8B). Both males and females displaying the piwil1.sup.−/− genotype were germ-cell free (FIGS. 7A and 8A).

[0180] These results indicate that piwil1 is only essential for early primordial germ cell formation in salmon, while the adult and juvenile expression of this gene is non-essential for a normal reproductive path in both sexes. The piwil1 transcript therefore represents a highly usable transcript for rescue of germ cells in Atlantic salmon as the function of this protein is only important for formation of primordial germ cells.

Example 6

Production of Broodstock Fish

[0181] To establish a piwil1 KO stable broodstock line, F0 fish are obtained following the methods given in Examples 1-2, but using piwil1 genes. Essentially, salmon zygotes are micro-injected with a gRNA which targets piwil1 and CRISPR Cas9. In contrast to dnd, it may not be necessary to rescue the salmon zygotes by the co-injection of piwil1 mRNA because the amount of maternal piwil1 mRNA in the wild-type zygotes may be sufficient on its own (without zygotic expression of piwil1) to enable to production of viable gametes.

[0182] The fish are grown to a size suitable for pit-tag and fin-clip, e.g. 10-15 g. DNA is extracted from fin clips to be able to determine whether the fish are mutated in the piwil1 gene (in the same manner as in Example 2). Fish with mutations in the piwil1 gene, mutations in the piwil1 gene+mRNA for piwil1 and control, are sampled for gonad gross morphology, histology and gene expression in ˜25 g fish.

[0183] The rescued fish are expected to be while at the same time having germ cells and expressing the germ cell marker vasa. The results demonstrate that it is possible to produce fish with germ cells from a fish with double allelic mutations in the piwil1 gene.

Example 7

Production of Farmed Fish and Further Broodstock Fish

[0184] Farmed fish and broodstock fish which have piwil1 biallelic knockouts are produced as described in Example 3, using the piwil1 gene/mRNA instead of the dnd gene/mRNA.

[0185] Salmon zygotes which have piwil1 biallelic mutations are produced as described in Example 4 using the piwil1 gene/mRNA instread of the dnd gene/mRNA.

REFERENCES

[0186] 1. Taranger G L, Karlsen O, Bannister R J, Glover K A, Husa V, Karlsbakk E, Kvamme B O, Boxaspen K K, Bjorn P A, Finstad B et al: Risk assessment of the environmental impact of Norwegian Atlantic salmon farming. Ices J Mar Sci 2015, 72(3):997-1021.

[0187] 2. Sambroni E, Abdennebi-Najar L, Remy J J, Le Gac F: Delayed sexual maturation through gonadotropin receptor vaccination in the rainbow trout Oncorhynchus mykiss. General and comparative endocrinology 2009, 164(2-3):107-116.

[0188] 3. Wong T T, Zohar Y: Production of reproductively sterile fish: A mini-review of germ cell elimination technologies. General and comparative endocrinology 2015, 221:3-8.

[0189] 4. Bedell V M, Westcot S E, Ekker S C: Lessons from morpholino-based screening in zebrafish. Briefings in functional genomics 2011, 10(4):181-188.

[0190] 5. Fjelldal P G, Hansen T: Vertebral deformities in triploid Atlantic salmon (Salmo salar L.) underyearling smolts. Aquaculture 2010, 309(1-4):131-136.

[0191] 6. Zohar Y, Munoz-Cueto J A, Elizur A, Kah O: Neuroendocrinology of reproduction in teleost fish. General and comparative endocrinology 2010, 165(3):438-455.

[0192] 7. Wargelius A, Leininger S, Skaftnesmo K O, Kleppe L, Andersson E, Taranger G L, Schulz R W, Edvardsen R B: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon. Scientific reports 2016, 6:21284.

[0193] 8. Kleppe L, Andersson E, Skaftnesmo K O, Edvardsen R B, Fjelldal P G, Norberg B, Bogerd J, Schulz R W, Wargelius A: Sex steroid production associated with puberty is absent in germ cell-free salmon. Scientific reports 2017, 7(1):12584.

[0194] 9. Kleppe L, Edvardsen R B, Furmanek T, Andersson E, Juanchich A, Wargelius A: bmp15l, figla, smc1bl, and larp6l are preferentially expressed in germ cells in Atlantic salmon (Salmo salar L.). Molecular reproduction and development 2017, 84(1):76-87.

[0195] 10. Kleppe L, Wargelius A, Johnsen H, Andersson E, Edvardsen R B: Gonad specific genes in Atlantic salmon (Salmon salar L.): characterization of tdrd7-2, dazl-2, piwil1 and tdrd1 genes. Gene 2015, 560(2):217-225.

[0196] 11. Nagasawa K, Fernandes J M, Yoshizaki G, Miwa M, Babiak I: Identification and migration of primordial germ cells in Atlantic salmon, Salmo salar: characterization of vasa, dead end, and lymphocyte antigen 75 genes. Molecular reproduction and development 2013, 80(2):118-131.

[0197] 12. Koprunner M, Thisse C, Thisse B, Raz E: A zebrafish nanos-related gene is essential for the development of primordial germ cells. Genes & development 2001, 15(21):2877-2885.

[0198] 13. Yoshizaki G, Takeuchi Y, Sakatani S, Takeuchi T: Germ cell-specific expression of green fluorescent protein in transgenic rainbow trout under control of the rainbow trout vasa-like gene promoter. The International journal of developmental biology 2000, 44(3):323-326.

[0199] 14. Zhang Y, Chen J, Cui X, Luo D, Xia H, Dai J, Zhu Z, Hu W A controllable on-off strategy for the reproductive containment of fish. Sci Rep. 2015 Jan. 5; 5:7614

[0200] 15. Noguchi T, Noguchi M. J A recessive mutation (ter) causing germ cell deficiency and a high incidence of congenital testicular teratomas in 129/Sv-ter mice. Natl Cancer Inst. 1985 August; 75(2):385-92.

[0201] 16. Youngren K K, Coveney D, Peng X, Bhattacharya C, Schmidt L S, Nickerson M L, Lamb B T, Deng J M, Behringer R R, Capel B, Rubin E M, Nadeau J H, Matin A. The Ter mutation in the dead end gene causes germ cell loss and testicular germ cell tumours. Nature. 2005 May 19; 435(7040):360-4.

[0202] 17. Northrup E, Zschemisch N H, Eisenblätter R, Glage S, Wedekind D, Cuppen E, Dorsch M, Hedrich H J. The ter mutation in the rat Dnd1 gene initiates gonadal teratomas and infertility in both genders. PLoS One. 2012; 7(5): e38001.

[0203] 18. Zechel J L, Doerner S K, Lager A, Tesar P J, Heaney J D, Nadeau J H. Contrasting effects of Deadend1 (Dnd1) gain and loss of function mutations on allelic inheritance, testicular cancer, and intestinal polyposis. BMC Genet. 2013 Jun. 17; 14:54

[0204] 19. Houwing S, Berezikov E, Ketting R F. Zili is required for germ cell differentiation and meiosis in zebrafish. EMBO J. 2008 Oct. 22; 27(20):2702-11. doi: 10.1038/emboj.2008.204. Epub 2008 Oct. 2. PMID:18833190

[0205] 20. Houwing S, Kamminga L M, Berezikov E, Cronembold D, Girard A, van den Elst H, Filippov D V, Blaser H, Raz E, Moens C B, Plasterk R H, Hannon G J, Draper B W, Ketting R F. A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in Zebrafish. Cell. 2007 Apr. 6; 129(1):69-82. PMID:17418787

[0206] 21. Bao J, Wang L, Lei J, Hu Y, Liu Y, Shen H, Yan W, Xu C. STK31(TDRD8) is dynamically regulated throughout mouse spermatogenesis and interacts with MIWI protein. Histochem Cell Biol. 2012 March; 137(3):377-89. doi: 10.1007/s00418-011-0897-9. Epub 2011 Dec. 29. PMID: 22205278

[0207] 22. Castañeda J, Genzor P, Bortvin A. piRNAs, transposon silencing, and germline genome integrity. Mutat Res. 2011 Sep. 1; 714(1-2):95-104. doi: 10.1016/j.mrfmmm.2011.05.002. Epub 2011 May 11. Review. PMID: 21600904

[0208] 23. Uniting germline and stem cells: the function of Piwi proteins and the piRNA pathway in diverse organisms.

[0209] 24. Juliano C, Wang J, Lin H. Annu Rev Genet. 2011; 45:447-69. doi: 10.1146/annurev-genet-110410-132541. Epub 2011 Sep. 19. Review. PMID: 21942366 Specific expression of Olpiwi1 and Olpiwi2 in medaka (Oryzias latipes) germ cells.

[0210] 25. Zhao H, Duan J, Cheng N, Nagahama Y. Biochem Biophys Res Commun. 2012 Feb. 24; 418(4):592-7. doi: 10.1016/j.bbrc.2011.12.062. Epub 2011 Dec. 20. PMID: 22209791

SEQUENCE LISTING FREE TEXT

[0211] <210> 1 <223> gRNA sequence