MODIFIED MRNAS FOR VACCINE DEVELOPMENT

Abstract

A modified messenger RNA (mRNA) of the present invention encodes within its ORF an antigen such as a viral protein, an immunogenically active part of such viral protein, or an anticancer protein or epitope, and contains at least one of an alkyne- or azide-modification in at least one nucleotide. A preferred viral protein encoded by the inventive mRNA is a Corona vims protein, especially nucleoprotein N of SARS-CoV-2. The modified mRNA or a pharmaceutical composition containing such mRNA is especially useful in the context of a method for vaccination against viral infection and adding an adjuvant like a STING antagonist further enhances the immune response in an individual and accordingly the vaccination efficiency.

Claims

1. Modified messenger RNA (mRNA) which encodes within its ORF an antigen such as a viral protein, an immunogenically active part of such viral protein or an anticancer protein or epitope characterized in that it contains at least one of an alkyne- or azide-modification in at least one nucleotide, and wherein the modified mRNA contains at least one functional molecule introduced via a click reaction of the modified mRNA with a correspondingly modified alkyne- or azide-containing functional molecule, which functional molecule is a cell-specific targeting group or ligand, which targets immune competent cells, in particular MHC1 peptide presenting cells.

2. Modified mRNA according to claim 1, wherein the viral protein is a Corona virus protein, preferably a Corona virus nucleoprotein, most preferably one or both of nucleoproteins N and envelope protein E of SARS-CoV-2.

3. Modified mRNA according to claim 1 or 2, comprising a 5′-cap structure, a 5′-untranslated region (5′-UTR), an open reading frame region (ORF), a 3′-untranslated region (3′-UTR) and a poly(A) tail region, characterized in that it contains at least one of an alkyne- or azide-modification in at least one nucleotide within at least one of the ORF, the 5′-UTR, the 3′-UTR and the poly(A) tail region.

4. Modified mRNA according to anyone of claims 1 to 3, characterized in that it contains modified nucleotides in a) the ORF and the UTRs, b) the ORF, the UTRs and the poly(A) tail, or c) only the poly(A) tail.

5. Modified mRNA according to anyone of claims 1 to 4, wherein at least one of the four standard types of nucleotides (AMP, CMP, GMP, UMP) are partly or completely modified, e.g. ethynyl-, ethenyl, tetrazine- or azido-modified at uracil or adenine, preferably ethynyl- or azido-modified at uracil or adenine.

6. Modified mRNA according to anyone of claims 1 to 5, wherein at least one nucleotide is alkyne-modified and at least one nucleotide is azide-modified.

7. Modified mRNA according to any one of the preceding claims, wherein at least one of the four standard types of nucleotides is present in modified form compared to the non-modified form in a ratio of 1:100 to 10:1, preferably 1:10 to 1:10 or 1:1.

8. Modified mRNA according to any one of the preceding claims, characterized in that it contains otherwise modified natural or artificial nucleotides, preferably ethenyl-uridine, pseudouridine or N1-methylpseudouridine.

9. Modified mRNA according to any one of the preceding claims, wherein the modified mRNA contains further functional molecule(s) introduced via a click reaction of the modified mRNA with a correspondingly modified alkyne- or azide-containing functional molecule(s).

10. Modified mRNA according to claim 9, wherein the further functional molecule is a substance, which increases the half-life of the mRNA, enhances expression of the mRNA, or acts as an adjuvant.

11. Modified mRNA according to anyone of claims 1 to 10, wherein the functional molecule is a sugar moiety, a fatty acid moiety, a cell-type specific antibody or fragment of such antibody, especially an anti-CD20 or anti-CD19 antibody or antibody fragment.

12. Modified mRNA according to claim 11, wherein the sugar moiety includes mannose and/or N-acetyl galactosamine.

13. Modified mRNA according to anyone of claims 1 to 12, wherein the functional molecule comprises linker molecules comprising one or more attached sugar moieties.

14. Modified mRNA according to anyone of claims 1 to 13, wherein the functional molecules targets MHC1 peptide presenting cells, lymphocytes or mast cells.

15. Modified RNA containing at least one alkyne- or azide-modification in at least one nucleotide or modified mRNA according to anyone of claims 1 to 14, which is complexed with a cationic or polycationic compound.

16. Process for the production of the modified mRNA according to any one of the preceding claims, wherein the process comprises in vitro transcribing mRNA from a DNA template or alternatively performing a fermentation process using prokaryotic or eukaryotic host cells to express a DNA template contained in an expression vector wherein the process is performed in the presence of an RNA polymerase and a nucleotide mixture containing the four standard types of nucleotides required for mRNA transcription, in which nucleotide mixture at least a part of at least one of the four types of nucleotides is modified to contain an alkyne- or azide-modification.

17. Process for the production of a modified mRNA containing an alkyne- or an azide-modification at the poly(A) tail, wherein the process comprises performing a poly(A) polymerase addition reaction at the poly(A) tail on an mRNA in the presence of ATP, wherein ATP is at least partly alkyne- or azide-modified at the adenosine.

18. Process according to claim 16 or 17, further comprising adding one or more correspondingly alkyne- or azide-modified functional molecule(s) under conditions to perform a click reaction to produce a modified mRNA according to anyone of claims 9 to 13.

19. Pharmaceutical composition, comprising a modified mRNA according to anyone of claims 1 to 15 as an active agent, optionally in combination with a pharmaceutically acceptable adjuvant or excipient and/or contained in pharmaceutically acceptable carrier.

20. Pharmaceutical composition according to claim 19, wherein the adjuvant is a STING receptor agonist.

21. Modified mRNA according to anyone of claims 1 to 5 or a pharmaceutical composition according to claim 19 or 20 for use in mRNA based therapeutic and/or prophylactic applications.

22. Modified mRNA according to anyone of claims 1 to 15 or pharmaceutical composition according to claim 19 or 20, for use in therapeutic and/or prophylactic application according to claim 21, wherein the therapeutic and/or prophylactic application comprises vaccination against viral infection, especially against Corona virus infection, and most preferably against SARS-CoV-2 infection.

23. Modified mRNA according to anyone of claims 1 to 15 or pharmaceutical composition according to claim 19 or 20, for use in prophylactic application according to claim 21 in a human or an animal.

24. A kit for production and/or delivery of a modified mRNA according to anyone of claims 1 to 15.

25. Method for vaccination of an individual against viral infection, especially against Corona virus infection, and most preferably against SARS-CoV-2 infection, which method comprises administering to such individual an effective amount of a modified mRNA according to anyone of claims 1 to 15 or of a pharmaceutical composition according claim 19 or 20.

Description

[0109] The figures and the following examples further illustrate the invention:

[0110] FIG. 1A shows a depiction from A. Wadhwa et al., Pharmaceutics 2020, 12(2), representing the guiding principle behind mRNA therapy which is based on providing in vitro-transcribed mRNA as a carrier of genetic information and delivered by lipid nano particle (LNP), thus allowing the organism to develop its own cure. In vaccination, mRNA which codes for a specific antigen is used to generate an immune response.

[0111] FIG. 1B depicts the non-LNP targeted vaccine via modified mRNA.

[0112] FIG. 2 is a schematic representation of a Corona Virus SARS-CoV particle (taken from Peiris et al., 2003).

[0113] FIG. 3 is a schematic representation of modified vaccine mRNA.

[0114] FIGS. 4A and 4B show the structures of the transfecting agents (sugar-click-linkers).

[0115] FIG. 5 shows the structure of mannose- and GalNAc-click-linkers and their production.

[0116] FIG. 6 shows further mannose-click-linkers and their production.

[0117] FIG. 7 shows the development of the mRNA vaccine.

[0118] FIGS. 8A and 8B show maps of the plasmid PstiA-120 containing the sequences of the nucleocapsid protein or the envelope protein of the SARS-CoV-2.

[0119] FIG. 9 shows an agarose gel for the analysis of the plasmids and mRNAs of the Envelope (E) and Nucleocapsid (N) protein. Lane 2-4: linearized pStiA120 containing N-E and YFP as ctrl. Lane 5-6: mRNA of N-gene. Lane 7-8: mRNA of E gene. Lane 9-10: mRNA of YFP ctrl.

[0120] FIG. 10 shows HPL chromatograms of A) Azide modified mRNA. B) Compound 1. C) click product after 3 h incubation at room temperature.

EXAMPLE 1: PREPARATION OF PLASMIDS ENCODING N AND E PROTEIN OF SARS-CoV-2

[0121] The coding sequences of the Nucleocapsid (N) and Envelope (E) proteins of the novel Coronavirus, SARS-CoV-2, (NCBI GenBank: MN908947.3, Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome https://www.ncbi.nlm.nih.gov/nuccore/MN908947) were introduced into a vector for the production of the corresponding mRNAs. The vector PstIA-120, already used before (S. Croce et. al., ChemBioChem 2020, 21), was modified by replacing the enhanced green fluorescent protein (eGFP) open reading frame (ORF) with the N and E ORF of SARS-CoV-2 using the Gybosn assembly master mix (New England Biolabs) following the manufacturer's instructions. The sequences of N, E and the 4 primers necessary for the Gybson assembly were ordered from Eurofins Genomics (Table 1).

[0122] About 100 ng of the obtained two plasmids (E and N) were transformed into 5-alpha Escherichia coli cells (NEB) according to manufacturer's recommendations and then used to inoculate 20 mL LB medium (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl) containing 50 μg/mL kanamycin as a selection marker. The plasmids were then isolated using the plasmid plus midi purification kit (Qiagen) according to manufacturer's instructions. The obtained two plasmids were then sequenced by Sanger sequencing (Eurofins) and the eventual mutations corrected via direct site mutagenesis following the manufacture instruction of Q5 site direct mutagenesis kit. One mutation in the E plasmid and three mutation in the N plasmid were corrected using the primer reported in Table 2.

[0123] The obtained plasmids where then linearized using BspQ1 restriction enzyme (NEB) according to manufacturer's recommendations. This results in a linear DNA template that ends directly after the poly A tail encoding sequence. Purity of the DNA template was assessed by nanophotometer measurement (A260/A280 ratio) and agarose gel electrophoresis.

TABLE-US-00001 TABLE 1 Sequence of the primers used for the Gybosn assembly primer 1 TTCGCCCTATAGTGAGTCGTATTAATTAATAAC plasmid (SEQ ID NO. 1) amplification primer 2 TCGAATTGATCCAGATCTTAAGTAAGTAAGC plasmid (SEQ ID NO. 2) amplification Nucleocapside CGACTCACTATAGGGCGAACTAGTAAGCAAGGAG primer 1 GCGT (SEQ ID NO. 3) Nucleocapside ACTTAAGATCTGGATCAATTCGATTAGGCCTGAG primer 2 TTGAGTCAG (SEQ ID NO. 4) Envelope primer CGACTCACTATAGGGCGAACTAGTAAGCAAGGAG 1 GCG (SEQ ID NO. 5) Envelope primer ACTTAAGATCTGGATCAATTCGATTAGACCAGAA 2 GATCAGGAACT (SEQ ID NO. 6) Nucleocapside ORF CTAGTAAGCAAGGAGGCGTGCAGATGTCTGATAATGGACCCCAAAAT CAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAAC TGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAAC GTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTC TCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGC GTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTAC CGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGA TCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGC TGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAAC TGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATC CTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACAT TGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGC CTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAAC TCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATG GCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAG CTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAAC TGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAA ACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACG TGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCA GACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCC CCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTC ACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGA TGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCAT ATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAA AAGAAGAAGGCTGATGAAACTCAGCCTTACCGCAGAGACAGAAGAAA CAGCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCC AAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCTAA (SEQ ID NO. 7) Envelope ORF CTAGTAAGCAAGGAGGCGTGCAGATGTACTCATTCGTTTCGGAAGAG ACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGG TATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTG CGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTA CGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTT CTGGTCTAA (SEQ ID NO. 8)

TABLE-US-00002 TABLE 2 Sequences of the primers used for the site directed mutagenesis. Envelope Sdm 1 Fwd CAGTACGCACACAATCGA (SEQ ID NO. 9) Envelope Sdm 1 Rev CTGCAATATTGTTAACGTGAG (SEQ ID NO. 10) Nucleocapsid 1 Fwd AGGTAGTAGAAATACCATCTTGC (SEQ ID NO. 11) Nucleocapsid 1 Rev AGGAACTGGGCCAGAAG (SEQ ID NO. 12) Nucleocapsid 2 Fwd TGAGTTTCATCAGCCTTCTT (SEQ ID NO. 13) Nucleocapsid 2 Rev AGCCTTACCGCAGAGAC (SEQ ID NO. 14) Nucleocapsid 3 Fwd TACCGACGAGCTACCAGACGA (SEQ ID NO. 15) Nucleocapsid 3 Rev GTAGCCAATTTGGTCATCTGGACT (SEQ ID NO. 16)

EXAMPLE 2: PRODUCTION OF MRNA ENCODING PROTEINS N AND E

[0124] mRNA production was performed by in vitro transcription from the linear version of the plasmids obtained in Example 1, using T7 RNA polymerase.

[0125] In a 50 μL final reaction volume 20 units of T7 RNA polymerase (THERMO FISHER), 1 μg of linear template DNA and several nucleotides were combined in transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl.sub.2, 4 mM spermidine, 10 mM DTT).

TABLE-US-00003 TABLE 3 Final concentrations of nucleotide mixtures used for the production of (modified) mRNAs. ARCA c ATP c CTP c GTP c UTP c □UTP c [mM] [mM] [mM] [mM] [mM] [mM] 4.00 1.50 1.25 1.00 1.25 1.25

[0126] Transcription reactions were incubated for 2 hours at 37° C. and then 2 units of DNAse I (THERMO FISHER) were added and incubated for 15 minutes at 37° C. to digest the DNA template and make its removal easier. The mRNA was purified by a spin column method according to manufacturer's instruction (QIAGEN).

[0127] Out of 1 μg of plasmid, about 12 μg of mRNA are produced.

[0128] The mRNAs are composed of the 5′ untranslated region (UTR) with the ribosome binding site (rbs), the open reading frame (ORF) of the proteins, a 3′ UTR consisting of two repetitive sequences of the human beta globulin 3′ UTR and a poly(A) tail. The N mRNA is composed of 1730 nt, the E mRNA of 700 nt. After purification using spin column methods (Quiagen), the quality of the mRNA is subsequently determined by nanodrop and agarose gel analysis. The results are shown in FIG. 9.

EXAMPLE 3: 3′ AZIDE LABELLING AND MANNOSE MODIFICATION OF MRNA

[0129] In a 25 μL reaction volume 600 units of yeast poly(A) polymerase, 10 μg of mRNA and 3′-Azido-2′,3″-ddATP (0.5 mM final concentration) were combined in reaction buffer (20 mM Tris-HCl, pH 7.0, 0.6 mM MnCl.sub.2, 20 μM EDTA, 200 μM DTT, 10 μg/mL acetylated BSA, 10% glycerol). The mixture was incubated for 20 minutes at 37° C. mRNA was purified by a spin column method according to manufacturer's instruction (Qiagen).

Mannose Based Transfection Agent Synthesis

[0130] ##STR00001##

[0131] Compound 1. 4-Aminophenyl-3,6-di-O-(α-D-mannopyranosyl)-α-D-mannopyra-noside (10 mg, 16.8 μmol, 1 eq) was dissolved in 100 μL of DMF. DBCO-PEG5-NHS (23.3 mg, 33.6 μmol, 2 eq) and Et.sub.3N (7 μL, 50.7 μmol, 3 eq) were added and the solution was stirred at room temperature for 1 h. The solvent was removed in vacuo and the crude material was purified by reversed phase preparative HPLC to afford 1 in 35% yield (7 mg, 5.96 μmol).

Model System for the SPAAC

[0132] In order to prove the efficiency of the Strain promoted Azide-Alkyne cycloaddition a short RNA oligonucleotide (31 mer) containing a 5′ azide was used as model template. 4 μg of RNA oligo and 2 nmol of compound 1 were combined in a total reaction volume of 30 μL and incubated at room temperature for 3 h and the resulting products were analysed by HPLC (FIG. 10).

Production of mRNA Vaccine by SPAAC

[0133] When click labeling was performed, 10 μg of purified azide mRNA, 2 nmol Compound 1, were combined in a total reaction volume of 30 μL. The reaction mixture was incubated at room temperature overnight and then cleaned using a spin column method according to manufacturer's instruction (Qiagen).

[0134] FIG. 10 shows the HPL Chromatograms of the SpAAC modification reaction. In part A, the higher peak represents azide modified mRNA, the smaller peak represents the unmodified oligonucleotide. The peak in part B represents the DBCO 3-mannose structure and part C shows the unreacted oligonucleotide, the clicked product after 2 hours incubation at room temperature and residual DBCO 3-mannose structure. The HPLC chromatograms show more than 95% conversion.

[0135] The following items are also disclosed herein:

[0136] Item 1:

[0137] Modified messenger RNA (mRNA) which encodes within its ORF an antigen such as a viral protein, an immunogenically active part of such viral protein or an anticancer protein or epitope characterized in that it contains at least one of an alkyne- or azide-modification in at least one nucleotide.

[0138] Item 2:

[0139] Modified mRNA according to item 1, wherein the viral protein is a Corona virus protein, preferably a Corona virus nucleoprotein, most preferably one or both of nucleoproteins N and envelope protein E of SARS-CoV-2.

[0140] Item 3:

[0141] Modified mRNA according to items 1 or 2, comprising a 5′-cap structure, a 5′-untranslated region (5′-UTR), an open reading frame region (ORF), a 3′-untranslated region (3′-UTR) and a poly(A) tail region, characterized in that it contains at least one of an alkyne- or azide-modification in at least one nucleotide within at least one of the ORF, the 5′-UTR, the 3′-UTR and the poly(A) tail region.

[0142] Item 4:

[0143] Modified mRNA according to anyone of items 1 to 3, characterized in that it contains modified nucleotides in

a) the ORF and the UTRs,

[0144] b) the ORF, the UTRs and the poly(A) tail, or
c) only the poly(A) tail.

[0145] Item 5:

[0146] Modified mRNA according to anyone of items 1 to 4, wherein at least one of the four standard types of nucleotides (AMP, CMP, GMP, UMP) are partly or completely modified, preferably ethynyl- or azido-modified at uracil or adenine.

[0147] Item 6:

[0148] Modified mRNA according to anyone of items 1 to 5, wherein at least one nucleotide is alkyne-modified and at least one nucleotide is azide-modified.

[0149] Item 7:

[0150] Modified mRNA according to any one of the preceding items, wherein at least one of the four standard types of nucleotides is present in modified form compared to the non-modified form in a ratio of 1:100 to 10:1, preferably 1:10 to 1:10 or 1:1.

[0151] Item 8:

[0152] Modified mRNA according to any one of the preceding items, characterized in that it contains otherwise modified natural or artificial nucleotides, preferably pseudouridine or N1-methylpseudouridine.

[0153] Item 9:

[0154] Modified mRNA according to any one of the preceding items, wherein the modified mRNA contains functional molecule(s) introduced via a click reaction of the modified mRNA with a correspondingly modified alkyne- or azide-containing functional molecule(s).

[0155] Item 10:

[0156] Modified mRNA according to item 9, wherein the functional molecule is a substance, which increases the half-life of the mRNA, enhances expression of the mRNA, acts as an adjuvant or is a cell-specific targeting group or ligand.

[0157] Item 11:

[0158] Modified mRNA according to items 9 or 10, wherein the functional molecule is a sugar moiety, a fatty acid moiety, a cell-type specific antibody or fragment of such antibody, especially an anti-CD20 or anti-CD19 antibody or antibody fragment.

[0159] Item 12:

[0160] Modified mRNA according to item 11, wherein the sugar moiety includes mannose and/or N-acetyl galactosamine.

[0161] Item 13:

[0162] Modified mRNA according to anyone of items 9 to 12, wherein the functional molecule comprises linker molecules comprising one or more attached sugar moieties.

[0163] Item 14:

[0164] Modified mRNA according item anyone of items 9 to 13, wherein the functional molecules target lymphocytes, in particular MHC1 peptide presenting cells, such as mast cells.

[0165] Item 15:

[0166] Modified RNA containing at least one alkyne- or azide-modification in at least one nucleotide or modified mRNA according to anyone of items 1 to 14, which is complexed with a cationic or polycationic compound.

[0167] Item 16:

[0168] Process for the production of the modified mRNA according to any one of the preceding items, wherein the process comprises in vitro transcribing mRNA from a DNA template or alternatively performing a fermentation process using prokaryotic or eukaryotic host cells to express a DNA template contained in an expression vector wherein the process is performed in the presence of an RNA polymerase and a nucleotide mixture containing the four standard types of nucleotides required for mRNA transcription, in which nucleotide mixture at least a part of at least one of the four types of nucleotides is modified to contain an alkyne- or azide-modification.

[0169] Item 17:

[0170] Process for the production of a modified mRNA containing an alkyne- or an azide-modification at the poly(A) tail, wherein the process comprises performing a poly(A) polymerase addition reaction at the poly(A) tail on an mRNA in the presence of ATP, wherein ATP is at least partly alkyne- or azide-modified at the adenosine.

[0171] Item 18:

[0172] Process according to items 16 or 17, further comprising adding one or more correspondingly alkyne- or azide-modified functional molecule(s) under conditions to perform a click reaction to produce a modified mRNA according to anyone of items 9 to 13.

[0173] Item 19:

[0174] Pharmaceutical composition, comprising a modified mRNA according to anyone of items 1 to 15 as an active agent, optionally in combination with a pharmaceutically acceptable adjuvant or excipient and/or contained in pharmaceutically acceptable carrier.

[0175] Item 20:

[0176] Pharmaceutical composition according to item 19, wherein the adjuvant is a STING receptor agonist.

[0177] Item 21:

[0178] Modified mRNA according to anyone of items 1 to 5 or a pharmaceutical composition according to item 19 or 20 for use in mRNA based therapeutic and/or prophylactic applications.

[0179] Item 22:

[0180] Modified mRNA according to anyone of items 1 to 15 or pharmaceutical composition according to item 19 or 20, for use in therapeutic and/or prophylactic application according to item 21, wherein the therapeutic and/or prophylactic application comprises vaccination against viral infection, especially against Corona virus infection, and most preferably against SARS-CoV-2 infection.

[0181] Item 23:

[0182] Modified mRNA according to anyone of items 1 to 15 or pharmaceutical composition according to item 19 or 20, for use in prophylactic application according to item 21 in a human or an animal.

[0183] Item 24:

[0184] A kit for production and/or delivery of a modified mRNA according to anyone of items 1 to 15.

[0185] Item 25:

[0186] Method for vaccination of an individual against viral infection, especially against Corona virus infection, and most preferably against SARS-CoV-2 infection, which method comprises administering to such individual an effective amount of a modified mRNA according to anyone of items 1 to 15 or of a pharmaceutical composition according item 19 or 20.