TANDEM DNA ELEMENT CAPABLE OF ENHANCING PROTEIN SYNTHESIS EFFICIENCY
20230203555 · 2023-06-29
Inventors
Cpc classification
C12N15/67
CHEMISTRY; METALLURGY
International classification
Abstract
A tandem DNA element capable of enhancing protein synthesis efficiency, in particular, the nucleic acid construct is formed by an IRES enhancer (such as ScBOI1, ScFLO8, ScNCE102, ScMSN1, KlFLO8, KlNCE102, KlMSN1, KlBOI1) derived from eukaryotic cells (such as yeast), a Ω sequence, and a yeast-specific Kozak sequence in tandem. The use of the nucleic acid construct in a yeast-based in vitro biosynthesis system (such as a yeast-based in vitro protein synthesis system) can significantly improve protein synthesis efficiency.
Claims
1. A nucleic acid construct, comprising a nucleic acid sequence of Formula I: Z1-Z2-Z3-Z4-Z5 (I) wherein, Z1˜Z5 are respectively an element as part of the nucleic acid construct; each “-” is independently a bond or a nucleotide linking sequence; Z1 is an enhancer element, comprising an IRES element; Z2 is a 5′ leading sequence of tobacco mosaic virus, that is Ω sequence; Z3 is an oligomeric chain [oligo(A)]n of adenine deoxynucleotide; Z4 is a translation initiation codon; Z5 is a serine codon; wherein Z3, Z4 and Z5 constitute a Kozak sequence, and the Kozak sequence is derived from yeast.
2. The nucleic acid construct of claim 1, wherein the IRES element is selected from the group consisting of ScBOI1, ScFLO8, ScNCE102, ScMSN1, KlFLO8, KlNCE102, KlMSN1, KlBOI1, and combinations thereof.
3. The nucleic acid construct of claim 1, wherein the nucleic acid sequence of the nucleic acid construct is any one of SEQ ID NO.: 2-17.
4. The nucleic acid construct of claim 1, comprising a structure of Formula II from 5′ to 3′:
Z1-Z2-Z3-Z4-Z5-Z6 (II) wherein, each “-” is independently a bond or a nucleotide linking sequence; Z6 is a coding sequence of an exogenous protein.
5. The nucleic acid construct of claim 4, wherein Z6 is a coding sequence of an exogenous protein which is selected from the group consisting of luciferin, luciferases, green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable regions of antibodies, luciferase mutants, α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursors, interferon αA, interleukin-1β, lysozyme, serum albumins, single-chain variable fragment of antibodies, transthyretin, tyrosinase, xylanase, and combinations thereof.
6. The nucleic acid construct of claim 4, wherein Z6 is a coding sequence of firefly luciferase.
7. The nucleic acid construct of claim 4, comprising a structure of Formula III from 5′ to 3′:
Z0-Z1-Z2-Z3-Z4-Z5-Z6 (III) wherein, each “-” is independently a bond or a nucleotide linking sequence; Z0 is a promoter element selected from the group consisting of T7 promoter, T3 promoter, SP6 promoter, and combinations thereof.
8. The nucleic acid construct of claim 4, comprising a structure of Formula IV from 5′ to 3′:
Z0′-Z1-Z2-Z3-Z4-Z5-Z6 (IV) wherein, each “-” is independently a bond or a nucleotide linking sequence; Z0′ is GAA.
9. A vector or a vector combination, containing a nucleic acid construct selected from any one of the following Groups: Group (1): a nucleic acid construct, comprising a nucleic acid sequence of Formula I:
Z1-Z2-Z3-Z4-Z5 (I) wherein, Z1˜Z5 are respectively an element as part of the nucleic acid construct; each “-” is independently a bond or a nucleotide linking sequence; Z1 is an enhancer element, comprising an IRES element; Z2 is a 5′ leading sequence of tobacco mosaic virus, that is Ω sequence; Z3 is an oligomeric chain [oligo(A)]n of adenine deoxynucleotide; Z4 is a translation initiation codon; Z5 is a serine codon; wherein Z3, Z4 and Z5 constitute a Kozak sequence, and the Kozak sequence is derived from yeast; Group (2): a nucleic acid construct, wherein, the nucleic acid sequence of the nucleic acid construct is any one of SEQ ID NO.: 2-17; Group (3): a nucleic acid construct, comprising a structure of Formula II from 5′ to 3′:
Z1-Z2-Z3-Z4-Z5-Z6 (II) wherein, Z1˜Z6 are respectively an element as part of the nucleic acid construct; each “-”, Z1, Z2, Z3, Z4, Z5 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (1); Z6 is a coding sequence of an exogenous protein; Group (4): a nucleic acid construct, comprising a structure of Formula III from 5′ to 3′:
Z0-Z1-Z2-Z3-Z4-Z5-Z6 (III) wherein Z0˜Z6 are respectively an element as part of the nucleic acid construct; Z0 is a promoter element selected from the group consisting of T7 promoter, T3 promoter, SP6 promoter, and combinations thereof; each “-”, Z1, Z2, Z3, Z4, Z5, Z6 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (3); Group (5): a nucleic acid construct, comprising a structure of Formula IV from 5′ to 3′:
Z0′-Z1-Z2-Z3-Z4-Z5-Z6 (IV) wherein, Z0′˜Z6 are respectively an element as part of the nucleic acid construct; Z0′ is GAA; each “-”, Z1, Z2, Z3, Z4, Z5, Z6 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (3); Group (6): a nucleic acid construct, comprising a nucleic acid sequence represented by the Formula I, the Formula II, the Formula III or the Formula IV, or comprising at least one nucleic acid sequence of SEQ ID NO.: 2-17; wherein, Z1 is an enhancer element, comprising an IRES element selected from the group consisting of ScBOI1, ScFLO8, ScNCE102, ScMSN1, KlFLO8, KlNCE102, KlMSN1, KlBOI1, and combinations thereof; Group (7): a nucleic acid construct selected from Groups (3)˜(6); wherein, the nucleic acid construct comprises a Z6 element which is a coding sequence of an exogenous protein, and the exogenous protein is selected from the group consisting of luciferin, luciferases, green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde phosphate dehydrogenase, catalase, actin, variable regions of antibodies, luciferase mutants, α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursors, interferon αA, interleukin-1β, lysozyme, serum albumins, single-chain variable fragment of antibodies, transthyretin, tyrosinase, xylanase, and combinations thereof; and Group (8): a nucleic acid construct selected from Groups (3)˜(6); wherein, the nucleic acid construct comprises a Z6 element which is a coding sequence of firefly luciferase.
10. A genetically engineered cell, wherein the genetically engineered cell has a nucleic acid construct integrated in its genome at one or more sites, or the genetically engineered cell contains a vector or a vector combination; wherein, the nucleic acid construct is selected from any one of the following Groups: Group (1): a nucleic acid construct, comprising a nucleic acid sequence of Formula I:
Z1-Z2-Z3-Z4-Z5 (I) wherein, Z1˜Z5 are respectively an element as part of the nucleic acid construct; each “-” is independently a bond or a nucleotide linking sequence; Z1 is an enhancer element, comprising an IRES element; Z2 is a 5′ leading sequence of tobacco mosaic virus, that is Ω sequence; Z3 is an oligomeric chain [oligo(A)]n of adenine deoxynucleotide; Z4 is a translation initiation codon; Z5 is a serine codon; wherein Z3, Z4 and Z5 constitute a Kozak sequence, and the Kozak sequence is derived from yeast; Group (2): a nucleic acid construct, wherein, the nucleic acid sequence of the nucleic acid construct is any one of SEQ ID NO.: 2-17; Group (3): a nucleic acid construct, comprising a structure of Formula II from 5′ to 3′:
Z1-Z2-Z3-Z4-Z5-Z6 (II) wherein, Z1˜Z6 are respectively an element as part of the nucleic acid construct; each “-”, Z1, Z2, Z3, Z4, Z5 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (1); Z6 is a coding sequence of an exogenous protein; Group (4): a nucleic acid construct, comprising a structure of Formula III from 5′ to 3′: Z0-Z1-Z2-Z3-Z4-Z5-Z6 (III) wherein, Z0˜Z6 are respectively an element as part of the nucleic acid construct; Z0 is a promoter element selected from the group consisting of T7 promoter, T3 promoter, SP6 promoter, and combinations thereof; each “-”, Z1, Z2, Z3, Z4, Z5, Z6 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (3); Group (5): a nucleic acid construct, comprising a structure of Formula IV from 5′ to 3′:
Z0′-Z1-Z2-Z3-Z4-Z5-Z6 (IV) wherein, Z0′˜Z6 are respectively an element as part of the nucleic acid construct; Z0′ is GAA; each “-”, Z1, Z2, Z3, Z4, Z5, Z6 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (3); Group (6): a nucleic acid construct, comprising a nucleic acid sequence represented by the Formula I, the Formula II, the Formula III or the Formula IV, or comprising at least one nucleic acid sequence of SEQ ID NO.: 2-17; wherein, Z1 is an enhancer element, comprising an IRES element selected from the group consisting of ScBOI1, ScFLO8, ScNCE102, ScMSN1, KlFLO8, KlNCE102, KlMSN1, KlBOI1, and combinations thereof; Group (7): a nucleic acid construct selected from Groups (3)˜(6); wherein, the nucleic acid construct comprises a Z6 element which is a coding sequence of an exogenous protein, and the exogenous protein is selected from the group consisting of luciferin, luciferases, green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable regions of antibodies, luciferase mutants, α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursors, interferon αA, interleukin-1β, lysozyme, serum albumins, single-chain variable fragment of antibodies, transthyretin, tyrosinase, xylanase, and combinations thereof; and Group (8): a nucleic acid construct selected from Groups (3)˜(6); wherein, the nucleic acid construct comprises a Z6 element which is a coding sequence of firefly luciferase.
11. A kit, comprising one or more reagents selected from one or more of the following Groups: Group (a): a nucleic acid construct; Group (b): a vector or a vector combination, wherein the vector or the vector combination contains the nucleic acid construct as defined in Group (a); and Group (c): a genetically engineered cell, wherein the genetically engineered cell has the nucleic acid construct as defined in Group (a) integrated in its genome at one or more sites, or the genetically engineered cell contains the vector or the vector combination as defined in Group (b); wherein, the nucleic acid construct is selected from any one of the following Groups: Group (1): a nucleic acid construct, comprising a nucleic acid sequence of Formula I:
Z1-Z2-Z3-Z4-Z5 (I) wherein, Z1˜Z5 are respectively an element as part of the nucleic acid construct; each “-” is independently a bond or a nucleotide linking sequence; Z1 is an enhancer element, comprising an IRES element; Z2 is a 5′ leading sequence of tobacco mosaic virus, that is Ω sequence; Z3 is an oligomeric chain [oligo(A)]n of adenine deoxynucleotide; Z4 is a translation initiation codon; Z5 is a serine codon; wherein Z3, Z4 and Z5 constitute a Kozak sequence, and the Kozak sequence is derived from yeast; Group (2): a nucleic acid construct, wherein, the nucleic acid sequence of the nucleic acid construct is any one of SEQ ID NO.: 2-17; Group (3): a nucleic acid construct, comprising a structure of Formula II from 5′ to 3′:
Z1-Z2 Z2-Z3-Z4-Z5-Z6 (II) wherein, Z1˜Z6 are respectively an element as part of the nucleic acid construct; each “-”, Z1, Z2, Z3, Z4, Z5 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (1); Z6 is a coding sequence of an exogenous protein; Group (4): a nucleic acid construct, comprising a structure of Formula III from 5′ to 3′:
Z0-Z1-Z2 Z2-Z3-Z4-Z5-Z6 (III) wherein, Z0˜Z6 are respectively an element as part of the nucleic acid construct; Z0 is a promoter element selected from the group consisting of T7 promoter, T3 promoter, SP6 promoter, and combinations thereof; each “-”, Z1, Z2, Z3, Z4, Z5, Z6 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (3); Group (5): a nucleic acid construct, comprising a structure of Formula IV from 5′ to 3′:
Z0′-Z1-Z2-Z2 Z3-Z4-Z5-Z6 (IV) wherein, Z0′˜Z6 are respectively an element as part of the nucleic acid construct; Z0′ is GAA; each “-”, Z1, Z2, Z3, Z4, Z5, Z6 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (3); Group (6): a nucleic acid construct, comprising a nucleic acid sequence represented by the Formula I, the Formula II, the Formula III or the Formula IV, or comprising at least one nucleic acid sequence of SEQ ID NO.: 2-17; wherein, Z1 is an enhancer element, comprising an IRES element selected from the group consisting of ScBOI1, ScFLO8, ScNCE102, ScMSN1, KlFLO8, KlNCE102, KlMSN1, KlBOI1, and combinations thereof; Group (7): a nucleic acid construct selected from Groups (3)˜(6); wherein, the nucleic acid construct comprises a Z6 element which is a coding sequence of an exogenous protein, and the exogenous protein is selected from the group consisting of luciferin, luciferases, green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde phosphate dehydrogenase, catalase, actin, variable regions of antibodies, luciferase mutants, α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursors, interferon αA, interleukin-1β, lysozyme, serum albumins, single-chain variable fragment of antibodies, transthyretin, tyrosinase, xylanase, and combinations thereof; and Group (8): a nucleic acid construct selected from Groups (3)˜(6); wherein, the nucleic acid construct comprises a Z6 element which is a coding sequence of firefly luciferase.
12. The use of a nucleic acid construct a vector or a vector combination according to claim 9, a genetically engineered cell or a kit, which is applicable for high-throughput in vitro protein synthesis; wherein, the vector or the vector combination contains the nucleic acid construct; wherein, the genetically engineered cell has the nucleic acid construct integrated in its genome at one or more sites, or the genetically engineered cell contains the vector or the vector combination; wherein, the kit comprises one or more reagents selected from one or more of the group consisting of the nucleic acid construct, the vector or the vector combination, and the genetically engineered cell; wherein, the nucleic acid construct is selected from any one of the following Groups: Group (1): a nucleic acid construct, comprising a nucleic acid sequence of Formula I:
Z1-Z2-Z3-Z4-Z5 (I) wherein, Z1˜Z5 are respectively an element as part of the nucleic acid construct; each “-” is independently a bond or a nucleotide linking sequence; Z1 is an enhancer element, comprising an IRES element; Z2 is a 5′ leading sequence of tobacco mosaic virus, that is Ω sequence; Z3 is an oligomeric chain [oligo(A)]n of adenine deoxynucleotide; Z4 is a translation initiation codon; Z5 is a serine codon; wherein Z3, Z4 and Z5 constitute a Kozak sequence, and the Kozak sequence is derived from yeast; Group (2): a nucleic acid construct, wherein, the nucleic acid sequence of the nucleic acid construct is any one of SEQ ID NO.: 2-17; Group (3): a nucleic acid construct, comprising a structure of Formula II from 5′ to 3′:
Z1-Z2-Z2 Z3-Z4-Z5-Z6 (II) wherein, Z1˜Z6 are respectively an element as part of the nucleic acid construct each“-”, Z1, Z2, Z3, Z4, Z5 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (1); Z6 is a coding sequence of an exogenous protein; Group (4): a nucleic acid construct, comprising a structure of Formula III from 5′ to 3′:
Z0-Z1-Z2-Z2 Z3-Z4-Z5-Z6 (III) wherein, Z0˜Z6 are respectively an element as part of the nucleic acid construct; Z0 is a promoter element selected from the group consisting of T7 promoter, T3 promoter, SP6 promoter, and combinations thereof; each“-”, Z1, Z2, Z3, Z4, Z5, Z6 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (3); Group (5): a nucleic acid construct, comprising a structure of Formula IV from 5′ to 3′:
Z0′-Z1-Z2-Z2 Z3-Z4-Z5-Z6 (IV) wherein, Z0′˜Z6 are respectively an element as part of the nucleic acid construct; Z0′ is GAA; each“-”, Z1, Z2, Z3, Z4, Z5, Z6 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (3); Group (6): a nucleic acid construct, comprising a nucleic acid sequence represented by the Formula I, the Formula II, the Formula III or the Formula IV, or comprising at least one nucleic acid sequence of SEQ ID NO.: 2-17; wherein, Z1 is an enhancer element, comprising an IRES element selected from the group consisting of ScBOI1, ScFLO8, ScNCE102, ScMSN1, KlFLO8, KlNCE102, KlMSN1, KlBOI1, and combinations thereof; Group (7): a nucleic acid construct selected from Groups (3)˜(6); wherein, the nucleic acid construct comprises a Z6 element which is a coding sequence of an exogenous protein, and the exogenous protein is selected from the group consisting of luciferin, luciferases, green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde phosphate dehydrogenase, catalase, actin, variable regions of antibodies, luciferase mutants, α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursors, interferon αA, interleukin-1β, lysozyme, serum albumins, single-chain variable fragment of antibodies, transthyretin, tyrosinase, xylanase, and combinations thereof; and Group (8): a nucleic acid construct selected from Groups (3)˜(6); wherein, the nucleic acid construct comprises a Z6 element which is a coding sequence of firefly luciferase.
13. An in vitro high-throughput synthesis method for an exogenous protein, comprising steps of: Step (i): in the presence of a eukaryote-based in vitro biosynthesis system, providing a nucleic acid construct; and Step (ii): under suitable conditions, incubating the eukaryote-based in vitro biosynthesis system of step (i) for a period of time T1 to synthesize the exogenous protein; wherein, the nucleic acid construct is selected from any one of the following Groups: Group (1): a nucleic acid construct, comprising a nucleic acid sequence of Formula I:
Z1-Z2-Z3-Z4-Z5 (I) wherein, Z1˜Z5 are respectively an element as part of the nucleic acid construct each “-” is independently a bond or a nucleotide linking sequence; Z1 is an enhancer element, comprising an IRES element; Z2 is a 5′ leading sequence of tobacco mosaic virus, that is Ω sequence; Z3 is an oligomeric chain [oligo(A)]n of adenine deoxynucleotide; Z4 is a translation initiation codon; Z5 is a serine codon; wherein Z3, Z4 and Z5 constitute a Kozak sequence, and the Kozak sequence is derived from yeast; Group (2): a nucleic acid construct, wherein, the nucleic acid sequence of the nucleic acid construct is any one of SEQ ID NO.: 2-17; Group (3): a nucleic acid construct, comprising a structure of Formula II from 5′ to 3′:
Z1-Z2-Z2 Z3-Z4-Z5-Z6 (II) wherein, Z1˜Z6 are respectively an element as part of the nucleic acid construct; each“-”, Z1, Z2, Z3, Z4, Z5 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (1); Z6 is a coding sequence of an exogenous protein; Group (4): a nucleic acid construct, comprising a structure of Formula III from 5′ to 3′:
Z0-Z1-Z2-Z2 Z3-Z4-Z5-Z6 (III) wherein, Z0˜Z6 are respectively an element as part of the nucleic acid construct; Z0 is a promoter element selected from the group consisting of T7 promoter, T3 promoter, SP6 promoter, and combinations thereof; each“-”, Z1, Z2, Z3, Z4, Z5, Z6 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (3); Group (5): a nucleic acid construct, comprising a structure of Formula IV from 5′ to 3′:
Z0′-Z1-Z2-Z2 Z3-Z4-Z5-Z6 (IV) wherein, Z0′˜Z6 are respectively an element as part of the nucleic acid construct; Z0′ is GAA; each“-”, Z1, Z2, Z3, Z4, Z5, Z6 and the combination of Z3, Z4 and Z5 are respectively defined the same as that defined in Group (3); Group (6): a nucleic acid construct, comprising a nucleic acid sequence represented by the Formula I, the Formula II, the Formula III or the Formula IV, or comprising at least one nucleic acid sequence of SEQ ID NO.: 2-17; wherein, Z1 is an enhancer element, comprising an IRES element selected from the group consisting of ScBOI1, ScFLO8, ScNCE102, ScMSN1, KlFLO8, KlNCE102, KlMSN1, KlBOI1, and combinations thereof; Group (7): a nucleic acid construct selected from Groups (3)˜(6); wherein, the nucleic acid construct comprises a Z6 element which is a coding sequence of an exogenous protein, and the exogenous protein is selected from the group consisting of luciferin, luciferases, green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable regions of antibodies, luciferase mutants, α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursors, interferon αA, interleukin-1β, lysozyme, serum albumins, single-chain variable fragment of antibodies, transthyretin, tyrosinase, xylanase, and combinations thereof; and Group (8): a nucleic acid construct selected from Groups (3)˜(6); wherein, the nucleic acid construct comprises a Z6 element which is a coding sequence of firefly luciferase.
14. The in vitro high-throughput synthesis method of claim 13, further comprising: (iii), isolating the exogenous protein from the eukaryote-based in vitro biosynthesis system; detecting the exogenous protein from the eukaryote-based in vitro biosynthesis system their combination.
15. The in vitro high-throughput synthesis method of claim 13, wherein the eukaryote-based in vitro biosynthesis system is a yeast-based in vitro biosynthesis system.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0116]
[0117]
[0118]
[0119]
[0120]
DETAILED DESCRIPTION
[0121] After extensive and in-depth research, through a lot of screening and exploration, a new nucleic acid construct that can enhance the efficiency of in vitro protein translation was unexpectedly found for the first time. The nucleic acid construct of the present invention is built by concatenating IRES enhancers (e.g., ScBOI1, ScFLO8, ScNCE102, ScMSN1, KlFLO8, KlNCE102, KlMSN1, KlBOI1) derived from eukaryotic cells (e.g., yeast), the Ω sequence and yeast-specific (e.g., Kluyveromyces, preferably Kluyveromyces lactis) Kozak sequences. When the nucleic acid construct of the present invention is used in a yeast-based in vitro biosynthesis system (e.g. a yeast-based in vitro protein synthesis system), the relative light unit (RLU) value for indicating the activity of the synthesized luciferase is very high, and can reach 1.65 times that of a tandem sequence (Ω-10A) concatenated by the single Ω sequence and a Kozak sequence, or can be approximately equivalent to that of Ω-10A.
[0122] In addition, the inventors also surprisingly found that placing three residues of GAA upstream of the nucleic acid construct of the present invention can also enhance the efficiency of protein synthesis, and the relative light unit value of luciferase when using the nucleic acid construct of the present invention to mediate the in vitro synthesis, was increased by approximately 0.28 folds (GAA-KlNCE102-Ω-10A relative to KlNCE102-Ω-10A). In comparison with using Ω-10A, the relative light unit value of luciferase when using GAA-KlNCE102-Ω-10A was increased by 1.52 folds (i.e., the relative light unit value when using GAA-KlNCE102-Ω-10A was 2.52-folds of that when using Ω-10A) (as shown in
[0123] Eukaryote-Based In Vitro Biosynthesis System
[0124] The eukaryote-based in vitro biosynthesis system is a transcription-translation coupled system based on eukaryotic cells, which can synthesize RNA starting from DNA template or use DNA or RNA as template to complete protein synthesis in vitro. The eukaryotic cells include yeast cells, rabbit reticulocytes, wheat germ cells, insect cells, human cells and the like. The eukaryote-based in vitro biosynthesis system has advantages of being able to synthesize RNA or proteins with complex structures, of post-translational modification of proteins, etc.
[0125] In the present invention, the eukaryote-based in vitro biosynthesis system is not particularly limited. A preferred eukaryote-based in vitro biosynthesis system includes a yeast-based in vitro biosynthesis system, preferably, a yeast-based in vitro protein synthesis system, more preferably, a Kluyveromyces-based expression system (more preferably, a Kluyveromyces lactis based expression system).
[0126] Yeast has advantages of simple culture, efficient protein folding and post-translational modification. Among yeasts, Saccharomyces cerevisiae and Pichia pastoris are model organisms that express complex eukaryotic proteins and membrane proteins. Yeast can also be used as a raw material for the preparation of in vitro translation systems.
[0127] Kluyveromyces is an ascosporogenous yeast. Among Kluyveromyces, Kluyveromyces marxianus and Kluyveromyces lactis are yeasts widely used in industry. Compared with other yeasts, Kluyveromyces lactis has many advantages, such as super secretion ability, better large-scale fermentation characteristics, conforming to food safety level, the ability of post-translational modification of proteins, and the like.
[0128] In the present invention, the eukaryote-based in vitro biosynthesis system comprises:
[0129] (a) a eukaryotic cell extract;
[0130] (b) polyethylene glycol;
[0131] (c) optional exogenous sucrose; and
[0132] (d) an optional solvent, which is water or an aqueous solvent.
[0133] In a particularly preferred embodiment, the in vitro biosynthesis system provided by the present invention comprises: a eukaryotic cell extract, 4-hydroxyethyl piperazine ethanesulfonic acid, potassium acetate, magnesium acetate, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), uridine triphosphate (UTP), amino acid mixture, phosphocreatine, dithiothreitol (DTT), creatine phosphokinase, RNase inhibitor, luciferin, DNA of luciferase and RNA polymerase.
[0134] In the present invention, the RNA polymerase is not particularly limited, and can be one or more RNA polymerases. A typical RNA polymerase is T7 RNA polymerase.
[0135] In the present invention, the proportion of the eukaryotic cell extract in the in vitro biosynthesis system is not particularly limited; usually the eukaryotic cell extract in the in vitro biosynthesis system accounts for 20-70%, preferably 30-60%, and more preferably 40-50%, by volume.
[0136] In the present invention, the eukaryotic cell extract does not contain intact cells. Typical eukaryotic cell extract comprises various types of RNA polymerases for RNA synthesis, and factors for protein translation including ribosomes, transfer RNA (tRNA), aminoacyl-tRNA synthetase as well as factors required for protein synthesis including initiation factors, elongation factors and termination release factors. In addition, the eukaryotic cell extract also comprises some other proteins derived from the cytoplasm of eukaryotic cells, especially soluble proteins.
[0137] In the present invention, the protein content of the eukaryotic cell extract is 20-100 mg/mL, preferably 50-100 mg/mL. The method for measuring the protein content is Coomassie brilliant blue assay.
[0138] In the present invention, the preparation method for the eukaryotic cell extract is not limited. A preferred preparation method comprises the following steps:
[0139] (i) providing eukaryotic cells;
[0140] (ii) washing the eukaryotic cells to obtain washed eukaryotic cells;
[0141] (iii) treating the washed eukaryotic cells with a cell lysis treatment to obtain a crude eukaryotic cell extract; and
[0142] (iv) treating the crude eukaryotic extract via solid-liquid separation to obtain the liquid phase (i.e., the eukaryotic cell extract).
[0143] In the present invention, the method of solid-liquid separation is not particularly limited. A preferred method is centrifugation.
[0144] In a preferred embodiment, the centrifugation is carried out in a liquid state.
[0145] In the present invention, the centrifugation condition is not particularly limited. A preferred centrifugation condition is in the range of 5000 g-100000 g, preferably in the range of 8000 g-30000 g.
[0146] In the present invention, the centrifugation time is not particularly limited. A preferred centrifugation time is in the range of 0.5 minutes to 2 hours, preferably in the range of 20 minutes to 50 minutes.
[0147] In the present invention, the temperature of the centrifugation is not particularly limited. Preferably, the centrifugation is carried out at 1-10° C., preferably at 2-6° C.
[0148] In the present invention, the washing treatment method is not particularly limited. A preferred washing treatment method is to carry out the treatment using a washing solution of pH 7-8 (preferably, pH 7.4). The washing solution is not particularly limited. A typical washing solution is selected from the group consisting of potassium 4-hydroxyethylpiperazine ethanesulfonate, potassium acetate, magnesium acetate, and combinations thereof.
[0149] In the present invention, the method for cell lysis treatment is not particularly limited. A preferred method for cell lysis treatment includes high-pressure lysis and freeze-thaw (e.g., treatment at liquid-nitrogen low temperature) lysis.
[0150] The mixture of nucleoside triphosphates in the in vitro biosynthesis system comprises adenosine triphosphate, guanosine triphosphate, cytidine triphosphate and uridine triphosphate. In the present invention, the concentration of various single nucleotides are not particularly limited. The concentration of each single nucleotide is usually in the range of 0.5-5 mM, preferably in the range of 1.0-2.0 mM.
[0151] The amino acid mixture in the in vitro biosynthesis system may include natural or unnatural amino acids, and may include amino acids of D-type or L-type. Representative amino acids include, but are not limited to, 20 types of natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine. The concentration of each type of amino acid is usually in the range of 0.01-0.5 mM, preferably in the range of 0.02-0.2 mM, such as 0.05 mM, 0.06 mM, 0.07 mM and 0.08 mM.
[0152] In a preferred embodiment, the in vitro biosynthesis system further comprises polyethylene glycol (PEG) or the like. The concentration of PEG or the like is not particularly limited. Generally, based on the total weight of the biosynthesis system, the concentration (w/v) of PEG or the like is in the range of 0.1-8%, preferably in the range of 0.5-4%, and more preferably in the range of 1-2%. Representative embodiments of PEG include, but are not limited to, PEG3000, PEG8000, PEG6000 and PEG3350. It should be understood that the system of the present invention may also include polyethylene glycols of other various molecular weights (such as PEG 200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc.).
[0153] In a preferred embodiment, the in vitro biosynthesis system further comprises sucrose. The concentration of sucrose is not particularly limited. Generally, based on the total weight of the protein synthesis system, the concentration of sucrose is in the range of 0.03-40 wt %, preferably in the range of 0.08-10 wt %, and more preferably in the range of 0.1-5 wt %.
[0154] A particularly preferred in vitro biosynthesis system comprises, in addition to the eukaryotic cell extract, the following components: 22 mM 4-hydroxyethyl piperazine ethanesulfonic acid of pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM phosphocreatine, 1.7 mM dithiothreitol, 0.27 mg/mL creatine phosphokinase, 1%-4% PEG, 0.5%-2% sucrose, 8-20 ng/μL DNA of firefly luciferase and 0.027-0.054 mg/mL T7 RNA polymerase.
[0155] Ω Sequence
[0156] As used herein, the term “Ω sequence” (i.e., omega sequence) refers to the 5′ leading sequence (5′ leader sequence) of the tobacco mosaic virus genome, and it is a translation enhancer of the virus. The DNA sequence of Ω contains 68 base pairs, comprising direct repeat modules of 8-basepair (ACAATTAC) in quantities of 1-6 (preferably 2-4, more preferably 3) and (CAA).sub.p modules in quantities of 1-5 (preferably 1-3, more preferably 1), wherein p is in the range of 6-12, preferably in the range of 8-10. These two modules are key to the translation-enhancing function of the Ω sequence. In the yeast-based in vitro protein synthesis system of the present invention, the Ω sequence can initiate a cap-independent protein translation, which may be achieved by recruiting the translation initiation factor eIF4G. However, the efficiency of the protein translation initiated by the Ω sequence is relatively low. The structural sequence of the Ω sequence needs to be optimized, and needs to cooperate with other DNA elements or proteins to enhance the efficiency of protein translation.
[0157] Kozak Sequence
[0158] Analyzing the upstream and downstream sequences of the translation initiation codon (AUG) in the mRNA molecules of known eukaryotes helps to find a consensus sequence which is called “Kozak sequence”. The Kozak sequence has been verified to enhance the translation initiation efficiency of mRNA. The Kozak sequence of different species are often different. For example, the Kozak sequence of Saccharomyces cerevisiae and the Kozak sequence of mammalian cells are significantly different.
[0159] The Kozak sequence used in the present invention comprises 6-12 (preferably, 8-10) oligomeric chains of adenine deoxynucleoside, a translation initiation codon (such as ATG, ATA, ATT, GTG, TTG, etc., preferably ATG) and a serine codon (such as TCT, TCC, TCA, TCG, AGT, AGC, etc., preferably TCT), and is derived from Kluyveromyces (preferably from Kluyveromyces lactis).
[0160] Exogenous Coding Sequence (Exogenous DNA)
[0161] As used herein, the terms “exogenous coding sequence” and “exogenous DNA” are used interchangeably, and both refer to an Do exogenous DNA molecule used to guide RNA or protein synthesis. Generally, the DNA molecule is linear or circular. The DNA molecule contains a sequence encoding exogenous RNA or an exogenous protein.
[0162] In the present invention, examples of the exogenous coding sequence include, but are not limited to: a genomic sequence and a cDNA sequence. The sequence encoding the exogenous protein also comprises a promoter sequence, a 5′ untranslated sequence, a 3′ untranslated sequence, or a combination thereof.
[0163] In the present invention, the selection of the exogenous DNA is not particularly limited. Generally, the exogenous DNA is selected from the group consisting of small non-coding RNA (sncRNA), long non-coding RNA (lncRNA), transfer RNA (tRNA), ribozymes including glucosamine-6-phosphate synthase (glmS), small nuclear RNA (snRNA), complexes (such as spliceosome) of RNA and protein, other various non-coding RNAs, and combinations thereof.
[0164] The exogenous DNA can also be selected from the group consisting of exogenous DNAs encoding luciferin, luciferases (such as firefly luciferase), green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin and variable regions of antibodies, DNAs of luciferase mutants, and combinations thereof.
[0165] The exogenous DNA can also be selected from the group consisting of exogenous DNAs encoding α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursors, interferon αA, interleukin-1β, lysozyme, serum albumins, single-chain variable fragment (scFv) of antibodies, transthyretin, tyrosinase, xylanase, and combinations thereof.
[0166] In a preferred embodiment, the exogenous DNA encodes a protein selected from the group consisting of green fluorescent protein (enhanced GFP, eGFP), yellow fluorescent protein (YFP), E. coli β-galactosidase (LacZ), human lysine-tRNA synthetase, human leucine-tRNA synthetase, Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase, murine catalase, and combinations thereof
[0167] Nucleic Acid Construct
[0168] The present invention provides a nucleic acid construct, comprising a nucleic acid sequence of Formula I:
Z1-Z2-Z3-Z4-Z5 (I)
[0169] wherein,
[0170] Z1˜Z5 are respectively an element as part of the construct;
[0171] each “-” is independently a bond or a nucleotide linking sequence;
[0172] Z1 is an enhancer element, and the enhancer element comprises an IRES element;
[0173] Z2 is a 5′ leading sequence of tobacco mosaic virus, that is Ω sequence;
[0174] Z3 is an oligomeric chain [oligo(A)].sub.n of adenine deoxynucleotide;
[0175] Z4 is a translation initiation codon;
[0176] Z5 is a serine codon;
[0177] Wherein, Z3, Z4 and Z5 constitute a Kozak sequence, and the Kozak sequence is derived from yeast.
[0178] The present invention also provides a nucleic acid construct comprising a structure of formula II from 5′ to 3′:
Z1-Z2-Z3-Z4-Z5-Z6 (II)
[0179] wherein,
[0180] Z1˜Z6 are respectively an element as part of the construct;
[0181] each “-” is independently a bond or a nucleotide linking sequence;
[0182] Z1 is an enhancer element, and the enhancer element comprises an IRES element;
[0183] Z2 is a 5′ leading sequence of tobacco mosaic virus, that is the Ω sequence;
[0184] Z3 is an oligomeric chain [oligo(A)].sub.n of adenine deoxynucleotide;
[0185] Z4 is a translation initiation codon;
[0186] Z5 is a serine codon;
[0187] Z6 is a coding sequence of an exogenous protein;
[0188] Wherein, Z3, Z4 and Z5 constitute a Kozak sequence, and the Kozak sequence is derived from yeast.
[0189] The present invention also provides a nucleic acid construct comprising a structure of Formula III from 5′ to 3′:
Z0-Z1-Z2-Z3-Z4-Z5-Z6 (III)
[0190] wherein,
[0191] Z0˜Z6 are respectively an element as part of the construct;
[0192] each “-” is independently a bond or a nucleotide linking sequence;
[0193] Z0 is a promoter element, and the promoter element is selected from the group consisting of T7 promoter, T3 promoter, SP6 promoter, and combinations thereof,
[0194] Z1 is an enhancer element, and the enhancer element comprises an IRES element;
[0195] Z2 is a 5′ leading sequence of tobacco mosaic virus, that is the Ω sequence;
[0196] Z3 is an oligomeric chain [oligo(A)].sub.n of adenine deoxynucleotide;
[0197] Z4 is a translation initiation codon;
[0198] Z5 is a serine codon;
[0199] Z6 is a coding sequence of an exogenous protein;
[0200] Wherein, Z3, Z4 and Z5 constitute a Kozak sequence, and the Kozak sequence is derived from yeast.
[0201] The present invention also provides a nucleic acid construct comprising a structure of Formula IV from 5′ to 3′:
Z0′-Z1-Z2-Z3-Z4-Z5-Z6 (IV)
[0202] wherein,
[0203] Z0′˜Z6 are respectively an element as part of the construct;
[0204] each “-” is independently a bond or a nucleotide linking sequence;
[0205] Z0′ is GAA;
[0206] Z1 is an enhancer element, and the enhancer element comprises an IRES element;
[0207] Z2 is a 5′ leading sequence of tobacco mosaic virus, that is the Ω sequence;
[0208] Z3 is an oligomeric chain [oligo(A)].sub.n of adenine deoxynucleotide;
[0209] Z4 is a translation initiation codon;
[0210] Z5 is a serine codon;
[0211] Z6 is a coding sequence of an exogenous protein;
[0212] Wherein, Z3, Z4 and Z5 constitute a Kozak sequence, and the Kozak sequence is derived from yeast.
[0213] In the present invention, the selection of the coding sequence of the exogenous protein is not particularly limited. Generally, the coding sequence of the exogenous protein is selected from the group consisting of exogenous DNAs encoding luciferin, luciferases (e.g., firefly luciferase), green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin and variable regions of antibodies, DNAs of luciferase mutants, and combinations thereof.
[0214] The coding sequence of the exogenous protein can also encode a protein selected from the group consisting of α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursors, interferon αA, interleukin-1β, lysozyme, serum albumins, single-chain variable fragment (scFv) of antibodies, transthyretin, tyrosinase, xylanase, and combinations thereof.
[0215] In addition, the nucleic acid construct of the present invention can be linear or circular. The nucleic acid construct of the present invention can be single-stranded or double-stranded. The nucleic acid construct of the present invention can be DNA, RNA, or DNA/RNA hybrid.
[0216] In a preferred embodiment, the sequence of the nucleic acid construct of the present invention is any one of SEQ ID NO.: 2-17.
[0217] In a preferred embodiment, the sequence of the nucleic acid construct is any one of SEQ ID NO.: 2-9.
[0218] In a preferred embodiment, the sequence of the nucleic acid construct is SEQ ID NO.: 3, 4 or 6.
[0219] In a preferred embodiment, the sequence of the nucleic acid construct of the present invention is any one of SEQ ID NO.: 85-87
[0220] In another preferred embodiment, the construct further comprises elements or combinations selected from the group consisting of promoters, terminators, poly (A) elements, transport elements, gene targeting elements, selection marker genes, enhancers, resistance genes, and transposase-encoding genes.
[0221] Various selectable marker genes can be used in the present invention, including but not limited to: auxotrophic markers, resistance markers, and reporter gene markers. The application of selectable markers plays a role in the screening of recombinant cells (recons), where the receptor cells can be significantly distinguished from untransformed cells. The auxotrophic marker can be complementary to the mutant gene of the receptor cell with the help of transferred marker gene, so that the receptor cell exhibits wild-type growth. The resistance marker refers to that the resistance gene is transferred into the receptor cell, and the transferred gene allow the receptor cell to exhibit drug resistance at a certain drug concentration. As a preferred mode of the present invention, resistance markers are used to achieve convenient screening of recombinant cells.
[0222] In the present invention, the application of the nucleic acid construct of the present invention in the yeast-based in vitro biosynthesis system of the present invention (such as a yeast-based protein biosynthesis system) can significantly improve the efficiency of exogenous protein translation. Specifically, the relative light unit value for indicating the activity of luciferase synthesized by using the nucleic acid construct of the present invention is very high, wherein the relative light unit value when using the nucleic acid construct of the present invention (such as KlNCE102-Ω-10A) was 1.65 times that when using the Ω-10A sequence.
[0223] Vector, Genetically Engineered Cell
[0224] The invention also provides a vector or a vector combination comprising the nucleic acid construct of the present invention. Preferably, the vector is selected from the group consisting of bacterial plasmids, phages (i.e., bacteriophages), yeast plasmids, animal cell vectors, and shuttle vectors; the vector is a transposon vector. Methods for preparing recombinant vectors are well known to those of ordinary skill in the art. Any plasmid or vector can be used as long as it can be replicated and stable in the host.
[0225] Those of ordinary skill in the art can construct an expression vector containing the promoter and/or the objective gene sequence of the present invention using well-known methods. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombinant technology and so on.
[0226] The present invention also provides a genetically engineered cell. The genetically engineered cell comprises the construct, the vector or the vector combination; or the chromosome of the genetically engineered cell is integrated with the construct or the vector. In another preferred embodiment, the genetically engineered cell further comprises a vector containing a transposase-encoding gene, or the chromosome of the genetically engineered cell is integrated with a transposase gene.
[0227] Preferably, the genetically engineered cell is a eukaryotic cell.
[0228] In another preferred embodiment, the eukaryotic cell includes, but is not limited to: human cell, Chinese hamster ovary cell, insect cell, wheat germ cell, rabbit reticulocyte and other higher eukaryotic cells.
[0229] In another preferred embodiment, the eukaryotic cell includes, but is not limited to: yeast cell (preferably, Kluyveromyces cell, more preferably Kluyveromyces lactis cell).
[0230] The construct or vector of the present invention can be used to transform appropriate genetically engineered cell. The genetically engineered cell can be a prokaryotic cell, such as E. coli, streptomyces, Agrobacterium; or be a lower eukaryotic cell, such as yeast cell; or be a higher animal cell, such as insect cell. Those of ordinary skill in the art know how to select appropriate vector and genetically engineered cell. Transformation of genetically engineered cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryote (such as E. coli), it can be treated using a CaCl.sub.2 method or an electroporation method. When the host is a eukaryote, the following DNA transfection methods can be selectively used: calcium phosphate coprecipitation method and conventional mechanical methods (such as microinjection, electroporation, liposome packaging, etc.). Transformation of plant cell can be performed also by using a method such as Agrobacterium-mediated transformation or gene gun transformation, for example, leaf disc method, immature embryo transformation method, flower bud soaking method, and the like.
[0231] In Vitro High-Throughput Protein Synthesis Method
[0232] The present invention provides an in vitro high-throughput protein synthesis method, comprising the following the steps:
[0233] (i) in the presence of a eukaryote-based in vitro biosynthesis system, providing the nucleic acid construct selected from the first to fourth aspects of the present invention; and
[0234] (ii) under suitable conditions, incubating the eukaryote-based in vitro biosynthesis system of step (i) for a period of time T1 to synthesize the exogenous protein.
[0235] In another preferred embodiment, the method further comprises: (iii) optionally isolating or detecting the exogenous protein from the eukaryote-based in vitro biosynthesis system.
[0236] The main advantages of the present invention include:
[0237] (1) For the first time, the present invention found that a nucleic acid construct comprising a promoter, a yeast-derived IRES, the Ω sequence, a Kozak sequence and the coding sequence of an exogenous protein, when being used in the eukaryote-based in vitro biosynthesis system of the present invention (such as a yeast-based in vitro protein synthesis system), can significantly improve the efficiency of exogenous protein translation.
[0238] (2) The endogenous IRESs of eukaryotic cells of the present invention concatenated in tandem with the Ω sequence and a Kozak sequence can enhance the efficiency of protein translation initiation in the eukaryote-based in vitro biosynthesis system. In the aspect of enhancing the efficiency of translation initiation, the tandem DNA elements are advantageous over the tandem sequence (Ω-10A) concatenating only the latter two. Wherein, in the Kluyveromyces lactis based in vitro biosynthesis system, the relative light unit (RLU) value of firefly luciferase (Fluc) when using KlNCE102-Ω-10A to initiate synthesis reached 1.67×10.sup.9, which was 1.65-folds of that when using the Ω-10A sequence.
[0239] (3) Compared with Saccharomyces cerevisiae, Kluyveromyces lactis can be used for the protein production in the food and pharmaceutical fields due to its safety and high efficiency, as well the advantages of in vitro biosynthesis system (such as suitability for high-throughput protein synthesis and screening, capability of synthesizing toxic proteins, short time, low cost, etc.), so the in vitro biosynthesis system derived from Kluyveromyces lactis cells can also be widely used in the related fields of protein synthesis.
[0240] (4) The nucleic acid construct provided by the present invention not only enhances the efficiency of initiating protein translation of the eukaryote-based in vitro biosynthesis system, but more importantly, increases the possibility of Kluyveromyces lactis based in vitro biosynthesis systems for the synthesis of different proteins.
[0241] (5) The nucleic acid construct of the present invention not only enhances the efficiency of protein translation initiation, but also provides new concepts and new methods for designing DNA elements used for eukaryote-based cell in vitro biosynthesis systems, which can greatly raise the application of related systems in the fields of scientific research and industrial production.
[0242] (6) The present invention found for the first time that combining a strong promoter (e.g., T7 promoter, T3 promoter, SP6 promoter) with the nucleic acid construct of the present invention can also achieve very high protein synthesis efficiency.
[0243] (7) The present invention found for the first time that placing three residues of GAA upstream of the nucleic acid construct of the present invention can also achieve very high protein synthesis efficiency.
[0244] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. With respect to the experimental methods without specifically described conditions in the following examples, one person may generally follow conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or follow the conditions recommended by the manufacturer. Unless otherwise stated, percentages and portions refer to percentages and portions by weight.
[0245] Unless otherwise specified, materials and reagents used in the examples of the present invention are all commercially available products.
Example 1: Design of DNA Elements Concatenating an Endogenous IRES of a Eukaryotic Cell, the Ω Sequence and a Kluyveromyces lactis-Specific Kozak Sequence in Tandem
[0246] 1.1 Determination of endogenous IRESs in Kluyveromyces lactis and Saccharomyces cerevisiae: 4 endogenous IRESs of Kluyveromyces lactis and the IRESs corresponding to their homologous proteins in Saccharomyces cerevisiae (as shown in Table 1) are capable of initiating in vitro protein synthesis. Among the IRESs to initiate the synthesis of Fluc, six IRESs (KlFLO8, KlMSN1, KlNCE102, ScFLO8, ScMSN1 and ScNCE102) showed a higher relative light unit (RLU) value than the traditional Ω sequence, and the other two (KlBOI1 and ScBOI1) showed a lower RLU value than the Ω Sequence (as shown in
[0247] 1.2 Determination of 16 tandem elements: concatenate in tandem the 8 endogenous IRESs with the Ω sequence and a Kluyveromyces lactis-specific Kozak sequence, and vary the upstream or downstream location of the IRES relative to the Ω sequence; consequently 16 tandem DNA elements in total were designed (KlFLO8, KlMSN1, KlNCE102, KlBOI1, ScFLO8, ScMSN1, ScNCE102 and ScBOI1-Ω-10A as well as Ω-KlFLO8, KlMSN1, KlNCE102, KlBOI1, ScFLO8, ScMSN1, ScNCE102 and ScBOI1-10A). The sequences of the tandem elements shown in SEQ ID NO.: 2-17 correspond to the sequences of the above tandem DNA elements (KlFLO8, KlMSN1, KlNCE102, KlBOI1, ScFLO8, ScMSN1, ScNCE102 and ScBOI1-Ω-10A as well as Ω-KlFLO8, KlMSN1, KlNCE102, KlBOI1, ScFLO8, ScMSN1, ScNCE102 and ScBOI1-10A) respectively in sequence.
[0248] 1.3 Design of tandem elements with a reporter protein gene (Fluc): the 16 tandem elements as designed above were inserted into an existing Ω-10A-Fluc plasmid (obtained from KangMa-Healthcode (Shanghai) Biotech Co., Ltd, and the Ω-10A sequence is shown in SEQ ID NO.:1) to replace Ω-10A and 16 new plasmids were formed; the resultant 16 new plasmids were respectively KlFLO8-Ω-10A-Fluc, KlMSN1-Ω-10A-Fluc, KlNCE102-Ω-10A-Fluc, KlBOI1-Ω-10A-Fluc, ScFLO8-Ω-10A-Fluc, ScMSN1-Ω-10A-Fluc, ScNCE102-Ω-10A-Fluc, ScBOI1-Ω-10A-Fluc, Ω-KlFLO8-10A-Fluc, Ω-KlMSN1-10A-Fluc, Ω-KlNCE102-10A-Fluc, Ω-KlBOI1-10A-Fluc, Ω-ScFLO8-10A-Fluc, Ω-ScMSN1-10A-Fluc, Ω-ScNCE102-10A-Fluc and Ω-ScBOI1-10A-Fluc. Among them, the sequences of KlNCE102-Ω-10A-Fluc, ScFLO8-Ω-10A-Fluc and KlMSN1-Ω-10A-Fluc are respectively shown in SEQ ID NO.: 85-87.
TABLE-US-00001 TABLE 1 Related Genes in Saccharomyces cerevisiae and Kluyveromyces lactis Gene Name Open Reading Frames (ORFs) ScBOI1 YBL085w ScFLO8 YER109c ScNCE102 YPR149w ScMSN1 YOL116w KlBOI1 KLLA0E20879g KlFLO8 KLLA0E20725g KlNCE102 KLLA0D16280g KlMSN1 KLLA0A07337g
Example 2: Construction of Plasmids Containing the Tandem DNA Element for the In Vitro Protein Synthesis System
[0249] 2.1 Construction of plasmids: insert 8 endogenous IRESs respectively into the Ω-10A-Fluc plasmid, which are respectively located upstream or downstream of the Ω sequence. The specifically used primers are shown in Table 2.
[0250] The specific construction process for one plasmid is as follow: The IRES fragment to be inserted and the Ω-10A-Fluc vector plasmid were respectively amplified by PCR by using two pairs of primers, and 10 μL of each PCR amplification product were taken and mixed together. Then, 1 μL DpnI was added into the 20 μL mixture of the amplification products followed by incubation at 37° C. for 6 hours. Thereafter, 4 μL of the DpnI-treated product was added into 50 μL of DH5a competent cells. The mixture was placed on ice for 30 minutes and heat-shocked at 42° C. for 45 seconds. Subsequently, the mixture was placed on ice for 3 minutes, added with 200 μL of LB liquid medium, and then cultured with shaking at 37° C. for 4 h. Thereafter, the mixture was coated on an LB solid medium containing Amp antibiotic and cultured overnight. Six monoclonal colonies were picked out for carrying out proliferation culture. After being confirmed the correctness by sequencing, the plasmid was extracted and stored.
TABLE-US-00002 TABLE 2 Primers for PCR Amplification SEQ SEQ Plasmid Primer Name of Vector ID Primer Name of IRES ID Name Amplification NO.: Amplification NO.: KlFLO8-Ω- PF_FLO8KL_Omega 18 PF_T7pro_FLO8KL 20 10A-Fluc PR_FLO8KL_T7pro 19 PR_Omega_FLO8KL 21 KlMSN1-Ω- PF_MSN1KL_Omega 22 PF_T7pro_MSN1KL 24 10A-Fluc PR_MSN1KL_T7pro 23 PR_Omega_MSN1KL 25 KlNCE102- PF_KLNCE102_Omega 26 PF_T7pro_KLNCE102 28 Ω-10A-Fluc PR_KLNCE102_T7pro 27 PR_Omega_KLNCE102 29 KlBOI1-Ω- PF_BOI1KL_Omega 30 PF_T7pro_BOI1KL 32 10A-Fluc PR_BOI1KL_T7pro 31 PR_Omega_BOI1KL 33 ScFLO8-Ω- PF_FLO8_Omega 34 PF_T7pro_FLO8 36 10A-Fluc PR_FLO8_T7pro 35 PR_Omega_FLO8 37 ScMSN1-Ω- PF_MSN1_Omega 38 PF_T7pro_MSN1 40 10A-Fluc PR_MSN1_T7pro 39 PR_Omega_MSN1 41 ScNCE102- PF_NCE102_Omega 42 PF_T7pro_NCE102 44 Ω-10A-Fluc PR_NCE102_T7pro 43 PR_Omega_NCE102 45 ScBOI1-Ω- PF_BOI1_Omega 46 PF_T7pro_BOI1 48 10A-Fluc PR_BOI1_T7pro 47 PR_Omega_BOI1 49 Ω-KlFLO8- O-Flo8(KL)_PF-2 50 Flo8(KL)_F 52 10A-Fluc O-Flo8(KL)-PR-2 51 Flo8(KL)_R 53 Ω-KlMSN1- PF_pET21a_KLMSN1_10A 54 PF_KLMSN1_Omega_pET21a 56 10A-Fluc PR_pET21a_KLMSN1_Omega 55 PR_KLMSN1_10A_pET21a 57 Ω-KlNCE102- O-IRES-PF 58 NCE102(KL)-F 60 10A-Fluc O-IRES-PR 59 NCE102(KL)-R 61 Ω-KlBOI1- PF_pET21a_10A_KLBOI 62 PF_KLBOI_Omega_pET21a 64 10A-Fluc PR_pET21a_Omega_KLBOI 63 PR_KLBOI_10A_pET21a 65 Ω-ScFLO8- O-FLO8-PF-2 66 Flo8_F 68 10A-Fluc O-FLO8-PR-2 67 Flo8_R 69 Ω-ScMSN1- PF_pET21a_MSN1_10A 70 PF_MSN1_Omega_pET21a 72 10A-Fluc PR_pET21a_MSN1_Omega 71 PR_MSN1_10A_pET21a 73 Ω-ScNCE102- O-IRES-PF2 74 NCE102-F 76 10A-Fluc O-IRES-PR2 75 NCE102-R 77 Ω-ScBOI1- PF_pET21a_10A_BOI1 78 PFBOI1_Omega_pET21a 80 10A-Fluc PR_pET21a_Omega_BOI1 79 PR_BOI1_10A_pET21a 81
Example 3: Application of Tandem DNA Elements in the Yeast-Based In Vitro Protein Synthesis System
[0251] 3.1 The fragment containing the tandem DNA element and Fluc in all plasmids, which are between the T7 transcription initiation sequence and the termination sequence, were amplified by the PCR method while using T7_pET21a_F:CGCGAAATTAATACGACTCACTATAGG (SEQ ID NO.: 82) and T7ter_pET21a_R: TCCGGATATAGTTCCTCCTTTCAG (SEQ ID NO.: 83) as primers.
[0252] The amplified DNA fragments were purified and enriched using the ethanol precipitation method: 1/10 volume of 3 M sodium acetate (pH 5.2) was added to the PCR product, and then 95% ethanol of 2.5-3 folds by volume was added (relative to the volume after the addition of sodium acetate), followed by incubation on ice for 15 minutes. Thereafter, the mixture was centrifuged at a speed higher than 14000 g for 30 minutes at room temperature, and the supernatant was removed. The precipitate was washed with 70% ethanol, and then centrifuged for 15 minutes followed by removal of the supernatant. The precipitate was dissolved with ultrapure water to measure the DNA concentration.
[0253] 3.2 According to the instructions for use, the purified DNA fragments were added to the self-made Kluyveromyces lactis based in vitro protein synthesis system. The above-said reaction system was placed in an environment of 25-30° C., and let the mixture stand for incubation for about 2-6 hours. After completion, an equal volume of luciferin as the substrate for Fluc was added into the wells for above reactions of a 96-well or 384-well white plate, which was immediately placed in an Envision 2120 multifunctional microplate reader (Perkin Elmer), and the absorbance was read to detect the activity of Fluc, where the unit of activity is relative light unit (RLU) value, as shown in
[0254] 3.3 The DNA fragment (Ω-10A-Fluc) group without endogenous IRES sequences of eukaryotic cells was used as a control, and a reaction group with no addition of DNA template was used as a negative control (NC). Three independent samples were used for each group.
Experimental Results
[0255] 1. Design of DNA Elements Concatenating an Endogenous IRES of a Eukaryotic Cell and the Ω Sequence with a Kluyveromyces lactis-Specific Kozak Sequence in Tandem
[0256] A total of 16 tandem DNA elements were designed, and all of the 16 elements were inserted respectively into the Ω-10A-Fluc plasmid to replace the Ω-10A sequence, and 16 plasmids used for the in vitro protein synthesis were formed.
[0257] 2. Construction of Plasmids Containing the Tandem DNA Element for the In Vitro Protein Synthesis System
[0258] After a lot of attempt, 16 plasmids in total for the in vitro protein synthesis system were successfully constructed.
[0259] 3. Application of Tandem DNA Elements in the Yeast-Based In Vitro Protein Synthesis System
[0260] As shown in
[0261] Since within the range of linear relationship between the relative light unit (RLU) value via the detecting instrument and the protein concentration, the relative light unit value by KlNCE102-Ω-10A which showed the highest activity was 1.65 times that by the Ω-10A sequence, it indicates that the tandem DNA element can enhance protein synthesis to about 1.65 folds.
[0262] The results of the present invention indicate that: concatenating the endogenous IRES of the eukaryotic cell and the Ω sequence with a Kluyveromyces lactis-specific Kozak sequence in tandem can enhance the efficiency of protein synthesis; the two can recruit translation initiation factors, Pab1 and eIF4G which are capable of interacting with each other, to achieve a synergistic effect on promoting protein synthesis efficiency (as shown in
[0263] Furthermore, according to the study results, the present invention also found that placing three residues of GAA upstream of the tandem DNA element (the 5′ end of the transcripted mRNA is GAA) can also enhance protein synthesis efficiency. The relative light unit value of luciferase using the tandem of GAA and the nucleic acid construct of the present invention to mediate the in vitro synthesis was 1.28 times the RLU value when using the nucleic acid construct of the present invention alone (as shown in
[0264] In addition, according to the study results, the present invention also found that the relative light unit value by the nucleic acid construct (such as KlNCE102-Ω-10A) of the present invention was 1.23 times that by KlNCE102 (as shown in
[0265] All documents mentioned in the present invention are incorporated by reference in this application, just as each document is individually incorporated by reference. In addition, it should be understood that, those skilled in the art, after reading the above-taught content of the present invention, can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope as defined by the appended claims of the present invention.