USE OF EPHB4 AS A TARGET IN SCREENING DRUGS OR MODELS FOR INCREASING INSULIN SENSITIVITY
20230132526 · 2023-05-04
Assignee
Inventors
- Pingping LI (Beijing, CN)
- Xingfeng LIU (Beijing, CN)
- Bing CIU (Beijing, CN)
- Kai Wang (Beijing, CN)
- Jingwen CHEN (Beijing, CN)
- Shaocong HOU (Beijing, CN)
- Lijuan KONG (Beijing, CN)
- Qian JIANG (Beijing, CN)
- Chunxiao MA (Beijing, CN)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
A01K67/0275
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
C12N2740/16043
CHEMISTRY; METALLURGY
A61K49/0008
HUMAN NECESSITIES
C12N2800/80
CHEMISTRY; METALLURGY
G01N33/566
PHYSICS
C12N15/11
CHEMISTRY; METALLURGY
C07K14/00
CHEMISTRY; METALLURGY
A01K2267/0362
HUMAN NECESSITIES
A61P5/50
HUMAN NECESSITIES
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
The present invention belongs to the technical field of protein and genetic engineering, and specifically discloses use of an erythropoietin human hepatocyte receptor B4 as a target in screening and preparing a biological formulation or medicament for increasing sensitivity to insulin. Also disclosed is use of an erythropoietin human hepatocyte receptor B4 in preparing an insulin-sensitized mouse model. On the basis of insulin signal regulation, a protein EphB4 capable of interacting with an insulin receptor (InsR) is found. The protein can interact with InsR, and insulin stimulation can promote the interaction between the two, which provides a basis for insulin resistance in the case of hyperinsulinaemia. Over-expression of EphB4 can promote degradation of InsR. Inhibition of EphB4 can enhance the sensitivity to insulin and improve insulin resistance.
Claims
1. A method for screening or preparation of a biological agent or a drug for increasing insulin sensitivity, wherein erythropoietin-producing hepatocyte receptor B4 is used as a target.
2. The method according to claim 1, wherein said biological agent or drug is used for preventing, alleviating or treating insulin resistance or a disease related to insulin resistance.
3. The method according to claim 2, characterized in that said insulin resistance or disease related to insulin resistance is diabetes mellitus, hyperinsulinemia, lipid metabolism disorder, obesity or glucose intolerance.
4. The method according to claim 1, characterized in that said biological agent or drug is used for inhibiting the interaction of EphB4 with insulin receptors, or increasing protein level of insulin receptors or level of phosphorylated Akt, or enhancing ability of glucose tolerance and clearance.
5. A method for preparation of an insulin-sensitized mouse model, wherein EphB4 gene was knocked out.
6. The method according to claim 5, characterized in that CRISPR-Cas9 technology is used to construct a transgenic mouse in which EphB4 gene was knocked out tissue-specifically and two flanks of first exon were inserted with LoxP site, thereby an insulin-sensitized mouse model with EphB4 tissue-specifically knockout is obtained.
7. The method according to claim 6, characterized in that said insulin-sensitized mouse model with EphB4 tissue-specifically knockout has an enhanced ability of glucose tolerance and clearance.
8. The method according to claim 7, characterized in that said tissue is liver.
9. An insulin-sensitized mouse model, wherein EphB4 gene was knocked out.
10. The insulin-sensitized mouse model according to claim 9, wherein CRISPR-Cas9 technology is used to construct a transgenic mouse in which EphB4 gene was knocked out tissue-specifically and two flanks of first exon were inserted with LoxP site, thereby an insulin-sensitized mouse model with EphB4 tissue-specifically knockout is obtained.
11. The insulin-sensitized mouse model according to claim 10, wherein said insulin-sensitized mouse model with EphB4 tissue-specifically knockout has an enhanced ability of glucose tolerance and clearance.
12. The insulin-sensitized mouse model according to claim 10, wherein said tissue is liver.
Description
FIGURE LEGENDS
[0019] In order to describe the technical scheme in embodiments of the invention or in prior art, the following is a brief introduction of the figures required for use in embodiments. It is obvious that the figures described below are only some embodiments of the invention, from which other figures can be obtained without creative effort by ordinary technicians in the field.
[0020]
[0021]
[0022]
[0023]
[0024]
SPECIFIC IMPLEMENTATION MODE
[0025] Various exemplary embodiments of the invention are detailed below. The specification should not be considered as a restriction of the invention, but should be understood as a more detailed description of certain aspects, features and implementation schemes of the invention.
[0026] It should be understood that the terms described in the present invention are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, the numerical range in the present invention shall be understood to specify each intermediate value between the upper and lower limits of the range. Each smaller range between any stated value or intermediate value within the stated range and any other stated value or intermediate value within the stated range is also included in the present invention. The upper and lower limits of these smaller ranges can be included or excluded independently.
[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning generally understood by conventional technicians in the fields described in the present invention. Although the present invention only describes the preferred method and material, any method and material similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All literature mentioned in this manual is incorporated by reference to disclose and describe methods and/or materials related to the literature. In case of conflict with any incorporated literature, the contents of this manual shall prevail.
[0028] Without deviating from the scope or spirit of the invention, a variety of improvements and changes can be made to the specific implementation of the specification of the invention, which is obvious to the technician in the field. Other embodiments obtained from the specification of the present invention are obvious to the technician. This application manual and embodiments are only exemplary.
[0029] With regard to the words “including”, “having”, “containing”, “involving” and so on, they are all open terms, that is, they mean to include but not to limit.
Embodiment 1
1. Research Methods and Technical Route
[0030] The present invention combines cell model and animal model. HEK293T cell, HepG2 cell, primary hepatocyte, C57BL/6J mice, db/db mice and insulin-sensitized animal model of EphB4 liver-specific knockout mice (EphB4 LKO) were used as research objects, and the corresponding cell or tissue samples were collected for the corresponding study.
[0031] Real-time quantitative PCR, western blotting, glucose tolerance test and insulin tolerance test in mice were used as the main methods.
2. Experimental Material
[0032] The transfection agent Lipo3000 was purchased from Invitrogene Corporation. InsR, EphB4, Akt, and pAkt antibodies were purchased from Cell Signaling Technology, the article numbers were #3025 #14960 #4685 and #4060. Western blotting was used in a ratio of 1:1000 to 2000 and protein immunoprecipitation was used in a ratio of 1:100.
[0033] Adenovirus that overexpressing EphB4 and lentivirus with knocked down EphB4 expression as well as corresponding control viruses were constructed and packaged by Shanghai Genechem Corporation. Correlation sequences: EphB4 shRNA sequences 5′-GTTATGATCCTCACGGAAT-3′, control shRNA sequences 5′-TTCTCCGAACGTGTCACGT-3′.
[0034] The inhibitors MG132(52619), chloroquine (S4157) and LCA(S4003) were purchased from Selleck chemicals. Ammonium chloride (A9434) was purchased from Sigma Company.
[0035] During the glucose tolerance and insulin tolerance tests, the blood glucose of mice was measured by Roche superior gold extraction type glucose meter and corresponding blood glucose test paper.
[0036] The primer sequences that were used in real-time quantitative PCR are as follows:
TABLE-US-00001 EphB4-F: TATGCCACGATACGCTTCACC; EphB4-R: AGCTTCGCTCTCGTAATAGAAGA; 36B4-F: AGATTCGGGATATGCTGTTGGC; 36B4-R: TCGGGTCCTAGACCAGTGTTC.
[0037] The relevant sequences of tissue-specifically knockout EphB4 transgenic mice constructed by CRISPR-Cas9 are as follows:
[0038] The target sequences of CRISPR-Cas9 are 5′-GCCCGAGATCTTTACTCCCCGGG-3′ and 5′-TTCTGGGCTGATCAAAGTGTGGG-3′, corresponding sequences of sgRNA are 5′-CTATTTCTAGCTCTAAAACGGGGAGTAAAGATCTCGGGCCTATAGTGAGTC GTATTA-3′ and 5′-CTATTTCTAGCTCTAAAACACACTTTGATCAGCCCAGCCTATAGTGAGTCGT ATT-3′.
[0039] PCR primer pairs for genotype identification are as follows: front 5′-AGTTCCTCCAAGTCCCCTAACACC-3′, 5′-CGCGCACTGGTGAAAATCCC-3′, wild type size is 287 bp, mutant type size is 372 bp; reverse 5′-GGAGAATCTGGGGAGTGGGACA-3′, 5′-ACTCTCCTTTTTTGCTGGGCAAAAT-3′, wild type size is 318 bp, mutant type size is 410 bp.
[0040] Statistical analysis: Values were expressed as mean and positive and negative standard deviations, and differences between the two groups were determined by student-Newman-Keuls test.
3. Experimental Methods and Results
3.1 Co-Immunoprecipitation
[0041] HEK293T cells and human liver cancer cells HepG2 cells were cultured in DMEM medium containing 10% fetal bovine serum and streptomycin and penicillin (gibco, 15140-122) in a constant temperature incubator of 37° C. and 5% CO.sub.2. In the co-immunoprecipitation experiment, for overexpression conditions, the expression plasmids pCMV5-EphB4-HA and pCMV3-flag-InsR were transferred into the cells via transfection reagent Lipo3000 at 70%-80% cell confluence, and then the cells were collected 30-36 hours after transfection. As for endogenous protein, directly cleaved the cultured cells and stimulated 30 min with insulin of 10 nM before collecting the cells. After collecting the lysed cells, the corresponding antibodies of the target protein were added in accordance with the recommended proportion of the used antibodies for immunoprecipitation, and were rotated for 5-12 h in a 4° C. refrigerator. After rinsing, the protein-protein interaction was detected by Western blotting.
[0042] The results showed that insulin receptor with flag tag (flag-InsR) and EphB4 with HA tag (EphB4-HA) were overexpressed in HEK293T cells, and the interaction between insulin receptor and EphB4 could be detected by co-immunoprecipitation assay (as shown in Fig. A and B of
[0043] The endogenous interaction between EphB4 and insulin receptors was also detected in HepG2 cells and hepatocytes induced by human pluripotent hepatocytes (as shown in Fig. C and D of
[0044] The above results show that there is an interaction between EphB4 and insulin receptor under both overexpression and endogenous conditions, and insulin stimulation can enhance the interaction between them.
3.2 EphB4 Inhibitors Increase the Level of Phosphorylated Akt
[0045] The mice were anesthetized by intraperitoneal injection of anesthetic, then abdominal cavity was opened, injected with type IV collagenase (Sigma, C5138) through portal vein, and fluid flew out of the inferior vena cava. After the liver tissue was fully digested, it was suspended with DMEM medium, flew through a cell sieve with a diameter of 70 μm, and was centrifugated, thereby the primary hepatocytes were obtained. The cells were resuspended in complete culture medium and dispersed into a petri dish or plate. After the cells were attached, they were treated with LCA (10 μM and 20 μM) overnight. Cells were stimulated with 10 nM insulin for 20 min before collection, and then the level of phosphorylated Akt was detected by western blotting.
[0046] The results showed that the treatment of primary mouse hepatocytes with Eph signal inhibitor lithocholic acid LCA could increase the level of phosphorylated Akt (as shown in
3.3 Overexpression of EphB4 Reduces the Level of Phosphorylated Akt and Insulin Receptor
[0047] The mice were anesthetized by intraperitoneal injection of anesthetic, then abdominal cavity was opened, injected with type IV collagenase (Sigma, C5138) through portal vein, and fluid flew out of the inferior vena cava. After the liver tissue was fully digested, it was suspended with DMEM medium, flew through a cell sieve with a diameter of 70 μm, then the primary hepatocytes were obtained by centrifuging with 50×g centrifugal force. After washing twice with DMEM medium, the cells were re-suspended with complete culture medium and dispersed to petri dishes or culture plates. After the cells were adhered to the wall, the primary hepatocytes were infected with adenovirus containing EphB4, and EphB4 was overexpressed. When cells were infected with adenovirus. MOI=100. The infected cells were cultured for 16 h and collected for western blot detection.
[0048] The results showed that overexpression of EphB4 could reduce the level of phosphorylated Akt and the level of insulin receptor protein in primary hepatocytes (as shown in
3.4 EphB4 Promotes the Degradation of Insulin Receptor Through Lysosomal Pathway
[0049] Insulin receptor (flag tagged insulin receptor) and EphB4 (HA tagged EphB4) were co-expressed in HEK293T cells. GFP was co-transfected as a reference for foreign proteins. The cells were treated with proteasome degradation pathway inhibitor MG132 (10 μM), lysosome degradation pathway inhibitor ammonium chloride (5 mM) and chloroquine (10 μM) for 8 h. Cells were collected to detect protein level of flag-InsR by Western blotting (as shown in
[0050] The results showed that EphB4 promoted the degradation of InsR through lysosomal degradation pathway (as shown in
3.5 Overexpression of EphB4 in C57 Mice Fed Normal Diet Interferes with Glucose Tolerance and Insulin Tolerance
[0051] EphB4 was overexpressed in mice fed normal diet by tail vein injection of adenovirus. Without affecting the body weight of mice, the dose of adenovirus injection was 2.5E+7 PFU (PFU: plaque forming unit). One week after injection, glucose tolerance and insulin tolerance were analyzed, and then tissues were harvested. The mice were fasted for 6 hours before tissue harvesting, and some of the mice were injected with insulin (0.5 U/kg) first, and then sacrificed after 5 min. The level of phosphorylated Akt was detected by Western blotting.
[0052] The results showed that overexpression of EphB4 decreased glucose tolerance and clearance ability of mice (as shown in Fig. A, B and C of
[0053] The results of Western blotting showed that overexpression of EphB4 decreased insulin sensitivity of mouse liver tissue (as shown in Fig. D and E of
3.6 Knocking Down the Expression of EphB4 can Improve Glucose Tolerance and Insulin Tolerance in db/db Mice
[0054] shRNA targeting EphB4 gene was injected into diabetic db/db mice via tail vein with lentivirus as a vector, and the expression of EphB4 was also knocked down in db/dh mice without affecting the body weight. Each mouse was injected with adenovirus at a dose of 2E+7 PFU. Two weeks after injection, glucose tolerance and insulin tolerance were analyzed.
[0055] The results showed that knocking down the expression of EphB4 in dh/db mice could significantly improve glucose tolerance and clearance ability of mice (as shown in Fig. B and D of
3.7 Knocking Down the Expression of EphB4 can Improve Insulin Resistance Induced by Hyperinsulinemia
[0056] The primary hepatocytes of mice with low EphB4 expression were isolated and treated with high concentration of insulin (100 nM) for 6 hours to make the hepatocytes in a state of insulin resistance, and then was treated with low concentration of insulin (10 nM) for 20 min. Then the cells were collected and the level of phosphorylated Akt was detected.
[0057] The results showed that knocking down the expression of EphB4 could improve insulin resistance of hepatocytes induced by high concentration of insulin (as shown in
3.8 Liver Specific Knockout of EphB4 can Improve Glucose Tolerance and Clearance Ability in Mice.
[0058] Through the technology platform of Biocytogen, the transgenic mice with flanking insertion of LoxP site into exon 1 of EphB4 gene for tissue specific knockout were constructed by CRISPR-Cas9 technology. The specific operation procedure is as follows: the target sequence of mouse EphB4 in genome was amplified and sequenced, and the CRISPR/Cas9 vector plasmid aiming at the target sequence was designed and constructed, and the activity was detected by the company's self-made kit. The targeting vector of conditional knockout of EphB4 gene was designed and constructed by selecting highly active sgRNA/Cas9 target sites sequence information (see “experimental materials” for details). sgRNA/Cas9 mRNA and targeting vector were injected into the pronucleus of mouse fertilized eggs, and the fertilized eggs were transplanted into the fallopian tubes of surrogate mice. The genotypes of F0 mice with conditional knockout of EphB4 gene were identified after birth, and the F1 mice with conditional knockout of EphB4 gene were obtained. The F1 mice were verified by PCR, southern blotting hybridization, and sequencing to identify genotypes. The F1 mice were mated with the existing liver tissue-specific expression of Cre recombinase mice (Alb-Cre mice), and then the offspring were self-mated, and finally the liver tissue-specific knockout EphB4 mice were obtained. The liver and muscle tissues of mice were detected by real-time quantitative PCR and Western blotting, and the mice were fed with high fat diet for glucose tolerance tests and insulin tolerance tests.
[0059] Similarly, after fasting for 6 hours, some mice were injected with insulin and sacrificed after 5 min, and the level of phosphorylated Akt in liver tissue of mice was detected.
[0060] Results: Real-time quantitative PCR detection showed that the mRNA level of EphB4 in liver tissue decreased significantly, while there was no significant change in kidney, white adipose tissue and muscle tissue (as shown in Fig. A of
[0061] Under the condition of feeding high fat diet, EphB4 LKO mice had better glucose tolerance and clearance ability than that of control mice (as shown in Fig. B and C of
[0062] The above embodiments only describe the preferred mode of the invention and do not limit the scope of the invention. Without departing from the design spirit of the invention, all kinds of deformations and improvements made by ordinary technicians in the field to the technical scheme of the invention shall fall within the scope of protection determined in the claims of the invention.