PEPTIDES AND COMBINATION OF PEPTIDES FOR USE IN IMMUNOTHERAPY AGAINST CANCERS

Abstract

The present description relates to peptides, proteins, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present description relates to the immunotherapy of cancer. The present description further relates to tumor-associated T-cell peptide epitopes, alone or in combination with other tumor-associated peptides that can for example serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses, or to stimulate T-cells ex vivo and transfer into patients. Peptides bound to molecules of the major histocompatibility complex (MHC), or peptides as such, can also be targets of antibodies, soluble T-cell receptors, and other binding molecules.

Claims

1. A method of eliciting an immune response in a patient who has cancer, comprising administering to the patient a composition comprising a population of activated T cells that selectively recognize the cancer cells that present a peptide consisting of the amino acid sequence of KIQEILTQV (SEQ ID NO: 1), wherein said cancer is selected from the group consisting of oral carcinomas, H. pylori-induced MALT lymphoma, Ewing's sarcoma, head and neck squamous cell carcinoma, epithelial cancer of the larynx, carcinoma of the urinary bladder, atypical meningioma, papillary thyroid carcinoma, salivary duct carcinoma, cervical cancer, extranodal T/NK-cell lymphomas, and non-Hodgkin's lymphoma.

2. The method of claim 1, wherein the activated T cells are produced by contacting T cells with the peptide loaded human class I or II MHC molecules expressed on the surface of an antigen-presenting cell for a period of time sufficient to activate the T cells.

3. The method of claim 1, wherein the cancer is oral carcinomas.

4. The method of claim 1, wherein the cancer is H. pylori-induced MALT lymphoma.

5. The method of claim 1, wherein the cancer is Ewing's sarcoma.

6. The method of claim 1, wherein the cancer is head and neck squamous cell carcinoma.

7. The method of claim 1, wherein the cancer is epithelial cancer of the larynx.

8. The method of claim 1, wherein the cancer is carcinoma of the urinary bladder.

9. The method of claim 1, wherein the cancer is atypical meningioma.

10. The method of claim 1, wherein the cancer is papillary thyroid carcinoma.

11. The method of claim 1, wherein the cancer is salivary duct carcinoma.

12. The method of claim 1, wherein the cancer is cervical cancer.

13. The method of claim 1, wherein the cancer is extranodal T/NK-cell lymphomas.

14. The method of claim 1, wherein the cancer is non-Hodgkin's lymphoma.

15. The method of claim 1, wherein the composition further comprises an adjuvant.

16. The method of claim 15, wherein the adjuvant is selected from the group consisting of anti-CD40 antibody, imiquimod, resiquimod, GM-CSF, cyclophosphamide, sunitinib, bevacizumab, interferon-alpha, interferon-beta, CpG oligonucleotides and derivatives, poly-(I:C) and derivatives, RNA, sildenafil, particulate formulations with poly(lactide co-glycolide) (PLG), virosomes, interleukin (IL)-1, IL-2, IL-4, IL-7, IL-12, IL-13, IL-15, IL-21, and IL-23.

17. The method of claim 16, wherein the adjuvant is IL-2.

18. The method of claim 16, wherein the adjuvant is IL-7.

19. The method of claim 16, wherein the adjuvant is IL-15.

20. The method of claim 16, wherein the adjuvant is IL-21.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0227] FIG. 1 shows IGF2BP3-001 peptide presentation in normal tissues and cancers.

[0228] FIG. 2 shows IGF2BP3-001 expression in cancer and normal tissues.

[0229] FIG. 3 shows IGF2BP3-001 expression in cancer and normal tissues.

[0230] FIG. 4 shows IGF2BP3-001 expression in cancer and normal tissues.

[0231] FIG. 5 shows affinities of IGF2BP3 to HLA-A*02:01 Dissociation constants (KD) of IGF2BP3 and control peptides MUC-001 (intermediate binder) and MET-001 (strong binder) were measured by an ELISA-based assay.

[0232] FIG. 6 shows that IGF2BP3 mRNA is detectable in all evaluated cancer specimens as in Example 6. The level of expression covers a range from considerable expression in colorectal cancer, head and neck cancer, non-small cell lung cancer, ovarian cancer and esophageal cancer specimens (CCA001T, CCA006T, HNSC0017T1, NSCLC004T1, NSCLC005T1, 00038T, OSCAR052T1 and OSCAR055T1) to rather low expression in a pancreatic cancer specimen (PC002T).

DETAILED DESCRIPTION OF THE INVENTION

Examples

[0233] HLA-Binding

[0234] The SYFPEITHI routine (Rammensee et al., 1997; Rammensee et al., 1999) predicts binding of KIQEILTQV (SEQ ID NO: 1) to A*02:01 with an absolute score of 27 and a relative score of 0.74. The peptide IGF2BP3-001 was presented on cancer cells as follows:

TABLE-US-00004 TABLE 4 IGF2BP3-001 CRC GC HCC NSCLC OC OSCAR PC RCC Natural presentation of IGF2BP3-001 peptide target (MS data) Natural presentation directly shown on + + + + + + + + tumor samples Presentation on normal tissues Not detected on normal tissues (n = 241 samples) mRNA expression of IGF2BP3 source protein Over-expressed on tumor samples (% of 10 30 10 45 25 55 20 5 analyzed tumor samples) Over-expression reported in the + + + + + + + + literature High and medium risk class normal High risk: Lung (0.09/0.21) tissues with highest expression (RPKM Medium risk: Esophagus (0.47/1.85) values median/Q95) Low risk: Testis (1.89/3.2) Immunogenicity and/or functional T-cell data Immunogenic in a large fraction of tested A*02 positive donors (69%). Primed T-cells are able to kill peptide-pulsed target cells.

TABLE-US-00005 TABLE 5 Frequency of IGF2BP3-001 presentation A*02 Samples Mean intensity Normal 1 of 225 — Cancer 63 of 376 7.5e+06 cIPC 9 of 20 1.9e+07 CRC 3 of 28 1.0e+07 HCC 7 of 16 1.2e+07 OC 7 of 20 6.4e+06 OSCAR 2 of 16 6.1e+06 PC 3 of 19 8.3e+06 pCLL 2 of 11 9.8e+06 pCRC 3 of 24 1.0e+07 pGB 5 of 28 5.6e+06 pGC 11 of 45 6.4e+06 pNSCLC 18 of 91 6.8e+06 pPC 3 of 18 8.3e+06 pRCC 3 of 18 1.4e+07 RCC 3 of 22 1.4e+07 SCLC 2 of 13 6.4e+06

[0235] IGF2BP3-001 was quantified in >380 HLA-A*02 positive tumor samples including 16 different cancer types and >240 normal tissue samples of different origin covering all risk categories with a focus on high and medium risk organs (status: August 2015). FIG. 1 shows the relative peptide presentation levels of IGF2BP3-001 in these tissues. IGF2BP3-001 was frequently and exclusively found on primary tumor samples of different entities and not on normal tissues. Thus, the IGF2BP3-001 target is presented in the context of HLA-A*02 in a highly tumor-specific manner.

[0236] The data shown in FIG. 5 further provides evidence that IGF2BP3-001 is a peptide with very good binding to HLA-A*02:01.

[0237] Allo-reactive settings can be used to circumvent self-tolerance and yield T-cells with a higher avidity when compared to T-cells derived from autologous settings, i.e., patients. Examples of such settings include in vitro generation of allo-HLA reactive, peptide-specific T-cells (Sadovnikova et al. 1998; Savage et al. 2004; Wilde et al. 2012), and immunization of mice transgenic for human-MHC or human TCR (Stanislawski et al. 2001; Li et al. 2010).

Example 1

[0238] In vitro generation of allo-HLA reactive, peptide-specific T-cells (Savage et al. 2004) PBMCs from HLA-A*02-positive and HLA-A*02-negative healthy donors were used after obtaining informed consent. Recombinant biotinylated HLA-A2 class I monomers and A2 fluorescent tetramers containing IGF2BP3-001 were obtained from MBLI (Woburn, Mass.). PBMCs were incubated with anti-CD20SA diluted in phosphate buffered saline (PBS) for 1 hour at room temperature, washed, and incubated with the biotinylated A2/IGF2BP3-001 monomers for 30 minutes at room temperature, washed, and plated at 3×10.sup.6 cells/well in 24-well plates in RPMI with 10% human AB serum. Interleukin 7 (IL-7; R&D Systems, Minneapolis, Minn.) was added on day 1 at 10 ng/mL and IL-2 (Chiron, Harefield, United Kingdom) was added at 10 U/mL on day 4. Over a 5-week period cells were restimulated weekly with fresh PBMCs, mixed with responder cells at a 1:1 ratio, and plated at 3×10.sup.6/well in 24-well plates.

[0239] To obtain high avidity T-cells, approximately 10.sup.6 PBMCs with HLA-A2/IGF2BP3-001 tetramer-phycoerythrin (PE) (obtained from MBLI) were incubated for 30 minutes at 37° C., followed by anti-CD8-fluorescein isothiocyanate (FITC)/allophycocyanin (APC) for 20 minutes at 4° C., followed by fluorescence activated cell sorting (FACS)-Calibur analysis. Sorting was done with a FACS-Vantage (Becton Dickinson, Cowley, Oxford, United Kingdom). Sorted tetramer-positive cells were expanded in 24-well plates using, per well, 2×10.sup.5 sorted cells, 2×10.sup.6 irradiated A2-negative PBMCs as feeders, 2×10.sup.4 CD3/CD28 beads/mL (Dynal, Oslo Norway), and IL-2 (1000 U/mL). The high avidity T-cells, thus obtained, were then used to identify and isolate TCRs using techniques known in the art, such as single cell 5′ RACE (Rapid Amplification of cDNA Ends). Non-redundant TCR DNAs were then analyzed for amino acid/DNA sequences determination and cloning into expression vectors using methods well known in the art.

Example 2: Cloning of TCRs

[0240] Methods of cloning TCRs are known in the art, for example, as described in U.S. Pat. No. 8,519,100, which is hereby incorporated by reference in its entirety for said methods. The alpha chain variable region sequence specific oligonucleotide A1 (ggaattccatatgagtcaacaaggagaagaagatcc SEQ ID NO:11) which encodes the restriction site NdeI, an introduced methionine for efficient initiation of expression in bacteria, and an alpha chain constant region sequence specific oligonucleotide A2 (ttgtcagtcgacttagagtctctcagctggtacacg SEQ ID NO:12) which encodes the restriction site SalI are used to amplify the alpha chain variable region. In the case of the beta chain, a beta chain variable region sequence specific oligonucleotide B1 (tctctcatatggatggtggaattactcaatccccaa SEQ ID NO:13) which encodes the restriction site NdeI, an introduced methionine for efficient initiation of expression in bacteria, and a beta chain constant region sequence specific oligonucleotide B2 (tagaaaccggtggccaggcacaccagtgtggc SEQ ID NO:14) which encodes the restriction site AgeI are used to amplify the beta chain variable region.

[0241] Three TCRs (R10P1A7, R13P1C6, and R18P1C12), each encoding tumor specific TCR-alpha and TCR-beta chains, were isolated and cloned from T-cells of three healthy donors. TCR R18P1C12 was derived from HLA-A2 positive donor and TCR R10P1A7 and TCR R13P1C6 were derived from HLA-A2 negative donors.

[0242] The alpha and beta variable regions of the TCRs were sequenced. The TCR alpha and beta variable regions were then cloned into pGMT7-based expression plasmids containing either Cα or Cβ (respectively) by standard methods described in (Molecular Cloning a Laboratory Manual Third edition by Sambrook and Russell). Plasmids were sequenced using an Applied Biosystems 3730×1 DNA Analyzer.

[0243] The DNA sequences encoding the TCR alpha chain cut with NdeI and SalI were ligated into pGMT7+Cα vector, which was cut with NdeI and XhoI. The DNA sequences encoding the TCR beta chain cut with NdeI and AgeI was ligated into separate pGMT7+Cβ vector, which was also cut with NdeI and AgeI. Ligated plasmids are transformed into competent Escherichia coli strain XL1-blue cells and plated out on LB/agar plates containing 100 μg/ml ampicillin. Following incubation overnight at 37° C., single colonies are picked and grown in 10 ml LB containing 100 μg/ml ampicillin overnight at 37° C. with shaking. Cloned plasmids are purified using a Miniprep kit (Qiagen) and the insert is sequenced using an automated DNA sequencer (Lark Technologies).

[0244] Phage display can be used to generate libraries of TCR variants to identify high affinity mutants. The TCR phage display and screening methods described in (Li et al, (2005) Nature Biotech 23 (3): 349-354) can be applied to a reference TCR.

[0245] For example, all three CDR regions of the alpha chain sequence and all three CDR regions of the beta chain sequence can be targeted by mutagenesis, and each CDR library panned and screened separately.

[0246] Accordingly, TCRs with affinities and/or binding half-lives at least twice that of the reference TCR (and therefore impliedly at least twice that of the native TCR) can be identified.

[0247] TCR heterodimers are refolded using the method including the introduced cysteines in the constant regions to provide the artificial inter-chain disulphide bond. In that way TCRs are prepared, consisting of (a) the reference TCR beta chain, together with mutated alpha chains; (b) the reference TCR alpha chain together with mutated beta chains; and (c) various combinations of beta and alpha chains including the mutant variable domains.

[0248] The interaction between high affinity soluble disulfide-linked TCRs, and TCR variants, and the native peptide KIQEILTQV (SEQ ID NO: 1) HLA-A*02 complex can be analyzed using the BIAcore method.

[0249] High avidity TCR variants can also be selected from a library of CDR mutants by yeast, or T-cell display (Holler et al. 2003; Chervin et al. 2008). Candidate TCR variants, thus, provide guidance to design mutations of the TCR's CDRs to obtain high avidity TCR variants (Robbins et al. 2008; Zoete et al. 2007).

Example 3: Autologous T-Cell Engineering

[0250] T-cells can be engineered to express high avidity TCRs (so-called TCR therapies) or protein-fusion derived chimeric antigen receptors (CARs) that have enhanced antigen specificity to MHC I/IGF2BP3-001 complex or MHC II/IGF2BP3-001 complex. In an aspect, this approach overcomes some of the limitations associated with central and peripheral tolerance, and generate T-cells that will be more efficient at targeting tumors without the requirement for de novo T-cell activation in the patient.

[0251] In one aspect, to obtain T-cells expressing TCRs of the present description, nucleic acids encoding the tumor specific TCR-alpha and/or TCR-beta chains identified and isolated, as described in Examples 1-2, are cloned into expression vectors, such as gamma retrovirus or lentivirus. The recombinant viruses are generated and then tested for functionality, such as antigen specificity and functional avidity. An aliquot of the final product is then used to transduce the target T-cell population (generally purified from patient PBMCs), which is expanded before infusion into the patient.

[0252] In another aspect, to obtain T-cells expressing TCRs of the present description, TCR RNAs were synthesized by techniques known in the art, e.g., in vitro transcription systems. The in vitro-synthesized TCR RNAs were then introduced into primary CD8+ T-cells obtained from healthy donors by electroporation to re-express tumor specific TCR-alpha and/or TCR-beta chains.

[0253] To test whether the exogenous TCRs were functionally expressed on cell surface of the transformed T-cells, a tetramer staining technique was used to detect MHC/IGF2BP3-001-binding T-cells. As shown in FIG. 5 and Table 6, a higher percentage of CD3-positive specific T-cell population, i.e., 6.78% (TCR R10P1A7) and 16.54% (TCR R13P1C6), was observed in TCR-expressing CD8+ T-cells by fluorescent-labeled MHC/IGF2BP3-001 tetramer staining than that with MHC/unrelated peptide (e.g., NYESO1-001) tetramers, e.g., 1.53%, or mock control, e.g., 1.73%. As a control, primary CD8+ T-cells transformed with unrelated TCRs, such as 1G4 TCR, which is known to bind specifically to MHC/NYESO1-001 complex, was readily detected by MHC/NYESO1-001 tetramer, i.e., 17.69%. These results indicate that TCR R10P1A7 and TCR R13P1C6 are expressed on T-cell surface and can bind specifically to MHC/IGF2BP3-001 complex.

[0254] To determine whether the TCRs induce MHC/IGF2BP3-001-specific cytotoxic activity, the transformed CD8+ T-cells were co-incubated with IGF2BP3-001-loaded target cells or with target cells loaded with similar but unrelated peptide, or with the controls, e.g., unloaded target cells and CD8+ T-cells only, followed by IFN-γ release assay. IFN-γ secretion from CD8+ T-cells is indicative of T-cell activation with cytotoxic activity.

TABLE-US-00006 TABLE 6 % specific TET in Donor/ primary % TET HLA-A2 IFNγ CD8+ T- IG4 TCR Code (+ or −) (pg/ml) cells control EC50 R10P1A7 HBC-688/(−) 175 6.78 1.53 ~1 nM R13P1C6 HBC-686/(−) 175-800 16.54 1.53 ~0.8 nM   R18P1C12 na/(+) 25-75 3.64 1.53 na

[0255] It was found that all primary CD8+ T-cells transformed with TCRs of the present disclosure, after co-incubation with IGF2BP3-001-loaded target cells, released much higher levels of IFN-γ than that stimulated by unrelated peptide-loaded target cells, and the controls. Target peptide titration analysis showed EC50 at ˜1 nM (TCR R10P1A7) and ˜0.8 nM (TCR R13P1C6). These results suggest that TCRs of the present invention can activate cytotoxic T-cell activity, e.g., IFN-γ release, through specific interaction with the MHC/IGF2BP3-001 complex.

[0256] To determine the binding motif of the TCRs for the MHC/IGF2BP3-001 complex, positional alanine scanning analysis was performed at each of the 9 amino acids of the IGF2BP3-001 peptide. Alanine-substituted IGF2BP3-001 peptides are shown in Table 7.

TABLE-US-00007 TABLE 7 Position: 1 2 3 4 5 6 7 8 9 IGF2BP3-001 (SEQ ID NO: K I Q E I L T Q V 1) IGF2BP3-001 A1 (SEQ ID A I Q E I L T Q V NO: 19) IGF2BP3-001 A2 (SEQ ID K A Q E I L T Q V NO: 20) IGF2BP3-001 A3 (SEQ ID K I A E I L T Q V NO: 21) IGF2BP3-001 A4 (SEQ ID K I Q A I L T Q V NO: 22) IGF2BP3-001 A5 (SEQ ID K I Q E A L T Q V NO: 23) IGF2BP3-001 A6 (SEQ ID K I Q E I A T Q V NO: 24) IGF2BP3-001 A7 (SEQ ID K I Q E I L A Q V NO: 25) IGF2BP3-001 A8 (SEQ ID K I Q E I L T A V NO: 26) IGF2BP3-001 A9 (SEQ ID K I Q E I L T Q A NO: 27)

[0257] Briefly, T-cells transformed with each TCR were co-incubated with target cells loaded with IGF2BP3-001, IGF2BP3-001-A1 to IGF2BP3-001-A9, or an unrelated NYESO1-001 peptide, followed by IFNγ release assay, as described above.

[0258] Results of positional alanine scanning analysis on TCR R10P1A7 and TCR R13P1C6 are summarized in Table 8.

TABLE-US-00008 TABLE 8 TCR IGF2BP3-001 positions enable TCR binding R10P1A7 1, 3-7 R13P1C6 3-6

[0259] A genome-wide screen for A*02-binding peptides with an identical motif revealed no potentially cross-reactive peptides. These results suggest that IGF2BP3-001 positions 3-6 may be important for TCR R10P1A7 and TCR R13P1C6 binding.

[0260] To determine efficacy of T-cells expressing TCRs described herein, primary CD8+ T-cells transformed with TCR R10P1A7 were co-incubated with human cancer cell lines, e.g., A-375 (human melanoma cell line) and T98G (human glioblastoma cell line), which are HLA-A2-positive and IGF2BP3-001 (target)-positive, and SK-BR-3 (human breast cancer cell line), which is HLA-A2-negative and IGF2BP3-001-negative, followed by IFNγ release assay.

[0261] IFNγ release was observed in both A-375 and T98G cells, which are HLA-A2-positive and IGF2BP3-001-positive, but not in SK-BR-3 cells, which have basal levels of IFNγ release that is comparable to that of effector cell only control. These results indicate that T-cells expressing TCR R10P1A7 can specifically induce cytotoxic activity targeting cancer cells in a HLA-A2/IGF2BP3-001 specific manner.

[0262] The present description provides TCRs that are useful in treating cancers/tumors, preferably melanoma and glioblastoma that over- or exclusively present IGF2BP3-001.

Example 4: Allogeneic T-Cell Engineering

[0263] Gamma delta (γδ) T cells, which are non-conventional T lymphocyte effectors implicated in the first line of defense against pathogens, can interact with and eradicate tumor cells in a MHC-independent manner through activating receptors, among others, TCR-gamma and TCR-delta chains. These γδ T cells display a preactivated phenotype that allows rapid cytokine production (IFN-γ, TNF-α) and strong cytotoxic response upon activation. These T-cells have anti-tumor activity against many cancers and suggest that γδ T cell-mediated immunotherapy is feasible and can induce objective tumor responses. (Braza et al. 2013).

[0264] Recent advances using immobilized antigens, agonistic monoclonal antibodies (mAbs), tumor-derived artificial antigen presenting cells (aAPC), or combinations of activating mAbs and aAPC have been successful in expanding gamma delta T-cells with oligoclonal or polyclonal TCR repertoires. For example, immobilized major histocompatibility complex Class-I chain-related A was a stimulus for γδ T-cells expressing TCRδ1 isotypes, and plate-bound activating antibodies have expanded Vδ1 and Vδ2 cells ex vivo. Clinically sufficient quantities of TCRδ1, TCRδ2, and TCRδ1.sup.negTCRδ2.sup.neg have been produced following co-culture on aAPC, and these subsets displayed differences in memory phenotype and reactivity to tumors in vitro and in vivo. (Deniger et al. 2014).

[0265] In addition, γδ T-cells are amenable to genetic modification as evidenced by introduction of TCR-alpha and TCR-beta chains. (Hiasa et al. 2009). Another aspect of the present description relates to production of γδ T-cells expressing TCR-alpha and TCR-beta that bind to IGF2BP3-001. To do so, γδ T-cells are expanded by methods described by Deniger et al. 2014, followed by transducing the recombinant viruses expressing the TCRs that bind to IGF2BP3-001 (as described in Example 3) into the expanded γδ T-cells. The virus-transduced γδ T-cells are then infused into the patient.

Example 5: mRNA Expression

[0266] In situ hybridization (ISH) was used to detect mRNA expression directly in formalin-fixed or frozen tissue sections. Due to its high sensitivity and its spatial resolution, it is a suitable method to determine cell type specific target expression and the distribution or frequency of target expression within cancer tissue sections.

[0267] ISH has been performed to detect IGF2BP3 mRNA using the RNAscope® technology developed by Advanced Cell Diagnostics (ACD). The RNAscope® technology is based on the hybridization of around 20 pairs of Z-shaped oligonucleotide probes to the target sequence. Signal amplification is achieved by branched DNA amplification, which is based on multiple hybridization steps of oligonucleotides, ultimately building up a branched DNA (bDNA) tree. Finally, a great number of label probes hybridize to the branches of the bDNA tree and the enhanced signal can be detected. The chromogenic RNAscope® Detection Kit (RED) includes label probes which are linked to an enzyme (alkaline phosphatase). Signal detection depends on the enzymatic conversion of the chromogenic substrate FastRed, which additionally amplifies the original signal. RNAscope® is a very sensitive technology, which is due to the efficient process of signal amplification, paired with the high sensitivity and the robust binding of the Z probe pairs to the target mRNA, even if it is partially crosslinked or degraded. According to ACD, binding of three out of 20 probe pairs to each single RNA molecule is enough to generate a detectable ISH signal.

[0268] Each ISH experiment is subdivided into two methodological processes: 1) Tissue pretreatment for target retrieval, and 2) Target hybridization, signal amplification and detection. Optimal pretreatment conditions are critical for successful target detection in FFPE tissue sections. The fixation process induces crosslinking of proteins, DNA and RNA in cells and tissues and thereby masks hybridization sites. Thus, to assure accessibility of the target mRNA and proper binding of the probe set, these crosslinks have to be removed prior to target hybridization. Tissue pretreatment includes three discrete steps: 1) Blocking of endogenous alkaline phosphatase by hydrogen peroxide treatment, 2) target retrieval by boiling in target retrieval reagent, and 3) target retrieval by protease digestion. As the extent of fixation and crosslinking may vary between different FFPE blocks, the optimal target retrieval conditions have to be determined experimentally for each individual FFPE block. Therefore, tissue sections were exposed to different boiling and protease digestion times followed by hybridization with a positive and a negative control probe set. The optimal conditions were determined by microscopic evaluation of specific signal intensity in the positive control, unspecific background in the negative control and tissue morphology. Tissue pretreatment was performed according to the manufacturer's protocols. Pretreatment reagents are included in the RNAscope® reagent kits. After completion of the different pretreatment steps, target expression was assessed by hybridization of specific probe sets to the mRNA of interest with subsequent branched DNA signal amplification and chromogenic or fluorescent signal detection. All assays were performed according to the manufacturer's protocols.

TABLE-US-00009 TABLE 9 mRNA expression (see FIG. 6) Sample Tissue IGF2BP3 expression CCA001T Colorectal cancer ++ CCA006T Colorectal cancer ++ HNSCC017T1 Head and neck cancer ++ NSCLC004T1 Non-small cell lung cancer ++ NSCLC005T1 Non-small cell lung cancer ++ OC038T1 Ovarian cancer ++ OSCAR052T1 Esophageal cancer ++ OSCAR055T1 Esophageal cancer ++ PC002T Pancreatic cancer + Overall expression level of IGF2BP3 in the respective section: ± very low, + low to moderate, ++ strong, +++ very strong

REFERENCE LIST

[0269] Brossart P, Bevan M J. Presentation of exogenous protein antigens on major histocompatibility complex class I molecules by dendritic cells: pathway of presentation and regulation by cytokines. Blood. 1997 Aug. 15; 90(4):1594-9. [0270] Gnjatic S, Atanackovic D, Jäger E, Matsuo M, Selvakumar A, Altorki N K, Maki R G, Dupont B, Ritter G, Chen Y T, Knuth A, Old L J. Survey of naturally occurring CD4+ T cell responses against NY-ESO-1 in cancer patients: correlation with antibody responses. Proc Natl Acad Sci USA. 2003 Jul. 22; 100(15):8862-7. [0271] Mortara L, Castellani P, Meazza R, Tosi G, De Lerma Barbaro A, Procopio F A, Comes A, Zardi L, Ferrini S, Accolla R S. CIITA-induced MHC class II expression in mammary adenocarcinoma leads to a Th1 polarization of the tumor microenvironment, tumor rejection, and specific antitumor memory. Clin Cancer Res. 2006 Jun. 1; 12(11 Pt 1):3435-43. [0272] Dengjel J, Nastke M D, Gouttefangeas C, Gitsioudis G, Schoor O, Altenberend F, Müller M, Krämer B, Missiou A, Sauter M, Hennenlotter J, Wernet D, Stenzl A, Rammensee H G, Klingel K, Stevanović S. Unexpected abundance of HLA class II presented peptides in primary renal cell carcinomas. Clin Cancer Res. 2006 Jul. 15; 12(14 Pt 1):4163-70. [0273] Tran E, Turcotte S, Gros A, Robbins P F, Lu Y C, Dudley M E, Wunderlich J R, Somerville R P, Hogan K, Hinrichs C S, Parkhurst M R, Yang J C, Rosenberg S A. Cancer immunotherapy based on mutation-specific CD4+ T cells in a patient with epithelial cancer. Science. 2014 May 9; 344(6184):641-5. [0274] Singh-Jasuja H, Emmerich N P, Rammensee H G. The Tübingen approach: identification, selection, and validation of tumor-associated HLA peptides for cancer therapy. Cancer Immunol Immunother. 2004 March; 53(3):187-95. Epub 2004 Jan. 31. Review. [0275] Mori M, Beatty P G, Graves M, Boucher K M, Milford E L. HLA gene and haplotype frequencies in the North American population: the National Marrow Donor Program Donor Registry. Transplantation. 1997 Oct. 15; 64(7):1017-27. [0276] Colombetti S, Fagerberg T, Baumgärtner P, Chapatte L, Speiser D E, Rufer N, Michielin O, Lévy F. Impact of orthologous melan-A peptide immunizations on the anti-self melan-A/HLA-A2 T cell cross-reactivity. J Immunol. 2006 Jun. 1; 176(11):6560-7. [0277] Appay V, Speiser D E, Rufer N, Reynard S, Barbey C, Cerottini J C, Leyvraz S, Pinilla C, Romero P. Decreased specific CD8+ T cell cross-reactivity of antigen recognition following vaccination with Melan-A peptide. Eur J Immunol. 2006 July; 36(7):1805-14. [0278] Xing Y, Hogquist K A. T-cell tolerance: central and peripheral. Cold Spring Harb Perspect Biol. 2012 Jun. 1; 4(6). [0279] Aleksic M, Liddy N, Molloy P E, Pumphrey N, Vuidepot A, Chang K M, Jakobsen B K. Different affinity windows for virus and cancer-specific T-cell receptors: implications for therapeutic strategies. Eur J Immunol. 2012 December; 42(12):3174-9. [0280] Burton E C, Prados M D. Malignant gliomas. Curr Treat Options Oncol. 2000 December; 1(5):459-68. Review. [0281] Dutoit V, Herold-Mende C, Hilf N, Schoor O, Beckhove P, Bucher J, Dorsch K, Flohr S, Fritsche J, Lewandrowski P, Lohr J, Rammensee H G, Stevanovic S, Trautwein C, Vass V, Walter S, Walker P R, Weinschenk T, Singh-Jasuja H, Dietrich P Y. Exploiting the glioblastoma peptidome to discover novel tumour-associated antigens for immunotherapy. Brain. 2012 April; 135(Pt 4):1042-54. [0282] Tomita, Y., Harao, M., Senju, S., Imai, K., Hirata, S., Irie, A., Inoue, M., Hayashida, Y., Yoshimoto, K., Shiraishi, K., Mori, T., Nomori, H., Kohrogi, H. and Nishimura, Y. (2011), Peptides derived from human insulin-like growth factor-II mRNA binding protein 3 can induce human leukocyte antigen-A2-restricted cytotoxic T lymphocytes reactive to cancer cells. Cancer Science, 102: 71-78. [0283] Barton V N, Donson A M, Birks D K, Kleinschmidt-DeMasters B K, Handler M H, Foreman N K, Rush S Z (2013). Insulin-like growth factor 2 mRNA binding protein 3 expression is an independent prognostic factor in pediatric pilocytic and pilomyxoid astrocytoma. J Neuropathol. Exp. Neurol. 72, 442-449. [0284] Beljan P R, Durdov M G, Capkun V, Ivcevic V, Pavlovic A, Soljic V, Peric M (2012). IMP3 can predict aggressive behaviour of lung adenocarcinoma. Diagn. Pathol. 7, 165. [0285] Bell J L, Wachter K, Muhleck B, Pazaitis N, Kohn M, Lederer M, Huttelmaier S (2013). Insulin-like growth factor 2 mRNA-binding proteins (IGF2BPs): post-transcriptional drivers of cancer progression? Cell Mol. Life Sci. 70, 2657-2675. [0286] Chen C L, Tsukamoto H, Liu J C, Kashiwabara C, Feldman D, Sher L, Dooley S, French S W, Mishra L, Petrovic L, Jeong J H, Machida K (2013a). Reciprocal regulation by TLR4 and TGF-beta in tumor-initiating stem-like cells. J Clin Invest 123, 2832-2849. [0287] Chen L T, Lin L J, Zheng L L (2013b). The correlation between insulin-like growth factor II mRNA binding protein 3 expression in hepatocellular carcinoma and prognosis. Hepatogastroenterology 60, 553-556. [0288] Chen P, Wang S J, Wang H B, Ren P, Wang X Q, Liu W G, Gu W L, Li D Q, Zhang T G, Zhou C J (2012). The distribution of IGF2 and IMP3 in osteosarcoma and its relationship with angiogenesis. J Mol. Histol. 43, 63-70. [0289] Chen S T, Jeng Y M, Chang C C, Chang H H, Huang M C, Juan H F, Hsu C H, Lee H, Liao Y F, Lee Y L, Hsu W M, Lai H S (2011). Insulin-like growth factor II mRNA-binding protein 3 expression predicts unfavorable prognosis in patients with neuroblastoma. Cancer Sci. 102, 2191-2198. [0290] Chen Y L, Jeng Y M, Hsu H C, Lai H S, Lee P H, Lai P L, Yuan R H (2013c). Expression of insulin-like growth factor II mRNA-binding protein 3 predicts early recurrence and poor prognosis in intrahepatic cholangiocarcinoma. Int. J Surg. 11, 85-91. [0291] Chiste M, Alexis J, Recine M (2014). IMP3 expression in serous tumors of the ovary. Appl. Immunohistochem. Mol. Morphol. 22, 658-662. [0292] Del G A, Vaira V, Rocco E G, Palleschi A, Bulfamante G, Ricca D, Fiori S, Bosari S, Ferrero S (2014). The Oncofetal Protein IMP3: A Useful Marker to Predict Poor Clinical Outcome in Neuroendocrine Tumors of the Lung. J Thorac. Oncol. [0293] Eldai H, Periyasamy S, Al Q S, Al R M, Muhammed M S, Deeb A, Al S E, Afzal M, Johani M, Yousef Z, Aziz M A (2013). Novel genes associated with colorectal cancer are revealed by high resolution cytogenetic analysis in a patient specific manner. PLoS. ONE. 8, e76251. [0294] Feng W, Zhou Z, Peters J H, Khoury T, Zhai Q, Wei Q, Truong C D, Song S W, Tan D (2011). Expression of insulin-like growth factor II mRNA-binding protein 3 in human esophageal adenocarcinoma and its precursor lesions. Arch. Pathol. Lab Med. 135, 1024-1031. [0295] Findeis-Hosey J J, Xu H (2012). Insulin-like growth factor II-messenger RNA-binding protein-3 and lung cancer. Biotech. Histochem. 87, 24-29. [0296] Gu L, Shigemasa K, Ohama K (2004). Increased expression of IGF II mRNA-binding protein 1 mRNA is associated with an advanced clinical stage and poor prognosis in patients with ovarian cancer. Int. J Oncol 24, 671-678. [0297] Hammer N A, Hansen T, Byskov A G, Rajpert-De M E, Grondahl M L, Bredkjaer H E, Wewer U M, Christiansen J, Nielsen F C (2005). Expression of IGF-II mRNA-binding proteins (IMPs) in gonads and testicular cancer. Reproduction. 130, 203-212. [0298] Hazama S, Nakamura Y, Takenouchi H, Suzuki N, Tsunedomi R, Inoue Y, Tokuhisa Y, Iizuka N, Yoshino S, Takeda K, Shinozaki H, Kamiya A, Furukawa H, Oka M (2014). A phase I study of combination vaccine treatment of five therapeutic epitope-peptides for metastatic colorectal cancer; safety, immunological response, and clinical outcome. J Transl. Med. 12, 63. [0299] Hoffmann N E, Sheinin Y, Lohse C M, Parker A S, Leibovich B C, Jiang Z, Kwon E D (2008). External validation of IMP3 expression as an independent prognostic marker for metastatic progression and death for patients with clear cell renal cell carcinoma. Cancer 112, 1471-1479. [0300] Hu S, Wu X, Zhou B, Xu Z, Qin J, Lu H, Lv L, Gao Y, Deng L, Yin J, Li G (2014). IMP3 combined with CD44s, a novel predictor for prognosis of patients with hepatocellular carcinoma. J Cancer Res Clin Oncol 140, 883-893. [0301] Hwang Y S, Park K K, Cha I H, Kim J, Chung W Y (2012a). Role of insulin-like growth factor-II mRNA-binding protein-3 in invadopodia formation and the growth of oral squamous cell carcinoma in athymic nude mice. Head Neck 34, 1329-1339. [0302] Hwang Y S, Xianglan Z, Park K K, Chung W Y (2012b). Functional invadopodia formation through stabilization of the PDPN transcript by IMP-3 and cancer-stromal crosstalk for PDPN expression. Carcinogenesis 33, 2135-2146. [0303] Iinuma H, Fukushima R, Inaba T, Tamura J, Inoue T, Ogawa E, Horikawa M, Ikeda Y, Matsutani N, Takeda K, Yoshida K, Tsunoda T, Ikeda T, Nakamura Y, Okinaga K (2014). Phase I clinical study of multiple epitope peptide vaccine combined with chemoradiation therapy in esophageal cancer patients. J Transl. Med. 12, 84. [0304] Ikenberg K, Fritzsche F R, Zuerrer-Haerdi U, Hofmann I, Hermanns T, Seifert H, Muntener M, Provenzano M, Sulser T, Behnke S, Gerhardt J, Mortezavi A, Wild P, Hofstadter F, Burger M, Moch H, Kristiansen G (2010). Insulin-like growth factor II mRNA binding protein 3 (IMP3) is overexpressed in prostate cancer and correlates with higher Gleason scores. BMC. Cancer 10, 341. [0305] Jeng Y M, Chang C C, Hu F C, Chou H Y, Kao H L, Wang T H, Hsu H C (2008). RNA-binding protein insulin-like growth factor II mRNA-binding protein 3 expression promotes tumor invasion and predicts early recurrence and poor prognosis in hepatocellular carcinoma. Hepatology 48, 1118-1127. [0306] Jeng Y M, Wang T H, Lu S H, Yuan R H, Hsu H C (2009). Prognostic significance of insulin-like growth factor II mRNA-binding protein 3 expression in gastric adenocarcinoma. Br. J Surg 96, 66-73. [0307] Jin L, Seys A R, Zhang S, Erickson-Johnson M R, Roth C W, Evers B R, Oliveira A M, Lloyd R V (2010). Diagnostic utility of IMP3 expression in thyroid neoplasms: a quantitative RT-PCR study. Diagn. Mol. Pathol. 19, 63-69. [0308] Kazeminezhad B, Mirafsharieh S A, Dinyari K, Azizi D, Ebrahimi A (2014). Usefulness of insulin-like growth factor II mRNA-binding protein 3 (IMP3) as a new marker for the diagnosis of esophageal adenocarcinoma in challenging cases. Turk. J Gastroenterol. 25, 253-256. [0309] Kleinschmidt-DeMasters B K, Donson A M, Vogel H, Foreman N K (2014). Pilomyxoid Astrocytoma (PMA) Shows Significant Differences in Gene Expression vs. Pilocytic Astrocytoma (PA) and Variable Tendency Toward Maturation to PA. Brain Pathol. [0310] Kobel M, Xu H, Bourne P A, Spaulding B O, Shih I, Mao T L, Soslow R A, Ewanowich C A, Kalloger S E, Mehl E, Lee C H, Huntsman D, Gilks C B (2009). IGF2BP3 (IMP3) expression is a marker of unfavorable prognosis in ovarian carcinoma of clear cell subtype. Mod. Pathol. 22, 469-475. [0311] Kono K, Iinuma H, Akutsu Y, Tanaka H, Hayashi N, Uchikado Y, Noguchi T, Fujii H, Okinaka K, Fukushima R, Matsubara H, Ohira M, Baba H, Natsugoe S, Kitano S, Takeda K, Yoshida K, Tsunoda T, Nakamura Y (2012). Multicenter, phase II clinical trial of cancer vaccination for advanced esophageal cancer with three peptides derived from novel cancer-testis antigens. J Transl. Med. 10, 141. [0312] Kono K, Mizukami Y, Daigo Y, Takano A, Masuda K, Yoshida K, Tsunoda T, Kawaguchi Y, Nakamura Y, Fujii H (2009). Vaccination with multiple peptides derived from novel cancer-testis antigens can induce specific T-cell responses and clinical responses in advanced esophageal cancer. Cancer Sci. 100, 1502-1509. [0313] Li D, Yan D, Tang H, Zhou C, Fan J, Li S, Wang X, Xia J, Huang F, Qiu G, Peng Z (2009). IMP3 is a novel prognostic marker that correlates with colon cancer progression and pathogenesis. Ann Surg Oncol 16, 3499-3506. [0314] Li H G, Han J J, Huang Z Q, Wang L, Chen W L, Shen X M (2011). IMP3 is a novel biomarker to predict metastasis and prognosis of tongue squamous cell carcinoma. J Craniofac. Surg. 22, 2022-2025. [0315] Liao B, Hu Y, Brewer G (2011). RNA-binding protein insulin-like growth factor mRNA-binding protein 3 (IMP-3) promotes cell survival via insulin-like growth factor II signaling after ionizing radiation. J Biol. Chem. 286, 31145-31152. [0316] Liao B, Hu Y, Herrick D J, Brewer G (2005). The RNA-binding protein IMP-3 is a translational activator of insulin-like growth factor II leader-3 mRNA during proliferation of human K562 leukemia cells. J Biol. Chem. 280, 18517-18524. [0317] Lin L, Zhang J, Wang Y, Ju W, Ma Y, Li L, Chen L (2013). Insulin-like growth factor-II mRNA-binding protein 3 predicts a poor prognosis for colorectal adenocarcinoma. Oncol Lett. 6, 740-744. [0318] Liu H, Shi J, Anandan V, Wang H L, Diehl D, Blansfield J, Gerhard G, Lin F (2012). Reevaluation and identification of the best immunohistochemical panel (pVHL, Maspin, S100P, IMP-3) for ductal adenocarcinoma of the pancreas. Arch. Pathol. Lab Med. 136, 601-609. [0319] Lochhead P, Imamura Y, Morikawa T, Kuchiba A, Yamauchi M, Liao X, Qian Z R, Nishihara R, Wu K, Meyerhardt J A, Fuchs C S, Ogino S (2012). Insulin-like growth factor 2 messenger RNA binding protein 3 (IGF2BP3) is a marker of unfavourable prognosis in colorectal cancer. Eur. J Cancer. [0320] Lu D, Vohra P, Chu P G, Woda B, Rock K L, Jiang Z (2009). An oncofetal protein IMP3: a new molecular marker for the detection of esophageal adenocarcinoma and high-grade dysplasia. Am J Surg Pathol. 33, 521-525. [0321] Lu D, Yang X, Jiang N Y, Woda B A, Liu Q, Dresser K, Mercurio A M, Rock K L, Jiang Z (2011). IMP3, a new biomarker to predict progression of cervical intraepithelial neoplasia into invasive cancer. Am. J Surg. Pathol. 35, 1638-1645. [0322] Mizukami Y, Kono K, Daigo Y, Takano A, Tsunoda T, Kawaguchi Y, Nakamura Y, Fujii H (2008). Detection of novel cancer-testis antigen-specific T-cell responses in TIL, regional lymph nodes, and PBL in patients with esophageal squamous cell carcinoma. Cancer Sci. [0323] Morimatsu K, Aishima S, Yamamoto H, Hayashi A, Nakata K, Oda Y, Shindo K, Fujino M, Tanaka M, Oda Y (2013). Insulin-like growth factor II messenger RNA-binding protein-3 is a valuable diagnostic and prognostic marker of intraductal papillary mucinous neoplasm. Hum. Pathol. 44, 1714-1721. [0324] Nielsen J, Christiansen J, Lykke-Andersen J, Johnsen A H, Wewer U M, Nielsen F C (1999). A family of insulin-like growth factor II mRNA-binding proteins represses translation in late development. Mol Cell Biol. 19, 1262-1270. [0325] Noske A, Faggad A, Wirtz R, Darb-Esfahani S, Sehouli J, Sinn B, Nielsen F C, Weichert W, Buckendahl A C, Roske A, Muller B, Dietel M, Denkert C (2009). IMP3 expression in human ovarian cancer is associated with improved survival. Int. J Gynecol. Pathol. 28, 203-210. [0326] Okada K, Fujiwara Y, Nakamura Y, Takiguchi S, Nakajima K, Miyata H, Yamasaki M, Kurokawa Y, Takahashi T, Mori M, Doki Y (2012). Oncofetal protein, IMP-3, a potential marker for prediction of postoperative peritoneal dissemination in gastric adenocarcinoma. J Surg. Oncol 105, 780-785. [0327] Pryor J G, Bourne P A, Yang Q, Spaulding B O, Scott G A, Xu H (2008). IMP-3 is a novel progression marker in malignant melanoma. Mod. Pathol. 21, 431-437. [0328] Rammensee H G, Bachmann J, Emmerich N P, Bachor O A, Stevanovic S (1999). SYFPEITHI: database for MHC ligands and peptide motifs. Immunogenetics 50, 213-219. [0329] Rammensee H G, Bachmann J, Stevanovic S (1997). MHC Ligands and Peptide Motifs. (Heidelberg, Germany: Springer-Verlag). [0330] Rivera V T, Boudoukha S, Simon A, Souidi M, Cuvellier S, Pinna G, Polesskaya A (2013). Post-transcriptional regulation of cyclins D1, D3 and G1 and proliferation of human cancer cells depend on IMP-3 nuclear localization. Oncogene. [0331] Samanta S, Sharma V M, Khan A, Mercurio A M (2012). Regulation of IMP3 by EGFR signaling and repression by ERbeta: implications for triple-negative breast cancer. Oncogene 31, 4689-4697. [0332] Samanta S, Sun H, Goel H L, Pursell B, Chang C, Khan A, Greiner D L, Cao S, Lim E, Shultz L D, Mercurio A M (2015). IMP3 promotes stem-like properties in triple-negative breast cancer by regulating SLUG. Oncogene. [0333] Schaeffer D F, Owen D R, Lim H J, Buczkowski A K, Chung S W, Scudamore C H, Huntsman D G, Ng S S, Owen D A (2010). Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) overexpression in pancreatic ductal adenocarcinoma correlates with poor survival. BMC. Cancer 10, 59. [0334] Serao N V, Delfino K R, Southey B R, Beever J E, Rodriguez-Zas S L (2011). Cell cycle and aging, morphogenesis, and response to stimuli genes are individualized biomarkers of glioblastoma progression and survival. BMC. Med. Genomics 4, 49. [0335] Su P, Hu J, Zhang H, Li W, Jia M, Zhang X, Wu X, Cheng H, Xiang L, Zhou G (2014). IMP3 expression is associated with epithelial-mesenchymal transition in breast cancer. Int. J Clin Exp. Pathol. 7, 3008-3017. [0336] Suda T, Tsunoda T, Daigo Y, Nakamura Y, Tahara H (2007). Identification of human leukocyte antigen-A24-restricted epitope peptides derived from gene products upregulated in lung and esophageal cancers as novel targets for immunotherapy. Cancer Sci. [0337] Suvasini R, Shruti B, Thota B, Shinde S V, Friedmann-Morvinski D, Nawaz Z, Prasanna K V, Thennarasu K, Hegde A S, Arivazhagan A, Chandramouli B A, Santosh V, Somasundaram K (2011). Insulin growth factor-2 binding protein 3 (IGF2BP3) is a glioblastoma-specific marker that activates phosphatidylinositol 3-kinase/mitogen-activated protein kinase (PI3K/MAPK) pathways by modulating IGF-2. J Biol. Chem. 286, 25882-25890. [0338] Szarvas T, Tschirdewahn S, Niedworok C, Kramer G, Sevcenco S, Reis H, Shariat S F, Rubben H, Vom D F (2014). Prognostic value of tissue and circulating levels of IMP3 in prostate cancer. Int. J Cancer 135, 1596-1604. [0339] Takata A, Takiguchi S, Okada K, Takahashi T, Kurokawa Y, Yamasaki M, Miyata H, Nakajima K, Mori M, Doki Y (2014). Expression of insulin-like growth factor-II mRNA-binding protein-3 as a marker for predicting clinical outcome in patients with esophageal squamous cell carcinoma. Oncol Lett. 8, 2027-2031. [0340] Taniuchi K, Furihata M, Hanazaki K, Saito M, Saibara T (2014). IGF2BP3-mediated translation in cell protrusions promotes cell invasiveness and metastasis of pancreatic cancer. Oncotarget. 5, 6832-6845. [0341] Tomita Y, Harao M, Senju S, Imai K, Hirata S, Irie A, Inoue M, Hayashida Y, Yoshimoto K, Shiraishi K, Mori T, Nomori H, Kohrogi H, Nishimura Y (2011). Peptides derived from human insulin-like growth factor-II mRNA binding protein 3 can induce human leukocyte antigen-A2-restricted cytotoxic T lymphocytes reactive to cancer cells. Cancer Sci. 102, 71-78. [0342] Ueki A, Shimizu T, Masuda K, Yamaguchi S I, Ishikawa T, Sugihara E, Onishi N, Kuninaka S, Miyoshi K, Muto A, Toyama Y, Banno K, Aoki D, Saya H (2012). Up-regulation of Imp3 confers in vivo tumorigenicity on murine osteosarcoma cells. PLoS. ONE. 7, e50621. [0343] Vikesaa J, Hansen T V, Jonson L, Borup R, Wewer U M, Christiansen J, Nielsen F C (2006). RNA-binding IMPs promote cell adhesion and invadopodia formation. EMBO J 25, 1456-1468. [0344] Wachter D L, Kristiansen G, Soll C, Hellerbrand C, Breuhahn K, Fritzsche F, Agaimy A, Hartmann A, Riener M O (2012). Insulin-like growth factor II mRNA-binding protein 3 (IMP3) expression in hepatocellular carcinoma. A clinicopathological analysis with emphasis on diagnostic value. Histopathology 60, 278-286. [0345] Wachter D L, Schlabrakowski A, Hoegel J, Kristiansen G, Hartmann A, Riener M O (2011). Diagnostic value of immunohistochemical IMP3 expression in core needle biopsies of pancreatic ductal adenocarcinoma. Am. J Surg. Pathol. 35, 873-877. [0346] Wang B J, Wang L, Yang S Y, Liu Z J (2015). Expression and clinical significance of IMP3 in microdissected premalignant and malignant pancreatic lesions. Clin Transl. Oncol 17, 215-222. [0347] Wang L, Li H G, Xia Z S, Lu J, Peng T S (2010). IMP3 is a novel biomarker to predict metastasis and prognosis of gastric adenocarcinoma: a retrospective study. Chin Med. J (Engl.) 123, 3554-3558. [0348] Wang Y, Li L, Wang Y, Yuan Z, Zhang W, Hatch K D, Zheng W (2014). IMP3 as a cytoplasmic biomarker for early serous tubal carcinogenesis. J Exp. Clin Cancer Res. 33, 60. [0349] Yantiss R K, Cosar E, Fischer A H (2008). Use of IMP3 in identification of carcinoma in fine needle aspiration biopsies of pancreas. Acta Cytol. 52, 133-138. [0350] Yoshino K, Motoyama S, Koyota S, Shibuya K, Sato Y, Sasaki T, Wakita A, Saito H, Minamiya Y, Sugiyama T, Ogawa J (2014). Identification of insulin-like growth factor 2 mRNA-binding protein 3 as a radioresistance factor in squamous esophageal cancer cells. Dis. Esophagus. 27, 479-484. [0351] Yuan R, Chen Y, He X, Wu X, Ke J, Zou Y, Cai Z, Zeng Y, Wang L, Wang J, Fan X, Wu X, Lan P (2013). CCL18 as an independent favorable prognostic biomarker in patients with colorectal cancer. J Surg. Res 183, 163-169. [0352] Yuan R H, Wang C C, Chou C C, Chang K J, Lee P H, Jeng Y M (2009). Diffuse expression of RNA-binding protein IMP3 predicts high-stage lymph node metastasis and poor prognosis in colorectal adenocarcinoma. Ann Surg Oncol 16, 1711-1719. [0353] Zhang Y, Garcia-Buitrago M T, Koru-Sengul T, Schuman S, Ganjei-Azar P (2013). An immunohistochemical panel to distinguish ovarian from uterine serous papillary carcinomas. Int. J Gynecol. Pathol. 32, 476-481.