AMPHIREGULIN GENE-SPECIFIC DOUBLE-STRANDED OLIGONUCLEOTIDE AND COMPOSITION FOR PREVENTING AND TREATING FIBROSIS-RELATED DISEASES AND RESPIRATORY DISEASES, COMPRISING SAME
20230203494 · 2023-06-29
Inventors
- Tae-Rim KIM (Daejeon, KR)
- Pyoung Oh YOON (Daejeon, KR)
- Youngho KO (Seoul, KR)
- Seon Joo BAE (Chungcheongnam-do, KR)
- Han-Oh PARK (Sejong-si, KR)
- Seung Seob SON (Chungcheongnam-do, KR)
- Jun-Hong PARK (Daejeon, KR)
- Sung-II YUN (Daejeon, KR)
Cpc classification
A61K31/713
HUMAN NECESSITIES
A61K9/19
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
C12N2320/11
CHEMISTRY; METALLURGY
C12N15/1136
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61K9/19
HUMAN NECESSITIES
Abstract
The present invention relates to a double-stranded oligonucleotide which can highly specifically and efficiently inhibit an amphiregulin expression and, preferably, a double-stranded oligonucleotide comprising a sequence in the form of RNA/RNA, DNA/DNA or DNA/RNA hybrid, a double-stranded oligonucleotide structure comprising the double-stranded oligonucleotide, nanoparticles comprising the double-stranded oligonucleotide structure, and a fibrosis or respiratory disease preventive or therapeutic use thereof.
Claims
1. An amphiregulin-specific double-stranded oligonucleotide comprising: a sense strand comprising any one sequence selected from the group consisting of SEQ ID NOs: 10, 11 and 12; and an antisense strand comprising a sequence complementary thereto.
2. The amphiregulin-specific double-stranded oligonucleotide of claim 1, wherein the sense strand or the antisense strand consists of 19 to 31 nucleotides.
3. The amphiregulin-specific double-stranded oligonucleotide of claim 1, wherein the oligonucleotide is siRNA, shRNA or miRNA.
4. The amphiregulin-specific double-stranded oligonucleotide of claim 1, wherein the sense or antisense strand is independently DNA or RNA.
5. The amphiregulin-specific double-stranded oligonucleotide of claim 1, wherein the sense strand or the antisense strand of the double-stranded oligonucleotide comprises a chemical modification.
6. The amphiregulin-specific double-stranded oligonucleotide of claim 5, wherein the chemical modification is any one or more selected from the group consisting of: modification in which a hydroxyl (OH) group at the 2′ carbon position of a sugar structure in nucleotides is substituted with any one selected from the group consisting of methyl (—CH.sub.3), methoxy (—OCH.sub.3), amine (—NH.sub.2), fluorine (—F), —O-2-methoxyethyl, —O-propyl, —O-2-methylthioethyl, —O-3-aminopropyl, —O-3-dimethylaminopropyl, —O—N-methylacetamido and —O-dimethylamidooxyethyl; modification in which oxygen in a sugar structure in nucleotides is substituted with sulfur; modification of a bond between nucleotides to any one bond selected from the group consisting of a phosphorothioate bond, a boranophosphophate bond and a methyl phosphonate bond; and modification to PNA (peptide nucleic acid), LNA (locked nucleic acid) or UNA (unlocked nucleic acid).
7. The amphiregulin-specific double-stranded oligonucleotide of claim 1, wherein one or more phosphate groups are bound to the 5′ end of the antisense strand of the double-stranded oligonucleotide.
8. An amphiregulin-specific double-stranded oligonucleotide structure comprising a structure represented by the following Structural Formula 1:
A-X—R—Y—B [Structural Formula (1)] wherein A represents a hydrophilic compound, B represents a hydrophobic compound, X and Y each independently represent a simple covalent bond or a linker-mediated covalent bond, and R represents the double-stranded oligonucleotide of claim 1.
9. The amphiregulin-specific double-stranded oligonucleotide structure of claim 8, wherein the oligonucleotide structure comprises a structure represented by the following Structural Formula (2): ##STR00008## wherein S and AS respectively represent the sense strand and the antisense strand of the double-stranded oligonucleotide of claim 8.
10. The amphiregulin-specific double-stranded oligonucleotide structure of claim 9, wherein oligonucleotide structure comprises a structure represented by the following Structural Formula (3) or (4): ##STR00009## wherein A, B, X, Y, S and AS are as defined in claim 9, and 5′ and 3′ represent the 5′ end and 3′ end, respectively, of the sense strand of the double-stranded oligonucleotide.
11. The amphiregulin-specific double-stranded oligonucleotide structure of claim 8, wherein the hydrophilic compound is selected from the group consisting of polyethylene glycol (PEG), polyvinylpyrrolidone, and polyoxazoline
12. The amphiregulin-specific double-stranded oligonucleotide structure of claim 8, wherein the hydrophilic compound has a structure represented by the following Structural Formula (5) or (6):
(A′.sub.m-J).sub.n [Structural Formula (5)]
(J-A′.sub.m).sub.n [Structural Formula (6)] wherein A′ represents a hydrophilic monomer, J represents a linker that connects a number (m) of hydrophilic monomers together or connects a number (m) of hydrophilic monomers with the double-stranded oligonucleotide, m is an integer ranging from 1 to 15, n is an integer ranging from 1 to 10, the hydrophilic monomer (A′) is any one compound selected from among the following compound (1) to compound (3), and the linker (J) is selected from the group consisting of —PO.sub.3.sup.−—, —SO.sub.3— and −CO.sub.2—: ##STR00010## wherein G is selected from the group consisting of O, S and NH; ##STR00011##
13. The amphiregulin-specific double-stranded oligonucleotide structure of claim 12, wherein the oligonucleotide structure has a structure represented by the following Structural Formula (7) or (8):
(A′.sub.m-J).sub.n-X—R—Y—B [Structural Formula (7)]
(J-A′.sub.m).sub.n-X—R—Y—B [Structural Formula (8)]
14. The amphiregulin-specific double-stranded oligonucleotide structure of claim 8, wherein the hydrophilic compound has a molecular weight of 200 to 10,000.
15. The amphiregulin-specific double-stranded oligonucleotide structure of claim 8, wherein the hydrophobic compound has a molecular weight of 250 to 1,000.
16. The amphiregulin-specific double-stranded oligonucleotide structure of claim 15, wherein the hydrophobic compound is any one selected from the group consisting of a steroid derivative, a glyceride derivative, glycerol ether, polypropylene glycol, a C.sub.12-C.sub.50 unsaturated or saturated hydrocarbon, diacylphosphatidylcholine, a fatty acid, a phospholipid, lipopolyamine, a lipid, tocopherol, and tocotrienol.
17. The amphiregulin-specific double-stranded oligonucleotide structure of claim 16, wherein the steroid derivative is any one selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cholestanyl formate, and cholestanyl amine.
18. The amphiregulin-specific double-stranded oligonucleotide structure of claim 16, wherein the glyceride derivative is any one selected from the group consisting of mono-glyceride, di-glyceride, and tri-glyceride.
19. The amphiregulin-specific double-stranded oligonucleotide structure of claim 8, wherein the covalent bond represented by X and Y is either a non-degradable bond or a degradable bond.
20. The amphiregulin-specific double-stranded oligonucleotide structure of claim 19, wherein the non-degradable bond is an amide bond or a phosphate bond.
21. The amphiregulin-specific double-stranded oligonucleotide structure of claim 19, wherein the degradable bond is any one selected from the group consisting of a disulfide bond, an acid-degradable bond, an ester bond, an anhydride bond, a biodegradable bond, and an enzyme-degradable bond.
22. A nanoparticle comprising the double-stranded oligonucleotide of claim 8.
23. The nanoparticle of claim 22, wherein the nanoparticle is composed of a mixture of double-stranded oligonucleotide structures comprising double-stranded oligonucleotide having different sequence.
24. A method for preventing or treating fibrosis or respiratory disease, comprising administering to a subject in need thereof, the double-stranded oligonucleotide of claim 1, or an amphiregulin-specific double-stranded oligonucleotide structure comprising said double-stranded oligonucleotide, represented by the following Structural Formula 1:
A-X—R—Y—B [Structural Formula (1)] wherein A represents a hydrophilic compound, B represents a hydrophobic compound, X and Y each independently represent a simple covalent bond or a linker-mediated covalent bond, and R represents said double-stranded oligonucleotide.
25. A method for preventing or treating fibrosis or respiratory disease, comprising administering the nanoparticle of claim 22 to a subject in need thereof.
26. The method of claim 24, wherein the respiratory disease is any one selected from the group consisting of chronic obstructive disease (COPD), asthma, acute and chronic bronchitis, allergic rhinitis, cough, sputum, bronchitis, bronchiolitis, sore throat, tonsillitis, and laryngitis.
27. The method of claim 24, wherein the fibrosis is any one selected from the group consisting of idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, pulmonary fibrosis, cardiac fibrosis, and radiation-induced fibrosis.
28. The method of claim 25, wherein the respiratory disease is any one selected from the group consisting of chronic obstructive disease (COPD), asthma, acute and chronic bronchitis, allergic rhinitis, cough, sputum, bronchitis, bronchiolitis, sore throat, tonsillitis, and laryngitis.
29. The method of claim 25, wherein the fibrosis is any one selected from the group consisting of idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, pulmonary fibrosis, cardiac fibrosis, and radiation-induced fibrosis.
30. A lyophilized formulation comprising a pharmaceutical composition for preventing or treating fibrosis or respiratory disease, said pharmaceutical composition comprising the double-stranded oligonucleotide of claim 1, or an amphiregulin-specific double-stranded oligonucleotide structure comprising said double-stranded oligonucleotide, represented by the following Structural Formula 1:
A-X—R—Y—B [Structural Formula (1)] wherein A represents a hydrophilic compound, B represents a hydrophobic compound, X and Y each independently represent a simple covalent bond or a linker-mediated covalent bond, and R represents said double-stranded oligonucleotide.
31. A lyophilized formulation comprising a pharmaceutical composition for preventing or treating fibrosis or respiratory disease, said pharmaceutical composition comprising the nanoparticle of claim 22.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0127] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
DETAILED DESCRIPTION AND PREFERRED EMBODIMENTS OF THE INVENTION
[0142] Hereinafter, the present invention will be described in more detail with reference to examples. It will be obvious to those skilled in the art that these examples are only to explain the present invention in more detail and the scope of the present invention is not limited by these examples. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereto.
[0143] In the present invention, three specific sequences capable of inhibiting amphiregulin expression were identified, and it was confirmed that these sequences can bind complementarily to an mRNA encoding amphiregulin and effectively inhibit amphiregulin expression, thereby effectively treating fibrosis and respiratory diseases.
Example 1. Algorithm for Screening of SAMiRNAs Targeting Amphiregulin and Selection of Candidate Sequences
[0144] SAMiRNA-based drug high-throughput screening is a method in which all possible candidate sequences are generated by applying a 1-base or 2-base sliding window algorithm to the entire mRNA, unnecessary candidate sequences are removed by performing homology filtering, and the degrees to which the expression of the gene of interest is inhibited by all the finally selected SAMiRNAs are determined.
[0145] First, a design process for SAMiRNA candidate sequences against amphiregulin was performed. Specifically, 1,257 SAMiRNA candidate sequences, each consisting of 19 nucleotides, were selected by applying a 1-basesliding window algorithm to the human amphiregulin mRNA NM_001657.3 (1,290 bp), and an experiment on the degree of inhibition of amphiregulin was performed.
Example 2. Synthesis of Double-Stranded Oligo RNA Structure
[0146] A double-stranded oligo RNA structure (SAMiRNA) produced in the present invention is represented by the following structural formula:
c.sub.24-5′ S 3′-(hexaethyleneglycol-PO.sub.4.sup.−).sub.3-hexaethyleneglycol AS 5′-PO4
[0147] For synthesis of the sense strain of a monoSAMiRNA (n=4) double-stranded oligo structure, 3,4,6-triacetyl-1-hexa(ethylene glycol)-N-acetyl galactosamine-CPG was used as a support, and three demethoxytrityl (DMT) hexaethylene glycol phosphoramidates as hydrophilic monomers were continuously bound to the support through a reaction. Next, synthesis of RNA or DNA was performed, and then hydrophobic C.sub.24 (C.sub.6—S—S—C.sub.18) containing a disulfide bond was bound to the 5′ end region, thereby synthesizing the sense strand of monoSAMiRNA (n=4) in which NAG-hexaethyleneglycol-(—PO.sub.3.sup.− hexaethyleneglycol).sub.3 is bound to the 3′ end and C.sub.24 (C.sub.6—S—S—C.sub.18) is bound to the 5′ end.
[0148] After completion of the synthesis, the synthesized RNA single strand and oligo (DNA or RNA)-polymer structure were detached from the CPG by treatment with 28% (v/v) ammonia in a water bath at 60° C., and then protective residues were removed by a deprotection reaction. After removal of the protective residues, the RNA single strand and the oligo (DNA or RNA)-polymer structure were treated with N-methylpyrrolidone, trimethylamine and triethylaminetrihydrofluoride at a volume ratio of 10:3:4 in an oven at 70° C. to remove 2′-TBDMS (tert-butyldimethylsilyl). An RNA single strand, an oligo (DNA or RNA)-polymer structure and a ligand-bound oligo (DNA or RNA)-polymer structure were separated from the reaction products by high-performance liquid chromatography (HPLC), and the molecular weights thereof were measured by a MALDI-TOF mass spectrophotometer (MALDI TOF-MS, SHIMADZU, Japan) to confirm whether they would match the nucleotide sequence and polymer structure desired to be synthesized. Thereafter, to produce each double-stranded oligo structure, the sense strand and the antisense strand were mixed together, added to 1× annealing buffer (30 mM HEPES, 100 mM potassium acetate, 2 mM magnesium acetate, pH 7.0 to 7.5), allowed to react in a water bath at 90° C. for 3 minutes, and then allowed to react at 37° C., thereby producing the desired SAMiRNA. Annealing of the produced double-stranded oligo RNA structures was confirmed by electrophoresis.
Example 3. High-Throughput Screening (HTS) of SAMiRNA Nanoparticles that Target Human Amphiregulin and Induce RNAi
[0149] 3-1 Production of SAMiRNA Nanoparticles
[0150] 1,257 SAMiRNAs targeting amphiregulin sequences, synthesized in Example 2, were dissolved in 1× Dulbecco's phosphate buffered saline (DPBS) (WELGENE, KR) and freeze-dried in a freeze dryer (LGJ-100F, CN) for 5 days. The freeze-dried nanoparticle powders were dissolved and homogenized in 1.429 ml of deionized distilled water (Bioneer, KR) and used in an experiment for the present invention.
[0151] 3-2 Treatment of Cells with SAMiRNA Nanoparticles
[0152] To identify SAMiRNA that inhibits amphiregulin expression, the human lung cancer line A549 was used. The A549 cell line was cultured in Gibcom Ham's F-12K (Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US) at 37° C. under 5% CO.sub.2. Using the same medium as above, the A549 cell line was dispensed into a 96-well plate (Costar, US) at a density of 2×10.sup.4 cells/well. The next day, the SAMiRNA homogenized with deionized distilled water in Example 3.1 above was diluted with 1×DPBS, and the cells were treated with the dilution to a SAMiRNA concentration of 500 nM or 1,000 nM. Treatment with the SAMiRNA was performed a total of four times (once every 12 hours), and the cells were cultured at 37° C. under 5% CO.sub.2.
[0153] 3-3 Screening of SAMiRNA by Inhibition Analysis of mRNA Expression of Human Amphiregulin
[0154] Total RNA was extracted from the cell line treated with SAMiRNA in Example 3-2, and was synthesized into cDNA, and then the relative mRNA expression level of the amphiregulin gene was quantified by real-time PCR.
[0155] For analysis of the mRNA expression level of the amphiregulin gene, 300 nM AREG forward primer, 300 nM AREG reverse primer, 300 nM AREG probe, 300 nM RPL13A forward primer, 300 nM RPL13A reverse primer, 300 nM RPL13A probe, 400 nM TBP forward primer, 400 nM TBP reverse primer, and 300 nM TBP probe were added to each well of AccuPower® Dual-HotStart RT-qPCR kit (Bioneer, Korea) and dried (Table 2, the sequences of the primers and hydrolysis probes used in the high-throughput screening (HTS) experiment). To evaluate the performance of the prepared kit, a calibration curve was created using the A549 cell total RNA and the PCR amplification efficiency was determined (Table 3). RT-qPCR was performed under the following conditions: 95° C. for 5 min, and then 45 cycles, each consisting of 95° C. for 5 sec and 58° C. for 15 sec. A protocol in which a fluorescence value is detected in each cycle was used.
[0156] The 96-well plate (Costar, US) treated with SAMiRNA was subjected to total RNA extraction and one-step RT-qPCR according to an automated program using the automated system ExiStation HT™ Korea and the separately prepared AccuPower® Dual-HotStart RT-qPCR kit (Bioneer, Korea) comprising primers and probes for analysis of amphiregulin.
[0157] Based on the Ct values of two genes obtained after qPCR array, the relative mRNA expression level of amphiregulin in the test group compared to that in the control group was analyzed by the 2(−Delta Delta C(T)) method [Livak K J, Schmittgen T D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. December; 25(4):4 02-8].
TABLE-US-00003 TABLE 2 Sequences of primers and hydrolysis probes used in high-throughput screening (HTS) experiment AREG Forward primer CAGTGCTGATGGATTTGAGGT (SEQ ID NO: 26) AREG Reverse primer ATAGCCAGGTATTTGTGGTTCG (SEQ ID NO: 27) AREG probe 5′FAM - TGAACCGTCCTCGGGAGC CGACT - 3′EBQ (SEQ ID NO: 28) RPL13A Forward GTGTTTGACGGCATCCCACC primer (SEQ ID NO: 29) RPL13A Reverse TAGGCTTCAGACGCACGACC primer (SEQ ID NO: 30) RPL13A probe 5′TAMRA- AAGCGGATGGTGGTTCC TGCT - 3′EBQ (SEQ ID NO: 31) TBP Forward primer CACCACAGCTCTTCCACTC (SEQ ID NO: 32) TBP Reverse primer ATCCCAGAACTCTCCGAAGC (SEQ ID NO: 33) TBP probe 5′TEXASRED - ACCCTTGCCGGGCAC CACTC - 3′EBQ (SEQ ID NO: 34)
TABLE-US-00004 TABLE 3 3-plex RT-qPCR amplification efficacy Slope R.sup.2 Efficiency AREG Y = −0.2778X + 12.3894 0.9998 90% RPL13A Y = −0.2863X + 10.5964 0.9999 93% TBP Y = −0.2892X + 13.0351 0.9946 95%
[0158] To select highly efficient SAMiRNA, 14 SAMiRNAs were selected, which had each of the sequences of SEQ ID NOs: 1 to 14 as a sense strand. Here, the selected SAMiRNAs showed the highest efficiency with which the mRNA expression level of amphiregulin at a final concentration of 500 nM or 1,000 nM decreased compared to the control.
[0159] As shown in
TABLE-US-00005 TABLE 4 Amphiregulin-specific SAMiRNA candidate sequences selected by 1-base sliding window screening and high-throughput screening (HTS) SEQ ID NO Accession No. Position Sequence (DNA/RNA) 1 NM_001657.3 8-26 Sense CCTATAAAGCGGCAGGTGC 35 Antisense GCACCUGCCGCUUUAUAGG 2 NM_001657.3 130-148 Sense GAGCGGCGCACACTCCCGG 36 Antisense CCGGGAGUGUGCGCCGCUC 3 NM_001657.3 195-213 Sense GTCCCAGAGACCGAGTTGC 37 Antisense GCAACUCGGUCUCUGGGAC 4 NM_001657.3 224-242 Sense GAGACGCCGCCGCTGCGAA 38 Antisense UUCGCAGCGGCGGCGUCUC 5 NM_001657.3 270-288 Sense CCGGCGCCGGTGGTGCTGT 39 Antisense ACAGCACCACCGGCGCCGG 6 NM_001657.3 278-296 Sense GGTGGTGCTGTCGCTCTTG 40 Antisense CAAGAGCGACAGCACCACC 7 NM_001657.3 289-307 Sense CGCTCTTGATACTCGGCTC 41 Antisense GAGCCGAGUAUCAAGAGCG 8 NM_001657.3 292-310 Sense TCTTGATACTCGGCTCAGG 42 Antisense CCUGAGCCGAGUAUCAAGA 9 NM_001657.3 329-347 Sense GGACCTCAATGACACCTAC 43 Antisense GUAGGUGUCAUUGAGGUCC 10 NM_001657.3 341-359 Sense CACCTACTCTGGGAAGCGT 44 Antisense ACGCUUCCCAGAGUAGGUG 11 NM_001657.3 342-360 Sense ACCTACTCTGGGAAGCGTG 45 Antisense CACGCUUCCCAGAGUAGGU 12 NM_001657.3 349-367 Sense CTGGGAAGCGTGAACCATT 46 Antisense AAUGGUUCACGCUUCCCAG 13 NM_001657.3 353-371 Sense GAAGCGTGAACCATTTTCT 47 Antisense AGAAAAUGGUUCACGCUUC 14 NM_001657.3 368-386 Sense TTCTGGGGACCACAGTGCT 48 Antisense AGCACUGUGGUCCCCAGAA
Example 4. Screening of SAMiRNA Nanoparticles that Target Human Amphiregulin and Induce RNAi
[0160] The lung cancer cell line A549 was treated with SAMiRNA (selected in Example 3) having each of the sequences of SEQ ID NOs: 1 to 14 as a sense strand, and the expression pattern of amphiregulin mRNA in the cell line was analyzed.
[0161] 4-1 Treatment of Cells with SAMiRNA Nanoparticles
[0162] To identify SAMiRNA that inhibits amphiregulin expression, the human lung cancer line A549 was used. The A549 cell line was cultured in Gibcom Ham's F-12K (Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US) at 37° C. under 5% CO.sub.2. Using the same medium as above, the A549 cell line was dispensed into a 12-well plate (Costar, US) at a density of 8×10.sup.4 cells/well. The next day, the SAMiRNA homogenized with deionized distilled water in Example 3.1 above was diluted with 1×DPBS, and the cells were treated with the dilution to a SAMiRNA concentration of 200 nM or 600 nM. Treatment with the SAMiRNA was performed a total of four times (once every 12 hours), and the cells were cultured at 37° C. under 5% CO.sub.2.
[0163] 4-2 Screening of SAMiRNA by Inhibition Analysis of Human Amphiregulin mRNA Expression
[0164] Total RNA was extracted from the cell line treated with SAMiRNA in Example 4-1 and was synthesized into cDNA, and then the relative mRNA expression level of the amphiregulin gene was quantified by real-time PCR.
[0165] 4-2-1 RNA Isolation from SAMiRNA-Treated Cells and cDNA Synthesis
[0166] Using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), total RNA was extracted from the cell line treated with SAMiRNA in Example 4-1 above. The extracted RNA was synthesized into cDNA in the following manner using RNA reverse transcriptase (AccuPower® RocketScript™Cycle RT Premix with oligo (dT)20, Bioneer, Korea). Specifically, 1 μg of the extracted RNA was added to AccuPower® RocketScript™Cycle RT Premix with oligo (dT)20 (Bioneer, Korea) in each 0.25 ml Eppendorf tube, and distilled water treated with DEPC (diethyl pyrocarbonate) was added thereto to a total volume of 20 μl. In a gene amplification system (MyGenie™96 Gradient Thermal Block, BIONEER, Korea), a process of hybridizing the RNA with primers at 37° C. for 30 seconds and a process of synthesizing cDNA at 48° C. for 4 minutes were repeated 12 times. Then, the amplification reaction was terminated by deactivating the enzyme at 95° C. for 5 minutes.
[0167] 4-2-2 Quantitative Analysis of Relative mRNA Expression Level of Human Amphiregulin mRNA
[0168] Using the cDNA synthesized in Example 4-2-1 as a template, SYBR green real-time qPCR was performed, and the relative mRNA expression level of amphiregulin compared to a SAMiRNA control sample was analyzed in the following manner. The cDNA synthesized in Example 4-2-1 above was diluted 5-fold with distilled water, and for analysis of the mRNA expression level of amphiregulin, 3 μl of the diluted cDNA, 25 μl of AccuPower® 2× GreenStar™ qPCR MasterMix (BIONEER, Korea), 19 μl of distilled water, and 3 μl of amphiregulin qPCR primers (SEQ ID NOs: 17 and 18 (Table 5); 10 pmole/μl for each primer, BIONEER, Korea) were added to each well of a 96-well plate to make a mixture. Meanwhile, GAPDH (glyceraldehyde 3-phosphate dehydrogenase), a housekeeping gene (hereinafter referred to as HK gene), was used as a standard gene to normalize the mRNA expression level of amphiregulin. The 96-well plate containing the mixture was subjected to the following reaction using Exicycler™ Real-Time Quantitative Thermal Block (BIONEER, Korea). Specifically, the mixture was allowed to react at 95° C. for 15 minutes to activate the enzyme and remove the secondary structure of the cDNA, and then the mixture was subjected to 42 cycles, each consisting of denaturation at 94° C. for 30 sec, annealing at 58° C. for 30 sec, extension at 72° C. for 30 sec, and SYBR green scan, and to final extension at 72° C. for 3 minutes. Next, the mixture was maintained at a temperature of 55° C. for 1 minute, and the melting curve from 55° C. to 95° C. was analyzed.
[0169] After completion of the PCR, the Ct (threshold cycle) value of the target gene was corrected by the GAPDH gene, and then the ΔCt value was calculated using a control treated with the control sequence SAMiRNA (SAMiCONT) that does not induce gene expression inhibition. The relative expression level of the target gene in the cells treated with the amphiregulin-specific SAMiRNA was quantified using the ΔCt value and the equation 2(−ΔCt)×100.
[0170] To select highly efficient SAMiRNAs, 14 SAMiRNAs were selected, which had each of the sequences of SEQ ID NOs: 10, 11 and 12 as a sense strand. Here, the selected SAMiRNAs showed the highest efficiency with which the mRNA expression level of amphiregulin at a final concentration of 200 nM or 600 nM decreased compared to the control.
[0171] As shown in
TABLE-US-00006 TABLE 5 Information on primer sequences for qPCR Primer Sequence SEQ ID NO hGAPDH-F GGTGAAGGTCGGAGTCAACG 15 hGAPDH-R ACCATGTAGTTGAGGTCAATGAAGG 16 hAREG-F ACACCTACTCTGGGAAGCGT 17 hAREG-R GCCAGGTATTTGTGGTTCGT 18
(F denotes a forward primer, and R denotes a reverse primer)
TABLE-US-00007 TABLE 6 SAMiRNA sequences that effectively inhibit amphiregulin expression SEQ Sense ID NO Code Name Position strand sequence 10 SAMi-AREG#10 341-359 CACCTACTCTGGGAAGCGT 11 SAMi-AREG#11 342-360 ACCTACTCTGGGAAGCGTG 12 SAMi-AREG#12 349-367 CTGGGAAGCGTGAACCATT
Example 5. Inhibition of Human Amphiregulin Expression in Lung Cancer Cell Line (A549) by Selected SAMiRNAs
[0172] The lung cancer cell line A549 was treated with the SAMiRNA (selected in Example 4) having each of the sequences of SEQ ID NOs: 10, 11 and 12 as a sense strand, and the expression pattern of amphiregulin mRNA in the cell line was analyzed to determine the IC.sub.50 value of the SAMiRNA.
[0173] 5-1 Production and Particle Size Analysis of SAMiRNA Nanoparticles
[0174] Each of the three SAMiRNAs targeting the amphiregulin sequence, synthesized in Example 2, was dissolved in 1× Dulbecco's phosphate buffered saline (DPBS) (WELGENE, KR) and freeze-dried in a freeze dryer (LGJ-100F, CN) for 5 days. The freeze-dried nanoparticle powders were dissolved and homogenized in 2 ml of deionized distilled water (Bioneer, KR) and used in an experiment for the present invention. To analyze the particle size of the produced SAMiRNA nanoparticles, the size and polydispersity index of the SAMiRNA were measured using Zetasizer Nano ZS (Malvern, UK). The results of measuring the size and polydispersity index of the SAMiRNA nanoparticles are shown in Table 7 below and graphically shown in
TABLE-US-00008 TABLE 7 Size and polydispersity index of amphiregulin-specific SAMiRNA nanoparticles Code Name Size PDI SAMi-AREG#10 103.9 ± 3.8 0.406 ± 0.065 SAMi-AREG#11 99.9 ± 4.0 0.501 ± 0.005 SAMi-AREG#12 170.1 ± 7.5 0.457 ± 0.084
[0175] 5-2 Treatment of Cells with SAMiRNA Nanoparticles
[0176] To evaluate the effect of the selected SAMiRNAs that inhibit amphiregulin expression, the human lung cancer cell line A549 was used. The A549 cell line was cultured in Gibcom Ham's F-12K (Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US) at 37° C. under 5% CO.sub.2. Using the same medium as above, the A549 cell line was dispensed into a 12-well plate (Costar, US) at a density of (Costar, US) 8×10.sup.4 cells/well. The next day, the SAMiRNA homogenized with deionized distilled water in Example 5.1 above was diluted with 1×DPBS, and the cells were treated with the dilution to a SAMiRNA concentration of 12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM, 600 nM or 1200 nM. Treatment of the cells with the SAMiRNA was performed a total of four times (once every 12 hours), and the cells were cultured at 37° C. under 5% CO.sub.2.
[0177] 5-3 Determination of IC.sub.50 of SAMiRNA by Inhibition Analysis of mRNA Expression of Human Amphiregulin
[0178] Total RNA was extracted from the cell line treated with the SAMiRNA in Example 5-2 and was synthesized into cDNA, and then the relative mRNA expression level of the amphiregulin gene was quantified by real-time PCR.
[0179] 5-3-1 RNA Isolation from SAMiRNA-Treated Cells and cDNA Synthesis
[0180] Using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), total RNA was extracted from the cell line treated with the SAMiRNA in Example 5-2 above. The extracted RNA was synthesized into cDNA in the following manner using RNA reverse transcriptase (AccuPower® RocketScrip™Cycle RT Premix with oligo (dT)20, Bioneer, Korea). Specifically, 1 μg of the extracted RNA was added to AccuPower® RocketScriptmCycle RT Premix with oligo (dT)20 (Bioneer, Korea) in each 0.25 ml Eppendorf tube, and distilled water treated with DEPC (diethyl pyrocarbonate) was added thereto to a total volume of 20 μl. In a gene amplification system (MyGenie™96 Gradient Thermal Block, BIONEER, Korea), a process of hybridizing the RNA with primers at 37° C. for 30 seconds and a process of synthesizing cDNA at 48° C. for 4 minutes were repeated 12 times. Then, the amplification reaction was terminated by deactivating the enzyme at 95° C. for 5 minutes.
[0181] 5-3-2 Quantitative Analysis of Relative mRNA Expression Level of Human Amphiregulin
[0182] Using the cDNA synthesized in Example 5-3-1 as a template, SYBR green real-time qPCR was performed, and the relative mRNA expression level of amphiregulin compared to a SAMiRNA control sample was analyzed in the following manner. The cDNA synthesized in Example 5-3-1 above was diluted 5-fold with distilled water, and for analysis of the mRNA expression level of amphiregulin, 3 μl of the diluted cDNA, 25 μl of AccuPower® 2× GreenStar™ qPCR MasterMix (BIONEER, Korea), 19 μl of distilled water, and 3 μl of amphiregulin qPCR primers (SEQ ID NOs: 17 and 18 (Table 5); 10 pmole/μl for each primer, BIONEER, Korea) were added to each well of a 96-well plate to make a mixture. Meanwhile, GAPDH (glyceraldehyde 3-phosphate dehydrogenase), a housekeeping gene (hereinafter referred to as HK gene), was used as a standard gene to normalize the mRNA expression level of amphiregulin. The 96-well plate containing the mixture was subjected to the following reaction using Exicycler™ Real-Time Quantitative Thermal Block (BIONEER, Korea). Specifically, the mixture was allowed to react at 95° C. for 15 minutes to activate the enzyme and remove the secondary structure of the cDNA, and then the mixture was subjected to 42 cycles, each consisting of denaturation at 94° C. for 30 sec, annealing at 58° C. for 30 sec, extension at 72° C. for 30 sec, and SYBR green scan, and to final extension at 72° C. for 3 minutes. Next, the mixture was maintained at a temperature of 55° C. for 1 minute, and the melting curve from 55° C. to 95° C. was analyzed.
[0183] After completion of the PCR, the Ct (threshold cycle) value of the target gene was corrected by the GAPDH gene was determined, and then the ΔCt value was calculated using a control treated with the control sequence SAMiRNA (SAMiCONT) that does not induce gene expression inhibition. The relative expression level of the target gene in the cells treated with the amphiregulin-specific SAMiRNA was quantified using the ΔCt value and the equation 2(−ΔCt)×100.
[0184] As a result, it was confirmed that all the amphiregulin-specific SAMiRNAs having each of the sequences of SEQ ID NOs: 10, 11 and 12 as a sense strand showed a 50% or more decrease in the mRNA expression level of amphiregulin even at a low concentration of 100 nM, suggesting that the amphiregulin-specific SAMiRNAs exhibited the effect of inhibiting amphiregulin expression with high efficiency. It was confirmed that the IC.sub.50 values were 28.75 nM as shown in
Example 6. Evaluation of In Vitro Cytotoxicity Using Human Peripheral Blood Mononuclear Cells (PBMCs)
[0185] In order to examine whether the mRNA expression levels of innate immune-related cytokines are increased by SAMi-hAREG, ePBMC® cryopreserved human PBMCs (human peripheral monocular cells), Cellular Technology Limited, USA) were dispensed at a density of 5×10.sup.3 cells per well into a 12-well plate (Costar® USA) with RPMI1640 (Hyclone™) medium containing 10% FBS (fetal bovine serum; Hyclone™) The cells were cultured in a 5% CO.sub.2 incubator at 37° C. for 1 hour so as to be stabilized, and then the dispensed PBMCs were treated with 2.5 μM of each of SAMi-CON (DNA/RNA), SAMi-hAREG #10 (DNA/RNA), SAMi-hAREG #11 (DNA/RNA), SAMi-hAREG #12 (DNA/RNA), SAMi-CON (RNA/RNA), SAMi-hAREG #10 (RNA/RNA), SAMi-hAREG #11 (RNA/RNA), an d SAMi-hAREG #12 (RNA/RNA), and cultured in a 5% CO.sub.2 incubator at 37° C. for 6 hours. As a positive control, 20 μg/ml of Concanavalin A (Sigma Aldrich, USA) was used.
[0186] Thereafter, all the cells were harvested, and total RNA was extracted therefrom using an RNeasy Mini Kit (Qiagen, Germany) and an RNase-Free DNase Set (Qiagen, Germany) according to the manufacturer's protocols.
[0187] 200 ng of the extracted RNA was mixed with deionized sterile DW (Bioneer, Korea) and RNA reverse transcriptase (AccuPower® RocketScriptmCycle RT Premix with oligo (dT)20, Bioneer, Korea), and the mixture was allowed to react using a gene amplification system (MyGenie™96 Gradient Thermal Block, BIONEER, Korea) under conditions of 12 cycles, each consisting of 37° C. for 30 sec, 48° C. for 4 min and 55° C. for 30 sec, and then 95° C. for 5 min, thereby synthesizing a total of 20 μl of cDNA.
[0188] The synthesized cDNA was mixed with qPCR primers for each of RPL13A, IL1B, IL6, IFNG, TNF and IL12B genes and then amplified using Exicycler™96 Real-Time Quantitative Thermal Block (Bioneer, Korea) under the following conditions: 95° C. for 5 min, and then 45 cycles, each consisting of 95° C. for 5 sec and 58° C. for 15 sec.
[0189] Based on the Ct values of two genes obtained after qPCR array, the relative mRNA expression level in the test group compared to that in the control group was analyzed by the 2(−Delta Delta C(T)) Method [Livak K J, Schmittgen T D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. December; 25(4):4 02-8].
[0190] As a result, as shown in
Example 7. Comparative Analysis of Human Amphiregulin Expression Inhibition by DNA/RNA Hybrid and RNA/RNA Hybrid SAMiRNAs Comprising Each of Selected Sequences of SEQ ID NOs: 10, 11 and 12 as Sense Strand
[0191] The lung cancer cell line A549 was treated with each of a double stranded DNA/RNA hybrid and RNA/RNA hybrid comprising the amphiregulin-specific SAMiRNA (selected in Example 4) having each of the sequences of SEQ ID NOs: 10, 11 and 12 as a sense strand, and the relative mRNA expression levels (%) of amphiregulin in the cell line were comparatively analyzed.
[0192] 7-1 Treatment of Cells with SAMiRNA Nanoparticles
[0193] To identify SAMiRNA that inhibits amphiregulin expression, the human lung cancer line A549 was used. The A549 cell line was cultured in Gibcom Ham's F-12K (Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US) at 37° C. under 5% CO.sub.2. Using the same medium as above, the A549 cell line was dispensed into a 12-well plate (Costar, US) at a density of 8×10.sup.4 cells/well. The next day, the SAMiRNA homogenized with deionized distilled water in Example 3.1 above was diluted with 1×DPBS, and the cells were treated with the dilution to a SAMiRNA concentration of 200 nM, 600 nM or 1200 nM. Treatment of the cells with the SAMiRNA was performed a total of four times (once every 12 hours), and the cells were cultured at 37° C. under 5% CO.sub.2.
[0194] 7-2 Screening of SAMiRNA by Inhibition Analysis of mRNA Expression of Human Amphiregulin
[0195] Total RNA was extracted from the cell line treated with SAMiRNA in Example 7-1 and was synthesized into cDNA, and then the relative mRNA expression level of the amphiregulin gene was quantified by real-time PCR.
[0196] 7-2-1 RNA Isolation from SAMiRNA-Treated Cells and cDNA Synthesis
[0197] Using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), total RNA was extracted from the cell line treated with SAMiRNA in Example 7-1 above. The extracted RNA was synthesized into cDNA in the following manner using RNA reverse transcriptase (AccuPower® RocketScrip™Cycle RT Premix with oligo (dT)20, Bioneer, Korea). Specifically, 1 μg of the extracted RNA was added to AccuPower® RocketScrip™Cycle RT Premix with oligo (dT)20 (Bioneer, Korea) in each 0.25 ml Eppendorf tube, and distilled water treated with DEPC (diethyl pyrocarbonate) was added thereto to a total volume of 20 μl. In a gene amplification system(MyGenie™96 Gradient Thermal Block, BIONEER, Korea), a process of hybridizing the RNA with primers at 37° C. for 30 seconds and a process of synthesizing cDNA at 48° C. for 4 minutes were repeated 12 times. Then, the amplification reaction was terminated by deactivating the enzyme at 95° C. for 5 minutes.
[0198] 7-2-2 Quantitative Analysis of Relative mRNA Expression Level of Human Amphiregulin
[0199] Using the cDNA synthesized in Example 7-2-1 as a template, SYBR green real-time qPCR was performed, and the relative mRNA expression level of amphiregulin compared to a SAMiRNA control sample was analyzed in the following manner. The cDNA synthesized in Example 7-2-1 above was diluted 5-fold with distilled water, and for analysis of the mRNA expression level of amphiregulin, and 3 μl of the diluted cDNA, 25 μl of AccuPower® 2× GreenStar™ qPCR MasterMix (BIONEER, Korea), 19 μl of distilled water, and 3 μl of amphiregulin qPCR primers (SEQ ID NOs: 17 and 18 (Table 5); 10 pmole/μl for each primer, BIONEER, Korea) were added to each well of a 96-well plate to make a mixture. Meanwhile, GAPDH (glyceraldehyde 3-phosphate dehydrogenase), a housekeeping gene (hereinafter referred to as HK gene), was used as a standard gene to normalize the mRNA expression level of amphiregulin. The 96-well plate containing the mixture was subjected to the following reaction using Exicycler™ Real-Time Quantitative Thermal Block (BIONEER, Korea). Specifically, the mixture was allowed to react at 95° C. for 15 minutes to activate the enzyme and remove the secondary structure of the cDNA, and then the mixture was subjected to 42 cycles, each consisting of denaturation at 94° C. for 30 sec, annealing at 58° C. for 30 sec, extension at 72° C. for 30 sec, and SYBR green scan, and to final extension at 72° C. for 3 minutes. Next, the mixture was maintained at a temperature of 55° C. for 1 minute, and the melting curve from 55° C. to 95° C. was analyzed.
[0200] After completion of the PCR, the Ct (threshold cycle) value of the target gene was corrected by the GAPDH gene, and then the ΔCt value was calculated using a control treated with the control sequence SAMiRNA (SAMiCONT) that does not induce gene expression inhibition. The relative expression level of the target gene was quantified using the ΔCt value and the equation 2(−ΔCt)×100.
[0201] To select highly efficient SAMiRNA from the double-stranded DNA/RNA hybrid and RNA/RNA hybrid, the DNA/RNA hybrid SAMiRNA having the sequence of SEQ ID NO: 12 as a sense strand was finally selected. Here, the selected sequence DNA/RNA hybrid SAMiRNA (a gene expression inhibition of 90% or more) showed the highest efficiency with the mRNA expression level of amphiregulin at a final concentration of 200 nM, 600 nM or 1200 nM decreased compared to the control.
[0202] As shown in
Example 8. High-Throughput Screening (HTS) of SAMiRNA Nanoparticles That Target Mouse Amphiregulin and Induce RNAi
[0203] In the case of siRNA therapeutic agents, it is difficult to identify an optimal sequence that is applicable to different strains. In this case, US FDA guidelines are applied, according to which a DNA sequence (surrogate sequence; mouse gene-specific siRNA) specific for an animal model for analysis of therapeutic effects (an in vivo efficacy test) is designed so as to verify pharmacological activity resulting from the inhibition of expression of the gene of interest and toxicity resulting from the inhibition of expression of the gene of interest (presentation by Robert T. Dorsam Ph.D. Pharmacology/Toxicology Reviewer, FDA/CDER).
[0204] Previously discovered screening was modified by existing algorithm-based siRNA program (Turbo-si-designer owned by the applicant's company), and SAMiRNA-based siRNA sequence high-throughput screening was performed. 1-base sliding window scanning (the same method as the above-described human amphiregulin target screening) of 19-mer siRNAs against the entire target gene was performed, and a total of 1,190 candidate siRNA sequences against the possible mouse amphiregulin gene (NM 009704.4) full transcript sequence were generated. Blast sequence homology filtering was performed to remove unnecessary candidate sequences that influence the expression of other genes, and 237 finally selected SAMiRNAs were synthesized. The mouse NIH3T3 cell line was treated with each selected SAMiRNA at a concentration of 1 μM in a cell culture medium containing 10% FBS, and the in vitro expression inhibitory effects of the SAMiRNAs were first screened using the primers shown in Table 8 (primer sequence information for qPCR) (
[0205] Thereafter, the mouse lung fibroblast cell line MLg was treated with each of the two sequences (SEQ ID NOs: 19 and 20) selected in the NIH3T3 cell line and the mouse SAMiRNA-amphiregulin of SEQ ID NO: 21 discovered through previous milestone studies, at treatment concentrations of 200 nM and 500 nM in cell culture media containing 10% FBS, and additional screening was performed. As a result, it was confirmed that SEQ ID NO: 20 exhibited the best expression inhibitory effect (
[0206] Additionally, the mouse lung epithelial cell line LA-4 was treated with each of the two selected sequences (SEQ ID NOs: 19 and 20) and the mouse SAMiRNA-amphiregulin of SEQ ID NO: 21 discovered through previous milestone studies, at treatment concentrations of 200 nM, 500 nM and 1,000 nM in cell culture media containing 10% FBS, and the expression inhibitory effects were additionally evaluated. As a result, it was confirmed again that SEQ ID NO: 20 exhibited the best expression inhibitory effect (
[0207] As shown in
TABLE-US-00009 TABLE 8 Primer sequence information for qPCR Primer Sequence mGAPDH-F AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 22) mGAPDH-R TGTAGACCATGTAGTTGAGGTCA SEQ ID NO: 23) mAREG-F GAGGCTTCGACAAGAAAACG (SEQ ID NO: 24) mAREG-R ACCAATGTCATTTCCGGTGT (SEQ ID NO: 25)
(F denotes a forward primer, and R denotes a reverse primer)
TABLE-US-00010 TABLE 9 SAMiRNA sequences that effectively inhibit mouse amphiregulin expression SEQ Sense ID NO Code Name Position strand sequence 19 SAMi-mAREG#19 936-954 AACGGGACTGTGCATGCCA 20 SAMi-mAREG#20 937-955 ACGGGACTGTGCATGCCAT 21 SAMi-mAREG#21 1071-1089 CAGTTGTCACTTTTTATGA
Example 9. Investigation of Efficacy of SAMiRNA-mAREG by Intravenous Administration in Silica-Induced Pulmonary Fibrosis Model
[0208] To analyze the efficacy of SAMi-mAREG in a pulmonary fibrosis animal model induced by silica (silicon dioxide, SIGMA, Korea), and experiment was performed. For the experiment, 7-weeks-old mice were obtained and allowed to acclimatize for 1 week. To induce the model, Silica (3 mg) was dissolved and injected intratracheally into the mice. On 3 days after the induction, mice showing no abnormal symptoms were selected and divided into a normal group, a test group to which physiological buffered saline (PBS) was administered, a test group to which SAMiRNA-Control was administered, and test groups (SAMi-mAREG #20) to which 1 mg/kg and 5 mg/kg of SAMi-mAREG #20 were respectively administered three times at intervals of 2 days. In addition, on 14 days after model induction, the mice were sacrificed.
[0209] 9-1. Gene Expression Analysis for SAMiRNA in Silica-Induced Pulmonary Fibrosis Animal Model
[0210] Lung tissue was obtained from the sacrificed mice and the tissue was crushed using a homogenizer. Using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), total RNA was extracted from the cell line treated with SAMiRNA in Example 7-1 above. The extracted RNA was synthesized into cDNA in the following manner using RNA reverse transcriptase (AccuPower® RocketScript™Cycle RT Premix with oligo (dT)20, Bioneer, Korea). Using the synthesized cDNA as a template, SYBR green real-time qPCR was performed, and the relative expression levels of total RNA in the groups were analyzed in the following manner. The synthesized cDNA was diluted 5-fold with distilled water, and for analysis of the mRNA expression level of amphiregulin, 3 μl of the diluted cDNA, 25 μl of AccuPower® 2×GreenStar™ qPCR MasterMix (BIONEER, Korea), 19 μl of distilled water, and 3 μl of amphiregulin qPCR primers (SEQ ID NOs: 24 and 25 (Table 8); 10 pmole/μl for each primer, BIONEER, Korea) were added to each well of a 96-well plate to make a mixture. Meanwhile, RPL13A, a housekeeping gene (hereinafter referred to as HK gene), was used as a standard gene to normalize the mRNA expression levels of amphiregulin, fibronectin and collagen 3α1.
[0211] After completion of the PCR, the Ct (threshold cycle) value of each target gene was corrected by the RPL13A gene, and then the ΔCt value between the groups was calculated. The relative expression levels of amphiregulin, fibronectin and collagen 3α1 genes were quantified using the ΔCt value and the equation 2(−ΔCt)×100.
[0212] As a result, it was confirmed that the expression of amphiregulin was observed decreased in the groups treated with 1 mg/kg of SAMiRNA-AREG and 5 mg/kg of SAMiRNA-AREG, respectively, compared to the silica-induced pulmonary fibrosis model group treated with physiological buffered saline and the silica-induced pulmonary fibrosis model group treated with SAMiRNA-Control. In addition, it was confirmed that fibronectin and collagen 3α1 decreased in a concentration-dependent manner in the groups treated with 1 mg/kg of SAMiRNA-AREG and 5 mg/kg of SAMiRNA-AREG, respectively, compared to the silica-induced pulmonary fibrosis model group treated with physiological buffered saline and the silica-induced pulmonary fibrosis model group treated with SAMiRNA-Control.
[0213] 9-2. Histopathological Analysis for SAMiRNA in Silica-Induced Pulmonary Fibrosis Animal Model
[0214] In order to verify whether SAMiRNA-AREG against the silica-induced pulmonary fibrosis model affects the expression of extracellular matrix components, immunohistochemical staining was performed. Each animal model group was sacrificed, and paraffin sections were prepared through tissue fixing, washing, dehydration, clearing, infiltration, embedding and cutting processes. The paraffin section was cut thinly with a microtome and the tissue was mounted on a slide. To observe the lung tissue pathologically, hematopoietic & eosin (H&E) staining was performed, and to examine the expression level of collagen 3α1, Masson's trichrome staining was performed. In addition, immunohistochemical staining was performed to analyze the expression level of amphiregulin.
[0215] Through hematoxylin & eosin staining, it could be seen that the silica-induced pulmonary fibrosis tissue was more damaged than the lung tissue of the normal group. However, it could be seen that the lung tissue of the mice to which SAMiRNA-AREG was administered had little damage, like the lung tissue of the normal group. In addition, Masson's trichrome staining was performed to examine the degree of fibrosis. It was confirmed that the degree of fibrosis in the lung tissue interstitium in the group to which SAMiRNA-AREG was administered decreased compared to those in the silica-induced pulmonary fibrosis model group to which physiological buffered saline (PBS) and those in the group to which SAMiRNA-Control was administered. In addition, through immunohistochemical staining for amphiregulin, it could be seen that amphiregulin was much expressed in the interstitium between the cells in the silica-induced pulmonary fibrosis animal group. However, it could be confirmed that, in the group to which SAMiRNA-AREG was administered, the expression of AREG in the lung tissue interstitium decreased.
[0216] In conclusion, 1 mg/kg and 5 mg/kg of SAMiRNA-AREG were administered intravenously to the silica-induced pulmonary fibrosis model mice three times (days 10, 12 and 14), and evaluation of the inhibitory effect of SAMiRNA-AREG on the expression of the target gene amphiregulin and the fibrosis marker genes in the lung tissue and H&E staining and Masson's trichrome staining of the lung tissue were performed. As a result of analyzing the expression of the target gene amphiregulin and the fibrosis marker genes collagen 3α1 and fibronectin, it was confirmed that the expression was increased by silica-induced pulmonary fibrosis and it was confirmed the effect of inhibiting the expression in a concentration-dependent manner by treatment with SAMiRNA-AREG. In addition, as a result of tissue staining, it was confirmed that, in the silica-induced pulmonary fibrosis mouse treated with PBS or SAMiRNA-Control, infiltration of cells into the lung tissue and the expression of collagen increased, but in the test group treated with SAMiRNA-AREG, cellular infiltration and collagen significantly decreased to levels comparable with those in the control group treated with DPBS (
[0217] In addition, immunohistochemistry staining for AREG in the silica-induced pulmonary fibrosis model was performed. As shown in
Example 10. Investigation of Efficacy of SAMiRNA-mAREG by Intravenous Administration in Bleomycin-Induced Pulmonary Fibrosis Model
[0218] 5 mg/kg of SAMiRNA-AREG (SAMi-mAREG #20) was administered intravenously to a bleomycin-induced pulmonary fibrosis mouse model three times (days 8, 10 and 12), and Sircol assay was performed. As a result, it was confirmed that the amount of collagen protein in the test group, to which SAMiRNA-AREG was administered, decreased by >40% compared to that in the control group SAMiRNA-Cont. In addition, RNA was extracted from the lung tissue of the same test group, and the effect of inhibiting the expression of the target gene amphiregulin and the fibrosis marker gene collagen 3α1 was analyzed. As a result, the expression inhibitory effect compared to the control was found. It was confirmed that the effect of the newly identified test substance of SEQ ID NO: 20 was equal to or higher than that of the existing sequence. H&E staining of the lung tissue and collagen 3α1-specific Masson's trichrome staining of the lung tissue were performed. As a result of tissue staining, it was confirmed that, in the bleomycin-induced pulmonary fibrosis mouse group treated with PBS or SAMiRNA-Control, infiltration of cells into the lung tissue increased and staining due to collagen accumulation increased. It was confirmed that, in the test group treated with SAMiRNA-AREG, cellular infiltration and collagen accumulation significantly decreased (
Example 11. Evaluation of Effect of SAMiRNA-AREG Against Renal Fibrosis Induced by UUO (Unilateral Ureteral Obstruction) in Mice
[0219] Analysis of the effect of SAMiRNA-AREG (SAMi-mAREG #20) in a renal fibrosis animal model induced by UUO surgery was performed. First, inhalation anesthesia of mice with iFran solution (Hana Pharmaceutical, Korea) was performed to prepare a renal fibrosis animal model. The skin and peritoneum were incised, and the ureter of the left kidney was tied with 4-0 silk in two positions. To prevent urinary tract infections, the middle between the two locations was cut. In addition, the right kidney was operated in the same way, but the ureter was not tied. Likewise, the abdomen of the normal group was also open, and the ureter of the left kidney was checked, but was not tied. In addition, the peritoneum and skin were sutured to prevent infection. At 6 hours after model induction, first administration of 1 mg/kg or 5 mg/kg of SAMiRNA-AREG was performed. After 24 hours, second administration was performed. Two administrations were performed, and animals were sacrificed 24 hours after the last administration. The animal model groups were a total of four groups: a normal group, an UUO model group to which physiological buffered saline was administered, and UUO groups to which 1 mg/kg and 5 mg/kg of SAMiRNA-AREG were administered, respectively.
[0220] 11-1. Gene Expression Analysis for SAMiRNA in Renal Fibrosis Induced by UUO (Unilateral Ureteral Obstruction)
[0221] Lung tissue was obtained from the sacrificed mice and the tissue was crushed using a homogenizer. Using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), total RNA was extracted from the cell line treated with SAMiRNA in Example 7-1 above. The extracted RNA was synthesized into cDNA in the following manner using RNA reverse transcriptase (AccuPower® RocketScriptmCycle RT Premix with oligo (dT)20, Bioneer, Korea). Using the synthesized cDNA as a template, SYBR green real-time qPCR was performed, and the relative expression levels of total RNA in the groups were analyzed in the following manner. The synthesized cDNA was diluted 5-fold with distilled water, and for analysis of the mRNA expression levels of amphiregulin and fibrosis markers, 3 μl of the diluted cDNA, 25 μl of AccuPower® 2× GreenStar™ qPCR MasterMix (BIONEER, Korea), 19 μl of distilled water, and 3 μl of qPCR primers (SEQ ID NOs: 24 and 25 (Table 8); 10 pmole/μl for each primer, BIONEER, Korea) for amphiregulin and fibrosis markers were added to each well of a 96-well plate to make a mixture. Meanwhile, RPL13A, a housekeeping gene (hereinafter referred to as HK gene), was used as a standard gene to normalize the mRNA expression levels of transforming growth factor-1, amphiregulin, fibronectin, collagen 1, smooth muscle actin and collagen 3α1. In addition, the CCR2 gene was also analyze to verify efficacy against inflammatory factors.
[0222] After completion of the PCR, the Ct (threshold cycle) value of the target gene was corrected by the RPL13A gene, and then the ΔCt value between the groups was calculated. The relative expression levels of transforming growth factor-1, amphiregulin, fibronectin, collagen 1, smooth muscle actin, collagen 3α1 and CCR2 gene were quantified using the ΔCt value and the equation 2(−ΔCt)×100.
[0223] As a result, the expression level of amphiregulin was 60 times higher in the UUO model group to which physiological buffered saline was administered than in the normal group. It was confirmed that the expression of amphiregulin gene decreased in the groups to which 1 mg/kg of SAMiRNA-AREG and 5 mg/kg of SAMiRNA-AREG were administered, respectively. In addition, it was confirmed that fibronectin and transforming growth factor-1 decreased in a concentration-dependent manner in the groups to which 1 mg/kg of SAMiRNA-AREG and 5 mg/kg of SAMiRNA-AREG were administered, respectively, compared to the UUO model group. In addition, collagen 3α1, collagen 1, and smooth muscle actin tended to decrease in the group to which 1 mg/kg of SAMiRNA-AREG was administered, compared to the UUO model group. However, it was confirmed that the effect of decreasing the expression of the genes was better in the group to which 5 mg/kg of SAMiRNA-AREG was administered than in the group to which 1 mg/kg of SAMiRNA-AREG was administered. In addition, it was confirmed that CCR2 about 6 times increased in the UUO model group, but decreased in the groups to which SAMiRNA-AREG was administered.
[0224] Although the present invention has been described in detail with reference to specific features, it will be apparent to those skilled in the art that this description is only of a preferred embodiment thereof, and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereto.
INDUSTRIAL APPLICABILITY
[0225] The double-stranded oligonucleotide structure comprising the amphiregulin-specific double-stranded oligonucleotide according to the present invention, and a pharmaceutical composition comprising the same as an active ingredient may inhibit amphiregulin with high efficiency without side effects, and thus may exhibit excellent effects on the prevention and treatment of diseases caused by excessive fibrosis and respiratory diseases.