METHODS FOR DIAGNOSIS AND IN VITRO RISK STRATIFICATION FOR HEAD AND NECK CANCER BASED ON EXOSOMAL MRNAS

20230135802 · 2023-05-04

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to primers, kits, PCR assay methods and methods for in vitro and non-invasive diagnosis of HPV positive head and neck squamous cell carcinoma. The invention provides inexpensive, rapid, non-invasive and objective determination whether a person is affected with HPV positive head and neck squamous cell carcinoma. Non-requirement of trained personnel for sample collection provides a huge advantage and can lead to real-time disease monitoring.

    Claims

    1. (canceled)

    2. (canceled)

    3. A kit comprising at least one primer set for amplifying a target sequence of HPV16 exosomal mRNA in a biological sample, wherein the target sequence has a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

    4. The kit as claimed in claim 3, wherein the primer set comprises: a. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 3; b. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 4; c. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 5; d. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 6.

    5. The kit as claimed in claim 3, wherein said primer set comprises: i. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 3, ii. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 4, wherein the primer set is adapted for amplifying a target sequence of E6 gene comprising the nucleic acid sequence of SEQ ID NO: 1.

    6. The kit as claimed in claim 3, wherein said primer set comprises: i. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 5, ii. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 6, wherein the primer set is adapted for amplifying a target sequence of E6 gene comprising the nucleic acid sequence of SEQ ID NO: 2.

    7. The kit as claimed in claim 3, wherein the kit further comprises means to isolate mRNA of HPV16 in a subject, means to carry out amplification of the isolated mRNA, and means to carry out electrophoresing of amplified product and to visualize fluorescent bands under UV light.

    8. A PCR based assay for detecting the presence of E6 or E7 gene of HPV16 in an exosomal sample, said assay comprising the steps of: a. isolating mRNA from exosomal samples; b. subjecting the isolated mRNA to amplification by said PCR using primers selected from a group comprising SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, wherein said primer sequences are specific to bind to HPV16gene or fragment thereof; and c. subjecting the amplified product resulting from step (b) to electrophoresis and visualizing the fluorescent bands under UV light, for detecting the presence of said E6 or E7 gene of HPV in said biological sample.

    9. The assay as claimed in claim 8, wherein said primer set is adapted to amplify SEQ ID NO:1 and SEQ ID NO: 2.

    10. An in vitro non-invasive method of diagnosing head and neck squamous cell carcinoma in a subject, comprising: a. isolating mRNA from exosomal samples of the subject; b. amplifying, with a pair of PCR primers a target sequence of HPV16 mRNA in the exosomal sample, wherein the target sequence has a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2; c. subjecting the amplified product resulting from step (b) to electrophoresis and visualizing fluorescent bands under UV light, for detecting the presence of said E6 or E7 gene of HPV in said biological sample; d. determining the presence of head and neck squamous cell carcinoma in a subject, wherein the presence of fluorescent bands under UV light is determinative of the presence of diagnosing head and neck squamous cell carcinoma.

    11. The method as claimed in claim 10, wherein the amplification is conducted using a set of amplification primers, wherein the amplification primer set comprises: a. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 3; b. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 4; c. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 5; d. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 6.

    12. The method as claimed in claim 8, wherein the amplification of the target sequence of HPV16 mRNA in the exosomal sample is performed using semi-quantitative or quantitative PCR.

    13. The method as claimed in claim 12, wherein the steps of semi-quantitative PCR comprises: a. initial denaturation at 95° C. for 5 minutes; b. thirty-five annealing cycles, each annealing cycle comprising: i. denaturation at 95° C. for 30 seconds; ii. annealing at 60° C. for 1 minute; iii. extension at 72° C. for 1 minute; and c. a final extension at 72° C. for 5 min.

    14. The method as claimed in claim 12, wherein the steps of quantitative PCR comprises: a. initial denaturation at 95° C. for 30 seconds; b. forty annealing and extension cycles, each cycle comprising: i. denaturation at 95° C. for 15 seconds; and ii. annealing and extension at 60° C. for 1 minute.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0026] FIG. 1: FIG. 1A provides a non-limiting embodiment for the collection of exosomes from salivary samples. FIG. 1B provides a non-limiting embodiment for RNA isolation from exosomes.

    [0027] FIG. 2: Representative images of semi-quantitative PCR for E6 (108 bp) and E7 (100 bp) primers in serum. A) represents Serum E6 gene expression in HNCC patient samples and SiHa, Caski cells. B) represents Serum E7 gene expression in HNCC patient samples and SiHa, Caski cells.

    [0028] FIG. 3: Representative images of semi-quantitative PCR for E6(108 bp) and E7(100 bp) primers in saliva. A) represents Saliva E6 gene expression in HNCC patient samples and SiHa, Caski cells. B) represents Saliva E7 gene expression in HNCC patient samples and SiHa, Caski cells.

    [0029] FIG. 4: Representative images of semi-quantitative PCR for E6(108 bp) and E7(100 bp) primers in Tissue. A) represents Tissue E6 gene expression in HNCC patient samples and SiHa, Caski cells. B) represents Tissue E7 gene expression in HNCC patient samples and SiHa, Caski cells.

    [0030] FIG. 5: Expression of E6 and E7 genes during semi-quantitative PCR

    [0031] FIG. 6: Results of a semi-quantitative PCR in which the expression level of E6 and E7 genes of HPV16 in salivary exosomes and tumor tissues were compared with the expression levels of GAPDH.

    [0032] FIG. 7: Representative images of semi-quantitative PCR for E6(108 bp) and E7 (100 bp) primers in serum. A) represents Serum E6 gene expression in HNCC patient samples and SiHa, Caski cells. B) represents Serum E7 gene expression in HNCC patient samples and SiHa, Caski cells.

    [0033] FIG. 8: Representative images of semi-quantitative PCR for E6(108 bp) and E7(100 bp) primers in saliva. A) represents Saliva E6 gene expression in HNCC patient samples and SiHa, Caski cells. B) represents Saliva E7 gene expression in HNCC patient samples and SiHa, Caski cells.

    [0034] FIG. 9: Representative images of semi-quantitative PCR for E6(108 bp) and E7(100 bp) primers in Tissue. A) represents Tissue E6 gene expression in HNCC patient samples and SiHa, Caski cells. B) represents Tissue E7 gene expression in HNCC patient samples and SiHa, Caski cells.

    [0035] FIG. 10: Expression of E6 and E7 genes during quantitative PCR.

    BRIEF DESCRIPTION OF SEQUENCE LISTING

    [0036] SEQ ID NO: 1 is the coding region sequence on E6 gene which can be amplified by SEQ ID NO: 3 and SEQ ID NO: 4.

    [0037] SEQ ID NO: 2 is the coding region sequence on E7 gene which can be amplified by SEQ ID NO: 5 and SEQ ID NO: 6.

    [0038] SEQ ID NO: 3 is the forward primer of the primer set 1 (E6 primer) as used herein.

    [0039] SEQ ID NO: 4 is the reverse primer of the primer set 1 (E6 primer) as used herein.

    [0040] SEQ ID NO: 5 is the forward primer of the primer set 2 (E7 primer) as used herein.

    [0041] SEQ ID NO: 6 is the reverse primer of the primer set 2 (E7 primer) as used herein.

    [0042] SEQ ID NO: 7 and SEQ ID NO: 8 represents GAPDH forward and reverse primers.

    Definition

    [0043] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods belong. Although any method, device, kit, reagent, or a composition similar or equivalent to those described herein can also be used in the practice or testing of the methods, representative illustrative methods and compositions are now described.

    [0044] It is appreciated that certain features of the methods, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the methods and compositions, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. It is noted that, as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements or use of a “negative” limitation.

    [0045] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other embodiments without departing from the scope or spirit of the present methods. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

    [0046] In the present invention, the term “exosomes” refers to small vesicles having a membrane structure secreted from various cells. Exosomes have diameters of about 30 to 100 nm, and fusion between plasma membranes and multivesicular bodies occurs, thereby being released to the outside of the cells. As used herein, “exosomal DNA” refers to DNA isolated from exosomes of a biological sample. As used herein, “exosomal mRNA” refers to mRNA isolated from exosomes of a biological sample.

    [0047] The term “exosomal sample” may encompass both exosomal DNA and exosomal mRNA. Further, the term “exosomal sample” indicates, exosomes collected from same/different biological samples by non-invasive means. In a non-limiting embodiment, the term encompasses exosomes collected from saliva, exosomes collected from serum, a combination of exosomes collected from saliva and serum, and the like.

    [0048] As used herein, the term “about” refers to an understood variation from the stated value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to.

    [0049] The term “primer” refers to a nucleic acid capable of acting as a point of initiation of template-directed nucleic acid synthesis when placed under conditions in which polynucleotide extension is initiated (e.g., under conditions comprising the presence of requisite nucleoside triphosphates (as dictated by the template that is copied) and a polymerase in an appropriate buffer and at a suitable temperature or cycle(s) of temperatures (e.g., as in a polymerase chain reaction)). A primer is typically a single-stranded oligonucleotide, typically having a range from 6 to 40 nucleotides. As used herein, the term is used to refer to an oligonucleotide selected from a group comprising SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6.

    [0050] The term “forward primer” means a primer that anneals to the anti-sense strand of dsDNA. As used herein, the term is used to refer to an oligonucleotide selected from a group comprising SEQ ID NO: 3 and SEQ ID NO: 5.

    [0051] The term “reverse primer” means a primer that anneals to the sense strand of dsDNA. As used herein, the term is used to refer to an oligonucleotide selected from a group comprising SEQ ID NO: 4 and SEQ ID NO: 6.

    [0052] The phrase “set of primers” as used herein, refers to a composition comprising two forward primers (SEQ ID NO: 3 and SEQ ID NO: 5) and two reverse primers (SEQ ID NO: 4 and SEQ ID NO: 6) that can be used together to amplify a given region of a nucleic acid-specific to E6 or E7 gene of HPV16.

    [0053] As defined herein, “biological sample” refers to a body fluid containing cells from which exosomal mRNA can be obtained by non-invasive means. For example, the biological sample can be derived from blood, saliva, cerebral spinal fluid, sputa, urine, mucous, synovial fluid, peritoneal fluid, amniotic fluid, and the like. The biological sample can be used either directly as obtained from the source or following a pretreatment to modify the character of the sample. Thus, the biological sample can be pre-treated before use by, for example, preparing plasma or serum from blood, disrupting cells, preparing liquids from solid materials, diluting viscous fluids, filtering liquids, distilling liquids, concentrating liquids, inactivating interfering components, adding reagents, and the like.

    [0054] As used herein, the term “subject” encompasses any human being. In a non-limiting embodiment, the human subject is already diagnosed or is exhibiting symptoms indicative of head and neck squamous cell carcinoma.

    [0055] The term “sensitivity” as used herein refers to the probability that a test result will be positive when the disease is present (true positive rate).

    [0056] The term “specificity” as used herein refers to the probability that a test result will be negative when the disease is not present (true negative rate).

    [0057] The term “positive likelihood ratio” as used herein refers to the ratio between the probability of a positive test result given the presence of the disease and the probability of a positive test result given the absence of the disease, i.e. Positive likelihood ratio=True positive rate/False positive rate=Sensitivity/(1−Specificity).

    [0058] The term “negative likelihood ratio” as used herein refers to the ratio between the probability of a negative test result given the presence of the disease and the probability of a negative test result given the absence of the disease, i.e. Negative likelihood ratio=False-negative rate/True negative rate=(1−Sensitivity)/Specificity.

    [0059] The term “accuracy” as used herein refers to the overall probability that a patient is correctly classified. Accuracy=Sensitivity×Prevalence+Specificity×(1−Prevalence)

    DETAILED DESCRIPTION OF THE INVENTION

    [0060] The present invention discloses methods for predicting, diagnosing, and monitoring head and neck cancer.

    [0061] For the first time, the inventors have developed a method for in vitro diagnosis and risk stratification based on expression levels of E6 and E7 genes of HPV16 in exosomes isolated from saliva and serum.

    [0062] The present invention represents an advancement over the existing methods for the determination of HPV positive head and neck cancer. The advances are characterized by the following features: [0063] (a) Affordable: The diagnostic and risk stratification methods developed in the present invention are inexpensive as compared to existing methods as they are non-invasive and do not require the involvement of trained personnel. [0064] (b) Sensitive and Specific: The measurement of E6 and E7 mRNA levels of enables accurate and objective determination of regarding the presence/absence of clinically significant HPV positive head and neck cancer. [0065] (c) Rapid: Being non-invasive, test results can be ascertained within a short period. [0066] (d) Assessing response and recurrences: The methods of the present invention would enable assessment of response to treatment and detect early recurrence in cases of HPV positive head and neck cancers

    [0067] The technical problem to be solved in this invention is rapid, inexpensive and non-invasive prediction, diagnosis, and monitoring of HPV positive head and neck cancer.

    [0068] The inventors have solved the above problem by the development of a primer set which can determine whether a person is affected by HPV-positive head and neck cancer based on the expression levels of E6 and E7 genes of HPV16 in exosomes isolated from saliva and serum.

    [0069] The inventors have contemplated a unique approach by analyzing E6 and E7 genes of HPV16 expressed in exosomes. Based on the analysis, the inventors have designed two sets of primers, which can be utilized for identifying E6 and E7 genes of HPV16 expressed in exosomes isolated by non-invasive means. The primer sets are highly effective and reduce the time and efforts taken for the identification of head and neck squamous cell carcinoma.

    [0070] Before the methods of the present disclosure are described in greater detail, it is to be understood that the invention is not limited to particular embodiments and may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

    [0071] The present invention allows the identification and characterization of targets useful for prognosis, diagnosis and monitoring, and/or other therapeutic intervention of cancers.

    Sequence Analysis of E6 and E7 Genes of HPV16

    [0072] In HPV16, E6 and E7 proteins are known to play an important role in head and neck carcinogenesis. The E6 and E7 genes from Papillomavirus Episteme (PaVE) genome database maintained by NIAID, NIH (https://pave.niaid.nih.gov/) were studied and two target sequences (coding regions) in the E6 and E7 genes were identified for the development of the primers.

    [0073] The Human papillomavirus type 16 isolate HP_2013-128 E6 protein (E6) and E7 protein (E7) genes (complete CDS) is available under GenBank Accession Number: MH370229.1, and originally published as Pham, Trang Thi Thu, et al. “Human papillomavirus genotypes and HPV16 E6/E7 variants among patients with genital cancers in Vietnam.” Japanese journal of infectious diseases (2018): MID-2018.

    TABLE-US-00001 E6 coding region sequence  (SEO ID NO: 1) atgtttcaggacccacaggagcgacccagaaagttaccacagttatgcac agagctgcaaacaactatacatgatataatattagaatgtgtgtactgca agcaacagttactgcgacgtgaggtatatgactttgcttttcgggattta tgcatagtatatagagatgggaatccatatgctgtatgtgataaatgttt aaagttttattctaaaattagtgagtatagacattattgttatagtttgt atggaacaacattagaacagcaatacaacaaaccgttgtgtgatttgtta attaggtgtattaactgtcaaaagccactgtgtcctgaagaaaagcaaag acatctggacaaaaagcaaagattccataatataaggggtcggtggaccg gtcgatgtatgtcttgttgcagatcatcaagaacacgtagagaaacccag ctgtaa E7 Coding region sequence  (SEO ID NO: 2) atgcatggagatacacctacattgcatgaatatatgttagatttgcaacc agagacaactgatctctactgttatgagcaattaaatgacagctcagagg aggaggatgaaatagatggtccagctggacaagcagaaccggacagagcc cattacaatattgtaaccttttgttgcaagtgtgactctacgctcggttg tgcgtacaaagcacacacgtagacattcgtactttggaagacctgttaat gggcacactaggaattgtgtgccccatctgttctcagaaaccataa

    [0074] Based on the above identified coding region, two primer sets were developed for identification of E6 and E7 genes of HPV16 in exosomal mRNA isolated from saliva and serum.

    Development of Primers

    [0075] Based on the sequence analysis, the primers were designed. For designing the primer, an open-source online primer design software, NCBI primer blast software plus was used. Any designing software known to a skilled person can be used. Preferably, the software can be programmed to avoid issues arising out of sequence quality such as avoidance of repetitive elements.

    [0076] In one embodiment, two primer sets were created, and the molecular markers are selected from the primer set 1 (E6 primers) and primer set 2 (E7 primers).

    E6 Primer Set

    [0077] In one embodiment, the forward primer of the E6 primer set comprises the nucleotide sequence of SEQ ID NO:3, which is GCGACCCAGAAAGTTACCACA.

    [0078] In another embodiment, the reverse primer of the primer set 1 (E6 primer) comprises the nucleotide sequence of SEQ ID NO: 4, which is AAGTCATATACCTCACGTCGCA.

    [0079] The primer set 1 can amplify E6 coding region represented by SEQ ID NO: 1 of E6 gene of HPV16 in exosomal mRNA isolated from saliva and serum.

    [0080] The length of the product as a result of amplification by E6 primer set is 114 bp.

    E7 Primers

    [0081] In yet another embodiment, the forward primer of the primer set 2 (E7 primer) comprises the nucleotide sequence of SEQ ID NO: 5, which is CAGAACCGGACAGAGCCCATT.

    In yet another embodiment, the reverse primer of the primer set 2 (E7 primer) comprises the nucleotide sequence of SEQ ID NO: 6, which is AACAGATGGGGCACACAATTCC.

    [0082] The primer set 2 can amplify E7 coding region represented by SEQ ID NO: 2 of E7 gene of HPV16 in exosomal mRNA isolated from saliva and serum.

    [0083] The length of the product as a result of amplification by E7 primer set is 150 bp.

    [0084] Primers of the present invention can be easily synthesized using a known method. Preferably, the primers can be artificially synthesized using gene synthesis approach, a commonly used technique in synthetic biology that is used to create artificial nucleic acids. The state of the art makes it possible to prepare a completely synthetic double-stranded DNA molecule ‘de novo’ without the need for precursor template DNA. The nucleic acids synthesized through artificial gene synthesis approach is faster, economical, and less error-prone.

    Collection of Biological Samples from a Subject

    [0085] The biological samples collected for the purposes of this invention are collected through non-invasive means. The biological samples used in this invention are different from traditionally used samples, such as surgical or biopsy samples.

    [0086] In one embodiment, a biological sample is collected from a head and neck tissue sample.

    [0087] In another embodiment, the biological sample is collected in a non-invasive manner.

    [0088] In another embodiment, the biological sample is a salivary sample.

    [0089] In yet another embodiment, the biological sample is a serum sample.

    [0090] In another embodiment, the biological sample can be harvested using standard techniques known in the art.

    Isolation of Exosomes

    [0091] In a further embodiment, the exosomes are isolated from the collected biological samples.

    [0092] In another embodiment, exosomes may be isolated from the cell culture supernatant of cell lines derived from patients infected with head and neck cancer. Such cell lines may be expanded from individual cells isolated from patients infected with head and neck cancer and propagated in vitro.

    [0093] In an alternative embodiment, exosomes may be isolated from the serum or saliva of an individual infected with head and neck cancer. Techniques for the separation of exosomes from serum or saliva are known to a person skilled in the art.

    [0094] FIG. 1A provides a non-limiting embodiment for the collection of exosomes from salivary samples. In the embodiment, a saliva collection kit is used for collecting the saliva. Thereafter, exosome precipitating reagent known in the art is used for precipitating the exosome in a pellet form.

    [0095] In another embodiment, the exosomes can be isolated from any biological sample using standard techniques known in the art.

    [0096] Exosome particles may be prepared from biological samples using any suitable technique, as will be clear to those of skill in the art.

    Checking the Quality of the Isolated Exosomes

    [0097] In another embodiment, one or more biochemical assays are performed to check the quality of the isolated exosomes.

    [0098] In another embodiment, the total protein content of the isolated exosomes is checked to assess the quality of the exosomes. Total protein content may be checked using any suitable technique, as will be clear to those of skill in the art.

    [0099] In another embodiment, the lipid content of the isolated exosomes is measured to assess the quality of the exosomes. Lipid content may be checked using any suitable technique, as will be clear to those of skill in the art.

    [0100] In another embodiment, an acetylcholinesterase assay is performed on the isolated exosomes to assess the quality of the exosomes. Acetylcholinesterase assay may be performed using any suitable technique, as will be clear to those of skill in the art.

    PCR Based Assay Method for Measuring the Expression Levels of E6 and E7 Genes of HPV16 in Isolated Exosomes

    [0101] Measuring the expression level of E6 and E7 genes of HPV16 can be performed by a variety of techniques well known in the art.

    [0102] According to one embodiment of the invention, methods for measuring the levels of mRNA are provided.

    [0103] In another embodiment, mRNA is isolated from the exosomes of the biological samples.

    [0104] FIG. 1B provides a non-limiting embodiment for RNA isolation from exosomes. In the embodiment, RNA is isolated using Trizol™ reagent (Invitrogen™) following the manufacturer's recommended protocols.

    [0105] In some embodiments, the expression level is determined at the nucleic acid level. Typically, the expression level of a gene may be determined by determining the quantity of mRNA. Methods for determining the quantity of mRNA are well known in the art.

    [0106] In one embodiment, the PCR based assay for detecting the presence of E6 or E7 gene of HPV16 in an exosomal sample comprises the steps of: [0107] a. isolating mRNA from exosomal samples; [0108] b. subjecting the isolated mRNA to amplification by said PCR using primers selected from a group comprising SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, wherein said primer sequences are specific to bind to HPV16 gene or fragment thereof; and [0109] c. subjecting the amplified product resulting from step (b) to electrophoresis and visualizing the fluorescent bands under UV light, for detecting the presence of said E6 or E7 gene of HPV in the said biological sample.

    [0110] In another embodiment, the primer set used is adapted for amplifying SEQ ID NO: 1 and SEQ ID NO: 2.

    [0111] For example, the mRNA contained in biological samples such as exosomes is first extracted according to standard methods. The extracted mRNA is then detected by hybridization (e. g., Northern blot analysis, in situ hybridization) and/or amplification (e.g., RT-PCR).

    [0112] In another embodiment, other methods of amplification which include ligase chain reaction (LCR), transcription-mediated amplification (TMA), strand displacement amplification (SDA), and nucleic acid sequence-based amplification (NASBA) may be used.

    [0113] In some embodiments, the methods of the invention comprise the steps of providing total RNAs extracted from and subjecting the RNAs to amplification and hybridization to specific probes, more particularly by means of a quantitative or semi-quantitative RT-PCR.

    [0114] In a non-limiting embodiment, the steps of semi-quantitative PCR for amplifying the coding regions of E6 or E7 gene of HPV16 comprises: [0115] a. initial denaturation at 95° C. for 5 minutes; [0116] b. thirty-five annealing cycles, each annealing cycle comprising: [0117] i. denaturation at 95° C. for 30 seconds; [0118] ii. annealing at 60° C. for 1 minute; [0119] iii. extension at 72° C. for 1 minute; and [0120] c. a final extension at 72° C. for 5 min.

    [0121] In another non-limiting embodiment, the steps of semi-quantitative PCR for amplifying the coding regions of E6 or E7 gene of HPV16 comprises: [0122] a. initial denaturation at 95° C. for 30 seconds; [0123] b. forty annealing and extension cycles, each cycle comprising: [0124] i. denaturation at 95° C. for 15 seconds; and [0125] ii. annealing at 60° C. for 1 minute.

    Kits

    [0126] The present invention provides diagnostic/screening kits for use in a clinical environment. Such kits could not only include one or more sampling means but other materials necessary for the identification of E6 and E7 genes of HPV16 in exosomal samples.

    [0127] The kits can optionally include reagents required to conduct a diagnostic assay, such as buffers, salts, detection reagents, and the like. Other components, such as buffers and solutions for the isolation and/or treatment of a biological sample, may also be included in the kit. One or more of the components of the kit may be lyophilized and the kit may further comprise reagents suitable for the reconstitution of the lyophilized components.

    [0128] Where appropriate, the kit may also contain reaction vessels, mixing vessels, and other components that facilitate the preparation of the test sample. The kit may also optionally include instructions for use, which may be provided in paper form or in computer-readable forms, such as a disc, CD, DVD, or the like.

    [0129] In one embodiment of the invention, a kit for diagnosing Head and neck squamous cell carcinoma comprising means for extraction of exosomal mRNA, primers, reagents and instructions is provided.

    [0130] In another embodiment, a kit comprising at least one primer set for amplifying a target sequence of HPV16 exosomal mRNA in a biological sample, wherein the target sequence has a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

    [0131] In yet another embodiment, the kit comprises the following primer set: [0132] d. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 3; [0133] e. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 4; [0134] f. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 5; [0135] g. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 6. [0136] In another embodiment, the kit as comprises a primer set comprising: [0137] iii. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 3, [0138] iv. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 4, [0139] wherein the primer set is adapted for amplifying a target sequence of E6 gene comprising the nucleic acid sequence of SEQ ID NO: 1.

    [0140] In another embodiment, the kit as comprises a primer set comprising: [0141] i. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 5, [0142] ii. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 6, [0143] wherein the primer set is adapted for amplifying a target sequence of E6 gene comprising the nucleic acid sequence of SEQ ID NO: 2.

    [0144] In another embodiment, the kit further comprises means to isolate mRNA of HPV16, means to carry out amplification of the isolated mRNA, and means to carry out electrophoresing of amplified product and to visualize fluorescent bands under UV light.

    [0145] In another aspect of the invention there is provided a kit for diagnosing Head and neck squamous cell carcinoma, comprising means to isolate mRNA of HPV16, means to carry out amplification of the isolated mRNA, and means to carry out electrophoresing of amplified product and to visualize fluorescent bands under UV light, primers having the nucleic acid sequences recited in SEQ ID NOs: 3, 4, 5 and 6, reagents and instructions.

    In Vitro Methods for Diagnosis of HPV Positive Head and Neck Cancer

    [0146] The present invention is based on the factor that expression levels of E6 and E7 genes of HPV16 in exosomes are significantly more from the expression levels of E6 and E7 genes in other biological samples.

    [0147] Diagnosis of any clinical condition contains the following phases: (i) the examination phase, involving the collection of data; (ii) the comparison of these data with standard values (iii) the finding of any significant deviation, i.e. a symptom, during the comparison; and (iv) the attribution of the deviation to a particular clinical picture.

    [0148] Measurement of the mRNA expression levels of E6 and E7 genes from the biological samples such as exosomes provides for a sound basis to find any significant deviation from the standard values. Consequently, it can be determined whether the deviation is due to the presence of head and neck cancerous cells in the subject.

    [0149] In one embodiment, the invention provides an in vitro non-invasive method of diagnosing head and neck squamous cell carcinoma in a subject, comprising: [0150] a. isolating mRNA from exosomal samples of the subject; [0151] b. amplifying, with a pair of PCR primers a target sequence of HPV16 mRNA in the exosomal sample, wherein the target sequence has a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2; [0152] c. subjecting the amplified product resulting from step (b) to electrophoresis and visualizing fluorescent bands under UV light, for detecting the presence of said E6 or E7 gene of HPV in the said biological sample; [0153] d. determining the presence of head and neck squamous cell carcinoma in a subject, wherein the presence of fluorescent bands under UV light is determinative of the presence of diagnosing head and neck squamous cell carcinoma.

    In Vitro Risk Stratification Methods for HPV Positive Head and Neck Cancer

    [0154] The quantitative determination of exosomal mRNA levels of E6 and E7 genes can provide for means of correlating the stage of cancer with the expression levels. A correlation between the stage of cancer and the mRNA level can provide adequate means of prognosis and treatment.

    EXAMPLES

    [0155] To gain a better understanding of the invention described herein, the following examples are set forth. It will be understood that these examples are intended to describe illustrative embodiments of the invention and are not intended to limit the scope of the invention in any way.

    Example 1: Collection of Biological Samples from Subjects

    [0156] Individuals seeking consultation for newly diagnosed cases of oropharyngeal squamous cell carcinoma at Apollo Gleneagles Hospitals, Kolkata were recruited in the study with informed consent. Patient consent forms were provided in three languages English, Hindi and Telugu and were approved by the Institutional Ethical Committee (Ethical permission No. ETH/2019/001).

    [0157] Tissue sample was collected during biopsy, kept in RNA later (GCC Biotech, India Pvt. Ltd.) and stored overnight at 4° C. in the fridge. The next day the sample was moved to −80° C.

    [0158] 6 ml of whole blood was collected and allowed to clot by leaving it at room temperature. This took around 15-30 minutes. The clot was removed by centrifuging at 1000-2000×g for 10 minutes in a refrigerated centrifuge. The resulting supernatant designated as serum, was collected and stored in −80° C.

    [0159] 7.5 ml whole blood was collected, inverted 5 times to mix and incubated for 30 minutes at room temperature. The tube was centrifuged at 1000-1300×g for 15 minutes. The plasma sample was dispensed in 2 collection vials and stored at −80° C.

    [0160] Saliva was collected in a Saliva Exosome Collection and Preservation Kit (Norgen Biotek Corp., Canada, Catalogue No. 65400), mixed by gentle inversion several times to mix the saliva with the dried preservative and stored at −80° C. until the further experiment.

    [0161] Saliva samples were collected from healthy volunteers at Apollo Health City, Hyderabad, India.

    [0162] Study protocols were explained to all the individuals providing the tissue, saliva, and serum samples. Informed consent was obtained as per the Declaration of Helsinki.

    Example 2: RNA Isolation from Tissue Samples and cDNA Conversion

    [0163] RNA was isolated using TRIzol™ reagent. 1 ml of TRIzol™ reagent was added to 50 mg of tissue and homogenized using a hand homogenizer and incubated at room temperature for 5 minutes.

    [0164] Then 0.2 ml of chloroform was added, and the tube was tilted upside down for 2 seconds and incubated for 2-5 minutes. Later, the tube was centrifuged at 12,000 g for 15 minutes at 4° C. The upper aqueous phase was transferred to a new tube carefully, and ice-cold isopropanol was added to it. It was incubated for 10 minutes at room temperature.

    [0165] The tube was centrifuged at 12,000 g for 15 minutes at 4° C. The supernatant was discarded carefully without disturbing the pellet using a pipette. 1 ml of 75% ethanol was added, briefly the tube vortexed and centrifuged at 7,500 g for 5 minutes at 4° C. The supernatant was discarded carefully with a pipette and the RNA pellet was air-dried for 10 minutes.

    [0166] The RNA pellet was re-suspended in 50 μl of RNase free water. The RNA was converted to cDNA on the same day of isolation with iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc., US) using the manufacturer's protocol. RNA was quantified using μCuvette Spectrophotometer (ThermoFisher Scientific, US). One μg of RNA was used for cDNA conversion. One μg of total RNA from each experimental sample was mixed with 4 μl of 5×iScript Reaction Mix and 1 μl of iScript Reverse Transcriptase and made up to 20 μl with RNase free water.

    [0167] The components were mixed with a short spin in a centrifuge and kept in a thermal cycler with the following running conditions: 5 min at 25° C. (priming), 20 min at 46° C. (reverse transcription) and 1 min at 95° C. (reverse transcriptase inactivation). The cDNA was stored in −20° C. until further analysis.

    Example 3: Total Exosome Isolation from Serum Samples

    [0168] Exosomes were isolated from serum samples using Total Exosome Isolation Reagent (Invitrogen Corporation, US). The 500 μl of the frozen serum sample was thawed on ice and centrifuged at 2000×g for 30 min at room temperature. The supernatant was transferred to another tube, mixed with 100 μl of Total Exosome Isolation Reagent and vortexed. The tube was incubated at 4° C. for 30 minutes and was then centrifuged at 10,000×g for 10 minutes. The supernatant was aspirated and discarded without disturbing the pellet. The pellet was then resuspended in 200 μl of PBS. The exosomes were stored in −20° C. until further processing.

    Example 4: RNA Isolation from Exosomes and Preparation of cDNA

    [0169] RNA was isolated from the experimental samples using Exiqon miRCURY™ exosome isolation kit for cells, urine and CSF (Qiagen Aarhus A/S, Denmark). Two hundred microlitres of the exosome suspension was mixed with 350 μl of lysis solution and vortexed for 15 sec. Two hundred microlitres of 100% ethanol were then added and the mixture was vortexed for 10 sec.

    [0170] The mixture was then added to a fresh spin column and centrifuged at 14,000×g for 1 min. The column was then transferred to another collection tube. The column was then washed thrice by the addition of 400 μl of wash solution and centrifugation at 14,000×g for 1 min. After transferring to a new collection tube, the spin column was centrifuged at 14,000×g for 2 min for drying before finally transferring onto an elution tube.

    [0171] The RNA was eluted with 50 μl of elution buffer by centrifugation at 200×g for 2 min and 14,000×g for 1 min. The RNA was converted to cDNA on the same day of isolation with iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc., US) using the manufacturer's protocol. RNA was quantified using μCuvette Spectrophotometer (ThermoFisher Scientific, US).

    [0172] As exosomes contain a meagre amount of RNA, 15 μl of total RNA from each experimental sample was mixed with 4 μl of 5×iScript Reaction Mix and 1 μl of iScript Reverse Transcriptase. The components were mixed with a short spin in a centrifuge and kept in a thermal cycler with the following running conditions: 5 min at 25° C. (priming), 20 min at 46° C. (reverse transcription) and 1 min at 95° C. (reverse transcriptase inactivation). The cDNA was stored in −20° C. until further analysis.

    Example 5: Primer Design and Kit

    [0173] Based on the sequence analysis, the primers were designed. For designing the primer, an open-source online primer design software, NCBI primer blast software plus was used. Any designing software known to a skilled person can be used. Preferably, the software can be programmed to avoid issues arising out of sequence quality such as avoidance of repetitive elements.

    [0174] Two primer sets were created, and the molecular markers are selected from the primer set 1 (E6 primers) and primer set 2 (E7 primers).

    [0175] GAPDH serves as a prognostic marker in many cancer types including head and neck cancer. Therefore, expression of GAPDH provides evidence as to the presence of malignancy.

    TABLE-US-00002 Gene Forward 5′-3′ Reverse 3′-5′ HPV16 CAGGAGCGACCCAGAAAGTT GCAGTAACTGTTGCTTGCAGT E6 (SEQ ID NO: 3) (SEQ ID NO: 4) HPV16 GATGAAATAGATGGTCCAGC GCTTTGTACGCACAACCGAAGC E7 (SEQ ID NO: 5) (SEQ ID NO: 6) GAPD TCACCATCTTCCAGGAGCGA GCAGGAGGCATTGCTGATGATC H GA TT (SEQ ID NO: 7) (SEQ ID NO: 8)
    A kit was prepared comprising the following primer set: [0176] a. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 3; [0177] b. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 4; [0178] c. a forward primer comprising the nucleic acid sequence of SEQ ID NO: 5; [0179] d. a reverse primer comprising the nucleic acid sequence of SEQ ID NO: 6.

    Example 6: Semi-Quantitative PCR

    [0180] A semi-quantitative PCR was performed in which the expression level of E6 and E7 genes of HPV16 in salivary exosomes and tumor tissues were studied.

    [0181] E6/E7 expression was studied in CaSki cell line. CaSki cell line was established from metastasis in the small bowel mesentery. The cells contain an integrated human papillomavirus type 16 genome (HPV-16) at about 600 copies per cell as well as sequences related to HPV-18.

    [0182] cDNA was 1:5 diluted with RNase free water and one microliter of this diluted product was added into PCR tubes. Semi-quantitative PCR was done using EmeraldAmp® GT PCR Master Mix (TAKARA BIO INC.) using the manufacturer's protocol.

    [0183] PCR master mix was prepared so that each 9 μl of the master mix contained 5 μl of 2×EmeraldAmp® GT PCR Master Mix, 0.2 μl of 500 nM each forward and reverse primers and 3.8 μl of RNase-free water.

    [0184] The components of the master mix were shortly spun in a centrifuge and nine μl of the master mix was added to the PCR tubes. No template control (NTC) with 1 μl of DNase-free water instead of cDNA for detecting any DNA contamination.

    [0185] Semi-quantitative PCR was done in Eppendorf thermocycler with the 3 step temperature cycles.

    [0186] Initial denaturation at 95° C. for 5 mins followed by the three steps of the annealing cycling conditions which were repeated for 35 cycles: [0187] (i) 30 sec at 95° C. (denaturation) [0188] (ii) 1 minute at 60° C. (annealing temperature of the primer); and [0189] (iii) 1 minute at 72° C. (extension) followed by a final extension at 72° C. for 5 minutes.

    [0190] Five μl of the PCR template is run on gel with a 50 Kb ladder to identify the bands against controls. Proper controls (SiHa, Caski) were run along with patient samples.

    [0191] The results of semi quantitative PCR are provided in FIGS. 2-6.

    Example 7: Quantitative PCR

    [0192] In order to validate the assay, E6 and E7 genes of HPV16 in exosomes samples were amplified using quantitative PCR.

    [0193] E6/E7 expression was studied in CaSki cell line. CaSki cell line was established from metastasis in the small bowel mesentery. The cells contain an integrated human papillomavirus type 16 genome (HPV-16) at about 600 copies per cell as well as sequences related to HPV-18.

    [0194] One micro liter of the 1:5 diluted cDNA was added into the 96-well PCR plate (ThermoFisher Scientific, US). Quantitative PCR was done using iTaq™ Universal SYBR® Green supermix (Bio-Rad Laboratories, Inc., US) using the manufacturer's protocol. PCR master mix was prepared so that so that each 9 μl of the master mix contained 5 μl of 2×iTaq™ Universal SYBR® Green Supermix, 0.2 μl of 500 nM each forward and reverse primers and 3.8 μl of DNase-free water.

    [0195] The components of the master mix were shortly spun in a centrifuge and 9 μl of the master mix was added to the 96-well PCR plate. No template control (NTC) with 1 μl of DNase-free water instead of cDNA was used for detecting DNA contamination. Quantitative PCR was done in Applied Biosystems™ 7500 Real-Time PCR System (ThermoFisher Scientific, US) with the holding stage of 30 sec at 95° C.

    [0196] The two steps of the cycling conditions were repeated for 40 cycles: [0197] (i) denaturation at 15 sec at 95° C.; [0198] (ii) annealing and extension at 60° C. for 1 minute (annealing temperature of the primer).

    [0199] The melting curve stage had the following conditions: 15 sec at 95° C., 1 min at 60° C., 30 sec at 95° C. and 15 sec at 60° C.

    [0200] The results of quantitative PCR are provided in FIGS. 7-10.

    Example 8: Sensitivity and Specificity of the PCR Assays

    [0201] The results were compared with paraffin embedded tissue specimens undergoing HPV In Situ Hybridization (ISH) and p16 Immunohistochemistry (p16 IHC) examination to detect the HPV status. The mean interval between the collection of specimens and histologic diagnosis was 2 months. The results were statistically analysed. The total number of samples collected and analyzed were 33.

    [0202] The diagnostic accuracy between several sample groups, as provided below were assessed: [0203] p16 IHC and Tissue E6 [0204] p16 IHC and Tissue E7 [0205] Tissue E6 and Saliva exosome E6 [0206] Tissue E6 and Serum exosome E6 [0207] Tissue E7 and Saliva exosome E7 [0208] Tissue E7 and Serum exosome E7 [0209] Tissue E6 and combination of Saliva+Serum exosome E6 [0210] Tissue E7 and combination of Saliva+Serum exosome E7

    [0211] The optimal sensitivity of the assays was found to be 66.67% with an optimal 95% Confidence Interval (CI) at 99.16%. The optimal specificity of the assay was found to be 86.67% with an optimal 95% CI at 96.24%. The optimal positive likelihood ratio was 4.0 and optimal negative likelihood ratio was 0.40. The optimal accuracy was found to be 81.82%.

    [0212] It was noted that exosomal samples containing the combination of exosomes from saliva and serum provides optimal sensitivity and specificity.