METHOD AND PRODUCT
20170369941 · 2017-12-28
Assignee
Inventors
Cpc classification
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q1/6848
CHEMISTRY; METALLURGY
C12Q2535/101
CHEMISTRY; METALLURGY
C12Q2535/101
CHEMISTRY; METALLURGY
C12Q1/6818
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a method which prevents undesirable binding of ddNTPs to double stranded polynucleotides when in the presence of a polymerase. Such methods may be used to prevent the appearance of false positives in methods employing ddNTPs, e.g. in sequence detection methods. The present invention also provides a method of avoiding a false Tm reading or false FRET effects (such as false positive quenching), for example in a melting curve analysis method. In particular a method is provided in which a target nucleotide sequence in a test polynucleotide is detected using a method in which a double stranded molecule is generated which may or may not comprise two labels depending on whether the target sequence is present in which the presence of the two labels is determined, preferably by performing a melting curve analysis.
Claims
1. A method of preventing binding of a ddNTP to a polynucleotide in the presence of a polymerase, wherein said polynucleotide is double stranded but optionally may contain a single stranded region which is up to 10 nucleotides in length, wherein when said single stranded region provides a 5′ protruding sequence it does not contain a base complementary to said ddNTP immediately adjacent to the double stranded region, wherein said method (i) comprises inactivating, degrading or removing said polymerase, dephosphorylating or removing said ddNTP and/or outcompeting said ddNTP with another ddNTP and/or (ii) uses a polynucleotide with a single stranded region which provides a 3′ protruding sequence which is at least 1 nucleotide in length or a 5′ protruding sequence which is at least 2 nucleotides in length and/or uses a polynucleotide with a single stranded region at one or both of the polynucleotide's ends which is at least one nucleotide in length and said single stranded region results, at least in part, from a mismatch between one or more base pairs in said polynucleotide, wherein preferably said method comprises melting curve analysis.
2. A method as claimed in claim 1 wherein when said single stranded region provides a 5′ protruding sequence it does not contain a base complementary to said ddNTP anywhere in said single stranded region.
3. A method as claimed in claim 1 or 2, wherein said ddNTP carries a first label and said polynucleotide carries a second label.
4. A method as claimed in claim 3 wherein said first or second label affects the signal generated by the other label when the labels are in proximity to one another.
5. A method as claimed in claim 4 wherein said first or second label is a fluorophore and the other label is a molecule which affects the fluorescence of said fluorophore when in proximity to said fluorophore.
6. A method as claimed in claim 5 wherein the other label is a quenching molecule.
7. A method as claimed in any one of claims 1 to 6 wherein said second label on said polynucleotide is a fluorophore.
8. A method as claimed in any one of claims 1 to 7 wherein said second label on said polynucleotide is at the 5′ end of one of the strands making up said double stranded polynucleotide.
9. A method as claimed in any one of claims 1 to 8 wherein when one or both ends of said double stranded polynucleotide is blunt ended inactivating, degrading or removing said polymerase, dephosphorylating or removing said ddNTP and/or outcompeting said ddNTP with another ddNTP.
10. A method as claimed in any one of claims 1 to 9 wherein when one or both ends of said double stranded polynucleotide has a 5′ protruding end inactivating, degrading or removing said polymerase, dephosphorylating or removing said ddNTP, outcompeting said ddNTP with another ddNTP and/or using a polynucleotide with a single stranded region which is at least 2 nucleotides (5′ protruding) in length and/or using a polynucleotide which has a single stranded region at one or both of the polynucleotide's ends which is at least one nucleotide in length to form a 5′ protruding strand and said single stranded region results, at least in part, from a mismatch between one or more base pairs in said polynucleotide.
11. A method as claimed in any one of claims 1 to 9 wherein when one or both ends of said double stranded polynucleotide has a 3′ protruding end inactivating, degrading or removing said polymerase, dephosphorylating or removing said ddNTP, outcompeting said ddNTP with another ddNTP and/or using a polynucleotide with a single stranded region which is at least 1 nucleotide (3′ protruding) in length and/or using a polynucleotide which has a single stranded region at one or both of the polynucleotide's ends which is at least one nucleotide in length to form a 3′ protruding strand and said single stranded region results, at least in part, from a mismatch between one or more base pairs in said polynucleotide.
12. A method as claimed in any one of claims 1 to 11 wherein said method additionally comprises the step of generating the double stranded polynucleotide by contacting a first and second polynucleotide under conditions allowing their hybridization.
13. A method as claimed in claim 12 wherein said step of inactivating, degrading or removing said polymerase, dephosphorylating or removing said ddNTP, outcompeting said ddNTP and/or using a polynucleotide with a single stranded region which is at least 1 nucleotide (3′ protruding) or 2 nucleotides (5′ protruding) in length and/or using a polynucleotide with a single stranded region at one or both of the polynucleotide's ends which is at least one nucleotide in length and said single stranded region results, at least in part, from a mismatch between one or more base pairs in said polynucleotide is performed before, during and/or after said double stranded polynucleotide is generated.
14. A method as claimed in any one of claims 1 to 13 wherein said polymerase is inactivated or degraded with proteinase K.
15. A method as claimed in any one of claims 1 to 13 wherein said polymerase is inactivated or degraded with a detergent, preferably sodium dodecyl sulphate.
16. A method as claimed in any one of claims 1 to 13 wherein said ddNTP is dephosphorylated with shrimp alkaline phosphatase or calf intestinal phosphatase.
17. A method as claimed in any one of claims 1 to 13 wherein removal of said polymerase or ddNTP comprises separating said one or both strands of said double stranded polynucleotide from said polymerase or ddNTP by affinity binding, preferably wherein said double stranded polynucleotide carries one binding partner of a binding pair, preferably biotin.
18. A method of avoiding false positives in a sequence detection method, wherein said sequence detection method comprises the step of bringing into contact a ddNTP, a polymerase and a first and second polynucleotide which hybridize to one another to form a third polynucleotide which is a double stranded polynucleotide with an optional single stranded region, wherein said double stranded polynucleotide is as defined in claim 1 or 2, wherein said ddNTP and/or polynucleotide optionally carries a label as defined in any one of claims 3-8, wherein said method prevents binding of a ddNTP to said third polynucleotide by a method as described in any one of claims 1-17.
19. A method as claimed in claim 18 wherein said step of inactivating, degrading or removing said polymerase, dephosphorylating or removing said ddNTP, outcompeting said ddNTP and/or using a polynucleotide with a single stranded region which is at least 1 nucleotide (3′ protruding) or 2 nucleotides (5′ protruding) in length and/or using a polynucleotide with a single stranded region at one or both of the polynucleotide's ends which is at least one nucleotide in length and said single stranded region results, at least in part, from a mismatch between one or more base pairs in said polynucleotide is performed before, during and/or after said double stranded polynucleotide is generated.
20. A method as claimed in claim 18 or 19 wherein said first and/or said second polynucleotide is from 10-100 nucleotides in length.
21. A method of avoiding a false melting temperature (Tm) reading and/or false FRET effects (preferably false positive quenching), wherein preferably said method is in a melting curve analysis method, wherein said method comprises the step of bringing into contact a polymerase, optionally ddNTP and/or dNTP, and a first and second polynucleotide which hybridize to one another to form a third polynucleotide which is a double stranded polynucleotide with an optional single stranded region, wherein when false FRET effects are to be avoided said first polynucleotide carries a fluorescent label, wherein said method further comprises inactivating, degrading or removing said polymerase prior to assessing Tm and/or FRET effects, and/or, when false FRET effects are to be avoided and dNTP and/or ddNTP are used in said method dephosphorylating or removing said dNTP and/or ddNTP and/or outcompeting said dNTP and/or ddNTP with another dNTP and/or ddNTP, wherein preferably said double stranded polynucleotide is as defined in claim 1 or 2 and/or preferably said method comprises an additional step as defined in claim 12, preferably as defined in claim 13 and/or preferably said inactivating, degrading or removing said polymerase or said dephosphorylating or removing said dNTP and/or ddNTP is performed as defined in any one of claims 14 to 17.
22. A method as claimed in claim 21 wherein when a dNTP and/or ddNTP is used said dNTP and/or ddNTP and said polynucleotide is labelled as defined in any one of claims 3 to 8 and when a dNTP and/or ddNTP is not used said first polynucleotide carries a first label as defined in any one of claims 4 to 7 and optionally said first or second polynucleotide carries a second label as defined in any one of claims 4 to 8.
23. A method of identifying a target nucleotide sequence in a test polynucleotide comprising: (a) contacting said test polynucleotide with a ddNTP and an unlabeled labelling probe, which probe hybridizes to said target nucleotide sequence, when present, immediately 5′ to a base which is complementary to said ddNTP in said target nucleotide sequence, in the presence of a polymerase, wherein said ddNTP carries a first label and when said target sequence is present in said test polynucleotide said unlabeled labelling probe hybridizes to said test polynucleotide and is extended in the 3′ direction by said polymerase to attach said labelled ddNTP to said unlabeled labelling probe to form a labelled labelling probe; (b) separating the labelling probe, which may be labelled or unlabeled, from the test polynucleotide; (c) hybridizing said labelling probe to a reporter probe carrying a second label to form a double stranded polynucleotide, wherein the first or second label affects the signal generated by the other label when the labels are in proximity to one another (wherein preferably said first or second label is a fluorophore and the other label is a molecule which affects the fluorescence of said fluorophore when in proximity to said fluorophore), wherein when said labelling probe is unlabeled, at the end closest to the second label said double stranded polynucleotide is (i) blunt ended; (ii) has a protruding 5′ end or (iii) has a protruding 3′ end, and at the end distal to the second label said double stranded polynucleotide is (i) blunt ended; (ii) has a protruding 5′ end or (iii) has a protruding 3′ end, wherein said protruding ends consist of a single stranded region and when said single stranded region provides a 5′ protruding sequence it does not contain a base complementary to said ddNTP immediately adjacent to the double stranded region (preferably does not contain a base complementary to said ddNTP anywhere in said single stranded region); (d) inactivating, degrading or removing said polymerase, dephosphorylating or removing said ddNTP which did not attach in step a), outcompeting said ddNTP with another ddNTP and/or using a labelling probe and reporter probe which when bound together provide a single stranded region which is at least 1 nucleotide (3′ protruding) or 2 nucleotides (5′ protruding) in length and/or using a labelling probe and reporter probe which when bound together provide a single stranded region at one or both of the double stranded polynucleotide's ends which is at least one nucleotide in length and said single stranded region results, at least in part, from a mismatch between one or more base pairs in said double stranded polynucleotide, wherein step (d) may be performed before, during and/or after said double stranded molecule is generated; and (e) determining if said labelling probe carries a first label by assessing the signal associated with the double stranded polynucleotide, wherein a change in the first or second label's signal is indicative of the presence of said target sequence in said test polynucleotide.
24. A method as claimed in claim 23 wherein, (i) when one or both ends of said polynucleotide is blunt ended according to step (c), in step (d) said polymerase is inactivated, degraded or removed, said ddNTP which did not attach in step a) is dephosphorylated or removed and/or said ddNTP is outcompeted with another ddNTP, (ii) when one or both ends of said polynucleotide has a 5′ protruding end according to step (c), in step (d) said polymerase is inactivated, degraded or removed, said ddNTP which did not attach in step a) is dephosphorylated, said ddNTP is outcompeted with another ddNTP and/or a labelling probe and reporter probe which when bound together provide a single stranded region which forms said 5′ protruding end which is at least 2 nucleotides in length is used and/or a labelling probe and reporter probe which when bound together provide a single stranded region at one or both of the double stranded polynucleotide's ends which is at least one nucleotide in length and said single stranded region results, at least in part, from a mismatch between one or more base pairs in said double stranded polynucleotide is used, and/or (iii) when one or both ends of said polynucleotide has a 3′ protruding end according to step (c), in step (d) said polymerase is inactivated, degraded or removed, said ddNTP which did not attach in step a) is dephosphorylated, said ddNTP is outcompeted with another ddNTP and/or a labelling probe and reporter probe which when bound together provide a single stranded region which forms said 3′ protruding end which is at least 1 nucleotide in length is used and/or a labelling probe and reporter probe which when bound together provide a single stranded region at one or both of the double stranded polynucleotide's ends which is at least one nucleotide in length and said single stranded region results, at least in part, from a mismatch between one or more base pairs in said double stranded polynucleotide is used.
25. A method as claimed in claim 23 or 24 wherein said first and/or second label is as defined in any one of claims 5 to 8 and/or said labelling probe and/or reporter probe is from 10-100 nucleotides in length.
26. A method as claimed in any one of claims 23 to 25 wherein said polymerase is inactivated or degraded with proteinase K or SDS and/or said ddNTP is dephosphorylated with shrimp alkaline phosphatase or calf intestinal phosphatase.
27. A method as claimed in any one of claims 23 to 25 wherein removal of said polymerase or ddNTP comprises separating said labelling probe and/or reporter probe from said polymerase or ddNTP by affinity binding, preferably wherein said labelling probe or reporter probe carries one binding partner of a binding pair, preferably biotin.
28. A method as claimed in any one of claims 23 to 27 wherein said target nucleotide sequence is a single nucleotide polymorphism (SNP).
29. A method as claimed in any one of claims 23 to 28 wherein at least two target nucleotide sequences are detected in said method, preferably at least two SNPs.
30. A method as claimed in any one of claims 23 to 29 wherein at least two ddNTPs which are labelled are used, wherein preferably the first labels on the different ddNTPs are different.
31. A method as claimed in any one of claims 23 to 30 wherein at least two reporter probes (and/or labelling probes) are used, wherein preferably the second labels on the different reporter probes are different.
32. A method as claimed in claim 31 wherein at least two reporter probes and/or at least two labelling probes are used and when the reporter probe(s) and labelling probe(s) are hybridized to one another they generate at least two double stranded polynucleotides with different melting temperatures.
33. A method as claimed in any one of claims 30 to 32 wherein multiple pairs of labels are provided, wherein each pair of labels comprising a first label on a ddNTP and a second label on a reporter probe, wherein each pair of labels is different to every other pair of labels, wherein preferably each pair contains first and second labels which are different to any first or second label found in any other pair of labels.
34. A method as claimed in any one of claims 23 to 33 wherein the reporter probe is labelled at one of the three nucleotides at its 5′ end, preferably at the 5′ terminus.
35. A method as claimed in claim any one of claims 23 to 34 wherein in step (e) said double stranded polynucleotide is subject to dissociation wherein a change in the first or second label's signal (preferably fluorescence) during said dissociation is indicative of the presence of said target sequence in said test polynucleotide, wherein preferably said dissociation is achieved by heating and said double stranded polynucleotide is subjected to melting curve analysis.
36. A method of diagnosing Irritable Bowel Syndrome, comprising a method as claimed in any one of claims 23 to 35, wherein preferably at least two SNPs are detected in said method.
37. A method of genotyping an organism, comprising a method as claimed in any one of claims 23 to 35, wherein preferably at least two SNPs are detected in said method.
38. A kit comprising: (a) at least one ddNTP labelled with a first label, wherein preferably said label is as defined in any one of claim 5, 6, 25, 30 or 33, (b) at least one first polynucleotide (or labelling probe), wherein preferably said first polynucleotide (or labelling probe) is as defined in any one of claim 23, 25, 31 or 32, (c) at least one second polynucleotide (or reporter probe) labelled with a second label, wherein preferably said second polynucleotide (or reporter probe) is as defined in any one of claim 7, 8, 23, 25, 31, 32, 33 or 34, (d) a polymerase; and (e) at least one of: (i) a means for inactivating the polymerase (preferably a detergent, preferably SDS), (ii) a means for degrading the polymerase (preferably a proteinase, preferably proteinase K or a detergent, preferably SDS), (iii) a means for removing the polymerase, (iv) a means for dephosphorylating the ddNTP (preferably a phosphatase), (v) a means for removing the ddNTP, and (vi) unlabeled ddNTP for outcompeting the labelled ddNTP; wherein the first or second label affects the signal generated by the other label when the labels are in proximity to one another.
39. A method of assessing the effect of a polymerase on the melting temperature (Tm) and/or FRET (preferably quenching) of a double stranded polynucleotide with an optional single stranded region, wherein preferably said method is a melting curve analysis method, wherein said method is performed on two samples and for each sample the method comprises the step of bringing into contact said polymerase, optionally ddNTP and/or dNTP, and a first and second polynucleotide which hybridize to one another to form a third polynucleotide which is said double stranded polynucleotide, wherein when FRET effects are to be assessed said first polynucleotide carries a fluorescent label, wherein said method performed on only one of said samples further comprises inactivating, degrading or removing said polymerase prior to assessing Tm and/or FRET effects, and/or, when FRET effects are to be assessed and dNTP and/or ddNTP are used in said method dephosphorylating or removing said dNTP and/or ddNTP and/or outcompeting said dNTP and/or ddNTP with another dNTP and/or ddNTP, subjecting the two samples to melting temperature analysis and/or FRET analysis, and assessing whether the melting temperature and/or FRET effects differ between the two samples to determine the effect of said polymerase on the melting temperature and/or FRET of said double stranded polynucleotide, wherein preferably said double stranded polynucleotide is as defined in claim 1 or 2 and/or preferably said method comprises an additional step as defined in claim 12, preferably as defined in claim 13 and/or preferably said inactivating, degrading or removing said polymerase or said dephosphorylating or removing said dNTP and/or ddNTP is performed as defined in any one of claims 14 to 17.
Description
[0192] All combinations of the preferred features described above are contemplated, particularly as described in the Examples. The invention will now be described by way of a non-limiting Examples with reference to the drawings in which:
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
EXAMPLES
Example 1
Materials & Methods
Template Generation for LP Labelling
[0205] Plasmids harbouring 16S rDNA sequences from E. coli or Faecalibacterium spp. were utilised in polymerase chain reactions to generate template for labelling probe (LP) labelling. In brief, 1 μL of a lysate of bacteria harbouring the plasmid clone was added to the following reaction components: 1.25 U HOT FIREPol® DNA polymerase, 1× B2 buffer, 2.5 mM MgCl.sub.2 (all from Solis Biodyne, Estonia), 0.1 mM dNTPs (Thermo Fisher Scientific, USA), 0.2 μM HU primer and 0.2 μM HR primer (see Table 3 for primer sequences) in a total volume of 30 μL. PCR amplification was carried out using an Applied Biosystems Veriti™ Thermal Cycler (Life Technologies, USA) and included an initial activation step for 12 minutes at 95° C., followed by 30 cycles of 30 seconds denaturation at 95° C., 30 seconds annealing at 65° C. and elongation at 72° C. for 1 minute and 30 seconds; a final elongation step at 72° C. for 7 minutes was also included. PCR products were visualised under UV illumination following electrophoresis of 5 μL of each reaction on 1% agarose gels containing 1× TAE buffer and 0.6 μg/mL ethidium bromide. To the remaining 25 μL of each reaction, 3 U of Exonuclease I (Exol; BioLabs Inc., Ipswich, Mass., USA) and 8 U of shrimp alkaline phosphatase (USB Corporation, Cleveland, Ohio, USA) were added prior to incubation at 37° C. for 90 min, 80° C. for 15 min before being placed on ice.
Labelling Primer End-Labelling
[0206] Four μL of a dilution series (undiluted, 10.sup.−1, 10.sup.−2, 10.sup.−3 and 10.sup.−4 diluted) Exo-SAP-treated PCR product template (or H.sub.2O as no template control) was added to 16 μl labelling reaction master mix for a total reaction volume of 20 μL [5 U HOT TERMIPol® DNA polymerase, 1× Reaction Buffer C, 1 mM MgCl.sub.2 (all from Solis Biodyne), 0.4 μM ddCTP.sup.TAMRA (TAMRA-labelled dideoxycytidine triphosphate; Jena Bioscience, Germany) and 0.1 μM LP (Table 3) in DNase/RNase free water]. The thermocycling conditions employed were: initial activation step for 10-12 minutes at 95° C., followed by 10 cycles of 30 seconds denaturation at 96° C., a 1 minute combined annealing and elongation step at 60° C. and a final hold at 10° C.
Melting Curve Analysis
[0207] To each LP labelling reaction, 5′ fluorescently labelled reporter probe (RP) was added to a final concentration of 0.05-0.1 μM in the presence or absence of proteinase K (final concentration of 25-50 μg/mL). Reactions were placed in a fluorescence-detecting thermocycler (ABI 7500 Fast, Applied Biosystems) with the following temperature profile: 56° C. for 30 minutes, 95° C. for 15 seconds, 40° C. for 15 s, 95° C. for 15 s and 60° C. for 15 s. These last four steps comprise the dissociation stage in which fluorescence is detected and expressed in dissociation curves as the derivative (dF/dT) of the fluorescence vs. temperature measurements.
Organic Extraction to Eliminate False Positive Quenching
[0208] In one experiment a chloroform extraction (1:1 v/v) was performed on the melting curve reaction after the initial dissociation before performing a secondary dissociation (as described above) to assess the effect of the extraction.
Proteinase K Treatment to Eliminate False Positive Quenching
[0209] Initially, proteinase K was added to a final concentration of 25-50 μg/mL simultaneously with the reporter probe prior to dissociation analysis. Later the concentration was raised to 100 μg/mL and treatment with the enzyme was allowed to proceed for 30 minutes at 56° C. prior to the addition of reporter probe. Furthermore, samples subjected to melting curve analysis that had not been treated with proteinase K, were subsequently treated with the enzyme prior to a second dissociation.
Analysis of Terminal Transferase-Like Activity of HOT TERMIPol DNA Polymerase
[0210] When testing for interactions between LP-RP duplexes and HOT TERMIPol DNA polymerase in the presence of ddCTP.sup.TAMRA, the reactions were set up as above with the polymerase in 1× buffer C, the ddCTP.sup.TAMRA and MgCl.sub.2. These reactions were first subjected to 95° C. for 10-12 minutes to activate the polymerase prior to adding the LP and splitting the reactions in two, one receiving proteinase K (50 μg/mL final concentration) prior to incubation for 30 minutes at 56° C. Corresponding RP's were then added and the reactions were further split in two, one set for dissociation as above and the other for capillary electrophoresis (see below).
Capillary Electrophoresis
[0211] To assess potential covalent, HOT TERMIPol-based labelling of oligonucleotides (LP and/or RP) with ddCTP.sup.TAMRA in the presence or absence of labelling template (ExoSAP-treated PCR product), complementary oligonucleotides or proteinase K treatment, melting curve reactions were first treated with Calf Intestinal Phosphatase (CIP) to remove phosphate groups from unincorporated ddCTP.sup.TAMRA before being subject to capillary electrophoresis on an ABI 3130xl Genetic Analyzer (Applied Biosystems, USA) using DyeSet G5, with or without a GSLIZ120 size standard, in which the TAMRA label is detected as the yellow (NED) dye of this dyeset.
Results and Discussion
[0212]
False Positive Quenching and its Alleviation
[0213] Our initial experiments developing the technology to quantify the presence of bacterial species involved the amplification of 16S rDNA sequences for use as template to end-label species-specific LPs adjacent to a G on the template strand. These experiments utilized lysates of transformants harbouring plasmids containing 16S rDNA sequences from E. coli and Faecalibacterium spp., and plasmid-specific PCR primers (HU and HR; see Table 3) were employed to avoid amplification of bacterial host sequences. As shown in
[0214] As an alternative to organic extraction, in line with the observation that the false positive effect was entirely polymerase-dependent, we chose to test whether including a proteinase K step to inactivate the polymerase could replace the chloroform extraction. The 2_1 LP and 2_1_in1bFAMRevComp RP (see Table 3 for sequences) were combined in the presence of ddCTP.sup.TAMRA and in the presence/absence of both the HOT TERMIPol DNA polymerase and proteinase K. To allow proteinase K to inactivate the polymerase, a 30 minute incubation at 56° C. was included after polymerase activation but prior to melting curve generation. Only the sample harbouring the polymerase without proteinase K showed a quenching response (
[0215] Using the proteinase K treatment to avoid the false positive effect, we then performed a new test of our LAD method.
False Positive Quenching Appears to Involve a Terminal Transferase-Like Activity
[0216] Although inclusion of a proteinase K treatment to inactivate the polymerase alleviated the false positive effect allowing our LAD method to perform successfully, we wished to explore the mechanism underlying the false positive effect to provide information effecting LP-RP probe duplex design parameters. To address whether the mechanism underlying the false positive effect possibly involved a covalent addition of the ddCTP.sup.TAMRA, the following experiment was performed. Two pairs of LP-RP duplexes (2_1 LP/2_1_in1bFAMRevComp RP and Faecali LP/Faecali RevComp FAM), each forming double blunt ends and a third in which the RP forms a 5′-FAM-G overhang at one end when duplexed with its complementary LP (Faecali LP/Faecali RevComp+1 FAM) were each placed in a reaction mix containing activated HOT TERMIPol DNA polymerase, ddCTP.sup.TAMRA, buffer/MgCl.sub.2, with and without proteinase K. Samples were first incubated at 56° C. for 30 minutes, then subjected to melting curve analysis. The proteinase K-untreated samples were then treated with proteinase K before both sets of samples were dissociated once again. The first two double blunt ended duplexes represent those employed in LAD, while the third having a 5′-protruding G was thought to function as a positive control for polymerase primer extension activity as the ddCTPTAMRA should be incorporated opposite this residue due to the enzyme's 5′->3′ polymerase activity.
[0217]
[0218] Results for the positive control duplex indicate that the proteinase K-treatment prior to the first dissociation was not sufficient to inhibit polymerase-directed LP extension with ddCTP.sup.TAMRA, while its eventual inactivation by proteinase K in both samples lead to an apparent lowered Tm of the quenching response. The fact that neither of the 2_1 double blunt ended duplex samples showed quenching in
[0219] The polymerase can also, in the presence of ddCTP.sup.TAMRA, direct a false positive quenching response of a fluorescently labelled RP when in duplex with a complementary, unlabeled LP. Thirdly, the polymerase has an apparent stabilization effect on quenched duplexes, regardless of the nature of ddCTPTAMRA binding/tethering; inactivation of the polymerase reduces the Tm of the quenching response.
[0220] These results are unexpected in view of the observations of Clark (1988, supra) who found that blunt ended oligonucleotide duplexes could be efficiently labelled with dATP by a non-template-dependent terminal deoxyribonucleotidyltransferase
[0221] (TdT)-like activity of thermostable DNA polymerases; similar labelling with dGTP was much less efficient, and nearly undetectable for dTTP and dCTP.
Verification of the TdT-Like Activity of HOT TERMIPol
[0222] In the previous experiment, only one of two blunt ended duplexes were labelled by the TdT-like activity, possibly indicating a sequence-context specificity of this activity. Also, the proteinase K was added simultaneously with the reporter probe, allowing for polymerase activity prior to full inactivation by the proteinase K. Detection of the TdT-like activity was also indirect, based on the observation of quenching during melting curve generation. We wished to test the potential HOT TERMIpol-based labelling of a third double blunt-ended LP-RP duplex directly by detecting fluorescence labelling of oligonucleotides by capillary electrophoresis. To determine polymerase-dependency of any such labelling, we treated the reactions containing activated polymerase with proteinase K prior to addition of the RP. The summary of these experiments is shown in Table 5. In the presence of active HOT TERMIPol DNA polymerase (i.e. in the absence of proteinase K treatment), both oligonucleotides of duplex 4 showed template-independent labelling with ddCTP.sup.TAMRA and the duplex showed the corresponding false positive quenching and Tm shift responses. It should be noted that the duplex also exhibited a background quenching response even when treated with proteinase K. The 3′ end of the LP in this duplex contains two terminal guanine bases that are known harbour intrinsic quenching activity (Marras et al., 2002, Nucleic Acids Research, e122; Seidel et al., 1996, J. Phys. Chem., 100, p 5541-5553).
Alternative Duplex Structures to Circumvent the TdT-Like Activity of HOT TERMIPol
[0223] We have demonstrated a novel TdT-like activity of HOT TERMIPol DNA polymerase that can add a single ddCTP to the ends of blunt-ended oligonucleotide duplexes. In addition, the evidence supports the ability of active polymerase to, by an unknown mechanism, tether unincorporated ddCTP.sup.TAMRA to a duplex harbouring a fluorescent label, thus generating a temperature-dependent quenching response that also shows an increased Tm indicative of a duplex-stabilising effect of the polymerase. This may also result from the direct polymerase-dependent false FRET effects. Collectively, these effects may be overcome by the inclusion of a polymerase inactivation step (by proteinase K treatment) prior to melting curve analysis.
[0224] With the aim of reducing some or all of these effects, we evaluated alternative duplex structures containing combinations of 5′ non-complementary protruding and/or 3′ protruding ends, some of which were labelled with a reporter fluorochrome, and assayed their ddCTP.sup.TAMRA-labelling and temperature-dependent quenching behaviours in the presence of active or inactive HOT TERMIPol DNA polymerase.
[0225] As shown in Table 6, none of the oligonucleotides of duplexes 5-9 that form 5′ T protrusions (either one or two T's in the presence or absence of a FAM label), or 3′ C or G protrusions become labelled with ddCTP.sup.TAMRA in the presence or absence of active DNA polymerase. The presence of a 5′ protrusion containing a FAM-labelled T (duplex 5) somewhat reduced the intrinsic double G quenching effect of the unlabeled LP in the absence of active polymerase as compared with that of duplex 4 (Table 5). Extending the distance between these two G bases of the LP and the 5′ FAM label in duplex 7 further reduced this effect. In the presence of non-proteinase K-treated, active polymerase, both duplex 5 and 7 showed increased quenching, a combination of the double G effect and the false positive ddCTP.sup.TAMRA-tethering effect and/or polymerase-dependent false FRET effect in the case of duplex 5 and less so of the former and more of the latter for duplex 7; both exhibited the corresponding Tm shift. Duplex 8 had the FAM-label positioned closer to the two guanines and yielded a correspondingly increased double G quenching effect.
[0226] Surprisingly the presence of active polymerase neither increased the quenching via the false positive effect, nor stabilised the duplex significantly as judged by the meagre increase in Tm. This result may indicate that the polymerase exhibits reduced binding at duplex ends harbouring a 5′ recess.
[0227] Results from Table 6 are consistent with the view that primer duplexes containing an LP with a G-rich 3′-end will have intrinsic quenching properties and the extension of the reporter fluorophore labelled 5′ end of the corresponding RP with a base (or two, i.e. T) not complementary to the ddCTP.sup.TAMRA label appeared to alleviate this G-mediated quenching effect, but did not seem to affect the false positive quenching effect caused by active polymerase in the presence of the labelled ddCTP as was observed for duplex 8. The differences in false positive quenching behaviour of duplexes may be explained by potential difference in binding efficiencies the active polymerase has for dsDNA end containing a 5′ recess vs. a 5′ protrusion, even with a base that is non-complementary to the free dideoxynucleoside triphosphate.
[0228] We wished to test whether the inclusion of 5′ LP-protrusions harbouring a non-complementary base in duplex with RPs containing either similar 5′ protrusions or a 5′ recess could further reduce the false positive effect. As shown in Table 7, the 3′ ends of RPs in duplex with an LP containing a 5′ T protrusion unexpectedly became labelled with ddCTP.sup.TAMRA in the presence of active polymerase, as verified by capillary electrophoresis (CE). That a similar 3′ extension of LPs opposite corresponding 5′ RP T-extensions (duplexes 10-12, Table 7 and duplexes 5-7, Table 6) was not observed may indicate a 3′-end-sequence-context specificity for this activity; the presence of a FAM label on these 5′ RPs does not appear to account for this discrepancy when considering the results for duplexes 11 (Table 7) and 6 (Table 6). Assessment of the false positive effect of the duplexes in Table 7 was confounded by the background double G effect and the potential for a 3′ TAMRA label on the RP exercising intramolecular quenching of the FAM-label on its 5′ end. In addition, depletion of unincorporated ddCTP.sup.TAMRA due to the 3′ RP-labelling might also be expected to reduce false positive quenching by the active polymerase and/or removal of polymerase to avoid the polymerase-dependent false FRET effects. These effects may be most profound in duplex 13, which showed the greatest degree of 3′ RP labelling of all the duplexes analysed by CE (data not shown), and in which the distance between the 3′-TAMRA and 5′-FAM moieties in the dually labelled RP is the shortest.
Preliminary Conclusions Regarding Optimal LAD Duplexes and Pre-Dissociation Treatments
[0229] From the results presented here, especially with regard to the hitherto undocumented TdT-like and non-complementary primer extension activities of the Thermosequence-like HOT TERMIPol DNA polymerase in addition to the false positive and Tm shift effects that occur during duplex dissociation irrespective of these activities, we can summarise important characteristics for optimal LAD duplexes.
[0230] 1. Unlabeled LPs in duplex with 5′ reporter-labelled RPs should generate single-base 5′ recesses at both ends. Blunt ends have the potential of becoming labelled by the TdT-like activity of the polymerase (duplexes 2 and 4 in Tables 4 and 5, respectively). Duplexes that contain 5′ protrusions complementary to the ddNTP should be avoided as they risk becoming labelled by primer extension activity of the polymerase. Such protrusions should also be avoided even when non-complementary to the ddNTP due to the non-complementary primer extension activity of the polymerase documented herein (duplexes 10-14).
[0231] 2. LPs can be designed adjacent to either side of an SNP and when possible, they should be designed to avoid guanines at the 3′ end to limit their intrinsic quenching effects. Similarly, RPs may be 5′-labelled with a reporter fluorochrome and 5′ guanines should be avoided when possible. These are not absolute requirements for the LAD method to work successfully as one measures the difference in temperature-dependent quenching between duplexes in which the LP becomes extended by the quencher-coupled ddNTP vs. those in which the LP remains unlabeled.
[0232] It should be noted that primer duplexes harbouring 5′ recessed ends will likely also be subject to the false positive and Tm shift effects of the active polymerase regardless of whether the quencher-coupled ddNTP is present or not. The results from duplex 8 suggest that the polymerase may bind 5′ recessed dsDNA ends less efficiently than blunt ends or 3′ recessed ends, thus abating the false positive and
[0233] Tm shift effects. These effects may be avoided by inactivating the polymerase with proteinase K treatment prior to RP addition and dissociation (as described above). This may also be used for duplexes with blunt and/or 3′ recessed ends, both to alleviate the false positive and Tm shift effects, but also to avoid pre-dissociation duplex labelling by TdT-like or primer extension activities of the polymerase.
[0234] Alternative treatments to alleviate the false positive effect may be to treat the post-LP-labelling sample with a phosphatase to inactivate the quencher-coupled ddNTP, or add unlabeled ddNTP to outcompete the quencher-coupled ddNTP as described herein. To abate both the false positive and Tm shift effects, an anti-DNA polymerase antibody that cross-reacts with HOT TERMIPol could added to the samples prior to RP addition and dissociation.
TABLE-US-00003 TABLE 3 Primer names and sequences (fluorescent FAM label indicated at 5′ ends). Primer name Sequence (5′-3′) 2_1 LP CAGGTGTAGCGGTGAAATGCGTAGAGAT 2_1_in1bFAMRevComp FAM-ATCTCTACGCATTTCACCGCTACA CCTG Faecali LP CGTAGTTAGCCGTCACTTC Faecali RevComp +1 FAM-GGAAGTGACGGCTAACTACG FAM Faecali RevComp FAM FAM-GAAGTGACGGCTAACTACG LAD LP GP2 GAGCTGGGGTAGCAGG LAD LP GP2 −1(5′) AGCTGGGGTAGCAGG LAD LP GP2 5′T TGAGCTGGGGTAGCAGG LAD RP1 GP2atda −1 CTGCTACCCCAGCTC LAD RP1 GP2atda −1 FAM-CTGCTACCCCAGCTC FAM LAD RP1 GP2atda +1T TCCTGCTACCCCAGCTC LAD RP1 GP2atda +1T FAM-TCCTGCTACCCCAGCTC FAM LAD RP1 GP2atda +2T FAM-TTCCTGCTACCCCAGCTC FAM LAD RP1 GP2atda 0 FAM-CCTGCTACCCCAGCTC FAM HR GCTTCCGGCTCGTATGTTGTGTGG HU CGCCAGGGTTTTCCCAGTCACGACG
TABLE-US-00004 TABLE 4 Primer duplexes treated with proteinase K prior to either first or second dissociation (solid circles represent the FAM labels and the stippled circles indicate sites of covalent ddCTP.sup.TAMRA labelling that can explain the quenching behaviour observed). No Prot. K added at Prot. K added at 1st dissoc; 1st dissoc.; Prot. K-treat. .fwdarw. directly to .fwdarw. 2nd dissoc. 2nd dissoc. 1st 2nd 1st 2nd Dissoci- Dissoci- Dissoci- Dissoci- ation ation ation Dation Duplex Pairing Alignment Oligo names Quenching Quenching Quenching Quenching 1
TABLE-US-00005 TABLE 5 Verification of blunt-end labelling of oligonucleotide duplexes by HOT TERMIPol (solid circle represents the FAM label and the strippled circles indicate sites of covalent ddCTP.sup.TAMRA labelling that can explain the quenching behaviour observed). CE-verified labelling Dissociation with ddCTP.sup.TAMRA Quenching Duplex Pairing Alignment Oligo names (− prot. K only) (+/− prot. K) Interpretation 4
TABLE-US-00006 TABLE 6 No labelling of 3′ protruding ends (solid circles represent the FAM labels). CE-verified labelling with Dissociation ddCTP.sup.TAMRA Quenching Duplex Pairing Aligment Oligo names (+/− prot. K) (+/− prot. K) Interpretation 5
TABLE-US-00007 TABLE 7 Non-template-based labelling of 3′ recessed ends opposite a 5′ protruding, non-complementary base (solid circles represent the FAM labels and the strippled circles indicate sites of covalent ddCTP.sup.TAMRA labelling that can explain the quenching behaviour observed). CE-verified labelling Dissociation with ddCTP.sup.TAMRA Quenching Duplex Pairing Aligment Oligo names (+/− prot. K) (+/− prot. K) Interpretation 10
Example 2
Materials & Methods
Template Generation for LP Labelling
[0235] Plasmids harbouring bovine MYOSTATIN (MSTN) sequences were utilised in polymerase chain reactions to generate template for labelling probe (LP) labelling. In brief, 100 pg plasmid DNA was added to the following reaction components: 1.25 U HOT FIREPol® DNA polymerase, 1× B2 buffer, 1.5 mM MgCl2 (all from Solis Biodyne, Estonia), 0.1 mM dNTPs (Thermo Fisher Scientific, USA), 0.1-0.2 μM sense primer (SP) and 0.1-0.2 μM antisense primer (ASP; see Table 8 for primer sequences) in a total volume of 30 μL. PCR amplification was carried out using an Applied Biosystems Veriti™ Thermal Cycler (Life Technologies, USA) and included an initial activation step for 10 minutes at 95° C., followed by 30 cycles of 30 seconds denaturation at 95° C., 30 seconds annealing at 50-60° C. and elongation at 72° C. for 1 minute and 30 seconds; a final elongation step at 72° C. for 7 minutes was also included. PCR products were visualised under UV illumination following electrophoresis of 5 μL of each reaction on 1% agarose gels containing 1× TAE buffer and 0.6 μg/mL ethidium bromide. To the remaining 25 μL of each reaction, 3 U of Exonuclease I (Exol; BioLabs Inc., Ipswich, Mass., USA) and 8 U of shrimp alkaline phosphatase (USB Corporation, Cleveland, Ohio, USA) were added prior to incubation at 37° C. for 90 min, 80° C. for 15 min before being placed on ice.
TABLE-US-00008 TABLE 8 Primer names and sequences. Primerr name Sequence (5′-3′) SP_MSTNgene_371-480 CTCCTCCACTCCTGGAACTG ASP_MSTN gene_371-480 CGTCCTGGCGTGGTAGTC SP_MSTN gene_2329-2683 TTATAGCTGATCTTCTAACGCAAGTG ASP_MSTN gene_2329-2688 CTGGGAAGGTTACAGCAAGATC SP_MST gene_4787-4976 GGAGAGATTTTGGGCTTGATTG ASP_MSTN gene_4787-476 TGCACAAGATGGGTATGAGGATAC ASP60 TTGTGATGTAGATGGCGGTTAGGACG GCAGTTTTATGGAGGTGGATAGGTCT TTACTCAG ASP30 AGTTTTATGGAGGTGGATAGGTCTTT ACTC ASP10 AGTTTTATGGAGGTGGATAG ASP16 TTATGGAGGTGGATAG SP60 CTGAGTAAAGACCTATCCACCTCCAT AAAACTGCCGTCCTAACCGCCATCTA CATCACAA D182N LP (C_U) TTCCAGTATACCTTGTACCGT D182N RP (C)CY5 CY5-TTTCGGTACAAGGTATACTGGA AT C313Y LP (C_U) GGATACTTTTGCAAAAATACAAATTC A C313Y RP (U)FAM FAM-AAuTTGTATTuTTGCAAAAGTA TccT nt821 (del11} LP (U) GGGCTTGATTGTGATGAACAC nt821 RP (U) HEX HEX-TTTGTTCATCACtATCAA Q204X LP (C_U) CCAGGCACTGGTATTTGG Q204X RP2 (C) ROX ROX-TTTTTCAAATACtAGTGCCTGG G E291X LP (C) CCAATCCCATCCAAAAGCTT E291X RP (C) CY5 CY5-TTTAGcTuTTGGATGGGATTGG A F94L LP (C) CTGGAACTGATTGATCAGTT F94L RP (C) ROX ROX-TTTACTGATCAATCAGTTCCAG G E226X LP (C) CCATTCTCATCTAAAGCTTTGATTT E226X RP (C) CY5 CY5-AATCAAA3CTTTAGATGAGAAT GGC E226X LP (U) CTGAATCCAACTTAGGCATT E226X RP (U)YY YY-ATGCCTAAGcTGGATTCAGG E291X LP (U) GTTACCCTCTAACTGTGGATTTT E291X RP (U)YY YY-AAATcCAcAGTTAGAGGGTAAcG F94L LP (U) GGCATCTCTCTGGACATC F94L RP (U)FAM FAM-ATGTCCAGAGAGATGCCA nt419 Wt LP (U) AGTTTATTGTATTGTATCTTAGAGCT AAA nt419 RP (U) FAM FAM-TTTAGCTCTAAGATAG nt419 (d7l10) LP (C) GAAAACCCAAATGTTGTTTCTAAG nt419 (d7l10) RP (C) ROX ROX-TTTTCTTAGAAACAACATTA Fluorescent FAM, HEX, Yakima Yellow (YY), ROX and CY5 labels of reporter probes are indicated. Lower case letters may indicate intentional mismatches or modified nucleotides (pdU, pdC or 5Me-C) utilized to achieve good Tm resolution between quenching signals on a given fluorescence channel.
Labelling Primer End-Labelling
[0236] Four μL of Exo-SAP-treated PCR product template (or H.sub.2O as no template control) was added to 16 μl labelling reaction master mix for a total reaction volume of 20 μL [5 U HOT TERMIPol® DNA polymerase, 1× Reaction Buffer C, 1 mM MgCl2 (all from Solis Biodyne), 0.4 μM ddNTP.sup.QUENCHER (ATTO540Q-labelled dideoxyuridine triphosphate, ATTO612Q-labelled and DYQ660-labelled dideoxycytidine triphosphate; Jena Bioscience, Germany) and 0.1 μM LP (Table 8) in DNase/RNase free water]. The thermocycling conditions employed were: initial activation step for 10-12 minutes at 95° C., followed by 10 cycles of 30 seconds denaturation at 96° C., a 1 minute combined annealing and elongation step at 60° C. and a final hold at 10° C.
Terminal Transferase Labelling
[0237] Reactions harbouring 0.1 μM labelling probe, 1× TdT buffer, 0.5 mM ddNTP.sup.QUENCHER (ATTO540Q-labelled dideoxyuridine triphosphate, ATTO612Q-labelled and DYQ660-labelled dideoxycytidine triphosphate; Jena Bioscience, Germany), 0.25 mM CoCl.sub.2, 0.2 U/4 Terminal (deoxynucleotidyl) Transferase (New England Biosciences) were incubated at 37° C. for 1 hour, and the enzyme was then heat-inactivated at 75° C. for 30 min.
Melting Curve Analysis
[0238] Prior to adding reporter probe and performing melting curve analysis, samples were treated with proteinase K (final concentration of 25-58 μg/mL in H.sub.2O, 1× Buffer C or 1× TdT buffer), bovine serum albumin (BSA, final concentration of 25-58 μg/mL in H.sub.2O, 1× Buffer C or 1× TdT buffer), SDS (final concentration of 0.1-0.25% in H.sub.2O, 1× Buffer C or 1× TdT buffer), or simply an identical volume of H.sub.2O, 1× Buffer C or 1× TdT buffer was added. Samples were then incubated at 56° C. for 30 min. Reporter probes were then added to a final concentration of 0.025-0.1 μM. Once it had been determined that SDS was as effective as proteinase K in inactivating the polymerase thus alleviating both the Tm shift and false FRET effects, reporter probes were added directly in a solution containing SDS (final concentration of 0.1-0.25% in H.sub.2O, 1× Buffer C or 1× TdT buffer). Reactions were then placed in a fluorescence-detecting thermocycler (ABI 7500 Fast, Applied Biosystems) with the following temperature profile: 95° C. for 15 seconds, 25-30° C. for 15 s, 95° C. for 15 s and 60° C. for 15 s. These last four steps comprise the dissociation stage in which fluorescence is detected and expressed in dissociation curves as the derivative (dF/dT) of the fluorescence vs. temperature measurements. Samples that contained duplexes where neither oligonucleotide was conjugated to a fluorophore, EvaGreen (Biotium) was added to a final concentration of 1×.
Results & Discussion
[0239] The Polymerase-Dependent False FRET Effect is Independent of ddNTP-Quencher
[0240] In order to further investigate the possible mechanism underlying the polymerase-dependent false quenching (FRET) effect, we performed mock labelling reactions lacking template and harbouring all combinations of +/−LP (labelling probe), +/−ddUTP-ATTO540Q that were first incubated at 95° C. for 10 minutes to activate the Hot TERMIpol DNA polymerase prior to being split into two equal sets of aliquots. Proteinase K (in 1× Buffer C) was added to one set at a final concentration of 58 μg/mL, and the other set received an identical volume of 1× Buffer C. Both sample sets were incubated at 56° C. for 30 min. prior to generating melting curves from 30° C. to 95° C. The FAM-labelled RP C313Y RP (U)FAM and the HEX-labelled RP nt821 RP (U) HEX showed quenching responses in samples containing their respective complementary LPs, C313Y LP (C_U) and nt821 (del11) LP (U) regardless of the presence or absence of the quencher-labelled ddNTP, but only those untreated with proteinase K where the polymerase remains active (
SDS Treatment Alleviates the Tm Shift and False FRET Effects
[0241] To find alternative methods to inactivate the polymerase that would not require a separate treatment and incubation step prior to adding the reporter probe(s), SDS was used. Sodium dodecyl sulfate (SDS) is a detergent and powerful protein denaturant that does not significantly affect nucleic acid hybridization at concentrations below 1%. The addition of SDS to a final concentration of 0.1-0.25% to samples harbouring LPs prior to adding RPs and performing melting curve analysis was tested.
[0242]
[0243] When added to unlabeled LPs prior to RP addition and melting curve generation, 0.1% SDS was also as effective as proteinase K in alleviating the false FRET effect seen in the negative control reaction treated with non-supplemented 1× buffer C (
[0244] The use of SDS to inactivate the polymerase represents a significant improvement to the LAD method by obviating an extra reagent addition step and the intervening incubation period; the reporter probe(s) may be added simultaneously with the SDS and melting curve determination can be initiated directly.
The Duplex Tm Shift Effect is a Generic Property of DNA Polymerases
[0245] Non-Thermosequenase-like DNA polymerases do not incorporate fluorochrome-conjugated ddNTPs into DNA efficiently, so to test the ability of a conventional, PCR-amenable DNA polymerase (e.g. Hot FIREPol) to elicit the duplex-stabilising Tm shift effect observed for Hot TERMIPol, the labelling probes were labelled with quencher-labelled ddNTPs using the heat labile terminal (deoxynucleotidyl) transferase. Once the labelling reaction at 37° C. was complete, the terminal transferase activity was eliminated by incubation at 75° C. for 30 minutes. Hot FIREPol was then added to the reactions, heat activated at 95° C. for 10-12 minutes prior to adding the complementary reporter probe either in a polymerase-inactivating SDS solution or in sample buffer in which the polymerase would remain active.
[0246] As shown in
The Polymerase-Dependent Duplex Tm Shift Effect Does not Require Conjugated Fluorophores
[0247] In order to verify that the polymerase-dependent Tm shift effect is not a property observed only for duplexes in which both oligonucleotides are conjugated with a fluorophore/quencher, we employed the dsDNA-binding fluorescent dye EvaGreen that only fluoresces when it reversibly intercalates between nucleotide pairs in duplexed DNA.
Use of LAD Technology to Genotype 8 Alleles at 2 Tms Across 4 Fluorescent Channels
[0248] We applied LAD technology to genotype four polymorphisms (three SNPs and one indel) across three amplicon regions of the bovine MYOSTATIN (MSTN) gene, mutations in which are the causative factor in the double-muscling trait.