STABLE PSEUDOTYPED LENTIVIRAL PARTICLES AND USES THEREOF

20230203537 · 2023-06-29

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a method for obtaining stable pseudotyped lentiviral particles including a heterologous gene of interest, comprising the following steps: a) transfecting at least one plasmid in appropriate cell lines, wherein said at least one plasmid comprises the gene of interest, the rev, gag and pol genes, and a sequence coding for an ERV syncytin, wherein the rev, gag and pol genes are retroviral genes; b) incubating the transfected cells obtained in a), so that they produce the stable pseudotyped lentiviral particles in the supernatant; and c) harvesting and concentrating the stable lentiviral particles obtained in b).

    The present invention also relates to a method to transduce immune cells using lentiviral vectors pseudotyped with an ERV syncytin glycoprotein. The method can be performed on non-stimulated blood cells or on cells stimulated briefly with IL7, and the cells can be expanded.

    The stable pseudotyped lentiviral particles obtained are particularly useful in gene therapy.

    Claims

    1. Stable lentiviral particles pseudotyped with an endogenous retroviral syncytin (ERV syncytin) and packaging a heterologous gene of interest, presenting a high physical and/or infectious titer(s).

    2. A method for obtaining the stable pseudotyped lentiviral particles of claim 1, comprising the following steps: a) transfecting at least one plasmid in appropriate cell lines, wherein said at least one plasmid comprises the gene of interest, the retroviral rev, gag and pol genes, and a sequence coding for an ERV syncytin; b) incubating the transfected cells obtained in a), so that they produce the stable lentiviral particles pseudotyped with an ERV syncytin, respectively, and packaging the heterologous gene of interest; and c) harvesting and concentrating the stable lentiviral particles obtained in b), preferably wherein the concentration of step c) comprises centrifugating and/or purifying the harvested stable lentiviral particles obtained in b).

    3. The method according to claim 2, wherein the retroviral rev, gag and pol genes are lentiviral rev, gag and pol genes; preferably HIV-1 rev, gag and pol genes.

    4. Particles obtained by the process of any one of claim 2 or 3.

    5. Particles according to claim 1 or 4, or the method according to any one of claims 2 to 4, wherein the ERV syncytin is selected from the group consisting of HERV-W, HERV-FRD, murine syncytin-A, murine syncytin-B, syncytin-Ory1, syncytin-Car1 and syncytin-Rum1, preferably the ERV syncytin is selected from the group consisting of HERV-W, HERV-FRD and murine syncytin-A and even more preferably the ERV syncytin is HERV-W or HERV-FRD.

    6. Particles according to claim 1 or 5, or the method according to any one of claims 2 to 4, wherein the high infectious titer is a titer of infectious particles produced at the end of step c), higher than 2 E+04 TU/ml, preferably higher than 1 E+05 TU/ml, preferably higher than 1 E+06 TU/ml, preferably higher 5 than 2 E+06 TU/ml, and/or wherein the high physical titer is a titer of particles produced at the end of step c) higher than 0.7×10.sup.5 ng p24/mL, notably higher than 1×10.sup.5 ng p24/mL, preferably higher than 1.1×10.sup.5 ng p24/mL, more preferably higher than 1.5×10.sup.5 ng p24/mL.

    7. Particles according to any one of claim 1, 5 or 6, for use as a medicament, preferably for use in gene therapy or immunotherapy or as a vaccine or in immunoprophylaxis.

    8. In vitro use of the particles according to any one of claim 1, 5 or 6, for the transduction of immune cells, preferably B cells or myeloid cells.

    9. In vitro use of the particles according to any one of claim 1, 5, 6 or 8, for biotechnology engineering, preferably for producing immunoglobulins.

    10. Particles according to any one of claims 1 or 5 to 7, for use for therapy by transducing immune cells, preferably for use for treating immune deficiencies, auto-immunities, infectious diseases or B cell-related cancers.

    11. A sample of immune cells infected with the particles according to any one of claim 1, 5 or 6, for use as a medicament, or for a diagnosis purpose.

    12. An ex vivo process for obtaining immune cells modified to express a heterologous gene of interest, comprising a step of infecting immune cells, preferably naïve immune cells optionally previously stimulated, with the particles according to any one of claim 1, 5 or 6.

    13. The ex vivo process of claim 12, wherein it is performed in the presence of a LAH4 peptide or a functional derivative thereof, preferably the LAH4-A4 vectofusin-1, and/or wherein the immune cells are chosen from B cells, T cells, dendritic cells, monocytes and macrophages, preferably are B cells.

    14. The ex vivo process of any one of claim 12 or 13, wherein it comprises the following steps: optionally stimulating naïve immune cells by incubating them in a medium comprising IL-7, and infecting the naïve immune cells, stimulated or not, with said particles according to any one of claim 1, 5 or 6, in the presence of a LAH4 peptide or a functional derivative thereof.

    15. The immune cells, preferably B cells, more preferably naïve B cells, comprising said heterologous gene of interest obtainable by the ex vivo process according to any one of claims 12 to 14.

    Description

    FIGURE LEGENDS

    [0158] FIG. 1: Transduction of BeWO Cells with Syncytin-Pseudotyped Vectors in the Presence of Various Transduction Additives

    [0159] BeWO cells were infected with GFP-encoding vectors, either with LV-VSVg (10.sup.8 TU/mL) or with LV-Syn2 (10.sup.5 TU/mL) in the absence or presence of additives protamine sulfate (PS), polybrene (PB) or Vectofusin-1 (VF1) and transgene expression was measured by FACS after 3 days. The percentages of live GFP+ cells in the gate are shown. Results from one experiment.

    [0160] FIGS. 2A-D: Transduction of 293T Cells with Syncytin-Pseudotyped Vectors and Vectofusin-1 (VF-1)

    [0161] A. B. One representative experiment out of 3 showing the dose-dependent effects of syncytin-pseudotyped vectors in the presence of VF1. 293 T cells were cultured with GFP-encoding LV-Syn1 (A) or LV-Syn2 (B) using vector concentrations ranging from 10.sup.4 to 10.sup.5 TU/mL and in the absence or presence of VF1. GFP expression was measured by FACS after 3 days. C. The enhancing effect of VF1 is statistically-significant as shown in 5-6 experiments using a Mann-Whitney test. D. Correlation between expression of GFP as measured by FACS and vector copy number per cell (VCN) as measured by qPCR was obtained from 3 separate experiments testing different vector concentrations.

    [0162] FIG. 3: Transduction of Primary Blood Cell Subsets with Syncytin-Pseudotyped Vectors

    [0163] Human peripheral blood mononuclear cells (PBMC) (4 to 9 separate blood donors) were infected with GFP-encoding LV-Syn1 or LV-Syn2 vectors (10.sup.5 TU/mL) in the absence or presence of VF1 and either immediately after isolation of the cells (no activation) or following an overnight culture of cells with IL-7 (10 ng/mL). After 3 days, GFP was measured by FACS in different subsets of live cells (CD3+ CD19− CD11c− T cells; CD3− CD19+ CD11c− B cells; CD3− CD19− CD11c+ myeloid dendritic cells) , naive (CD27−) or memory (CD27+) B cell subsets.

    [0164] FIG. 4: Dose-Dependent Effects of Syncytin-Pseudotyped Vectors on Blood Cell Subsets

    [0165] Representative results of 3 donors of PBMC incubated with IL-7 overnight, then transduced with ΔNGFR-encoding LV-Syn1 and LV-Syn2 at concentrations 10.sup.5 and 10.sup.6 TU/mL in the presence of VF1. Transgene expression was measured by FACS after 3 days.

    [0166] FIGS. 5A-B: Transduction of CD11c+ Blood Cells with Syncytin-Pseudotyped Vectors

    [0167] Whole PBMC (2 donors tested in 2 separate experiments) or plastic-adherent PBMC (1 donor tested in another separate experiment) were transduced with GFP-encoding LV-Syn1 or LV-Syn2 (2×10.sup.5 TU/mL) or LV-VSVg (10.sup.8 TU/mL) vector in the absence of presence of VF1 (12 μg/mL). Cells were washed and further cultured in XVivo20+10% FCS+GM-CSF+IL-4 for 3 to 7 days. A. Gating strategy for the analysis of CD11c+ HLD-DR+ myeloid cells. B. Representative experiment out of 3 showing the transduction of CD11c+ HLD-DR+ cells obtained after 3 days in different conditions.

    [0168] FIGS. 6A-C: Expression of ASCT2 and MFSD2a Receptors on Blood Cells

    [0169] A. Multicolor FACS analysis for ASCT2 and MFSD2a expression in CD19+ B cells, CD3+ T cells and CD11c+ myeloid dendritic cells in one representative experiment out of 3 (1 blood donor each). B. Average and standard deviation of the percentage of cells expressing the indicated receptors in 5 experiments, after subtraction of the background obtained with the rabbit immunoglobulin control. C. RT-PCR analysis of MFSD2a and ASCT2 mRNA on PBMC cell subsets averaging 2 experiments.

    [0170] FIGS. 7A-B: Phenotype of blood mononuclear cells of a SCIDX1 patient treated by gene therapy. Flow cytometry analysis was performed: (A) with a healthy donor PBMC and in comparison (B) after thawing the patient's peripheral blood mononuclear cells (PBMC) and in comparison.

    [0171] FIGS. 8A-C & 9A-C: Transduction of murine spleen cells (FIG. 8) and of bone marrow cells (FIG. 9) with LV-Syn A vectors. LV-SynA vector encoding dNGFR was added on red-blood cell-depleted spleen cells obtained from C57Bl/6 mice. After 3 days, the phenotype of cells and transgene expression were measured by flow cytometry.

    [0172] FIGS. 10A-D: In vivo delivery of the LucII transgene with LV-SynA. A single bolus of LV-SYn A encoding LucII (C, n=7, flux: 1,8.10.sup.8 photons/sec) was injected intravenously into albinos C57Bl/6 mice (5×10.sup.5 TU/mouse n=3). As control a LV-VSVg encoding the same transgene was used (B, n=4, flux:7.10.sup.8 photons/sec), as well as PBS (A, n=7, flux: 1,5.10.sup.4 photons/sec). Bioluminescence detection of transgene expression was performed 16 days post IV injection of LVs. One of the anesthetized mice was opened to confirm bioluminescence of the spleen (D).

    [0173] Supplementary Figures S1A-D [0174] A. Optimization of plasmid ratio for LV production by transient transfection in HEK293T cells. Production of LV-Syn2 vector coding for GFP using various amounts of pcDNA3Syn2 plasmid in each T175 cm.sup.2 flask as indicated on the X axis. Medium was collected 24 h after transfection and p24 was measured by ELISA. Results of average±SD of 4 measures. [0175] B. Dose-dependent increase in transduction and stability of transduction over time. HEK293T cells were transduced with increasing concentrations of LV-Syn1 encoding GFP. Cells were cultured for the indicated times (d=days) at which GFP expression was measured by FACS. Results are expressed as percentage of GFP+ cells in the culture. Results of 1 experiment representative of 4. [0176] C. Comparative transduction of different cell lines with syncytin-pseudotyped LV. HEK293T cells, BeWO cells or HCT116 cells were transduced with LV-Syn1 (10.sup.5 TU/mL), LV-Syn2 (10.sup.5 TU/mL) or LV-VSVg (10.sup.6 TU/mL) vectors encoding GFP. Expression of GFP was measured by FACS after 3 days. Results obtained with LV-Syn1 and LV-Syn1 respectively on 5 and 6 separate experiments on 293 T cells; 1 and 3 experiments on BeWO cells and 2 and 4 experiments on HCT116 cells.

    [0177] Supplementary Figures S2A-B [0178] A. Treatment schema of PBMC with vectors [0179] B. FACS gating strategy to analyse the transduction of various B cell subpopulations

    [0180] Supplementary Figures S3A-B [0181] A. FACS gating strategy to analyze the transduction of dendritic cells which are CD3− CD19−, HLA-DR+, CD1a+ and express or not GFP and CD86 or CD80. Transduction of PBMC with LV-Syn1, LV-Syn2 or LV-VSVG vectors in the same conditions as in FIG. 5 and expression of CD80 and CD86 (percentages indicated in quadrants) on the subset of CD3−CD19−CD14−CD1a+GFP+ cells after 7 days. [0182] B. Same as A. and expression of GFP (percentages indicated in histogram) on the subset of CD3−CD19−CD14+HLA-DR+ cells after 7 days.

    [0183] Supplementary Figure S4: Immunostaining for ASCT2 and MFSD2a on HEK293T Cells and HCT116 Cells

    [0184] Histograms represent the mean fluorescence intensity (MFI) of unstained negative control cells (293T: 5%; HCT116: 3%), cells stained with irrelevant IgG and the Alexa 647-conjugated secondary antibody (293T: and HCT116: 1%), cells stained with the anti-ASCT2 and secondary antibody (293T: 12%, HCT116: 4%) and cells stained with anti-MFSD2a and secondary antibody (293T: 99%, HCT116: 65%).

    [0185] Supplementary Figure S5: Transduction of Raji and Jurkat Cells with LV-Syn1 and LV-Syn2 Vectors Encoding GFP Using 10.sup.6 TU/mL Vector

    [0186] Cells were analyzed by FACS 8 days after infection.

    [0187] Supplementary Figure S6: In Vivo Transduction with LV-Syn1 Vector

    [0188] 7 week-old female NSG mice (Nod/Scid/gc−/−) purchased from Charles River were injected in the retro-orbital sinus with 10.sup.7 PBMC in 100 μL volume. After 24 hours, the mice were injected intravenously in the tail vein with 150 μL of undiluted LV-Syn1 vector. After 7 days, mice were sacrificed and spleens were collected, lysed with ACK and the red blood cell-depleted fraction was analyzed by FACS to measure GFP on the CD45+ human cell fraction. Results show the FACS plots of 2 mice in which human GFP+ cells were found.

    [0189] Supplementary Figure S7: Ex Vivo Transduction of Murine Cells with the LV-Syn1 or LV-Syn2 Vectors

    [0190] Spleen cells were obtained from 6 week-old female C57Bl/6 mice following red blood cell lysis with ACK. The cells were cultured in RPMI supplemented with 10% FCS and bet2 mercaptoethanol at the concentration of 10.sup.6 cells/mL in 100 μL in the presence of LV-SYn1 or LV-Syn2 encoding ΔNGFR at 1 or 5×10.sup.5 TU/mL and VF1 (12 μg/mL). After 3 days, expression of ΔNGFR was measured by FACS on live cells.

    [0191] Supplementary Figure S8: Infectious Titration of LV-SynA on the Murine B Cell Lymphoma Cell Line A20

    [0192] A20 cells were transduced with different amounts of LV-SynA vector (0, 0.2, 0.6, 1.8, 3.2, 5.4 and 16.2 μL) with VF1 (red) and without VF1) To 12 μg/mL. The cells are cultured for 7 days in complete medium. Evaluation of the number of copies of syncytin A by qPCR.

    EXAMPLE 1

    Human Endogenous Retroviral Envelope Glycoproteins Syncytin-1 and Syncytin-2 Enable an Effective Lentiviral Transduction of Human Primary B Cells and Dendritic Cells

    [0193] Materials and Methods

    [0194] Cell Lines

    [0195] Human embryonic kidney 293T cells and human colorectal carcinoma HCT116 cells (CCL-247; ATCC, Manassas, Va.) were cultured at 37° C., 5% CO2 in Dulbecco's modified Eagle's medium (DMEM+glutamax) (Life Technologies, St-Aubin, France) supplemented with 10% of heat inactivated fetal calf serum (FCS) (Life Technologies). Human choriocarcinoma BeWO cells (CCL-98; ATCC) were cultured in Ham's F12K medium (Life technologies) supplemented with 10% of FCS. Raji cells and Jurkat cells were infected in XVivo 20 medium.

    [0196] Cloning of Syncytin-Expressing Plasmids and Production of Vectors

    [0197] Plasmids pCDNA3-syncytin-1 and pCDNA3-syncytin-2 coding for human syncytin-1 (ERVW-1-001) or human syncytin-2 (ERVFRD-1) were constructed by cloning the respective synthesized DNA sequences (Gencust, Dudelange, Luxembourg) corresponding to Ensembl genome browser ENST00000493463 and ENSG00000244476 transcript sequences, into a pCDNA3 plasmid (Invitrogen, Carlsbad, Calif.) using NHeI et XhoI restriction enzymes. Plasmid sequences were verified by two strand sequencing. The syncytin-2 plasmid functionality was verified by immunoblotting protein extracts following transfection of 293T cells using the anti-HERV-FRD antibody (LS-BIO, Nanterre, France) detecting a 65-70 Kd protein expected to be syncytin-2. Plasmids were produced with endotoxin-free using DNA RNA purification Nucleobond kit (Macherey-Nagel, Duren, Germany) Lentiviral particles pseudotyped with either syncytin-1 or syncytin-2 were produced by transient transfection of 293T cells with 4 plasmids, using calcium phosphate. Each T175 cm.sup.2 flask was transfected with 14.6 μg pKLgagpol expressing the HIV-1 gagpol gene, 5.6 μg pKRev expressing HIV-1 rev sequences, 22.5 μg of the gene transfer cassette (pCCL PGK GFP expressing enhanced green fluorescent protein (GFP) under control of the human phospho glycerate kinase (PGK) promoter (Charrier et al, 2011) or pCCL PGK delta-NGFR expressing a truncated form of the nerve growth factor receptor (NGFR) under control of the human PGK promoter) and 22 μg of either the pCDNA3-syncytin-1 or pCDNA3-syncytin-2 plasmid. Medium was changed the following day and replaced by DMEM 4.5 g/L glucose supplemented with penicillin and streptomycin and 10% FCS. After 24 hours, medium containing viral particles was collected, centrifuged at low speed, sterile-filtered (0.22 μm) and concentrated by ultracentrifugation 50 000 g (19500 RPM using a Beckman ultracentrifuge with rotor SW28) for 2 h at 4° C. The pellet was resuspended in PBS, aliquoted and stored at −80° C. VSVg-pseudotype particles were produced also by transient transfection as reported (Merten et al, 2011).

    [0198] Transduction Additives

    [0199] Vectofusin-1 (VF1) peptides were synthetized by standard fluorenyl-methyloxy-carbonyl chloride solid-phase peptide synthesis, followed by HPLC and mass spectrometry purification (Gencust). Peptides were solubilized in H.sub.2O, aliquoted and stored at −80° C. until used. When needed for transduction experiments, VF1 was thawed, resuspended in medium and added to vector and to cells at a final concentration of 12 μg/mL. Protamine sulfate (PS) (Sigma-Aldrich, St Louis, Mo.) and polybrene (PB) (Sigma-Aldrich) were also diluted extemporaneally with vector and cells and respectively used at final concentrations of 8 μg/mL and 6 μg/mL in the transduction culture.

    [0200] Titration of Vectors

    [0201] Concentrated and cryopreserved vector was titered before use. Physical particle titer was determined by p24 ELISA (Alliance© HIV-1 Elisa kit, Perkin-Elmer, Villebon/Yvette, France) as previously reported (Charrier et al, 2011). Infectious titer was determined by adding serial dilutions of vector to HEK293T cells in the presence of 12 μg/mL VF1 and after 3 days, 293T cells were analyzed by flow cytometry to calculate a transducing units titer (TU/mL) or by qPCR to measure infectious genomes (ig/mL) using standard calculations (Kutner et al, 2009).

    [0202] Culture and Transduction of Peripheral Blood Mononuclear Cells

    [0203] Peripheral blood collected with EDTA was purchased from the Etablissement Francais du Sang (Evry, France). Peripheral blood mononuclear cells (PBMC) purified by Ficoll gradient centrifugation (Eurobio, les Ulis, France) were suspended in serum-free medium X-VIVO 20 (Lonza, Levallois-Perret, France) for transduction. In some experiments, cytokines IL-7 (10 ng/μL) (Miltenyi Biotech, Bergisch Gladbach, Germany) was added to the medium overnight prior to transduction. For transduction, LV-Syn1 or LV-Syn2 vectors (1.10.sup.5 TU/mL), or LV-VSVg (1.10.sup.8 TU/mL) were added to cells in the presence of VF1 (12 μg/mL). After 6 hours, medium was changed to XVivo20 supplemented with 10% FCS and IL-7 (10 ng/mL) and cells were cultured for up to 7 days. To expand transduced B cells, CD40L (2 μg/mL) and IL-4 (20 ng/mL) was added to the medium and cells were cultured in these conditions for up to 2 weeks. To expand myeloid dendritic cells, hGM-CSF (50 ng/ml) and IL-4 (20 ng/ml) were added to medium.

    [0204] EBV Immortalization

    [0205] PBMC were cultured overnight with IL-7, then infected with vectors. After 6 hours, the cells were washed and cultured in the presence of B95.8 marmoset cell supernatant with cyclosporin using standard procedures for EBV immortalization. Medium was changed twice weekly.

    [0206] Transduction of a SCID-X1 Patient Cells

    [0207] PBMC of SCID-X1 patient treated by gene therapy were rapidly thawed at 37° C. and then washed twice with PBS. After trypan blue counting the cells are labeled with 2 μM CFSE (Molecular Probes, Cambridge, UK), transduced with Lv-Syn1 IL2rg vector and cultured (3.105/200 μL) in 96-well round bottomed plates in the absence or presence of CD40Ligand [2 μg/mL] (Miltenyi Biotec) and IL-21 [50 ng/mL] (Miltenyi Biotec). After 3, 6 and 7 days culture, B cell transduction (ie, NGFR or IL2Rg expression), B cell proliferation (ie, CFSE dilution) and the frequency of CD19+ CD27+ cells were determined by flow cytometry. Human IgG secretion in medium was determined by ELISA (Sigma-Aldrich, St Louis, Mo.).

    [0208] In Vitro B Cells Activation

    [0209] PBMCs were labeled with 2 μM CFSE (Molecular Probes, Cambridge, UK) and cultured (3.10.sup.5/200 μL) in 96-well round bottomed plates in the absence or presence of CD40Ligand [2 μg/mL] (Miltenyi Biotec) and IL-21 [50 ng/mL] (Miltenyi Biotec). After 3, 6 and 7 days culture, B cell transduction (ie, NGFR or IL2Rg expression), B cell proliferation (ie, CFSE dilution) and the frequency of CD19+ CD27++ plasmablasts were determined by flow cytometry. Human IgG secretion was determined by ELISA (Sigma-Aldrich, St Louis, Mo.).

    [0210] Flow Cytometry

    [0211] Antibodies used for flow cytometry were purchased from BD-Biosciences (Le Pont de Claix, France) and include PE conjugated anti-CD3 and anti-CD1a, Alexa-Fluor 700 conjugated anti-CD19, APC-H7 conjugated anti-CD45 and anti-IgD, CF594 conjugated anti-IgM, PeCy7 conjugated anti-CD27 and anti-HLA-DR, APC conjugated anti-CD14, V450 conjugated anti-CD11c. Prior to adding antibodies to cells, Fc receptors were blocked by incubating cells with gammaglobulin (1 mg/mL) (Sigma Aldrich) for 15 minutes, at 4° C. Saturating amounts of antibodies were then added for 30 minutes at 4° C. in PBS with 0.1% bovine serum albumin (BSA) (Sigma Aldrich) and cells were washed twice. At the end of the procedure, 7-amino-actinomycin D (0.3 mg/mL) (Sigma-Aldrich) was added to exclude dead cells. For receptor studies, rabbit polyclonal anti-SLC1A5 (ASCT2) (Abcam, Paris, France), anti-MFSD2a (Origene, Rockville, Md.) or rabbit immunoglobulin controls (Origene) were used and revealed by Alexa 647-conjugated goat anti-rabbit antibodies (Thermo Fisher Scientific, Waltham, Md.). Acquisitions were performed on a LSRII using Diva software (BD-Biosciences) and analyses were carried out with Kaluza software (Beckman-Coulter, Villepinte, France).

    [0212] The detection of human IL2Rg was performed using PE conjugated anti-human CD132 antibody (BD bioscience).

    [0213] Measure of ASCT2 and MFSD2A Expression by RT-qPCR

    [0214] Total RNA was extracted from purified cells using SV total RNA isolation (Promega, Charbonniére les bains, France). Residual DNA was removed from the samples using the free DNA kit (Ambion, Courtaboeuf, France). cDNA was synthesized from 1 μg of RNA using random hexamers according to the protocol Superscript II first strand synthesis system for reverse transcription-PCR (Invitrogen). Real time PCR was performed using LightCycler 480 system (Roche, Bâle, Switzerland) with 0.1 μM of each primer according to the protocol Sybr Green PCR Master Mix (Applied Biosystem, Foster city, Calif., USA). The primer pairs used for amplification of either ASCT2 or MFSD2A were described previously (Cornelis et al, PNAS, 2008 and Toufailly et al, placenta, 2013). Sequences of ASCT2 primers are (sense, 5′-GGCTTGGTAGTGTTTGCCAT-3′; antisense, 5′-GGGCAAAGAGTAAACCCACA-3′) and MFSD2A primers are (sense, 5′-CTCCTGGCCATCATGCTCTC-3′; antisense, 5′-GGCCACCAAGATGAGAAA-3′). We also used TFIID (Transcription Final II D) primers as normalization. TFIID primers sequences are (sense, 5′-ACGGACAACTGCGTTGATTTT-3′; antisens, 5′-ACTTAGCTGGGAAGCCCAAC-3′). Results are expressed in fold change using the formula: relative abundance=2{circumflex over ( )}.sup.−ΔΔCt with ΔCt=Ct ASCT2 or MFSD2A−Ct TFIID and ΔΔCt=ΔCtsample−ΔCtcalibrator.

    [0215] In Vivo Transduction with LV-Syn1 Vector

    [0216] 7 week-old female NSG mice (Nod/Scid/gc−/−) purchased from Charles River were injected in the retro-orbital sinus with 10.sup.7 PBMC in 100 μL volume. After 24 hours, the mice were injected intravenously in the tail vein with 150 μL of undiluted LV-Syn1 vector. After 7 days, mice were sacrificed and spleens were collected, lysed with ACK and the red blood cell-depleted fraction was analyzed by FACS

    [0217] Ex Vivo Transduction of Murine Cells with the LV-Syn1 or LV-Syn2 Vectors

    [0218] Spleen cells were obtained from 6 week-old female C57Bl/6 mice following red blood cell lysis with ACK. The cells were cultured in RPMI supplemented with 10% FCS and bet2 mercaptoethanol at the concentration of 10.sup.6 cells/mL in 100 μL in the presence of LV-SYn1 or LV-Syn2 encoding ΔNGFR at 1 or 5×10.sup.5 TU/mL and VF1 (12 μg/mL). After 3 days, expression of ΔNGFR was measured by FACS on live cells.

    [0219] Statistical Analysis

    [0220] Statistical significance was assessed by one-way ANOVA analysis, Mann-Whitney or Student's t test, as specified, using GraphPad Prism software (GraphPad Inc, La Jolla, Calif.).

    [0221] Results

    [0222] Syncytin-1 and Syncytin-2 Pseudotyped LVs can be Produced as Stable and Infectious Particles

    [0223] Two human endogenous retroviral envelope glycoproteins, syncytin-1 and syncytin-2, were explored as possible new pseudotypes for recombinant HIV-1-derived LV. The full-length cDNAs of these glycoproteins were expressed in a transient LV production system in 293T cells. An optimization of the amount of syncytin-1 and syncytin-2 plasmids for the transfection step increased the production of LV particles based on p24 levels in medium (Supplementary Figure S1A). In the conditions defined (see Materials and Methods), it was possible to produce stable and infectious particles pseudotyped with either of these envelopes. Using different transgenes (GFP and dNGFR), harvested raw stocks of LV-Syn-1 titered on average 705 ng p24/mL (n=7 productions) and LV-Syn-2 titered on average 496 ng p24/mL (n=4 productions) (Table 1). Lentiviral particles pseudotyped with either of these envelopes could be successfully concentrated by ultracentrifugation using the same conditions as used for VSVg-pseudotyped particles (Charrier et al, 2011). The concentrated stocks were cryopreserved at −80° C. and were stable for several months. Upon thawing of the LV stocks, titers of 4.1±1.7 E+05 ng p24/mL were obtained for LV-Syn1 (n=6 productions) and 1.7±0.6 E+05 ng p24/mL for LV-Syn2 (n=6 productions) and vectors could be produced to code different transgenes (GFP or ΔNGFR) (Table 1).

    TABLE-US-00002 TABLE 1 Titers of syncytin 1- and 2-pseudotyped LVs Titer harvest Titer concentrate Vector Transgene ng p24/mL n ng p24/mL × 10.sup.5 293T TU/mL × 10.sup.6 n LV-Syn1 GFP 794 ± 217 5 4.1 ± 1.7 2.8 ± 6.0 6 LV-Syn2 GFP 366 ± 165 4 1.7 ± 0.6 2.7 ± 6.0 6 LV-Syn1 ANGFR 485 ± 64  2 4.5 ± 3.4 6.3 ± 7.5 3 LV-Syn2 ANGFR 671 ± 141 3 6.4 ± 4.2 4.4 ± 1.5 2 Legend: Separate batches of LV with the indicated envelope and transgene (n = number of batches tested) were produced by transient transfection, clarified, sterile-filtered, concentrated or not, cryopreserved, thawed and titered. Concentration was performed by ultracentrifugation (19500 rpm (50000 g) for 2 hours). Physical titers in p24 levels were measured by ELISA and infectious titers were measured as 293T cells transducing units (TU) in the presence of Vectofusin-1 using flow cytometry.

    [0224] To determine the infectious properties of these particles, the inventors first infected the human

    [0225] BeWo choriocarcinoma cell line known to express both the ASCT2 receptor for syncytin-1 and the more restricted MFSD2a receptor for syncytin-2 (Esnault et al, 2008). BeWo cells were not transduced effectively with LV-Syn1 or LV-Syn2 whereas they were well-transduced with VSVg-pseudotyped LV. However, adding cationic agents such as protamine sulfate (PS), polybrene (PB), or Vectofusin-1 (VF1) enhanced the transduction of BeWo cells as shown with LV-Syn2 (FIG. 1). Of these agents, the greatest level of transduction enhancement was obtained with VF1. Vectofusin-1 is a short histidine-rich amphipathic peptide which enhances the infectivity of lentiviral and y-retroviral vectors pseudotyped with various envelope glycoproteins including RD114-TR (Fenard et al, 2015 et Majdoul et al, 2015). The effects of Vectofusin-1 had not been tested before with syncytins, and this short peptide reveals the gene transfer potential of syncytin-pseudotyped LV particles.

    [0226] In the presence of VF1, it was possible to transduce 293 T cells with either of the syncytins-pseudotyped vectors in a dose-dependent manner and reaching levels comparable to those obtained in BeWo cells (FIG. 2A,B). In contrast, only about 1 to 2% of 293T cells were transduced without this additive. The enhancing effects of VF1 were statistically-significant over repeated experiments in 293T cells using LV-Syn1 or LV-Syn2 (FIG. 2C). The transduction of 293T cells with syncytin-pseudotyped vectors led to a stable genomic integration of the transgene over time as examined in continuous cultures lasting 2 weeks (Supplementary Figure S1B). The level of gene expression was coherent with the number of copies per cell, showing no evidence of transgene silencing over time (FIG. 2D).

    [0227] The discovery of the enhancing effects of the VF1 peptide on LV-Syn1 and LV-Syn2 infectivity enabled the development of a robust infectious titration assay using 293T cells. The choice of the 293T cell line was prompted by failure to transduce HCT116 colon carcinoma cells which are routinely used to titer VSVg-pseudotyped LV in the laboratory. HCT116 could not be transduced with LV-Syn1 or LV-Syn2 at any concentration tested and even in the presence of Vectofusin-1 (Supplementary Figure S1C). In addition, 293 T cells were preferred over BeWo cells for this infectious titer assay because of more consistent growth patterns and a trend to higher transduction levels in repeat experiments (Supplementary Figure S1C). In the conditions defined for the assay (see Materials and Methods), the infectious titer of concentrated and cryopreserved batches of GFP-encoding LV-Syn1 and LV-Syn2 were respectively 2.8±6×E+06 TU/mL (n=6 batches) and 2.7±6×E+06 TU/mL (n=6 batches) for GFP transgene and 6.3±7.5×E+06 TU/mL (n=3 batches) and 4.4±1.5×E+06 TU/mL (n=2 batches) for dNGFR transgene (Table 1). Thus syncytin-1 and syncytin-2 glycoproteins can pseudotype rHIV vectors to obtain stable particles that are infectious and useful for stable gene transfer. Their infectivity requires co-factors and is selective at the cellular level.

    [0228] LV-Syn1 and LV-Syn2 Vectors Efficiently Transduce Naive Blood Cells

    [0229] Syncytins are cellular proteins, which may be useful to derive immunologically-tolerated vectors for in vivo applications. Thus, to evaluate if syncytin-pseudotyped vectors would interact with blood cells, the inventors added the vectors to peripheral blood mononuclear cell (PBMC) in vitro. PBMCs were infected either immediately after their in vitro isolation, or following an overnight culture in the presence of IL-7 aiming at maintaining the viability of naive lymphocytes (Supplementary Figure S2A). After the infection step, cells were cultured in the presence of IL-7 to support cell viability for at least 3 days. Globally, transgene expression was low on the total nucleated cell population expressing CD45 (Supplementary Table S1). However, significantly higher amounts of cells were transduced in the presence of VF1 compared to mock controls without vector (Supplementary Table S1). The effects of LV-Syn1 were comparable to those of VSVg. Cells that had been preactivated with IL-7 were better transduced than cells infected immediately upon isolation.

    TABLE-US-00003 SUPPLEMENTARY TABLE S1 Transduction of whole PBMC with LV-Syn1 and LV-Syn2 in the presence of Vectofusin-1 No vector LV-Syn1 LV-Syn2 LV-VSVg VF1 − + − + − + − + Prior activation with IL-7 Average ± SD 0.1 ± 0.1 0.3 ± 0.2 1.0 ± 0.1 12.7 ± 14.6.sup.& 1.7 ± 1 4.5 ± 2.7.sup.& 5.9 ± 7.8.sup.& 5.4 ± 1.sup.& n 9 7 3 9 3 7 9 6 Non-activated PBMC Average ± SD 0.2 ± 0.2 0.7 ± 0.7 2.7 ± 3.3 5.7 ± 6.7.sup.& 1.4 ± 1.6 0.8 ± 0.5 4.0 ± 2.0.sup.& 6.0 ± 2.5.sup.& n 6 6 2 6 2 6 6 6 Legend: Average percentage ± SD of total nucleated cells (CD45+) expressing GFP, 3 days after infection of PBMC. The cells were preactivated with IL-7 or not as indicated, and were transduced with indicated LV in the presence or absence of Vectofusin-1 (VF1) additive. PBMC were obtained from different donors and the number of donors (n) tested is indicated. .sup.&p < 0.05 compared to “no vector” in a paired Student's t test

    [0230] PBMC contain multiple subsets of cells in different proportion. As shown in FIG. 3 and Table 2, transgene expression was found in a large proportion of CD19+ B lymphocytes and CD11c+ myeloid/dendritic cells (which are a minority in PBMC) whereas only a fraction of CD3+ T cells (which are more abundant in PBMC) were marked in agreement with the overall low results of transduction obtained in CD45+ cells. An average of 59% each of CD19+ cells or of CD11c+ cells were transduced by LV-Syn1 following a pre-activation with IL-7 (Table 2). As observed with 293T and BeWo cells, adding VF1 was necessary to achieve PBMC transduction as few cells were transduced in the absence of this additive. The VF1 peptide also enhanced the transduction of PBMC by LV-VSVg.

    TABLE-US-00004 TABLE 2 Transduction of human peripheral blood cell subsets with the syncytin-pseudotyped LV CD19+ CD3+ CD11c+ B cells T cells myeloid cells no activation PBS 0.0 ± 0   0.1 ± 0.1 0.2 ± 0.3 LV-Syn1 2.3 ± 4.3 1.3 ± 2.6 5.5 ± 6.3 LV-Syn2 0.6 ± 0.4 0.4 ± 1.0 0.2 ± 8.2 LV-VSVg 3.6 ± 5.0 2.8 ± 2.9 11.5 ± 3.5  VF1 3.3 ± 4.0 0.24 ± 0.2  7.8 ± 8.4 LV-Syn1 + VF1 35.7 ± 24   3.61 ± 3.6  57.7 ± 11   LV-Syn2 + VF1 22.2 ± 26   1.49 ± 1.9  35.5 ± 34   LV-VSVg + VF1 27.6 ± 17   0.97 ± 0.6  45.2 ± 16   IL-7 activation PBS 0.3 ± 0.4 0.5 ± 0.4 0.8 ± 0.6 LV-Syn1 2.1 ± 2.6 0.8 ± 0.3 4.1 ± 6.0 LV-Syn2 1.8 ± 1.5 1.5 ± 1.0 2.2 ± 2.2 LV-VSVg 2.6 ± 1.6 1.3 ± 0.6 2.4 ± 0.8 VF1 0.8 ± 0.5 0.18 ± 0.2  0.25 ± 0.5  LV-Syn1 + VF1 59.3 ± 23   11.2 ± 19   59.2 ± 18   LV-Syn2 + VF1 44.0 ± 24   6.1 ± 10  40.1 ± 15   LV-VSVg + VF1 32.1 ± 18   3.5 ± 1.4 35.1 ± 10   Legend: Human PBMC were transduced with the indicated vectors and with or without Vectofusin-1 (VF1) in steady-state conditions (no activation) or following a short overnight pre-activation with IL-7, the subsequently cultured with IL-7 for 3 days. Transduction results are expressed as the average percentage ± SD of cells positive for GFP in CD3+ (T cells), CD19+ (B cells) or CD11c+ (dendritic myeloid cells) cells in culture, 3 days after infection. Data represent 3 separate experiments without VF1 and 8 to 9 separate experiments in the presence of VF1.

    [0231] Remarkably, it was possible to transduce non-activated CD19+ cells suggesting that truly naïve cells can be targeted by syncytins. Various subsets of CD19+ B cells have been characterized (Kaminski et al, 2012) including naïve CD19+ CD27− IgD+ cells (50-70% of the population); memory non-switched CD19+ CD27+ IgD+ cells (15-20% of the population); memory switched CD19+ CD27+ IgD− IgM− cells (2-5% of the population); memory switched IgM only CD19+ CD27+ IgD−IgM+ cells (2-5% of the population) and plasmablasts CD19+ CD27hi (1-2% of the population). The FACS gating strategies following infection of PBMC are shown in Supplementary Figure S2B. Overall, both naïve and memory B cell subsets were effectively transduced with the syncytin-pseudotyped vectors regardless of prior activation (FIG. 3). In greater detail, all memory B cell subsets were found to be transduced in the absence of prior activation (Table 3). In such non-activated conditions, syncytin-pseudotyped vectors transduced B cells more effectively than LV-VSVg suggesting a specific tropism of the syncytins for these cells. The B cell transducing effects of LV-Syn1 and LV-Syn2 were found to be vector concentration dependent (FIG. 4) and transgene independent. Almost all peripheral blood CD19+ cells could be transduced using 10.sup.6 TU/mL of LV-Syn1 or LV-Syn2 vectors encoding either GFP or ΔNGFR thereby providing a very effective system to express various types of heterologous proteins in these cells.

    TABLE-US-00005 TABLE 3 Percentage of transduction of B cells subsets Memory Memory Memory Naive non-switch IgM only switched Plasmablasts PBS 0.2 ± 0.3 0.0 ± 0   0.3 ± 0.5 0.5 ± 1   0.3 ± 0.6 VF1 0.6 ± 0.5 1 ± 0.1 0 ± 0 0.3 ± 0.5 0.3 ± 0.6 LV-Syn1 0.4 ± 1.1 1 ± 0.9 0.2 ± 0.3 0 ± 0 0.3 ± 0.6 LV-Syn1 + VF1 62 ± 26 23 ± 3.3  16 ± 13 41 ± 11 32 ± 13 LV-Syn2   1 ± 0.1 4 ± 5.2 5 ± 6   4 ± 5.3 1.00 ± 1.4  LV-Syn2 + VF1 52 ± 29 29 ± 15   27 ± 34 26 ± 30  29 ± 8.5 LV-VSVg 0.1 ± 0.1 9 ± 8.4 4 ± 4 10 ± 16   2 ± 1.1 LV-VSVg + VF1 14 ± 14 18 ± 16   12 ± 11 20 ± 11 nd Legend: Human PBMC were transduced in steady-state conditions with LV-Syn1 or LV-Syn2 (1E10.sup.5 TU/mL) or LV-VSVg (1E10.sup.7 TU/mL). Results are the average percentage ± SD of cells positive for GFP in the indicated populations defined as naive B cells (CD3−, CD19+, CD27−, IgM+, IgD+ cells); memory non-switch B cells (CD3−, CD19+, CD27+, IgM+, IgD+ cells); memory IgM only B cells (CD3−, CD19+, CD27+, IgM+, IgD− cells); memory switched B cells (CD3−, CD19+, CD27+, IgM−, IgD−) and plasmablasts (CD3−, CD19+, CD27high), 3 days after infection. Data represent 2 to 3 separate experiments with 1 to 2 different donor per experiment. nd = not determined because too few cells to analyze in the gate.

    [0232] Functional B Cells are Stably Transduced with Syncytin-Pseudotyped Vectors

    [0233] To exclude that the observed effects were non-specific, caused by pseudo-transduction or by artefactual auto-fluorescence of Vectofusin-1 which can occur upon aggregation (Fenard et al 2013) the inventor verified proviral integration in cells treated with the vector and cultured over time. Following addition of the vector to the cells, the inventors added CD40L and IL-4 to activate and expand the culture for 8-14 days. In such cultures, the inventors detected vector copies specifically when vectors were added together with Vectofusin-1 (Table 4) even though conditions were not optimal to ensure the survival of all cells. In addition, using B cell-activation signals such as CD40 ligand (CD40L) and IL-21 previously reported to be essential for the development of memory B cells (Recher et al 2011), the inventors confirmed that transduced B cells could be activated efficiently (Table 5). Using CFSE marking and flow cytometry to detect B cell division and transgene expression, the inventors confirmed the marking of cells capable of responding to CD40L and IL-21 and with activated B cell, including plasmablast, phenotype (Table 5). To further confirm the transduction of functional B cells, the inventors used EBV to transform PBMC immediately after they had been infected with the LV-Syn1 vector and obtained lymphoblastic cells containing stably integrated vector sequences (Table 4). These results confirm that the syncytin vectors can stably transduce primary B cells that retain functional ability to proliferate and be expanded.

    TABLE-US-00006 TABLE 4 Functional B cells are stably transduced by syncytin-pseudotyped LV VCN Experiment 1 Experiment 2 CD40L + IL-4 (Day 13) (Day 7) PBMC 0.0 0.0 PBMC + VF1 0.0 0.0 PBMC + LV-Syn1 + VF1 3.8 0.4 PBMC + LV-Syn2 + VF1 0.3 0.0 PBMC + LV-VSVg 0.2 0.1 PBMC + LV-VSVg + VF1 0.2 0.0 VCN Experiment 1 Experiment 2 EBV (Day 14) (Day 14) PBMC 0 0; 0; 0 PBMC + VF1 0 not done PBMC + LV-Syn1 + VF1 0.5 0.02; 0.06; 0.2 PBMC + LV-Syn2 + VF1 not done 0.02; 0.02; 0.2 PBMC + LV-VSVg 0.05 not done Legend: PBMC were activated with IL-7 and transduced in the indicated conditions, then cultured for 6-13 days in the presence of CD40L and IL4 (top table) or incubated with EBV and cyclosporin A for immortalization using standard procedures and cultured for 2 weeks (bottom table). At the indicated times, genomic DNA was extracted from the culture and the average number of integrated vector copy per cell (VCN) was measured by qPCR. In experiment 2 of EBV transformation, results are shown with 3 different blood donors.

    TABLE-US-00007 TABLE 5 In vitro activation of transduced primary CD19+ B cells Day 3 Day 6 IL-21 IL-21 + CD40L IL-21 IL-21 + CD40L LV- LV- LV- LV- LV- LV- LV- LV- Syn1 Syn2 Syn1 Syn2 Syn1 Syn2 Syn1 Syn2 % NGFR+ 37.2 ± 5.3  60.2 ± 8 26.8 ± 9.4  45.8 ± 11.5 39.8 ± 9.4  45.3 ± 6.9  17.3 ± 2.7 23.3 ± 6.8  B cells % NGFR+ 25.2 ± 15.7 16.7 ± 6  77.5 ± 16.4 82.3 ± 10  28.8 ± 12.8 28.7 ± 14.1 93.2 ± 3.4 93.5 ± 4   B cells in CFSE division % NGFR− 35.3 ± 16.7  34.2 ± 17 85.8 ± 7.4 91.0 ± 4.4 40.5 ± 18.9 31.7 ± 8.6  94.8 ± 1.2 95.2 ± 1.5  B cells in CFSE division % plasmablast 4.4 ± 1.8   5.7 ± 2.7 13.6 ± 4.8 14.1 ± 5.2 17.8 ± 13.1 18.2 ± 11.2  29.8 ± 13.1 28.9 ± 12.2 on NGFR+ B cells % plasmablast 4.7 ± 1.2   6.0 ± 3.0 15.8 ± 5.7 14.5 ± 5.6 20.8 ± 14.1 16.3 ± 12.sup.  32.7 ± 15  30.2 ± 10.9 on NGFR− B cells n = 6 different healthy donors Legend. PBMCs were labeled with 2 μM CFSE, transduced with Lv-Syn1-2 NGFR, and cultured in the absence or presence of CD40Ligand [2 μg/mL] and IL-21 [50 ng/mL]. After 3 and 6 days culture, B cell transduction (ie, NGFR expression), B cell proliferation (ie, CFSE dilution) and the frequency of CD19+ CD27++ plasmablasts were determined by flow cytometry.

    [0234] Transduction of Murine Primary B Cells

    [0235] Freshly-isolated murine spleen cells were cultured with LV-Syn1 or LV-SYn2 vectors encoding ΔNGFR for 3 days. As shown in Supplementary Figure S7 this resulted in a very efficient transduction of CD19+ B cells. In these cultures, much fewer CD19− cells were transduced in proportion, thus confirming the particular tropism of the syncytin-pseudotyped vectors for B cells in mice as in humans. The data also show that the syncytin-1 and syncytin-2 glycoproteins recognize murine counterparts and these findings will facilitate future preclinical studies with these vectors.

    [0236] Transduction of CD11c+ Cells

    [0237] As seen in FIG. 3, a large proposition of CD19− CD3− CD11c+ cells was transduced with LV-Syn1 and LV-Syn2 from PBMC without prior activation and in the presence of Vectofusin-1. Further phenotyping showed that such CD11c cells also expressed high levels of HLA-DR and were transduced effectively with the syncytin-pseudotyped vectors (FIG. 5). The cells were grown in GM-CSF+IL-4, expressed CD1a, CD80, CD86 and lacked CD14, suggesting that they were immature dendritic cells (Supplementary Figure S3A). In addition, CD14+ HLA-DR+ cells which have the phenotype of monocytic cells are also transduced (Supplementary Figure S3B). Thus, both LV-Syn1 and LV-Syn2 can be used effectively to express a transgene in antigen presenting cells.

    [0238] LV-Syn1 and LV-Syn2 Vectors do not Efficiently Transduce Primary Human T Cells

    [0239] Peripheral blood T cells were not efficiently transduced by the syncytin-pseudotyped LV, although some cells could be transduced upon activation. Following prior activation with IL-7, a small proportion of peripheral blood T cells was transduced with LV-Syn1 or LV-Syn2 vectors but these effects were not consistent from experiment to experiment (FIG. 3 and Table 2). Without prior activation, transduction levels were always low.

    [0240] Thus, differential transduction of blood cell subsets is observed with syncytin-pseudotyped vectors.

    [0241] Expression of the ASCT2 and MFSD2a Receptors on Blood Cell Subsets and Cell Lines

    [0242] ASCT2 and MFSD2a which are respectively the entry receptors for syncytin-1 and syncytin-2 were detected on the cell surface of blood cell subsets using and indirect immunofluorescence detection (FIG. 6A). The highest percentage of cells expressing these markers were CD19+ and CD11c+ cells, whereas T cells expressed lower levels of these receptors (FIG. 6B). These results were confirmed by qRT-PCR, which show for the first time that human B cells express MFSD2a and ASCT2 (FIG. 6-C). Expression of ASCT2 and MFSD2a was also found on 293T cells whereas it was at a much lower level of HCT116 cells which are not transduced with the vectors (Supplementary Figure S4). On cells tested, the expression of the receptors correlated well with the transduction levels that were achieved.

    [0243] Human B and T Cell Lines are Transduced with Syncytin-Pseudotyped Vectors

    [0244] To extend the results obtained on primary cells and to further assess the cellular specificity of the syncytin-pseudotyped vectors, the inventors attempted to transduce a panel of human cell lines. The Burkitt's lymphoma Raji B cells and Jurkat T cells were tested. Raji B cells could be transduced with the Syncytin-pseudotyped vectors (Supplementary Figure S5). The highest levels obtained in Raji cells using 2×10.sup.6 TU/mL of LV-Syn2 vector reached 16% (as opposed to >90% reached with 10.sup.6 TU/mL in primary B cells as seen in FIG. 4). The inventors verified that Raji cells were permissive for transduction with LV because 88% transduction of Raji cells were transduced with 10.sup.8 TU/mL LV-VSVg (control of Supplementary Figure S5, not shown). In one experiment, transduced Raji cells were sorted by flow cytometry and cultured for 49 days, demonstrating the stable integration of the transgene for prolonged periods of time (Supplementary Table S2). Jurkat T cells were partially transduced with syncytin-pseudotyped vectors (Supplementary Figure S5). Thus syncytin-pseudotyped LV can be used as gene transfer tools for some cell lines. In B cells, transduction appears to be more effective in primary cells than with established B cell lines.

    TABLE-US-00008 SUPPLEMENTARY TABLE S2 Stable transduction of Raji cells with Syncytin-pseudotyped vectors % GFP+ cells VCN Sorted GFP− Sorted GFP+ Sorted GFP− Sorted GFP+ Vector cells cells cells cells LV-Syn1 0 72.8 0 1.003 LV-Syn2 0 93.8 0.001 1.017 LV-VSVg 0.3 86.3 0.116 6.177 Legend: Three different GFP-encoding vectors were used at the concentration of 1.2 10.sup.5 TU/mL to infect Raji cells in the presence of Vectofusin-1 (12 μg/mL). After 2 weeks, the expression of GFP was 2.5% with LV-Syn1, 5% with LV-Syn2, and 100% withLV-VSVg vector. After 30 days, cells expressing GFP (GFP+) or not (GFP−) were sorted by flow cytometry and these sorted cells were cultured until day 49 to measure GFP expression by FACS and the average vector copy number per cell (VCN) by qPCR.

    [0245] Functional Correction in a Primary Immune Deficit

    [0246] Severe combined immunodeficiency type-1 (SCIDX1) is an X-linked primary immunodeficiency which is caused by mutations in the interleukin 2-receptor gamma chain (IL2Rg) gene. Allogeneic bone marrow transplantation can cure the disease but some patients remain incompletely corrected with only partial chimerism in B cells (Recher et al 2011). Patients with less than 5% B cell chimerism remain incapable of maturing and producing immunoglobulins. Their B cells remain incapable of becoming mature memory IgG secreting B cells. Indeed, it was found recently that IL2Rg is also the receptor for IL-21 providing essential signals for the maturation of B cells (Recher et al 2011). Several gene therapy trials have been attempted to treat this disease using IL2Rg gene transfer in hematopoietic stem and progenitor cells. However, without conditioning of the patient, the gene-corrected cells only produce corrected T cells and B cells remain uncorrected as shown in the most recent gene therapy trial (Hacein-Bey-Abina et al 2014). As a result, such patients B cells are non-functional and patients remain dependent upon immunoglobulin infusion to prevent infections. This prompted the inventors to ask if syncytin-pseudotyped vectors could be used to transfer IL2Rg to peripheral B cells in patients who have been incompletely corrected by gene therapy. Cells from a patient were obtained. The patient blood mononuclear cells were found to contain CD3+ IL2Rg+ T cells but contrary to healthy individuals, the patient blood CD19+ B cells did not express the maturation marker CD27, did not express IL2Rg (FIG. 7A and B) and did not produce IgG (Table 6). Upon gene transfer with LV-syncytin1 vectors encoding the IL2Rg, patients cells were able to respond to CD40L+IL-21 by producing IgG in medium, even though activation markers were not detected on the cells, probably due to the high level of mortality of these fragile cells in culture. These results demonstrate that peripheral blood B cells can be targeted by gene transfer to provide some functional correction in SCIDX1 and that syncytin-pseudotyped LV are useful tools for this application.

    [0247] In Vivo Experiments

    [0248] The efficient transduction of primary human B cells by LV-Syn1 prompted to test if this vector functioned in vivo Immunodeficient NSG mice were first engrafted with 10.sup.7 PBMC per mouse and the next day received a single bolus of LV-Syn1 intravenously. After 7 days, mice were sacrificed and different tissues were examined In 2 mice out of 3, the inventors found the presence of CD45+ CD19+ human B cells in the spleen in which a small proportion (3-15%) expressed GFP suggesting that they had been transduced in vivo (Supplementary Figure S6). These preliminary results suggest the possibility of using syncytin-pseudotyped vectors to target human B cells in vivo.

    EXAMPLE 2

    Murine Syncytin-A and In Vivo Gene Delivery in Mice with LV-SynA

    [0249] Production of Stable and Infectious LV-SynA Particles

    [0250] Materials and Methods (See Also Materials and Methods for Example 1)

    [0251] Cloning of Syncytin A and Production of LV-Syn A.

    [0252] a. Generation of a Plasmid Expressing Murine Syncytin-A.

    [0253] The cloning of the murine syncytin-A cDNA into the HindIII and XbaI sites of the pcDNA3.1 eukaryotic expression plasmid was performed by inserting a PCR-amplified fragment from the pUC-SynA plasmid generated by Genecust (Ellange, Luxembourg) and which contains the Syn-A murine gene full-length cDNA (Ensembl reference ENSMUSG00000085957) using the following primers forward 5′ AGCAAGCTTATGGTTCGTCCTTGG 3′ (SEQ ID NO:32) (Tm=69.8° C.; % GC=50%; Sigma, Saint-Louis, USA) and reverse 5′ AGCTCTAGACTAGACGGCATCCTC 3′ (SEQ ID NO:33) (Tm=65° C.; % GC=54%; Sigma) and ligation. The plasmid was verified by sequencing (Beckman Coulter Genomics, Takeley, UK).

    [0254] b. Production of Syn-A-Pseudotyped Lentiviral Vectors.

    [0255] HEK293T cells plated in T175 cm2 flasks in DMEM+10% fetal calf serum (FCS) were co-transfected with the following 4 plasmids (quantities per flask): pKLgagpol (14.6 μg), pKRev (5.6 μg), pcDNA3.1-SynA (20 μg), and transfer plasmid either PRRL-SFFV LucII or pRRL-SFFV-LucII-2A-ΔNGFR-WPRE (22.5 μg). After 24 hours, the cells are washed and fresh fmedium is added. The following day, medium is harvested, clarified by centrifugation 1500 rpm for 5 min and filtered 0.45 μm, then concentrated by ultracentrifugation 50000 g for 2 h at 12° C. and stored at −80° C. until used.

    [0256] c. Titration of Syncytin-A-Pseudoptyped LV.

    [0257] Physical titer was determined by p24 ELISA as for other types of LV. Infectious titer was determined as infectious genome titer (IG/mL) using the murine lymphoma cell line A20. Serial dilutions of vector are added to A20 cells in the presence of Vectofusin-1® (12 μg/uL) for 6 hours. Medium is renewed and cells are incubated for 7 days and genomic DNA is obtained to measure vector copy number per cells using duplex qPCR on iCycler 7900HT (Applied Biosystems) with the primers: PSI forward 5′CAGGACTCGGCTTGCTGAAG3′ (SEQ ID NO:34), PSI reverse 5′ TCCCCCGCTTAATACTGACG3′ (SEQ ID NO:35), and a PSI probe labeled with FAM (6-carboxyfluoresceine) 5′CGCACGGCAAGAGGCGAGG3′ (SEQ ID NO:36), Titin forward 5′ AAAACGAGCAGTGACGTGAGC3′ (SEQ ID NO:37), Titin reverse 5′TTCAGTCATGCTGCTAGCGC3′ (SEQ ID NO:38) and a Titin probe labeled with VIC 5′TGCACGGAAGCGTCTCGTCTCAGTC3′ (SEQ ID NO:39).

    [0258] In Vivo Bioluminescent Gene Transfer in Mice.

    [0259] LV-SynA encoding LucII vector was produced and 5×10.sup.5 TU of vector were injected intravenously into albinos C57Bl/6 mice. Controls included LV-VSVg encoding LucII and PBS. For the detection of bioluminescence, mice were anesthetized with ketamine (100 mg/kg)/xylasine (10 mg/kg), and 100 μL of 150 μg/mL D-luciferin was administered intra-peritoneally and imaged 10 min later with a CCD camera ISO14N4191 (IVIS Lumina, Xenogen, MA, USA). A 3 min bioluminescent image was obtained using 15 cm filed-of-view, binning (resolution) factor 4, 1/f stop and open filter. Region of interest (ROIs) were defined manually (using a standard area in each case), signal intensities were calculated using the living image 3.0 software (Xenogen) and expressed as photons per second. Background photon flux was defined from an ROI drawn over the control mice or control muscle where no vector had been administered.

    [0260] Results

    [0261] Murine Syncytins were explored for in vivo applications. Syncytin A is non-orthologue but functionally similar murine counterpart to human Syncytins-1 and -2 (Dupressoir et al 2005). We cloned the murine SynA into an expression plasmid and used it to produce lentiviral vector particles. We found that SyncytinA can successfully pseudotype rHIV-derived LV. We used the same conditions already defined for the production of human syncytin-pseudotype LV (22 Ug DNA per plate, one harvest only) to generate stable LV-SynA. LV-Syn A were very efficient at transducing the murine A20 B lymphoma cell line in the presence of VF1 (Figure S8) (Supplementary table S4). We found that SynA was as efficient as its human counterparts to transduce primary non-activated murine B cells in vitro. As seen in FIG. 8 and FIG. 9 LV-SynA were capable of transducing without pre-treatment murine B cells from spleen (FIG. 8) and from bone marrow (FIG. 9). These experiments also show that murine T cells can be transduced as well. The transduction of B220 low cells suggests that immature B cells were transduced and can be targeted for biological applications.

    [0262] Interestingly, it was possible to transduce human CD19+ B cells with LV pseudotyped with the murine syncytin A (supplementary table S5)

    [0263] LV-Syn A proved to be efficient for gene delivery in vivo in mice. FIG. 10 shows the bioluminescent detection of the transgene 16 days after injection of a LV-SynA vector encoding LucII. The vector was injected through the mice tail vein and the inventors did not use vectofusin for this. The presence of vector in the spleen CD45+ CD19+ cells was confirmed by purifying spleen cells by flow cytometry cell sorting and measuring the levels of transduction by q-PCR (supplementary table S3). Thus, Syncytins are unique tools to mediate entry into human and murine B cells in vitro and in vivo.

    TABLE-US-00009 SUPPLEMENTARY TABLE S3 In vivo delivery of the LucII transgene with LV-SynA. Vector copy number Whole spleen Spleen CD45 cells Spleen CD45+ 19+ cells 0.039 0.002 0.039 Legend: the table shows the vector copy number obtained on cell subpopulations obtained by flowcytometry cell sorting of spleen cells using CD45 and CD19 antibodies. CD45− cells represent stromal cells of non-hematopoietic origin. CD45+ CD19+ cells are B cells.

    TABLE-US-00010 SUPPLEMENTARY TABLE S4 Infectious titration of Lv-SynA on the murine B lymphoma cell line A20. Titer ng Titer Titer n P24/mL TU/mL GI/mL SynA 10 1.74 .Math. 10.sup.5 7.1 .Math. 10.sup.6  1.3 .Math. 10.sup.6 10  2.3 .Math. 10.sup.5 1.98 .Math. 10.sup.7  4.72 .Math. 10.sup.6 LV-VSVg 1 5.23 .Math. 10.sup.5 2.1 .Math. 10.sup.7 — Legend: different LV-SynA and LV-VSVg productions and titers obtained in physical particles (ng p24/mL) and infectious particles (TU/mL and GI/ML). TU: transduction unit, GI: infectious genome.

    TABLE-US-00011 SUPPLEMENTARY TABLE S5 Transduction of human CD19+ B cells with syncytin-A-pseudotyped LV. CD19+ B ells Conditions nb copies donor 1 Non transduced 0.04 LV-SA LucII 9.4 LV-S1 NGFR 3.6 donor 2 Non transduced 0.1 LV-SA LucII 1.9 LV-S1 NGFR 1.1 donor 3 Non transduced 0.05 LV-SA LucII 3.7 LV-S1 NGFR 2.0 Legend: Human peripheral blood CD19+ B cells were obtained from 3 separate blood donors, and were prepared by Ficoll separation of the mononuclear cells followed by positive selection of CD19+ B cells using magnetic beads and the Miltenyi AutoMacs system. CD19+ cells were incubated in the indicated conditions, using various preparations of LV pseudotyped with syncytin A, or syncytin 1 and expressing different transgenes. We used 2 μL of concentrated vector on the cells in the presence of Vectofusin-1 (12 μg/mL). Cells were washed after 6 hours and cultured for 4 days before measuring the number of integrated vector copies per cell using a duplex qPCR as described in (Merten et al. 2011).

    EXAMPLE 3

    Physical Titers Determination: Correspondence Between Physical Titer Obtained by p24 RT ELISA and by Direct Particle Counting with an Automated Counter.

    [0264] Physical titers were determined by 2 different methods for HIV-1-derived lentiviral vectors (LV) pseudotyped with syncytin-1 (S1), syncytin-2 (S2), syncytin A (SA) or with VSVg, and encoding either the truncated form of the nerve growth factor receptor (ΔNGFR) or the green fluorescent protein (GFP). The LV were produced by transient transfection, concentrated by ultracentrifugation and cryopreserved a −80° C. before titration.

    [0265] The methods consisted either of (a) an ELISA measuring the p24 concentration in the sample followed by a calculation of the titer as physical particles (pp) assuming that 1 fg of p24 corresponds to 12 pp of LV (Farson et al, 2001) or (b) using the NS300 Nanosight particle counter from Malvern Instruments (UK) which directly measures the particle concentration in the sample using automated microscopy.

    TABLE-US-00012 SUPPLEMENTARY TABLE S6 Titer pp/mL Titer pp/mL Vectors ELISA P24 Nanosight LV-S1-DNGFR 9.6 .Math. 10.sup.12 7.1 .Math. 10.sup.11 LV-S2-DNGFR   6 .Math. 10.sup.12 1.4 .Math. 10.sup.12 LV-SA Luc2-2A-DNGFR 2.8 .Math. 10.sup.12 9.9 .Math. 10.sup.11 LV-SA-DNGFR 2.4 .Math. 10.sup.12 7.7 .Math. 10.sup.11 LV-S2-DNGFR 9.4 10.sup.11   5 × 10.sup.11 LV-S1-DNGFR 1.6 × 10.sup.11 1.8 × 10.sup.11 LV-SA-Luc2 4.4 × 10.sup.11 3.1 × 10.sup.11 LV-VSVg-DNGFR 1.6 .Math. 10.sup.12 8.9 .Math. 10.sup.11 On average, a conversion factor between the titer pp/mL (ELISA P24) and the titer pp/mL (Nanosight) obtained as a [(mean titer ELISA P24)/(mean titer Nanosight)] is about 3.7, i.e. about 4.

    REFERENCES

    [0266] An D S, Xie Y, Chen I S (2001). Envelope gene of the human endogenous retrovirus HERV-W encodes a functional retrovirus envelope. Journal of virology 75: 3488-3489.

    [0267] Antony J M, Ellestad K K, Hammond R, Imaizumi K, Mallet F, Warren K G et al (2007). The human endogenous retrovirus envelope glycoprotein, syncytin-1, regulates neuroinflammation and its receptor expression in multiple sclerosis: a role for endoplasmic reticulum chaperones in astrocytes. Journal of immunology 179: 1210-1224.

    [0268] Biffi A (2015). Gene therapy for lysosomal storage disorders: a good start. Human molecular genetics.

    [0269] Blaise S, de Parseval N, Benit L, Heidmann T (2003). Genomewide screening for fusogenic human endogenous retrovirus envelopes identifies syncytin 2, a gene conserved on primate evolution. Proceedings of the National Academy of Sciences of the United States of America 100: 13013-13018.

    [0270] Blaise S, Ruggieri A, Dewannieux M, Cosset F L, Heidmann T (2004). Identification of an envelope protein from the FRD family of human endogenous retroviruses (HERV-FRD) conferring infectivity and functional conservation among simians. Journal of virology 78: 1050-1054.

    [0271] Blaise S, de Parseval N, Heidmann T (2005). Functional characterization of two newly identified Human Endogenous Retrovirus coding envelope genes. Retrovirology 2: 19.

    [0272] Blond J L, Lavillette D, Cheynet V, Bouton O, Oriol G, Chapel-Fernandes S et al (2000). An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor. Journal of virology 74: 3321-3329.

    [0273] Charrier S, Ferrand M, Zerbato M, Precigout G, Viornery A, Bucher-Laurent S et al (2011). Quantification of lentiviral vector copy numbers in individual hematopoietic colony-forming cells shows vector dose-dependent effects on the frequency and level of transduction. Gene therapy 18: 479-487.

    [0274] Cheynet V, Ruggieri A, Oriol G, Blond J L, Boson B, Vachot L et al (2005). Synthesis, assembly, and processing of the Env ERVWEl/syncytin human endogenous retroviral envelope. Journal of virology 79: 5585-5593.

    [0275] Cire S, Da Rocha S, Yao R, Fisson S, Buchholz C J, Collins M K et al (2014) Immunization of mice with lentiviral vectors targeted to MHC class II+ cells is due to preferential transduction of dendritic cells in vivo. PloS one 9: e101644.

    [0276] Cornelis G, Heidmann O, Degrelle S A, Vernochet C, Lavialle C, Letzelter C, et al (2013). Captured retroviral envelope syncytin gene associated with the unique placental structure of higher ruminants PNAS 110(9): E828-E837.

    [0277] Dewannieux M, Blaise S, Heidmann T (2005). Identification of a functional envelope protein from the HERV-K family of human endogenous retroviruses. Journal of virology 79: 15573-15577.

    [0278] Dewannieux M, Heidmann T (2013). Endogenous retroviruses: acquisition, amplification and taming of genome invaders. Current opinion in virology 3: 646-656.

    [0279] Dupressoir A, Marceau G, Vernochet C, Benit L, Kanellopoulos C, Sapin V et al (2005). Syncytin-A and syncytin-B, two fusogenic placenta-specific murine envelope genes of retroviral origin conserved in Muridae. Proceedings of the National Academy of Sciences of the United States of America 102: 725-730.

    [0280] Esnault C, Priet S, Ribet D, Vernochet C, Bruls T, Lavialle C et al (2008). A placenta-specific receptor for the fusogenic, endogenous retrovirus-derived, human syncytin-2. Proceedings of the National Academy of Sciences of the United States of America 105: 17532-17537.

    [0281] Farson D, Witt R, McGuinness R, Dull T, Kelly M, Song et al (2001) A new-generation stable inducible packaging cell line for lentiviral vectors. Hum Gene Ther. 20;12(8):981-97.

    [0282] Fenard D, Ingrao D, Seye A, Buisset J, Genries S, Martin S et al (2013). Vectofusin-1, a new viral entry enhancer, strongly promotes lentiviral transduction of human hematopoietic stem cells. Molecular therapy Nucleic acids 2: e90.

    [0283] Fischer A, Hacein-Bey Abina S, Touzot F, Cavazzana M (2015). Gene therapy for primary immunodeficiencies. Clinical genetics 88: 507-515.

    [0284] Frecha C, Costa C, Levy C, Negre D, Russell S J, Maisner A et al (2009). Efficient and stable transduction of resting B lymphocytes and primary chronic lymphocyte leukemia cells using measles virus gp displaying lentiviral vectors. Blood 114: 3173-3180.

    [0285] Frese S, Ruebner M, Suhr F, Konou T M, Tappe K A, Toigo M et al (2015). Long-Term Endurance Exercise in Humans Stimulates Cell Fusion of Myoblasts along with Fusogenic Endogenous Retroviral Genes In Vivo. PloS one 10: e0132099.

    [0286] Funke S, Maisner A, Muhlebach M D, Koehl U, Grez M, Cattaneo R et al (2008). Targeted cell entry of lentiviral vectors. Molecular therapy: the journal of the American Society of Gene Therapy 16: 1427-1436.

    [0287] Ghosh S, Thrasher A J, Gaspar H B (2015). Gene therapy for monogenic disorders of the bone marrow. British journal of haematology.

    [0288] Girard-Gagnepain A, Amirache F, Costa C, Levy C, Frecha C, Fusil F et al (2014). Baboon envelope pseudotyped LVs outperform VSV-G-LVs for gene transfer into early-cytokine-stimulated and resting HSCs. Blood 124: 1221-1231.

    [0289] Hacein-Bey-Abina S, Pai S Y, Gaspar H B, Armant M, Berry C C, Blanche S et al (2014). A modified gamma-retrovirus vector for X-linked severe combined immunodeficiency. The New England journal of medicine 371: 1407-1417.

    [0290] Hacein-Bey Abina S, Gaspar H B, Blondeau J, Caccavelli L, Charrier S, Buckland K et al (2015). Outcomes following gene therapy in patients with severe Wiskott-Aldrich syndrome. Jama 313: 1550-1563.

    [0291] Hummel J, Kammerer U, Muller N, Avota E, Schneider-Schaulies S (2015). Human endogenous retrovirus envelope proteins target dendritic cells to suppress T-cell activation. European journal of immunology 45: 1748-1759.

    [0292] Imakawa K, Nakagawa S, Miyazawa T (2015). Baton pass hypothesis: successive incorporation of unconserved endogenous retroviral genes for placentation during mammalian evolution. Genes to cells: devoted to molecular & cellular mechanisms 20: 771-788.

    [0293] Ingrao D, Majdoul S, Seye A K, Galy A, Fenard D (2014). Concurrent measures of fusion and transduction efficiency of primary CD34+ cells with human immunodeficiency virus 1-based lentiviral vectors reveal different effects of transduction enhancers. Human gene therapy methods 25: 48-56.

    [0294] Kaminski D A, Wei C, Qian Y, Rosenberg A F, Sanz I (2012). Advances in human B cell phenotypic profiling. Frontiers in immunology 3: 302.

    [0295] Kichler A, Mason A J, Marquette A, Bechinger B (2013). Histidine-rich cationic amphipathic peptides for plasmid DNA and siRNA delivery. Methods in molecular biology 948: 85-103.

    [0296] Kneissl S, Zhou Q, Schwenkert M, Cosset F L, Verhoeyen E, Buchholz C J (2013). CD19 and CD20 targeted vectors induce minimal activation of resting B lymphocytes. PloS one 8: e79047.

    [0297] Kutner R H, Zhang X Y, Reiser J (2009). Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors. Nature protocols 4: 495-505.

    [0298] Lavillette D, Marin M, Ruggieri A, Mallet F, Cosset F L, Kabat D (2002). The envelope glycoprotein of human endogenous retrovirus type W uses a divergent family of amino acid transporters/cell surface receptors. Journal of virology 76: 6442-6452.

    [0299] Majdoul S, Seye A K, Kichler A, Holic N, Galy A, Bechinger B et al (2015). Molecular determinants of Vectofusin-1 and its derivatives for the enhancement of lentiviral-mediated gene transfer into hematopoietic stem/progenitor cells. The Journal of biological chemistry.

    [0300] Malassine A, Blaise S, Handschuh K, Lalucque H, Dupressoir A, Evain-Brion D et al (2007). Expression of the fusogenic HERV-FRD Env glycoprotein (syncytin 2) in human placenta is restricted to villous cytotrophoblastic cells. Placenta 28: 185-191.

    [0301] Mangeney M, Renard M, Schlecht-Louf G, Bouallaga I, Heidmann O, Letzelter C et al (2007). Placental syncytins: Genetic disjunction between the fusogenic and immunosuppressive activity of retroviral envelope proteins. Proceedings of the National Academy of Sciences of the United States of America 104: 20534-20539.

    [0302] Merten O W, Charrier S, Laroudie N, Fauchille S, Dugue C, Jenny C et al (2011). Large-scale manufacture and characterization of a lentiviral vector produced for clinical ex vivo gene therapy application. Human gene therapy 22: 343-356.

    [0303] Nguyen L N, Ma D, Shui G, Wong P, Cazenave-Gassiot A, Zhang X et al (2014). Mfsd2a is a transporter for the essential omega-3 fatty acid docosahexaenoic acid. Nature 509: 503-506.

    [0304] Oburoglu L, Tardito S, Fritz V, de Barros S C, Merida P, Craveiro M et al (2014). Glucose and glutamine metabolism regulate human hematopoietic stem cell lineage specification. Cell stem cell 15: 169-184.

    [0305] Pochini L, Scalise M, Galluccio M, Indiveri C (2014). Membrane transporters for the special amino acid glutamine structure/function relationships and relevance to human health. Frontiers in chemistry 2: 61.

    [0306] Porter C D, Collins M K, Tailor C S, Parkar M H, Cosset F L, Weiss R A et al (1996). Comparison of efficiency of infection of human gene therapy target cells via four different retroviral receptors. Human gene therapy 7: 913-919.

    [0307] Porter D L, Hwang W T, Frey N V, Lacey S F, Shaw P A, Loren A W et al (2015). Chimeric antigen receptor T cells persist and induce sustained remissions in relapsed refractory chronic lymphocytic leukemia. Science translational medicine 7: 303ra139.

    [0308] Recher M, Berglund U, Avery D T, Cowan M J, Gennery A R, Smart J et al (2011). IL-21 is the primary common gamma chain-binding cytokine required for human B-cell differentiation in vivo. Blood 118: 6824-6835.

    [0309] Renard M, Varela P F, Letzelter C, Duquerroy S, Rey F A, Heidmann T (2005). Crystal structure of a pivotal domain of human syncytin-2, a 40 million years old endogenous retrovirus fusogenic envelope gene captured by primates. Journal of molecular biology 352: 1029-1034.

    [0310] Tolosa J M, Schjenken J E, Clifton V L, Vargas A, Barbeau B, Lowry P et al (2012). The endogenous retroviral envelope protein syncytin-1 inhibits LPS/PHA-stimulated cytokine responses in human blood and is sorted into placental exosomes. Placenta 33: 933-941.