N-GLYCOSYLATION

20170369905 · 2017-12-28

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a mammalian cell comprising a gene encoding a polypeptide of interest, wherein the polypeptide of interest is expressed comprising one or more posttranslational modification patterns. These modifications are useful for example in glycoprotein production where the antibodies with the modifications have an enhanced antibody-dependent cell-mediated cytotoxicity (ADCC). The present invention also relates to methods for producing the glycoproteins and compositions comprising the glycoproteins, and their uses.

    Claims

    1. A cell comprising one or more glycosyltransferase genes, which have been inactivated.

    2-92. (canceled)

    93. The cell according to claim 1, wherein the cell has new and/or more homogeneous stable glycosylation capacities.

    94. The cell according to claim 1, wherein the cell comprises one or more glycosyltransferase genes, which have been introduced stably by site-specific or non-site-specific gene knockin.

    95. The cell according to claim 1, wherein the cell is a mammalian cell or an insect cell.

    96. The cell according to claim 1, wherein the cell is selected from the group consisting of CHO, NS0, SP2/0, YB2/0, CHO-K1, CHO-DXB11, CHO-DG44, CHO-S, HEK293, HUVEC, HKB, PER-C6, and NS0, or derivatives of any of these cells.

    97. The cell according to claim 1, wherein the cell additionally encodes an exogenous protein of interest.

    98. The cell according to claim 97, wherein the protein of interest is an antibody, an antibody fragment, or a polypeptide.

    99. The cell according to claim 98, wherein the antibody is an IgG antibody.

    100. The cell according to claim 98, wherein the protein of interest is EPO, a protein involved in hemostasis, or a coagulation factor.

    101. The cell according to claim 93, wherein the glycosylation capacities of the cell are selected from the group consisting of glycosylation being non-sialylated, non-galactosylated, comprising biantennary N-glycans, not comprising poly-LacNAc and any combination without fucose.

    102. The cell according to claim 1, wherein inactivation is accomplished by knockout of one or more glycosyltransferase genes selected form the group consisting of FUT8, B4galt1, and combinations thereof.

    103. The cell according to claim 1, wherein inactivation is accomplished by knockout of one or more of the glycosyltransferase genes selected from the group consisting of mgat1, mgat2, mgat4A, mgat4B, mgat4C, mgat5 and mgat5B.

    104. The cell according to claim 1, wherein inactivation is accomplished by knockout of one or more of the galatosylation genes selected from the group consisting of B4gal1, B4gal2, B4gal3 and B4 gal.

    105. The cell according to claim 1, wherein inactivation is accomplished by knockout of one or more of the poly-LacNAc elongation genes selected from the group consisting of B3gnt1, B3gnt2 and B3gnt8.

    106. The cell according to claim 1, wherein inactivation is accomplished by knockout of one or more of the sialyltransferase genes selected from the group consisting of ST3gal3, ST3gal4 and ST3gal6.

    107. The cell according to claim 106, wherein ST6gal1 has been knocked in and ST3gal4 and ST3gal6 have been knocked out.

    108. The cell according to claim 106, wherein ST6gal1 has been knocked in and ST3gal4, ST3gal6, mgat4A, mgat4B and mgat5 have been knocked out.

    109. A method for producing a glycoprotein having a modified glycan profile, wherein the cell producing the glycoprotein has more than one modification of one or more glycosyltransferase genes.

    110. A glycoprotein obtainable according to the method of claim 109 having glycostructure outcome with one or more of following changes selected from the group consisting of simpler glycan structure, more homogeneous product, more sialic acids per molecule, non-sialylated, non-galactosylated, more homogeneous bi-antennary, more homogeneous monoantennary, more homogeneous triantennary, more homogeneous without poly-LacNAc, higher productivity in cell culture, new stable homogeneous glycosylation capacities, more human glycostructure, more homogeneous glycosylation, improved ADCC targeting of IgG, modified fucose level, no fucose, and an improved substrate for generating glycoconjugates.

    111. A mammalian cell capable of expressing a gene encoding a polypeptide of interest, wherein the polypeptide of interest is expressed comprising one or more of the posttranslational modification patterns: i) homogenous biantennary N-glycans, and a) with α2,3NeuAc capping, or b) without α2,3NeuAc capping, or c) with α2,6NeuAc capping, or d) without α2,6NeuAc capping.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0101] FIG. 1 shows ZFN knockout screen in CHO to define key glycosyltransferase genes involved in N-glycosylation using human EPO as reporter. (a) Graphic depiction of a common tetraantennary N-glycan with poly-LacNAc on the β6-antenna and capping by sialic acids. Arrows indicate glycosyltransferase genes with potential roles in biosynthesis of each step. Designations for monosaccharides according to the Consortium for Functional Glycomics are indicated. (b) Glycoprofiling of EPO expressed in CHO GS WT cells. MALDI-TOF spectra of PNGase F released permethylated N-glycans with labeling of four major species. (c) Glycoprofiling of EPO expressed in CHO GS cells with KO of genes involved in tri- and tetraantennary biosynthesis, showing that triple KO of mgat4A/4B/5 results in homogeneous biantennary N-glycans with a minor amount of poly-LacNAc (lower panel). (d) Glycoprofiling with KO of β4galactosyltransferase genes involved in LacNAc biosynthesis, showing that only B4galt1 KO alone produced substantial albeit partial loss of galactosylation, while only stacked KO of B4galt1/3 resulted in near complete loss of galactosylation. (e) Glycoprofiling with KO of two β3GlcNAc-transferase genes with claimed roles in poly-LacNAc biosynthesis, showing that KO of B3gnt2 results in complete loss of poly-LacNAc. (f) Glycoprofiling with KO of three α2,3sialyltransferase genes with claimed roles in N-glycosylation, showing that only the double KO of st3gal4/6 resulted in complete loss of sialic acid capping.

    [0102] FIG. 2 shows De novo design of sialylation capacity in CHO GS by ZFN targeted knockin. (a) Glycoprofiling of EPO expressed in WT, double st3gal4/6 KO, and st3gal4/6 KO with ST6GAL1 KI, showing that the range of tetraantannary N-glycan structures produced in WT CHO regain sialylation to same degree after KI of ST6GAL1. (b) Glycoprofiling of EPO with triple mgat4A/4B/5 and B3gnt2 KO, showing complete loss of poly-LacNAc on biantennary N-glycans. Glycoprofiling of mgat4A/4B/5 and st3gal4/6 KO without and with KI of ST6GAL1, showing complete loss of sialic acid capping on biantennary N-glycans and complete de novo capping by α2,6 sialic acid on biantennary N-glycans, respectively.

    [0103] FIG. 3 shows graphic depiction of the design matrix for genetic engineering of CHO N-glycosylation capacity to produce homogeneous biantennary N-glycans with α2,3NeuAc capping, without sialylation, and with α2,3NeuAc capping on EPO. Additional KO of fut8 would result in loss of core fucosylation.

    [0104] FIG. 4 shows expression profiling of selected glycosyltransferase genes by RNAseq in CHO. RNAseq analysis was performed on two common CHO lines (CHO-K1, CHO-GS) and two independent CHO GS triple mgat4A/4B/5 KO clones (cl#1, cl#2). The reported RNAseq analysis of CHO K1 is included, and this was largely identical to our analyses except that the relative expression levels were higher. Importantly, a few genes including mgat4b reported previously not to be expressed in CHO K1, were found in the present study to be expressed, and mgat4b was found to be essential for the glycoengineering experiments reported here. Another important observation was that the expression profiles of glycogenes in the two triple KO clones analyses were identical to those of the parental CHO lines, providing evidence that the precise gene editing does not alter expression of other glycogenes even for functional compensatory reasons. For more conclusive evaluation of this we clearly need to obtain broader RNAseq data for all mutant clones.

    [0105] FIG. 5 shows Immunocytology of CHO knockout clones with mutations related to N-glycan branching and poly-LacNAc biosynthesis. (a) The L-PHA lectin was used to specifically probe 86 branching of N-glycans and only KO of mgat5 produced (mgat4A/4b/5) altered L-PHA labeling, while the control lectin ConA binding all types of N-glycans was unaffected. This confirms that MGAT4A and 4B forms the β4 branch, while MGAT5 forms the β6 branch, and hence supports the interpretation of the mass spec data presented in FIG. 1c regarding branch assignments. (b) A similar strategy was used to probe for poly-LacNAc with the LEL, where only KO of B3gnt2 resulted in loss of labeling. This data also support the interpretation of the mass spec data presented in FIG. 2 regarding assignment of LacNAc's to biantennary structures.

    [0106] FIG. 6 shows immunocytology of CHO knockout clones with mutations related to LacNAc formation. (a) The MAb 1B2 was used to label presence of LacNAc after removal of sialic acids by neuraminidase pretreatment. Analysis of KO of B4galt1-4 in CHO GS WT with heterogeneous branching showed that KO of B4galt1 reduced labeling, while only stacked KO of B4galt1/3 completely abolished labeling. (b) The same analysis of KO of B4galt1-4 in CHO GS engineered with homogenous biantennary N-glycans (KO of mgat4A/4B/5) showed that KO of B4galt1 alone essentially abolished MAb 1B2 labeling, indicating that β4Gal-T1 is the main enzyme responsible for galactosylation of biantennary N-glycans. This finding is expected to have implications for recombinant production of therapeutic IgGs in CHO, since these proteins in general are produced with biantennary N-glycans with limited galactosylation.

    [0107] FIG. 7 shows immunocytology of CHO knockout and knockin clones related to sialylation. (a) The MAb 1B2 was used to label exposure of LacNAc as a result of loss of sialylation capacity, and this demonstrated that KO of st3gal3 and st3gal6 did not affect labeling substantially, while KO of st3galt4 and stacked KO of st3galt4/6 resulted in strong labeling. This suggests that the ST3Gal-IV enzyme is the main sialyltransferase responsible for α2,3sialylation of N-glycans. Furthermore, de novo introduction of human ST6Gal-1 in the stacked st3galt4/6 KO clone completely abolished MAb 1B2 labeling demonstrating efficient sialylation by this enzyme. (b) To confirm the de novo introduction of human ST6Gal-1 resulted in α2,6sialylation we used the lectin SNA, which did not label CHO WT cells as expected and only labeled after introduction of ST6GAL1. This result supports the mass spec interpretations presented in FIG. 2.

    [0108] FIG. 8 shows analysis of targeted knockin of ST6GAL1 by junction PCR. (a) We used a modified Obligare targeted KI strategy utilizing two inverted ZFN binding sites flanking the ST6GAL1 gene in donor plasmid. 5 ‘and 3’ junction PCR confirmed targeted integration into the Safeharbor#1 site in the CHO clone with st3gal4/6 KO. (b) 5 ‘and 3’ junction PCR confirmed targeted integration in the CHO clone with st3gal4/6/mgat4A/413/5 KO. The status of allelic copy number of integration was determined by WT allelic PCR. The presence of desired band in WT allelic PCR indicates the presence of Safeharbor#1 site without the integration of targeted KI of gene of interest on at least one of the allele. The results showed biallelic integration of st6gal1 to Safeharbor#1 site in st3gal4/6 KO and monoallelic integration to mgat4A/413/5/st3gal4/6 KO, respectively.

    [0109] FIG. 9 shows SDS-PAGE Coomassie analysis of purified recombinant EPO expressed in CHO clones. Approximately 1 μg of purified EPO based on OD was loaded.

    [0110] FIG. 10 shows glycoprofiling of EPO produced in CHO-GS WT, B3gnt2/mgat4A/4B/5, and st3gal4/6/mgat4A/413/5 KO with KI of ST6Gal-I, showing complete loss of poly-LacNAc on biantennary N-glycans, and complete de novo capping by α2,6 sialic acid on biantennary N-glycans without poly-LacNAc. Negative ion ESI-MS glycoprofilling was used to validate MALDI-TOF based glycan profiling data.

    [0111] FIG. 11 shows negative ion ESI-MS/MS of the precoursor ions as m/z 1183.92 (sialyllated biantennary N-glycan with core fucose) from EPO produced in CHO with (A) mgat4A/4B/5 KO and with (B) both mgat4A/4B/5 and st3gal4/6 KO and KI of ST6Gal-I. The presence of the diagnostic fragmen ions at m/z 306.12 indicates α2,6 terminal sialylation.

    [0112] FIG. 12. A graphic depiction of the human CAZy GT families involved in the biosynthesis of the major mammalian glycoconjugates and their different glycosylaton pathways. The common mammalian glycan structures are depicted for (A) O-glycans including O-GalNAc, O-GlcNAc, O-Fuc, O-Glc, O-Man, O-Xyl; (B) N-glycans; (C) GPI-anchors; (D) C-glycans; (E) glycospingolipids; (F) hyaloronan and (G) hydroxy-lysine. Designations for monosaccharides according to the Consortium for Functional Glycomics are indicated.

    [0113] FIG. 13 A graphic representation of the different glycan structures and glycosylation pathways found in CHO cell lines with designations of glycosyltransferase genes expressed in CHO cell lines and their predicted role in biostynthic steps. The genes are assigned to the major confirmed or putative functions in the O-glycosylation (O-GalNAc (A1), O-Man (A2), and O-Fuc, O-Glc, O-GlcNAc, O-Xyl (A3)) and N-glycosylation pathways relevant for recombinant glycoprotein therapeutics today. (A1-4) O-GalNAc glycosylation pathway with extended core 1, core 2, core 3, and core 4 structures; (B) N-glycosylation pathway; (C) glycosphingolipid biosynthetic pathways; (D) C-glycan, and (E) GPI-anchors. The CAZy families of glycosyltransferase (GT genes are notated and GT genes expressed in CHO cell lines are shown. Glycan structures not synthesized in CHO are boxed. Designations for monosaccharides according to the Consortium for Functional Glycomics are indicated.

    [0114] FIG. 14 Graphic depictions of all genes encoding isoenzymes with potential to regulate N-glycosylation branching, elongation, and terminal capping expressed in CHO. The depiction shows the knockout screen of glycosyltransferase genes involved in N-glycosylation in CHO using human EPO as recombinant expressed reporter glycoprotein. (A) The common tetraantennary N-glycan with poly-LacNAc on the β6-antenna and capping by sialic acids is shown, the knockout genes are boxed, and genes not expressed in the CHO cells are annotated. Note that human ST6Gal-I (ST6GAL1) has been introduced by ZFN-mediated knock-in. Designations for monosaccharides according to the Consortium for Functional Glycomics (CFG) are indicated. (B) Schematic depiction of the actual nuclease targeted regions relative to the predicted general domain structure of type II glycosyltransferase proteins (upper panel) and the targeted exon for each gene numbering the respective genes from first coding exon (lower panel). The exon structure depiction only includes the first targeted exons and does not include all exons for all genes.

    [0115] FIG. 15 Glycoprofiling of EPO expressed in CHO WT cells. MALDI-TOF spectra of PNGase F released permethylated N-glycans with predicted structures for the four major species.

    [0116] FIG. 16 Glycoprofiling of EPO expressed in CHO cells with KO of genes involved in complex type N-glycan biosynthesis and antennary formation, showing that double KO of mgat4B/5 (B) and triple KO of mgat4A/4B/5 (B) results in homogeneous biantennary N-glycans with a minor amount of poly-LacNAc. Since single KO of mgat4A (A) had minor effects compared to WT it is likely that minor amounts of triantennary structures are present in the double mgat4B/5 KO.

    [0117] FIG. 17 Glycoprofiling with KO of B4galt1/2/3/4 genes involved in LacNAc biosynthesis, showing that only B4galt1 KO alone produced substantial albeit partial loss of galactosylation, while only stacked KO of B4galt1/3 resulted in near complete loss of galactosylation, while stacked KO of B4galt1/3 resulted in near complete loss of galactosylation. Stacked KO of B4galt1/2/3 resulted in essentially complete loss of galactosylation.

    [0118] FIG. 18 Glycoprofiling with KO of three β3GlcNAc-transferase genes showing that KO of B3gnt2 results in complete loss of poly-LacNAc, whereas KO of B3gnt1 and B3gnt1 had no effects. Lower PANEL shows that KO of B3gnt2 in combination with mgat4A/4B/5 results in complete loss of poly-LacNAc on biantennary structures.

    [0119] FIG. 19 Glycoprofiling with KO of three α2,3sialyltransferase genes with claimed roles in N-glycosylation, showing that only the double KO of st3gal4/6 resulted in complete loss of sialic acid capping.

    [0120] FIG. 20 Immunoflourescense cytology with ConA and L-PHA lectin staining showing loss of L-PHA with knockout of mgat5.

    [0121] FIG. 21 Immunoflourescense cytology with a monoclonal antibody (clone 1B2) to LacNAc. Panel (A) shows surprisingly that only stacked KO of B4galt1/3, and not B4galt1/2/4, abolished galactosylation. Panel (B) shows that KO of B4galt1 in CHO-GS with KO of mgat4A/4B/5 eliminated immunoreactivity for LacNAc while KO of B4galt2, 3, and 4 in the same CHO-GS had no substantial effects.

    [0122] FIG. 22 Recombinant expression of a therapeutic IgG in CHO with KO of B4galt1 resulted in homogenous biantennary N-glycans without galactosylation. Glycoprofiling of IgG produced in CHO WT and B4galt1 KO showing essentially complete loss of the incomplete galactosylation and sialylation characteristic for the conserved N-glycan at Asn297. KO of B4galt1 in combination with fut8 resulted in N-glycans without galactosylation and fucose.

    [0123] FIG. 23 Immunoflourescense cytology with LEL lectin shows that B3gnt2 is the key gene controlling the LacNAc initiation in CHO cells.

    [0124] FIG. 24 Immunoflourescense cytology with monoclonal antibody to LacNAc (1B2). Knockout of St3gal3, St3gal4, and St3gal6 individually using immunocytology to evaluate exposure of LacNAc shows that only KO of St3gal4 produced substantial exposure of LacNAc.

    [0125] FIG. 25 Glycoprofiling of EPO expressed in CHO with KO of mgat4a/4b/5 and ZFN-mediated knockin of human ST6GAL1. Panel A shows profiling of EPO with homogenous α2,6NeuAc capping of the complete range of N-glycan antennary structures. Also shown is KI of ST6GAL1 in CHO with KO of mgat4a/4b/5/B3gnt2, which produced more homogeneous tetraantennary structures. Panel B shows profiling with additional KO of mgat4a/4b/5 where EPO is produced with homogenous biantennary N-glycans capped by α2,6NeuAc. Also shown are KI of human ST3Gal-4 in combination with KO of st3gal4/6/mgat4a/4b/5/63gnt2 where EPO is produced with homogeneous biantennary N-glycans without poly-LacNAc and capped by α2,3NeuAc.

    [0126] FIG. 26 Negative ion ESI-MS/MS of the precursor ions at m/z 1183.92 (sialylated biantennary N-glycan with core fucose) from EPO produced in CHO with (A) Mgat4a/4b/5 KO and with (B) both Mgat4a/4b/5 and st3gal4/6 KO and KI of ST6GAL1. The presence of the diagnostic fragment ions at m/z 306.12 demonstrates the presence of α2,6 terminal sialylation.

    [0127] FIG. 27 Analysis of targeted KI of ST6GAL1 by junction PCR. Panel A shows that a modified ObLiGaRe targeted KI strategy utilizing two inverted ZFN binding sites flanking the ST6GAL1 full open reading frame in donor plasmid was used. 5 ‘and 3’ junction PCR confirmed targeted integration into the Safeharbor#1 site in the CHO clone with st3gal4/6 KO. (b) 5 ‘and 3’ junction PCR confirmed targeted integration in the CHO clone with st3gal4/6/mgat4a/4b/5 KO. The status of allelic copy number of integration was determined by WT allelic PCR. The presence of desired band in WT allelic PCR indicates the presence of Safeharbor#1 site without the integration of targeted KI of gene of interest on at least one of the allele. The results showed biallelic integration of ST6Gal-I at Safeharbor#1 site in the CHO st3gal4/6 KO clone and monoallelic integration in the mgat4a/4b/5/St3gal4/6 KO clone. The ObLiGaRe KI strategy was highly efficient with approximately 30-50% single cloned cells expressing ST6GAL1 as evaluated by antibody and lectin immunocytology.

    [0128] FIG. 28 Graphic depiction of the genetic deconstruction of N-glycosylation in CHO established using EPO as N-glycoprotein reporter. Several KO CHO lines have potential for production of glycoprotein therapeutics with more homogenous glycosylation (e.g. biantennary α2,3-sialylated N-glycans for EPO, and biantennary non-galactosylated/sialylated with and without core Fuc for IgG. Examples of reconstruction based on KI are shown producing homogenous α2,6-sialylation after KO of α2,3-sialylation capacities with either WT N-glycan branching heterogeneity or homogenous biantennary structure, homogeneous α2,3-sialylation after KO of endogeneous sialylation, and homogeneous tetranatennary structures with α2,6-sialylation after KO of endogeneous branching and sialylation capacities. Reconstruction may address homogeneity as shown, but also branching, poly-LacNAc elongation, and any type of capping as indicated.

    [0129] FIG. 29 Glycoprofiling of EPO expressed in CHO with KO of Cosmc to eliminate O-GalNAc elongation with Gal and NeuAc showing improved capacity for sialic acid capping of N-glycans at all three N-glycosites present in EPO, when compared to WT as shown in FIG. 15.

    [0130] FIG. 30 Glycoprofiling of EPO expressed in CHO with KO of B4galT7 to eliminate O-Xyl elongation with Gal (PANEL A) and Pomgnt1 to eliminate O-Man elongation with Gal and NeuAc (PANEL B) showing enhanced capacity for sialic acid capping of N-glycans at all three N-glycosites present in EPO. PANEL C illustrates glycoprofiling of EPO expressed in double KO of B4galt7 and pomgnt1, and Panel D illustrates glycoprofiling of EPO expressed in triple KO of B4galt7, pomgnt1, and cosmc showing the same improved capacity for sialic acid capping of N-glycans in EPO.

    [0131] FIG. 31 Glycoprofiling of EPO expressed in CHO with KO of B4galT4 to eliminate a galactosyltransferase paralog not utilized for N-glycans and this glycosylation pathway showing improved capacity for sialic acid capping of N-glycans at all three N-glycosites present in EPO.

    [0132] FIG. 32 Glycoprofiling of EPO expressed in CHO with KO of mgat2 showing loss of tetra and triantennary N-glycan structures and appearance of mono and biantennary N-glycans with galactose and NeuAc capping (PANEL B), and without sialic acid capping with KO of st3gal4/6 (PANEL C). Further KO of mgat4A/4B/5 resulted in monoantennary structures with minor amounts of poly-LacNAc (PANELS D and E). Reintroduction of human mgat4A and mgat5 in combination with ST6Gal-I resulted in loss of monoantennary N-glycans and restoration of tri and tetraantennary structures (PANELS H and I).

    [0133] FIG. 33 SDS-PAGE gel analysis of glycoPEGylation reactions of recombinant wildtype EPO-Myc-His6 and recombinant EPO-Myc-His6 with monoantennary N-glycans. Lanes contained: (1) HiMark Standard, (2) ST3Gal3, (3) Sialidase, (4) wt hEPO, wt EPO-Myc-His6 glycoPEGylated with ST3Gal-III and (5) 1×, (6) 5×, (7) 10×, (8) 25×, (9) 50×10 kDa-PSC reagent respectively, (10) EPO-Myc-His6 glycosylation variant and EPO-Myc-His6 glycosylation variant glycoPEGylated with ST3Gal-III and (11) 1×, (12) 5×, (13) 10×, (14) 25×, (15) 50×10 kDa-PSC reagent. Bands above approximately 160 kD indicates GlycoPegylation with more than two PEG chains at one or more N-glycans.

    [0134] FIG. 34 Quantification of number of attached PEG chains by densitometry of SDS-PAGE gels. (PANEL A) Product profile of enzymatic 10 kDa-GlycoPEGylation reaction with EPO-Myc-His6 produced in ordinary CHO cell lines. (PANEL B) Product profile of enzymatic 10 kDa-GlycoPEGylation reaction with EPO-Myc-His6 produced in Mgat2/4a/4b/5 KO CHO cell lines. Profiles A and B were obtained by densitometry measurements on lane 9 and lane 15 in FIG. 33, respectively

    [0135] FIG. 35 Glycoprofiling of EPO expressed in CHO cells with KO of B3gnt2 stacked with KO of Cosmc/Pomgnt1/B4galt7 (this latter triple KO is seen in FIG. 30D) (top panel), double KO of B4galt5 and B4galt6 (second panel), double KO's of Mgat2 and Mgat4B (third panel) and double KO of Mgat2 and Mgat5 (lower panel). Compared to background (see FIG. 30D) KO of B3gnt2 abolishes polyLacNac. KO of B4galt5 and B4galt6 gives more LacNac when comparing with wt EPO (FIG. 31). The two last panels with double KO's of Mgat2/4b or Mgat2/5 both show that monoantennary can be obtained with double KO's so KO of four genes Mgat2/4A/4B/5 is not needed (compare with FIG. 32D).

    [0136] FIG. 36 Glycoprofiling of IgG expressed in CHO cells with KO of Mgat2 (top), double KO of St3Gal4/6 (middle) or KO of B4galt1/3 stacked onto Cosmc/Fut8 (lower panel). The Mgat2 KO results in homogeneous mono antennary structure and higher degree of sialylation than wt IgG (compare with FIG. 22). St3gal4/6 KO gives higher galactosylation (compare with FIG. 22). Double KO of B4galt1 and B4galt3 show more homogenous N-glycans without galactose than obtained with single ko of B4galt1 (compare with FIG. 22, lower panel).

    [0137] The present invention will now be described in more detail in the following.

    DETAILED DESCRIPTION OF THE INVENTION

    [0138] Sugar chains of glycoproteins are roughly divided into two types, namely a sugar chain which binds to asparagine (N-glycoside-linked sugar chain) and a sugar chain which binds to other amino acid such as serine, threonine (O-glycoside-linked sugar chain), based on the binding form to the protein moiety.

    [0139] The sugar chain terminus which binds to asparagine is called a reducing end, and the opposite side is called a non-reducing end. It is known that the N-glycoside-linked sugar chain includes a high mannose type in which mannose alone binds to the non-reducing end of the core structure; a complex type in which the non-reducing end side of the core structure has at least one parallel branches of galactose-N-acetylglucosamine (hereinafter referred to as “Gal-GlcNAc”) and the non-reducing end side of Gal-GlcNAc has a structure of sialic acid, bisecting N-acetylglucosamine or the like; a hybrid type in which the non-reducing end side of the core structure has branches of both of the high mannose type and complex type.

    [0140] In general, most of the humanized antibodies of which application to medicaments is in consideration are prepared using genetic recombination techniques and produced using Chinese hamster ovary tissue-derived CHO cell as the host cell. As described above, the sugar chain structure play important roles for the structure, function, size, circulatory half-life, and pharmacokinetic behaviour of glycoprotein drugs. Moreover, the sugar structure plays a remarkably important role in the effector function of antibodies and differences are observed in the sugar chain structure of glycoproteins expressed by host cells, development of a host cell which can be used for the production of an antibody having higher effector function is desired.

    [0141] To support production of a growing number of biopharmaceutical glycoproteins there is a need for development of new mammalian cell lines and preferably CHO derived cell lines with different glycosylation capacities and characteristics.

    [0142] Moreover there is a need to develop design matrices for individual glycosylation pathways involving gene inactivation and/or stable gene introduction that will enable generation of tailored mammalian cell lines with different and more homogenous glycosylation capacities and characteristics.

    [0143] Further there is a need to develop mammalian cell lines and preferably CHO derived cell lines with inactivation of two or more glycosyltransferase genes that can produce recombinant glycoproteins with different glycosylation than their natural counterpart. More particularly there is a need to develop such cell lines with inactivation of two or more glycosyltransferase genes encoding isoenzymes with related functions in the same glycosylation pathway being for example the N-glycosylation pathway. Further, there is a need to develop such cell lines with inactivation of two or more glycosyltransferase genes encoding enzymes with unrelated functions in the same glycosylation pathway.

    [0144] Further there is a need to introduce one or more glycosyltransferases into cell lines and preferably CHO derived cell lines to obtain desirable glycosylation capacities including homogeneous and novel capacities. Such introduction of glycosyltransferase(s) may be combined with inactivation of one or more of the endogenous glycosyltransferase genes.

    [0145] An object of the present invention is to provide a modified cell with genetically engineered stable capacity for production of a therapeutic protein, and that produces said protein with glycan chains with defined structures, and/or more homogenous glycan structures, and/or with improved bioactivity.

    [0146] This invention discloses an inactivation and deconstruction screen of glycosyltransferase genes in CHO that provides a design matrix for engineering a cell with a multitude of well-defined glycosylation capacities. Moreover the invention provides reconstruction designs for de novo engineering a multitude of desired and/or novel well-defined glycosylation capacities by combining one or more glycosyltransferase gene inactivation and introduction events in a cell to improve production of recombinant glycoprotein therapeutics.

    [0147] This invention discloses cell lines with inactivation of two or more glycosyltransferase genes and with new glycosylation capacities that enables improvements for recombinant production of protein therapeutics.

    [0148] In one aspect, ZFN targeting designs for inactivation of glycosyltransferase genes are provided.

    [0149] In another aspect, TALEN targeting designs for inactivation of glycosyltransferase genes are provided.

    [0150] In yet another aspect, CRISPR/Cas9 based targeting for inactivation of glycosyltransferase genes are provided.

    [0151] In certain embodiments, the invention provides cell lines with inactivation of two or more glycosyltransferase genes encoding isoenzymes with partially overlapping glycosylation functions in the same glycosylation pathway, and for which inactivation of two or more of these genes is required for loss of said glycosylation functions in the cell.

    [0152] In certain embodiments, the invention provides cell lines with inactivation of two or more glycosyltransferase genes encoding isoenzymes with partially overlapping glycosylation functions in the same glycosylation pathway and biosynthetic step, and for which inactivation of two or more of these genes is required for loss of said glycosylation functions in the cell.

    [0153] In certain embodiments, the invention provides cell lines with inactivation of two or more glycosyltransferase genes encoding isoenzymes with no overlapping glycosylation functions in the same glycosylation pathway, and for which inactivation of two or more of these genes is required for loss of said glycosylation functions in the cell.

    [0154] In another embodiment, the invention provides cell lines with inactivation of two or more glycosyltransferase genes encoding enzymes with unrelated glycosylation functions in the same glycosylation pathway, and for which inactivation of two or more genes is required for abolishing said glycosylation functions in the cell.

    [0155] In another embodiment, the invention provides cell lines with inactivation of two or more glycosyltransferase genes encoding enzymes with unrelated glycosylation functions in different glycosylation pathways, and for which inactivation of two or more genes is required for desirable glycosylation functions in the cell.

    [0156] In another embodiment, the disclosure provides a design matrix to identify which glycosyltransferase gene inactivation(s) that are required for obtaining specific desirable N-glycosylation capacities in a cell line.

    [0157] In another embodiment, the disclosure provides a design matrix for two or more glycosyltransferase gene inactivation(s) required for obtaining specific desirable N-glycosylation capacities in a cell line.

    [0158] In yet another embodiment, this invention provides compositions for partial or complete knockout of glycosyltransferase genes, individually and in relevant combinations that encode enzymes involved in biosynthesis of N-glycans on proteins and are members of homologous subfamilies with potential redundant functions in a cell line. The disclosed compositions provide a design matrix for knockout combinations of glycosyltransferase genes that will generate mammalian cell lines with a variety of well-defined and homogeneous N-glycosylation capacities that are useful for production of recombinant glycoproteins such as antibodies, erythropoietin, and other therapeutic glycoproteins with improved and/or more consistent N-glycosylation.

    [0159] In yet another embodiment, this invention provides a design matrix for one or more glycosyltransferase gene inactivation(s) required for obtaining N-glycosylation capacities in a mammalian cell line that are useful for recombinant production of glycoproteins that can be directly modified enzymatically with galactosyltransferase and/or sialyltransferase enzymes in vitro post production.

    [0160] In yet another embodiment, the disclosure provides a design matrix for single or multiple glycosyltransferase gene inactivations required to obtain specific desirable N-glycosylation capacities that are advantageous for de novo stable introduction of one or more glycosyltransferases and function of these without direct competition from endogenous glycosyltransferase activities in a cell line.

    [0161] In yet another embodiment, the disclosure provides a design matrix for single or multiple glycosyltransferase gene inactivations required to obtain specific desirable N-glycosylation capacities that are advantageous for de novo stable introduction of one or more glycosyltransferases and to induce improved and/or more homogenous glycosylation properties in a cell line.

    [0162] The present inventors have first employed a ZFN-mediated knockout screen in CHO to explore the potential for engineering N-glycosylation of recombinant glycoproteins. Many steps in the N-glycan biosynthetic pathway are potentially catalyzed by multiple isoenzymes, which leave genetic engineering unpredictable (FIG. 1a). Dissection of the in vivo functions of each of these isoenzymes is required to construct a matrix for design options.

    [0163] Thus, an object of the present invention is to provide a cell capable of expressing a gene encoding a polypeptide of interest, wherein the polypeptide of interest is expressed comprising one or more of the posttranslational modification patterns:

    a) eliminated β4-branched tetraantennary N-glycans,
    b) eliminated β6-branched tetraantennary structures,
    c) elimination of L-PHA lectin labelling,
    d) homogenous biantennary N-glycans,
    e) abolished galactosylation on N-glycans,
    f) elimination of poly-LacNAc,
    g) heterogeneous tetraantennary N-glycans without trace of sialylation,
    h) biantennary N-glycans without sialylation,
    i) lack of sialic acid,
    j) uncapped LacNAc termini,
    k) homogenous biantennary N-glycans capped by α2,6NeuAc,
    l) homogenous α2,6NeuAc capping, or
    m) homogenous biantennary N-glycans capped by α2,3NeuAc.

    [0164] One, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, or more of these effect can be combined to generate specific posttranslational modification patterns.

    [0165] The genes involved in this highly complex machinery have been examined by the present inventors (see the examples) and effects have been identified.

    [0166] Thus, in one aspect of the present invention is one or more of the group selected from mgat4A, mgat4B, mgat4C, mgat5, mgat5B, B4galt1, B4galt2, B4galt3, B4galt4, B3gnt1, B3gnt2, B3gnt8, st3gal3, st3gal4, and st3gal6 involved in the posttranslational modification patterns.

    [0167] In another aspect of the present invention are one or more of these genes knocked out (KO) or in (KI).

    [0168] In one aspect of the present invention mgat4A/4B is knocked out in the cell to eliminate β4-branched tetraantennary N-glycans.

    [0169] In another aspect of the present invention mgat5 is knocked out in the cell to eliminate β6-branched tetraantennary structures.

    [0170] In yet another aspect of the present invention mgat5 is knocked out in the cell leading to loss of L-PHA lectin labelling.

    [0171] In a further aspect of the present invention mgat4A, mgat4B and mgat5 are knocked out in the cell leading to homogenous biantennary N-glycans.

    [0172] In another aspect of the present invention B4galt1/3 is knocked out in the cell leading to abolished galactosylation on N-glycans.

    [0173] In a further aspect of the present invention B3gnt2 is knocked out in the cell leading to elimination of poly-LacNAc.

    [0174] In another aspect of the present invention st3gal4 and st4gal6 are knocked out in the cell leading to heterogeneous tetraantennary N-glycans without trace of sialylation.

    [0175] In another aspect of the present invention st3gal4, st3gal6, mgat4A, mgat4B, and mgat5 are knocked out in the cell leading to biantennary N-glycans without sialylation, but increase in poly-LacNAc.

    [0176] In another aspect of the present invention st3gal3, st3gal4, and st3gal6 are knocked out in the cell leading to complete lack of sialic acid.

    [0177] In yet another aspect of the present invention st3gal4 and 6 are knocked out in the cell leading to uncapped LacNAc termini thereby allowing de novo engineering of recombinant glycoproteins with α2,6NeuAc capping.

    [0178] In a further aspect of the present invention are st3gal4, st3gal6, mgat4A, mgat4B, mgat5 knocked out in the cell leading to homogenous biantennary N-glycans capped by α2,6NeuAc.

    [0179] In yet another aspect b4galt1 is knocked out in a cell leading to loss of galactosylation and a homogenous N-glycan on the conserved N-glycan site of IgG when expressed recombinantly.

    [0180] ST6GAL1 introduced (knock in, KI) with KO of st3gal4/6 produces the complete range of N-glycan antennary structures with normal degree of NeuAc capping (FIG. 2a).

    [0181] ST6GAL1 introduced with additional KO of mgat4A/4B/5 produces glycoproteins with homogenous biantennary N-glycans capped by α2,6NeuAc (FIG. 2b).

    [0182] De novo introduction of ST6GAL1 abrogates the minor amounts of poly-LacNAc formed on biantennary structures when sialylation is eliminated (FIG. 2b).

    [0183] Thus, KI of ST6GAL1 can be used in combination with any one or more of the knockouts described herein.

    [0184] In the present context is NeuAc also known as neuraminic acid.

    [0185] Thus, an aspect of the present invention relates to a protein expressed in a cell, wherein the posttranslational modification pattern comprises homogenous biantennary N-glycans with or without α2,3NeuAc capping or with and without α2,6NeuAc capping.

    [0186] Knockout means full or partial impairment of the function of the gene of interest.

    [0187] In one aspect of the present invention is one or more of the above mentioned genes knocked out using zinc finger nucleases ZFN. ZFNs can be used for inactivation of a FUT8 gene or any of the other genes disclosed herein. ZFNs comprise a zinc finger protein (ZFP) and a nuclease (cleavage) domain.

    [0188] In yet another embodiment, this invention provides CHO cell lines with different well-defined N-glycosylation capacities that enable recombinant production of glycoprotein therapeutics with N-glycans comprised of biantennary N-glycans with or without poly-LacNAc, and with or without α2,3NeuAc capping.

    [0189] In yet another embodiment, this invention provides cell lines with different well-defined N-glycosylation capacities that enable recombinant production of glycoprotein therapeutics with N-glycans comprised of either biantennary, triantennary, or tetraantennary N-glycans with or without poly-LacNAc, and with or without α2,6NeuAc capping.

    [0190] In yet another embodiment, this invention provides cell lines that enable production of glycoproteins with homogeneous N-glycans without sialic acid capping, which enables direct enzymatic modification of N-glycans by sialyltransferases in vitro postproduction.

    [0191] In yet another embodiment, this invention provides cell lines that enable production of glycoproteins with homogeneous N-glycans without galactose and sialic acid capping, which enables direct enzymatic modification of N-glycans by galactosyltransferases in vitro postproduction.

    [0192] In yet another embodiment, this invention provides cell lines that enable production of glycoproteins with homogeneous N-glycans of biantennary status without sialic acid capping, which enables direct enzymatic modification of N-glycans by sialyltransferases in vitro postproduction.

    [0193] In yet another embodiment, this invention provides cell lines that enable production of glycoproteins with homogeneous N-glycans of monoantennary status with or without sialic acid capping, which enables direct enzymatic modification of one N-glycan by sialyltransferases in vitro postproduction.

    [0194] In yet another aspect, also provided is an isolated cell comprising any of the proteins and/or polynucleotides as described herein. In certain embodiments, one or more glycosyltransferase genes are inactivated (partially or fully) in the cell. Any of the cells described herein may include additional genes that have been inactivated, for example, using zinc finger nucleases, TALENs and/or CRISPR/Cas9 designed to bind to a target site in the selected gene. In certain embodiments, provided herein are cells or cell lines in which two or more glycosyltransferase genes have been inactivated, and cells or cell lines in which one or more glycosyltransferase genes have been inactivated and one or more glycosyltransferases introduced.

    [0195] In yet another embodiment, this invention provides cell lines with inactivation of undesirable glycosylation pathways for optimized production of glycoproteins with desirable glycosylation features. In certain embodiments inactivation of one or more biosynthetic steps in protein O-glycosylation pathways (O-GalNAc, O-Xyl, O-Man, and glycolipid) are obtained individually or in combination to improve the sugar nucleotide pool available for desirable glycosylation features.

    [0196] In one embodiment, this invention provides a cell with inactivation of the second step in the O-GalNAc glycosylation pathway, and that produces truncated O-GalNAc O-glycans without sialic acid capping and with improved capacity for sialic acid capping of N-glycans.

    [0197] In one embodiment, this invention provides a cell with inactivation of the second step in the O-Xyl glycosylation pathway, and that produces truncated O-Xyl O-glycans without proteoglycan chains and with improved capacity for galactosylation, poly-LacNAc, branching and sialic acid capping of N-glycans.

    [0198] In one embodiment, this invention provides a cell with inactivation of the second step in the O-Man glycosylation pathway, and that produces truncated O-Man O-glycans without sialic acid capping and with improved capacity for galactosylation, poly-LacNAc, branching of N-glycans and sialic acid capping of N-glycans.

    [0199] In one embodiment, this invention provides a cell with inactivation of the second step in the O-Man, O-Xyl and O-GalNAc glycosylation pathways, and that produces truncated O-Man, O-Xyl, and O-GalNAc O-glycans and with improved capacity for galactosylation, poly-LacNAc, branching of N-glycans and/or sialic acid capping of N-glycans.

    [0200] In one embodiment, this invention provides a cell with inactivation mgat2, mgat4A, mgat4B, and mgat5, produce erythropoietin with N-glycans having homogenous monoantennary structures, and are suitable for more homogeneous glycomodification.

    [0201] For example, cell lines as described herein having inactivated mgat2, mgat4A, mgat4B, mgat5, st3gal4 and 6 genes, produce erythropoietin with N-glycans having homogenous monoantennary structures without sialic acid capping, and are suitable for more homogeneous glycomodification.

    [0202] Inactivation of unnecessary glycosyltransferases to improve desirable glycosylation pathways

    [0203] In yet another embodiment, this invention provides cell lines with inactivation of undesirable glycosylation enzymes to enhance capacity and/or fidelity of desirable glycosylation features. In certain embodiments cell lines with activation of one or more sialyltransferases, and/or galactosyltransferases, and/or GlcNAc-transferases, not functioning in a desirable glycosylation pathway such as for example N-glycosylation are provided.

    [0204] In one embodiment, this invention provides a cell with inactivation of a β4galactosyltransferase (β4Gal-T7) with little or no function in the N-glycosylation pathway, and improved capacity for galactosylation, polyLacNAc and sialic acid capping of N-glycans.

    [0205] In one embodiment, this invention provides a cell with inactivation of a sialyltransferase with little or no function in the N-glycosylation pathway, and improved capacity for galactosylation and sialic acid capping of N-glycans.

    [0206] In one embodiment, this invention provides a cell with inactivation of a β3galactosyltransferase (C1GalT1) with little or no function in the N-glycosylation pathway, and improved capacity for galactosylation and sialic acid capping of N-glycans.

    [0207] In one embodiment, this invention provides a cell with inactivation of a β4galactosyltransferase with little or no function in the N-glycosylation pathway, and improved capacity for galactosylation and sialic acid capping of N-glycans.

    [0208] In one embodiment, this invention provides a cell with inactivation of a β2GlcNAc-transferase (POMGnT1) with little or no function in the N-glycosylation pathway, and improved capacity for galactosylation and sialic acid capping of N-glycans.

    [0209] In one embodiment, this invention provides a cell with inactivation of a β3galactosyltransferase (C1GalT1), and/or a β2GlcNAc-transferase (POMGnT1), and/or a β4galactosyltransferase (β4Gal-T7) with little or no function in the N-glycosylation pathway, and improved capacity for galactosylation and sialic acid capping of N-glycans.

    [0210] In one embodiment, this invention provides a cell with inactivation of a β4galactosyltransferase (β4Gal-T4) with little or no function in the N-glycosylation pathway, and improved capacity for galactosylation and sialic acid capping of N-glycans.

    [0211] In addition, methods of using the zinc finger proteins and fusions thereof in methods of inactivating glycosyltransferase genes in a cell or cell line are provided. In certain embodiments, inactivating one or more glycosyltransferase genes results in a cell line, which can produce recombinant proteins at higher levels or in which one or more activities (functions) of the proteins are increased as compared to proteins produced in cells where the gene(s) is not inactivated.

    [0212] Thus, in another aspect, provided herein are methods for inactivating one or more cellular glycosyltransferase genes (e.g., endogenous mgat1, mgat2, mgat3, mgat4A, mgat4B, mgat4C, mgat5, mgat5B, B4galt1, B4galt2, B4galt3, B4galt4, B3gnt1, B3gnt2, B3gnt8, st3gal3, st3gal4, st3gal6, fut8 genes) in a cell, by use of methods comprising genome perturbation, gene-editing and/or gene disruption capability such as nucleic acid vector systems related to Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and components thereof, nucleic acid vector systems encoding fusion proteins comprising zinc finger DNA-binding domains (ZF) and at least one cleavage domain or at least one cleavage half-domain (ZFN) and/or nucleic acid vector systems encoding a first transcription activator-like (TAL) effector endonuclease monomer and a nucleic acid encoding a second cleavage domain or at least one cleavage half-domain (TALEN). Introduction into a cell of either of the above mentioned nucleic acid cleaving agents (CRISPR, TALEN, ZFN) are capable of specifically cleaving a glycosyltransferase gene target site as a result of cellular introduction of: (1) a nucleic acid encoding pair of either ZF or TAL glycosyltransferase gene target binding proteins each fused to said a nucleic acid cleaving moiety, wherein at least one of said ZF or TAL polypeptides is capable of specifically binding to a nucleotide sequence located upstream from said target cleavage site, and the other ZF or TAL protein is capable of specifically binding to a nucleotide sequence located downstream from the target cleavage site, whereby each of the zinc finger proteins are independently bound to and surround the nucleic acid target followed by target nucleic acid disruption by double stranded breakage mediated by the fused endonuclease cleaving moieties, (2) a nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes glycosyltransferase gene target sequence, and b) a second nucleotide sequence encoding a Type-II Cas9 protein, wherein components (a) and (b) are located on same or different vectors of the system, wherein the guide RNA is comprised of a chimeric RNA and includes a guide sequence and a trans-activating cr (tracr) sequence, whereby the guide RNA targets the glycosyltransferase gene target sequence and the Cas9 protein cleaves the glycosyltransferase gene target site.

    [0213] In yet another embodiment, this invention provides cell lines with inactivation of one or more glycosyltransferase genes and with stable introduction of one or more glycosyltransferases to enhance fidelity of desirable glycosylation features and/or introduce improved glycosylation features and/or novel glycosylation features.

    [0214] In certain embodiments cell lines with inactivation of one or more sialyltransferases, and/or galactosyltransferases, and/or glucosyltransferases, and/or GlcNAc-transferases, and/or GalNAc-transferases, and/or xylosyl-transferase, and/or glucuronosyltransferases, mannosyltransferases, and/or fucosyltransferases, and in which one or more glycosyltransferases have been stably introduced are provided.

    [0215] For example, cell lines as described herein having inactivated st3gal4 and 6 genes and in which the human ST6Gal-I sialyltransferase has been introduced, produce erythropoietin with N-glycans homogenous capped by α2,6NeuAc and are more human-like.

    [0216] For example, cell lines as described herein having inactivated mgat4A, mgat4B, mgat5, st3gal4 and 6 genes and in which the human ST6Gal-I sialyltransferase has been introduced, produce erythropoietin with biantennary N-glycans homogenously capped by α2,6NeuAc and are more human-like.

    [0217] For example, cell lines as described herein having inactivated mgat4A, mgat4B, mgat5, st3gal4 and 6 genes and in which the human MGAT4A and ST6Gal-I have been introduced, produce erythropoietin with triantennary N-glycans homogenously capped by α2,6NeuAc and are more human-like.

    [0218] For example, cell lines as described herein having inactivated mgat4A, mgat4B, mgat5, st3gal4 and 6 genes and in which MGAT4A, MGAT5 and ST6Gal-I have been introduced, produce erythropoietin with tetraantennary N-glycans homogenously capped by α2,6NeuAc and are more human-like.

    [0219] There are a number of methods available for introduction of exogenous genes such as glycosyltransferase genes in mammalian cells and selecting stable clonal cell lines that harbor and express the gene of interest. Typically the gene of interest is co-transfected with a selection marker gene that favors cell lines expressing the selection marker under certain defined media culture conditions. The media could contain an inhibitor of the selection marker protein or the media composition could stress cell metabolism and thus require increased expression of the selection marker. The selection marker gene may be present on same plasmid as gene of interest or on another plasmid.

    [0220] In one embodiment, introduction of one or more exogenous glycosyltransferase(s) is performed by plasmid transfection with a plasmid encoding constitutive promotor driven expression of both the glycosyltransferase gene and a selectable antibiotic marker, where the selectable marker could also represent an essential gene not present in the host cell such as GS system (Sigma/Lonza), and/or separate plasmids encoding the constitutive promotor driven glycosyltransferase gene or the selectable marker. For example, plasmids encoding ST6GalNAc-I and Zeocin have been transfected into cells and stable ST6Gal-I expressing lines have been selected based on zeocin resistance

    [0221] In another embodiment, introduction of one or more exogenous glycosyltransferase(s) is performed by site-directed nuclease-mediated insertion.

    [0222] In one embodiment, a method for stably expressing at least one product of an exogenous nucleic acid sequence in a cell by introduction of double stranded breaks at the PPP1R12C or Safe Harbor#1 genomic locus using ZFN nucleic acid cleaving agents and an exogenous nucleic acid sequence that by a homology dependent manner or via compatible flanking ZFN cutting overhangs is inserted into the cleavage site and expressed. Safe Harbor sites are sites in the genome that upon manipulation do not lead to any obvious cellular or phenotypic consequences. In addition to the aforementioned sites, several other sites have been identified such as Safe Harbor#2, CCR5 and Rosa26. Besides ZFN technology, TALEN and CRISPR tools can also provide for integrating exogenous sequences into cell lines or genomes in a precise manner. In doing so it should be should be evaluated; i) to what extend epigenetic silencing and ii) what the desired expression level of the gene of interest should be. In the examples enclosed herein, site-specific integration of human glycosyltransferases e.g. ST6Gal-I, MGAT4A, or MGAT5, using the ObLiGaRe insertion strategy is based on a CMV expression driven insulator flanked vector design.

    [0223] In yet another aspect, the disclosure provides a method of producing a recombinant protein of interest in a host cell, the method comprising the steps of: (a) providing a host cell comprising two or more endogenous glycosyltransferase genes; (b) inactivating the endogenous glycosyltransferase genes of the host cell by any of the methods described herein; and (c) introducing an expression vector comprising a transgene, the transgene comprising a sequence encoding a protein of interest, into the host cell, thereby producing the recombinant protein. In certain embodiments, the protein of interest comprises e.g. erythropoietin or an antibody, e.g., a monoclonal antibody.

    [0224] In yet another aspect, the disclosure provides a method of producing a recombinant protein of interest in a cell, the method comprising the steps of: (a) providing a cell comprising one or more endogenous glycosyltransferase gene; (b) inactivating the endogenous glycosyltransferase gene(s) of the host cell; (c) introducing one or more glycosyltransferase gene(s) in the cell by any of the methods described herein;

    and (d) introducing an expression vector comprising a transgene, the transgene comprising a sequence encoding a protein of interest, into the cell, thereby producing the recombinant protein. In certain embodiments, the protein of interest comprises e.g. erythropoietin or an antibody, e.g., a monoclonal antibody.

    [0225] Another aspect of the disclosure encompasses a method for producing a recombinant protein with a more homogeneous and/or human-like and/or novel and/or functionally beneficial glycosylation pattern. The method comprises expressing the protein in a mammalian cell line deficient in two or more glycosyltransferase genes and/or deficient in one or more glycosyltransferase genes combined with one or more gained glycosyltransferase genes. In one specific embodiment, the cell line is a Chinese hamster ovary (CHO) cell line. In one embodiment, the cell line comprises inactivated chromosomal sequences encoding any endogenous glycosyltransferases. In one embodiment, the inactivated chromosomal sequences encoding any endogenous glycosyltransferases is monoallelic and the cell line produces a reduced amount of said glycosyltransferases. In another embodiment, the inactivated chromosomal sequences encoding encoding any endogenous glycosyltransferases are biallelic, and the cell line produces no measurable said glycosyltransferases. In another embodiment, the recombinant protein has more homogeneous and/or human-like and/or novel and/or functionally beneficial glycosylation pattern. In one embodiment, the recombinant protein has at least one property that is improved relative to a similar recombinant protein produced by a comparable cell line not deficient in said endogenous glycosyltransferases, for example, reduced immunogenicity, increased bioavailability, increased efficacy, increased stability, increased solubility, improved half-life, improved clearance, improved pharmacokinetics, and combinations thereof. The recombinant protein can be any protein, including a therapeutic protein. Exemplary proteins include those selected from but not limited to an antibody, an antibody fragment, a growth factor, a cytokine, a hormone, a lysosomal enzyme, a clotting factor, a gonadotropin and functional fragment or variants thereof.

    [0226] The disclosure may also be used to identify target genes for modification and use this knowledge to glycoengineer an existing mammalian cell line previously transfected with DNA coding for the protein of interest.

    [0227] In any of the cells and methods described herein, the cell or cell line can be a COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NS0, SP2/0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), and PERC6.

    [0228] Cell lines as described herein can also be used to produce other N-glycoproteins including without intend for limitation for example α1-antitrypsin, gonadotropins, lysosomal targeted enzyme proteins (e.g. Glycocerebrosidase, alpha-Galactosidase, alpha-glucosidase, sulfatases, glucuronidase, iduronidase). Known human glycosyltransferase genes are assembled in homologous gene families in the CAZy database and these families are further assigned to different glycosylation pathways in Hansen et al. (Hansen, Lind-Thomsen et al. 2014). TABLE 1 lists all human glycosyltransferase genes in CAZy GT families with NCBI Gene IDs and assignment of confirmed or putative functions in biosynthesis of different mammalian glycoconjugates (N-glycans, O-GalNAc, O-GlcNAc, O-Glc, O-Gal, O-Fuc, O-Xyl, O-Man, C-Man, Glycosphingolipids, Hyaluronan, and GPI anchors). FIG. 1 further graphically depicts confirmed and putative roles of the human CAZy GT families in biosynthesis of different glycoconjugates.

    TABLE-US-00001 TABLE 1 Human GTf genes CAZy Gene Map family.sup.(1) ID.sup.(2) Symbol.sup.(3) Description.sup.(4) location.sup.(5) GT32 53947 A4GALT α1,4-galactosyltransferase 22q13.2 GT32 51146 A4GNT α1,4-N- 3p14.3 acetylglucosaminyltransferase GT6 28 ABO ABO blood group 9q34.2 GT33 56052 ALG1 chitobiosyldiphosphodolichol β- 16p13.3 mannosyltransferase GT59 84920 ALG10 α1,2-glucosyltransferase 12p11.1 GT59 144245 ALG10B α1,2-glucosyltransferase 12q12 GT4 440138 ALG11 α1,2-mannosyltransferase 13q14.2 GT22 79087 ALG12 α1,6-mannosyltransferase 22q13.33 GT1 79868 ALG13 UDP-N- Xq23 acetylglucosaminyltransferase subunit GT1 199857 ALG14 UDP-N- 1p21.3 acetylglucosaminyltransferase subunit GT33 200810 ALG1L chitobiosyldiphosphodolichol β- 3q21.2 mannosyltransferase-like GT33 644974 ALG1L2 chitobiosyldiphosphodolichol β- 3q22.1 mannosyltransferase-like 2 GT4 85365 ALG2 α1,3/1,6-mannosyltransferase 9q22.33 GT58 10195 ALG3 α1,3-mannosyltransferase 3q27.1 GT2 29880 ALG5 dolichyl-phosphate β- 13q13.3 glucosyltransferase GT57 29929 ALG6 α1,3-glucosyltransferase 1p31.3 GT57 79053 ALG8 α1,3-glucosyltransferase 11q14.1 GT22 79796 ALG9 α1,2-mannosyltransferase 11q23 GT31 8706 B3GALNT1 β1,3-N- 3q25 acetylgalactosaminyltransferase 1 GT31 148789 B3GALNT2 β1,3-N- 1q42.3 acetylgalactosaminyltransferase 2 GT31 8708 B3GALT1 UDP-Gal: βGlcNAc β 1,3- 2q24.3 galactosyltransferase, polypeptide 1 GT31 8707 B3GALT2 UDP-Gal: βGlcNAc β1,3- 1q31 galactosyltransferase, polypeptide 2 GT31 8705 B3GALT4 UDP-Gal: βGlcNAc-β1,3- 6p21.3 galactosyltransferase, polypeptide 4 GT31 10317 B3GALT5 UDP-Gal: βGlcNAc-β1,3- 21q22.3 galactosyltransferase, polypeptide 5 GT31 126792 B3GALT6 UDP-Gal: βGal-β31,3- 1p36.33 galactosyltransferase polypeptide 6 GT31 145173 B3GALTL β1,3-galactosyltransferase-like 13q12.3 GT43 27087 B3GAT1 β1,3-glucuronyltransferase 1 11q25 GT43 135152 B3GAT2 β1,3-glucuronyltransferase 2 6q13 GT43 26229 B3GAT3 β1,3-glucuronyltransferase 3 11q12.3 GT49 11041 B3GNT1 UDP-GlcNAc: βGal β1,3-N- 11q13.2 acetylglucosaminyltransferase 1 GT31 10678 B3GNT2 UDP-GlcNAc: βGal β1,3-N- 2p15 acetylglucosaminyltransferase 2 GT31 10331 B3GNT3 UDP-GlcNAc: βGal β1,3-N- 19p13.1 acetylglucosaminyltransferase 3 GT31 79369 B3GNT4 UDP-GlcNAc: βGal β1,3-N- 12q24 acetylglucosaminyltransferase 4 GT31 84002 B3GNT5 UDP-GlcNAc: βGal β1,3-N- 3q28 acetylglucosaminyltransferase 5 GT31 192134 B3GNT6 UDP-GlcNAc: βGal β1,3-N- 11q13.4 acetylglucosaminyltransferase 6 GT31 93010 B3GNT7 UDP-GlcNAc: βGal β1,3-N- 2q37.1 acetylglucosaminyltransferase 7 GT31 374907 B3GNT8 UDP-GlcNAc: βGal β1,3-N- 19q13.2 acetylglucosaminyltransferase 8 GT31 84752 B3GNT9 UDP-GlcNAc: βGal β1,3-N- 16q22.1 acetylglucosaminyltransferase 9 GT2 146712 B3GNTL1 UDP-GlcNAc: βGal β1,3-N- 17q25.3 acetylglucosaminyltransferase- like 1 GT12 2583 B4GALNT1 β1,4-N-acetyl-galactosaminyl 12q13.3 transferase 1 GT12 124872 B4GALNT2 β1,4-N-acetyl-galactosaminyl 17q21.32 transferase 2 GT7 283358 B4GALNT3 β1,4-N-acetyl-galactosaminyl 12p13.33 transferase 3 GT7 338707 B4GALNT4 β1,4-N-acetyl-galactosaminyl 11p15.5 transferase 4 GT7 2683 B4GALT1 UDP-Gal: βGlcNAc β1,4- 9p13 galactosyltransferase, polypeptide 1 GT7 8704 B4GALT2 UDP-Gal: βGlcNAc β1,4- 1p34-p33 galactosyltransferase, polypeptide 2 GT7 8703 B4GALT3 UDP-Gal: βGlcNAc β1,4- 1q21-q23 galactosyltransferase, polypeptide 3 GT7 8702 B4GALT4 UDP-Gal: βGlcNAc β1,4- 3q13.3 galactosyltransferase, polypeptide 4 GT7 9334 B4GALT5 UDP-Gal: βGlcNAc β1,4- 20q13.1- galactosyltransferase, q13.2 polypeptide 5 GT7 9331 B4GALT6 UDP-Gal: βGlcNAc β1,4- 18q11 galactosyltransferase, polypeptide 6 GT7 11285 B4GALT7 xylosylprotein β1,4- 5q35.2- galactosyltransferase, q35.3 polypeptide 7 GT31 56913 C1GALT1 core 1 synthase, 7p21.3 galactosyltransferase 1 GT31 29071 C1GALT1C1 C1GALT1-specific chaperone 1 Xq24 GT25 51148 CERCAM cerebral endothelial cell 9q34.11 adhesion molecule GT7/31 79586 CHPF chondroitin polymerizing factor 2q35 GT7/31 54480 CHPF2 chondroitin polymerizing factor 7q36.1 2 GT7/31 22856 CHSY1 chondroitin sulfate synthase 1 15q26.3 GT7/31 337876 CHSY3 chondroitin sulfate synthase 3 5q23.3 GT25 79709 COLGALT1 collagen β(1- 19p13.11 O)galactosyltransferase 1 GT25 23127 COLGALT2 collagen β(1- 1q25 O)galactosyltransferase 2 GT7 55790 CSGALNACT1 chondroitin sulfate N- 8p21.3 acetylgalactosaminyltransferase 1 GT7 55454 CSGALNACT2 chondroitin sulfate N- 10q11.21 acetylgalactosaminyltransferase 2 GT2 8813 DPM1 dolichyl-phosphate 20q13.13 mannosyltransferase polypeptide 1 GTnc 23333 DPY19L1 dpy-19-like 1 (C. elegans) 7p14.3- p14.2 GTnc 283417 DPY19L2 dpy-19-like 2 (C. elegans) 12q14.2 GTnc 147991 DPY19L3 dpy-19-like 3 (C. elegans) 19q13.11 GTnc 286148 DPY19L4 dpy-19-like 4 (C. elegans) 8q22.1 GT61 285203 EOGT EGF domain-specific O-linked N- 3p14.1 acetylglucosamine transferase GT47/64 2131 EXT1 exostosin glycosyltransferase 1 8q24.11 GT47/64 2132 EXT2 exostosin glycosyltransferase 2 11p12-p11 GT47/64 2134 EXTL1 exostosin-like 1p36.1 glycosyltransferase 1 GT64 2135 EXTL2 exostosin-like 1p21 glycosyltransferase 2 GT47/64 2137 EXTL3 exostosin-like 8p21 glycosyltransferase 3 GTnc 79147 FKRP fukutin related protein 19q13.32 GTnc 2218 FKTN Fukutin 9q31-q33 GT11 2523 FUT1 fucosyltransferase 1, H blood 19q13.3 group GT10 84750 FUT10 fucosyltransferase 10, α1,3 8p12 fucosyltransferase GT10 170384 FUT11 fucosyltransferase 11, α1,3 10q22.2 fucosyltransferase GT11 2524 FUT2 fucosyltransferase 2 secretor 19q13.3 status include GT10 2525 FUT3 fucosyltransferase 3, Lewis 19p13.3 blood group GT10 2526 FUT4 fucosyltransferase 4, α1,3 11q21 fucosyltransferase, myeloid- specific GT10 2527 FUT5 fucosyltransferase 5, α1,3 19p13.3 fucosyltransferase GT10 2528 FUT6 fucosyltransferase 6, α1,3 19p13.3 fucosyltransferase GT10 2529 FUT7 fucosyltransferase 7, α1,3 9q34.3 fucosyltransferase GT23 2530 FUT8 fucosyltransferase 8, α1,6 14q24.3 fucosyltransferase GT10 10690 FUT9 fucosyltransferase 9, α1,3 6q16 fucosyltransferase GT27 2589 GALNT1 polypeptide N- 18q12.1 acetylgalactosaminyltransferase 1 GT27 55568 GALNT10 polypeptide N- 5q33.2 acetylgalactosaminyltransferase 10 GT27 63917 GALNT11 polypeptide N- 7q36.1 acetylgalactosaminyltransferase 11 GT27 79695 GALNT12 polypeptide N- 9q22.33 acetylgalactosaminyltransferase 12 GT27 114805 GALNT13 polypeptide N- 2q24.1 acetylgalactosaminyltransferase 13 GT27 79623 GALNT14 polypeptide N- 2p23.1 acetylgalactosaminyltransferase 14 GT27 117248 GALNT15 polypeptide N- 3p25.1 acetylgalactosaminyltransferase 15 GT27 57452 GALNT16 polypeptide N- 14q24.1 acetylgalactosaminyltransferase 16 GT27 374378 GALNT18 polypeptide N- 11p15.3 acetylgalactosaminyltransferase 18 GT27 2590 GALNT2 polypeptide N- 1q41-q42 acetylgalactosaminyltransferase 2 GT27 2591 GALNT3 polypeptide N- 2q24-q31 acetylgalactosaminyltransferase 3 GT27 8693 GALNT4 polypeptide N- 12q21.33 acetylgalactosaminyltransferase 4 GT27 11227 GALNT5 polypeptide N- 2q24.1 acetylgalactosaminyltransferase 5 GT27 11226 GALNT6 polypeptide N- 12q13 acetylgalactosaminyltransferase 6 GT27 51809 GALNT7 polypeptide N- 4q31.1 acetylgalactosaminyltransferase 7 GT27 26290 GALNT8 polypeptide N- 12p13.3 acetylgalactosaminyltransferase 8 GT27 50614 GALNT9 polypeptide N- 12q24.33 acetylgalactosaminyltransferase 9 GT27 168391 GALNTL5 polypeptide N- 7q36.1 acetylgalactosaminyltransferase- like 5 GT27 442117 GALNTL6 polypeptide N- 4q34.1 acetylgalactosaminyltransferase- like 6 GT6 26301 GBGT1 globoside α1,3-N- 9q34.13- acetylgalactosaminyltransferase q34.3 1 GT14 2650 GCNT1 glucosaminyl (N-acetyl) 9q13 transferase 1, core 2 GT14 2651 GCNT2 glucosaminyl (N-acetyl) 6p24.2 transferase 2, I-branching enzyme GT14 9245 GCNT3 glucosaminyl (N-acetyl) 15q21.3 transferase 3, mucin type GT14 51301 GCNT4 glucosaminyl (N-acetyl) 5q12 transferase 4, core 2 GT14 644378 GCNT6 glucosaminyl (N-acetyl) 6p24.2 transferase 6 GT14 140687 GCNT7 glucosaminyl (N-acetyl) 20q13.2 transferase family member 7 GT6 2681 GGTA1P glycoprotein, α- 9q33.2 galactosyltransferase 1 pseudogene GT4 144423 GLT1D1 glycosyltransferase 1 domain 12q24.33 containing 1 GT6 360203 GLT6D1 glycosyltransferase 6 domain 9q34.3 containing 1 GT8 55830 GLT8D1 glycosyltransferase 8 domain 3p21.1 containing 1 GT8 83468 GLT8D2 glycosyltransferase 8 domain 12q containing 2 GT4 79712 GTDC1 glycosyltransferase-like domain 2q22.3 containing 1 GT8 283464 GXYLT1 glucoside xylosyltransferase 1 12q12 GT8 727936 GXYLT2 glucoside xylosyltransferase 2 3p13 GT8 2992 GYG1 glycogenin 1 3q24- q25.1 GT8 8908 GYG2 glycogenin 2 Xp22.3 GT8/49 120071 GYLTL1B glycosyltransferase-like 1B, 11p11.2 LARGE2 GT3 2997 GYS1 glycogen synthase 1 (muscle) 19q13.3 GT3 2998 GYS2 glycogen synthase 2 (liver) 12p12.2 GT2 3036 HAS1 hyaluronan synthase 1 19q13.4 GT2 3037 HAS2 hyaluronan synthase 2 8q24.12 GT2 3038 HAS3 hyaluronan synthase 3 16q22.1 GT90 79070 KDELC1 KDEL (Lys-Asp-Glu-Leu) 13q33 containing 1 like- glycosyltransferase GT8/49 9215 LARGE β1,3-xylosyltransferase 22q12.3 GT31 3955 LFNG O-fucosylpeptide 3-βN- 7p22.2 acetylglucosaminyltransferase GT31 4242 MFNG O-fucosylpeptide 3-βN- 22q12 acetylglucosaminyltransferase GT13 4245 MGAT1 mannosyl α1,3glycoprotein 5q35 β1,2N- acetylglucosaminyltransferase GT16 4247 MGAT2 mannosyl α1,6glycoprotein β2N- 14q21 acetylglucosaminyltransferase GT17 4248 MGAT3 mannosyl β1,4glycoprotein 22q13.1 β1,4N- acetylglucosaminyltransferase GT54 11320 MGAT4A mannosyl α1,3glycoprotein 2q12 β1,4N- acetylglucosaminyltransferase GT54 11282 MGAT4B mannosyl α1,3glycoprotein 5q35 β1,4N- acetylglucosaminyltransferase GT54 25834 MGAT4C mannosyl α1,3glycoprotein 12q21 β1,4N- acetylglucosaminyltransferase GT18 4249 MGAT5 mannosyl α1,6glycoprotein 2q21.3 β1,6N- acetylglucosaminyltransferase GT18 146664 MGAT5B mannosyl α1,6glycoprotein β- 17q25.2 1,6-N-acetyl- glucosaminyltransferase, isozyme B GT41 8473 OGT O-linked N-acetylglucosamine Xq13 (GlcNAc) transferase GT4 5277 PIGA phosphatidylinositol glycan Xp22.1 anchor biosynthesis, class A GT22 9488 PIGB phosphatidylinositol glycan 15q21.3 anchor biosynthesis, class B GT50 93183 PIGM phosphatidylinositol glycan 1q23.2 anchor biosynthesis, class M GT76 55650 PIGV phosphatidylinositol glycan 1p36.11 anchor biosynthesis, class V GT22 80235 PIGZ phosphatidylinositol glycan 3q29 anchor biosynthesis, class Z GTnc 8985 PLOD3 procollagen-lysine, 2- 7q22 oxoglutarate 5-dioxygenase 3 GT65 23509 POFUT1 O-fucosyltransferase 1 20q11 GT68 23275 POFUT2 O-fucosyltransferase 2 21q22.3 GT90 56983 POGLUT1 O-glucosyltransferase 1 3q13.33 GT13 55624 POMGNT1 O-linked mannose N- 1p34.1 acetylglucosaminyltransferase 1, β1,2 GT61 84892 POMGNT2 O-linked mannose N- 3p22.1 acetylglucosaminyltransferase 2, β1,4 GT39 10585 POMT1 O-mannosyltransferase 1 9q34.1 GT39 29954 POMT2 O-mannosyltransferase 2 14q24 GT35 5834 PYGB phosphorylase, glycogen; brain 20p11.21 GT35 5836 PYGL phosphorylase, glycogen, liver 14q21-q22 GT35 5837 PYGM phosphorylase, glycogen, 11q12- muscle q13.2 GT31 5986 RFNG O-fucosylpeptide 3βN- 17q25 acetylglucosaminyltransferase GT29 6482 ST3GAL1 β-galactoside α-2,3- 8q24.22 sialyltransferase 1 GT29 6483 ST3GAL2 β-galactoside α-2,3- 16q22.1 sialyltransferase 2 GT29 6487 ST3GAL3 β-galactoside α-2,3- 1p34.1 sialyltransferase 3 GT29 6484 ST3GAL4 β-galactoside α-2,3- 11q24.2 sialyltransferase 4 GT29 8869 ST3GAL5 β-galactoside α-2,3- 2p11.2 sialyltransferase 5 GT29 10402 ST3GAL6 β-galactoside α-2,3- 3q12.1 sialyltransferase 6 GT29 6480 ST6GAL1 β-galactosamide α-2,6- 3q27-q28 sialyltranferase 1 GT29 84620 ST6GAL2 β-galactosamide α-2,6- 2q11.2- sialyltranferase 2 q12.1 GT29 55808 ST6GALNAC1 α-N-acetyl-neuraminyl-2,3-β- 17q25.1 galactosyl-1,3-N- acetylgalactosaminide α-2,6- sialyltransferase 1 GT29 10610 ST6GALNAC2 α-N-acetyl-neuraminyl-2,3-β- 17q25.1 galactosyl-1,3)-N- acetylgalactosaminide α-2,6- sialyltransferase 2 GT29 256435 ST6GALNAC3 α-N-acetyl-neuraminyl-2,3-β- 1p31.1 galactosyl-1,3)-N- acetylgalactosaminide α-2,6- sialyltransferase 3 GT29 27090 ST6GALNAC4 α-N-acetyl-neuraminyl-2,3-β- 9q34 galactosyl-1,3-N- acetylgalactosaminide α-2,6- sialyltransferase 4 GT29 81849 ST6GALNAC5 α-N-acetyl-neuraminyl-2,3-β- 1p31.1 galactosyl-1,3-N- acetylgalactosaminide α-2,6- sialyltransferase 5 GT29 30815 ST6GALNAC6 α-N-acetyl-neuraminyl-2,3-β- 9q34.11 galactosyl-1,3-N- acetylgalactosaminide α-2,6- sialyltransferase 6 GT29 6489 ST8SIA1 α-N-acetyl-neuraminide α-2,8- 12p12.1- sialyltransferase 1 p11.2 GT29 8128 ST8SIA2 α-N-acetyl-neuraminide α-2,8- 15q26 sialyltransferase 2 GT29 51046 ST8SIA3 α-N-acetyl-neuraminide α-2,8- 18q21.31 sialyltransferase 3 GT29 7903 ST8SIA4 α-N-acetyl-neuraminide α-2,8- 5q21 sialyltransferase 4 GT29 29906 ST8SIA5 α-N-acetyl-neuraminide α-2,8- 18q21.1 sialyltransferase 5 GT29 338596 ST8SIA6 α-N-acetyl-neuraminide α-2,8- 10p12.33 sialyltransferase 6 GT66 3703 STT3A subunit of the 11q23.3 oligosaccharyltransferase complex (catalytic) GT66 201595 STT3B subunit of the 3p23 oligosaccharyltransferase complex (catalytic) GTnc 10329 TMEM5 transmembrane protein 5 12q14.2 GT21 7357 ST8SIA UDP-glucose ceramide 9q31 glucosyltransferase GT24 56886 UGGT1 UDP-glucose glycoprotein 2q14.3 glucosyltransferase 1 GT24 55757 UGGT2 UDP-glucose glycoprotein 13q32.1 glucosyltransferase 2 GT1 54658 UGT1A1 UDP glucuronosyltransferase 1 2q37 family, polypeptide A1 GT1 54575 UGT1A10 UDP glucuronosyltransferase 1 2q37 family, polypeptide A10 GT1 54659 UGT1A3 UDP glucuronosyltransferase 1 2q37 family, polypeptide A3 GT1 54657 UGT1A4 UDP glucuronosyltransferase 1 2q37 family, polypeptide A4 GT1 54579 UGT1A5 UDP glucuronosyltransferase 1 2q37 family, polypeptide A5 GT1 54578 UGT1A6 UDP glucuronosyltransferase 1 2q37 family, polypeptide A6 GT1 54577 UGT1A7 UDP glucuronosyltransferase 1 2q37 family, polypeptide A7 GT1 54576 UGT1A8 UDP glucuronosyltransferase 1 2q37 family, polypeptide A8 GT1 54600 UGT1A9 UDP glucuronosyltransferase 1 2q37 family, polypeptide A9 GT1 10941 UGT2A1 UDP glucuronosyltransferase 2 4q13 family, polypeptide A1 GT1 79799 UGT2A3 UDP glucuronosyltransferase 2 4q13.2 family, polypeptide A3 GT1 7365 UGT2B10 UDP glucuronosyltransferase 2 4q13.2 family, polypeptide B10 GT1 10720 UGT2B11 UDP glucuronosyltransferase 2 4q13.2 family, polypeptide B11 GT1 7366 UGT2B15 UDP glucuronosyltransferase 2 4q13 family, polypeptide B15 GT1 7367 UGT2B17 UDP glucuronosyltransferase 2 4q13 family, polypeptide B17 GT1 54490 UGT2B28 UDP glucuronosyltransferase 2 4q13.2 family, polypeptide B28 GT1 7363 UGT2B4 UDP glucuronosyltransferase 2 4q13 family, polypeptide B4 GT1 7364 UGT2B7 UDP glucuronosyltransferase 2 4q13 family, polypeptide B7 GT1 133688 UGT3A1 UDP glycosyltransferase 3 5p13.2 family, polypeptide A1 GT1 167127 UGT3A2 UDP glycosyltransferase 3 5p13.2 family, polypeptide A2 GT1 7368 UGT8 UDP glycosyltransferase 8 4q26 GT27 64409 WBSCR17 Williams-Beuren syndrome 7q11.23 chromosome region 17 GT8 152002 XXYLT1 xyloside xylosyltransferase 1 3q29 GT14 64131 XYLT1 xylosyltransferase I 16p12.3 GT14 64132 XYLT2 xylosyltransferase II 17q21.33 .sup.(1)GT classification system (Lombard et al. (2013). Nucl Acid Res 42: D1P: D490-D495) .sup.(2)gene symbol .sup.(3)Gene ID GenBank .sup.(4)Protein name UniProt .sup.(5)Human chromosomal position (hg19)

    [0229] Most of the corresponding orthologous CHO glycosyltransferase genes were previously assigned in connection with the recent sequencing of the CHO genome (Xu, Nagarajan et al. 2011), but some genes were wrongly assigned or missed. The current set of orthologous glycosyltransferase genes in human and CHO are listed in TABLE 2.

    TABLE-US-00002 TABLE 2 Chinese hamster (Cricetulus griseus) GTfs genes CAZy Gene family.sup.(1) Symbol.sup.(2) ID.sup.(3) Description.sup.(4) GT1 Alg13 100754023 UDP-N-acetylglucosaminyltransferase subunit GT1 Alg14 100773644 UDP-N-acetylglucosaminyltransferase subunit GT1 Ugt1a1 100755423 UDP-glucuronosyltransferase 1-6 GT1 Ugt2a1 100762963 UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus GT1 Ugt2a3 100762673 UDP-glucuronosyltransferase 2A3 GT2 Alg5 100769679 ALG5, dolichyl-phosphate β- glucosyltransferase GT2 B3gntl1 100751193 UDP-GlcNAc: βGal β-1,3-N- acetylglucosaminyltransferase-like 1 GT2 Dpm1 100689420 dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit GT2 Has2 100751055 hyaluronan synthase 2 GT2 Has2 100751055 hyaluronan synthase 2 GT2 Has3 100757895 hyaluronan synthase 3 GT3 Gys1 100769788 glycogen synthase 1 (muscle) GT3 Gys2 100770628 glycogen synthase 2 (liver) GT4 Alg11 100771009 α-1,2-mannosyltransferase GT4 Alg2 100768412 α-1,3/1,6-mannosyltransferase GT4 Glt1d1 100761757 glycosyltransferase 1 domain containing 1 GT4 Gtdc1 100752161 glycosyltransferase-like domain containing 1 GT4 Piga 100773712 phosphatidylinositol glycan anchor biosynthesis, class A GT6 Abo 100772592 ABO blood group GT6 Gbgt1 100771256 globoside α-1,3-N- acetylgalactosaminyltransferase 1 GT7 B4galnt3 100756528 β-1,4-N-acetyl-galactosaminyl transferase 3 GT7 B4galnt4 100758404 β-1,4-N-acetyl-galactosaminyl transferase 4 GT7 B4galt1 100689430 UDP-Gal: βGlcNAc β1,4- galactosyltransferase, polypeptide 1 GT7 B4galt2 100689434 UDP-Gal: βGlcNAc β1,4- galactosyltransferase, polypeptide 2 GT7 B4galt3 100689346 UDP-Gal: βGlcNAc β1,4- galactosyltransferase, polypeptide 3 GT7 B4galt4 100689435 UDP-Gal: βGlcNAc β1,4- galactosyltransferase, polypeptide 4 GT7 B4galt5 100689347 UDP-Gal: βGlcNAc β1,4- galactosyltransferase, polypeptide 5 GT7 B4galt6 100689438 UDP-Gal: βGlcNAc β1,4- galactosyltransferase, polypeptide 6 GT7 B4galt7 100769652 xylosylprotein β1,4- galactosyltransferase, polypeptide 7 GT7/GT31 Chpf 100765856 chondroitin polymerizing factor GT7/GT31 Chsy1 100770803 chondroitin sulfate synthase 1 GT7/GT31 Chsy3 100767985 chondroitin sulfate synthase 3 GT7 Csgalnact1 100754969 chondroitin sulfate N- acetylgalactosaminyltransferase 1 GT7 Csgalnact2 100770830 chondroitin sulfate N- acetylgalactosaminyltransferase 2 GT8 Glt8d1 100762757 glycosyltransferase 8 domain containing 1 GT8 Glt8d2 100772458 glycosyltransferase 8 domain containing 2 GT8 Gxylt1 100760543 glucoside xylosyltransferase 1 GT8 Gxylt2 100758512 glucoside xylosyltransferase 2 GT8 Gyg1 100751671 glycogenin 1 GT8/49 Gyltl1b 100750932 glycosyltransferase-like 1B GT8/49 Large 100765249 like-glycosyltransferase GT8 Xxylt1 100760146 xyloside xylosyltransferase 1 GT10 Fut10 100760260 fucosyltransferase 10 (α (1,3) fucosyltransferase) GT10 Fut11 100758336 fucosyltransferase 11 (α (1,3) fucosyltransferase) GT10 Fut4 100754814 fucosyltransferase 4 (α (1,3) fucosyltransferase, myeloid-specific) GT10 Fut6a 100689084 α1,3 fucosyltransferase 6A GT10 Fut6b 100689083 α1,3 fucosyltransferase 6B GT10 Fut7 100772214 α1,3 fucosyltransferase GT10 Fut9 100689036 α1,3 fucosyltransferase GT11 Fut1 100757047 galactoside 2α-L-fucosyltransferase, H blood group GT11 Fut2 100751185 fucosyltransferase 2 GT12 B4galnt1 100764682 β1,4-N-acetyl-galactosaminyl transferase 1 GT12 B4galnt2 100760696 β1,4-N-acetyl-galactosaminyl transferase 2 GT13 Mgat1 100682529 mannosyl (α-1,3-)-glycoprotein β1,2-N- acetylglucosaminyltransferase GT13 Pomgnt1 100772511 protein O-linked mannose N- acetylglucosaminyltransferase 1 (β1,2-) GT14 Gcnt1 100767124 glucosaminyl (N-acetyl) transferase 1, core 2 GT14 Gcnt3 100774815 glucosaminyl (N-acetyl) transferase 3, mucin type GT14 Gcnt4 100757239 glucosaminyl (N-acetyl) transferase 4, core 2 GT14 Gcnt7 100760777 glucosaminyl (N-acetyl) transferase family member 7 GT14 Xylt1 100756878 xylosyltransferase I GT14 Xylt2 100759604 xylosyltransferase II GT16 Mgat2 100753385 mannosyl (α-1,6-)-glycoprotein β-1,2- N-acetylglucosaminyltransferase GT17 Mgat3 100689076 mannosyl (β-1,4-)-glycoprotein β-1,4- N-acetylglucosaminyltransferase GT18 Mgat5 100760162 mannosyl (α-1,6-)-glycoprotein β-1,6- N-acetyl-glucosaminyltransferase GT18 Mgat5b 100771275 mannosyl (α-1,6-)-glycoprotein β-1,6- N-acetyl-glucosaminyltransferase GT21 Ugcg 100689432 UDP-glucose ceramide glucosyltransferase GT22 Alg12 100770096 α-1,6-mannosyltransferase GT22 Alg9 100755062 α-1,2-mannosyltransferase GT22 Pigb 100768002 phosphatidylinositol glycan anchor biosynthesis, class B GT22 Pigz 100750622 phosphatidylinositol glycan anchor biosynthesis, class Z GT23 Fut8 100751648 α1,6 fucosyltransferase) GT24 Uggt1 100773968 UDP-glucose glycoprotein glucosyltransferase 1 GT24 Uggt2 100762273 UDP-glucose glycoprotein glucosyltransferase 2 GT25 Cercam 100765284 cerebral endothelial cell adhesion molecule GT25 Colgalt1 100774081 collagen β(1-O)galactosyltransferase 1 GT25 Colgalt2 100764465 collagen β(1-O)galactosyltransferase 2 GT27 Galnt1 100763868 polypeptide N- acetylgalactosaminyltransferase 1 GT27 Galnt10 100768523 polypeptide N- acetylgalactosaminyltransferase 10 GT27 Galnt11 100758359 polypeptide N- acetylgalactosaminyltransferase 11 GT27 Galnt12 100772146 polypeptide N- acetylgalactosaminyltransferase 12 GT27 Galnt13 100768831 polypeptide N- acetylgalactosaminyltransferase 13 GT27 Galnt14 100759781 polypeptide N- acetylgalactosaminyltransferase 14 GT27 Galnt15 100766936 polypeptide N- acetylgalactosaminyltransferase 15 GT27 Galnt16 100764829 polypeptide N- acetylgalactosaminyltransferase 16 GT27 Galnt18 100767393 polypeptide N- acetylgalactosaminyltransferase 18 GT27 Galnt2 100767525 polypeptide N- acetylgalactosaminyltransferase 2 GT27 Galnt3 100753226 polypeptide N- acetylgalactosaminyltransferase 3 GT27 Galnt4 100765247 polypeptide N- acetylgalactosaminyltransferase 4 GT27 Galnt5 100757219 polypeptide N- acetylgalactosaminyltransferase 5 GT27 Galnt6 100751126 polypeptide N- acetylgalactosaminyltransferase 6 GT27 Galnt6 100751126 polypeptide N- acetylgalactosaminyltransferase 6 GT27 Galnt7 100762043 polypeptide N- acetylgalactosaminyltransferase 7 GT27 Galnt8 100764127 polypeptide N- acetylgalactosaminyltransferase 8 GT27 Galnt9 100773797 polypeptide N- acetylgalactosaminyltransferase 9 GT27 Galntl5 100767659 polypeptide N- acetylgalactosaminyltransferase-like 5 GT27 Galntl6 100761752 polypeptide N- acetylgalactosaminyltransferase-like 6 GT27 Wbscr17 100750837 Williams-Beuren syndrome chromosome region 17 GT29 St3gal1 100754088 β-galactoside α-2,3-sialyltransferase 1 GT29 St3gal1 100754088 β-galactoside α-2,3-sialyltransferase 1 GT29 St3gal2 100767717 β-galactoside α-2,3-sialyltransferase 2 GT29 St3gal2 100767717 β-galactoside α-2,3-sialyltransferase 2 GT29 St3gal3 100689187 β-galactoside α-2,3-sialyltransferase 3 GT29 St3gal4 100689440 β-galactoside α-2,3-sialyltransferase 4 GT29 St3gal5 100754838 β-galactoside α-2,3-sialyltransferase 5 GT29 St3gal6 100771326 β-galactoside α-2,3-sialyltransferase 6 GT29 St6gal1 100689389 β-galactosamide α-2,6-sialyltranferase 1 GT29 St6gal2 100763756 β-galactosamide α-2,6-sialyltranferase 2 GT29 St6galnac1 100763224 α-N-acetylgalactosaminide α-2,6- sialyltransferase 1 GT29 St6galnac3 100762285 (α-N-acetyl-neuraminyl-2,3β-galactosyl- 1,3)-N-acetylgalactosaminide α-2,6- sialyltransferase 3 GT29 St6galnac4 100759065 (α-N-acetyl-neuraminyl-2,3β-galactosyl- 1,3)-N-acetylgalactosaminide α-2,6- sialyltransferase 4 GT29 St6galnac5 100759381 (α-N-acetyl-neuraminyl-2,3β-galactosyl- 1,3)-N-acetylgalactosaminide α-2,6- sialyltransferase 5 GT29 St6galnac6 100757138 (α-N-acetyl-neuraminyl-2,3β-galactosyl- 1,3)-N-acetylgalactosaminide α-2,6- sialyltransferase 6 GT29 St8sia1 100768920 α-N-acetyl-neuraminide α-2,8- sialyltransferase 1 GT29 St8sia2 100759559 α-N-acetyl-neuraminide α-2,8- sialyltransferase 2 GT29 St8sia3 100764454 α-N-acetyl-neuraminide α-2,8- sialyltransferase 3 GT29 St8sia4 100689217 α-N-acetyl-neuraminide α-2,8- sialyltransferase 4 GT29 St8sia5 100750766 α-N-acetyl-neuraminide α-2,8- sialyltransferase 5 GT29 St8sia6 100774188 α-N-acetyl-neuraminide α-2,8- sialyltransferase 6 GT31 B3galnt1 100756438 β-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) GT31 B3galnt2 100768564 β-1,3-N-acetylgalactosaminyltransferase 2 GT31 B3galt1 100761765 UDP-Gal: βGlcNAc β1,3- galactosyltransferase, polypeptide 1 GT31 B3galt2 100766715 UDP-Gal: βGlcNAc β1,3- galactosyltransferase, polypeptide 2 GT31 B3galt4 100751197 UDP-Gal: βGlcNAc β1,3- galactosyltransferase, polypeptide 4 GT31 B3galt5 100755714 UDP-Gal: βGlcNAc β1,3- galactosyltransferase, polypeptide 5 GT31 B3galt6 100767598 UDP-Gal: βGal β1,3- galactosyltransferase polypeptide 6 GT31 B3galtl 100759864 β1,3-galactosyltransferase-like GT31 B3gnt2 100766691 UDP-GlcNAc: βGal β-1,3-N- acetylglucosaminyltransferase 2 GT31 B3gnt3 100773213 UDP-GlcNAc: βGal β-1,3-N- acetylglucosaminyltransferase 3 GT31 B3gnt4 100769077 UDP-GlcNAc: βGal β-1,3-N- acetylglucosaminyltransferase 4 GT31 B3gnt5 100757919 UDP-GlcNAc: βGal β-1, 3-N- acetylglucosaminyltransferase 5 GT31 B3gnt6 100768656 UDP-GlcNAc: βGal β-1,3-N- acetylglucosaminyltransferase 6 GT31 B3gnt7 100760456 UDP-GlcNAc: βGal β-1,3-N- acetylglucosaminyltransferase 7 GT31 B3gnt8 103160327 UDP-GlcNAc: βGal β-1,3-N- acetylglucosaminyltransferase 8 GT31 B3gnt9 103159649 UDP-GlcNAc: βGal β-1,3-N- acetylglucosaminyltransferase 9 GT31 C1galt1 100761169 glycoprotein-N-acetylgalactosamine 3- β-galactosyltransferase, 1 GT31 C1galt1c1 100751243 C1GALT1-specific chaperone 1 GT31 Lfng 100762397 O-fucosylpeptide 3-β-N- acetylglucosaminyltransferase GT31 Mfng 100762875 O-fucosylpeptide 3-β-N- acetylglucosaminyltransferase GT31 Rfng 100771257 O-fucosylpeptide 3-β-N- acetylglucosaminyltransferase GT32 A4galt 100770462 α-1,4-galactosyltransferase GT32 A4gnt 100771969 α-1,4-N-acetylglucosaminyltransferase GT33 Alg1 100773731 chitobiosyldiphosphodolichol β- mannosyltransferase GT35 Pygb 100769186 phosphorylase, glycogen; brain GT35 Pygm 100757350 phosphorylase, glycogen, muscle GT39 Pomt1 100755033 protein-O-mannosyltransferase 1 GT39 Pomt2 100764752 protein-O-mannosyltransferase 2 GT41 Ogt 100768670 O-linked N-acetylglucosamine (GlcNAc) transferase GT43 B3gat1 100750701 β-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) GT43 B3gat2 100756696 β-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) GT43 B3gat3 100689419 β-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) GT47/64 Ext1 100689334 exostosin glycosyltransferase 1 GT47/64 Ext2 100751585 exostosin glycosyltransferase 2 GT47/64 Extl1 100770000 exostosin-like glycosyltransferase 1 GT47/64 Extl3 100751999 exostosin-like glycosyltransferase 3 GT49 B3gnt1 100762253 UDP-GlcNAc: βGal β-1,3-N- acetylglucosaminyltransferase 1 GT50 Pigm 100764842 phosphatidylinositol glycan anchor biosynthesis, class M GT54 Mgat4a 100766200 mannosyl (α-1,3-)-glycoprotein β-1,4- N-acetylglucosaminyltransferase GT54 Mgat4b 100768637 mannosyl (α-1,3-)-glycoprotein β-1,4- N-acetylglucosaminyltransferase GT54 Mgat4c 100760589 mannosyl (α-1,3-)-glycoprotein β-1,4- N-acetylglucosaminyltransferase GT57 Alg6 100753783 α-1,3-glucosyltransferase GT57 Alg8 100766150 α-1,3-glucosyltransferase GT58 Alg3 100772003 α-1,3-mannosyltransferase GT61 Eogt 100757071 EGF domain-specific O-linked N- acetylglucosamine (GlcNAc) transferase GT61 Pomgnt2 100770708 protein O-linked mannose N- acetylglucosaminyltransferase 2 (β1,4-) GT64 Extl2 100761218 exostosin-like glycosyltransferase 2 GT65 Pofut1 100753417 protein O-fucosyltransferase 1 GT66 Stt3a 100751391 subunit of the oligosaccharyltransferase complex (catalytic) GT66 Stt3b 100752084 subunit of the oligosaccharyltransferase complex (catalytic) GT68 Pofut2 100765129 protein O-fucosyltransferase 2 GT90 Kdelc1 100763723 KDEL (Lys-Asp-Glu-Leu) containing 1 GT90 Poglut1 100760325 protein O-glucosyltransferase 1 GTnc Dpy19l1 100765722 dpy-19-like 1 (C. elegans) GTnc Dpy19l2 100752353 dpy-19-like 2 (C. elegans) GTnc Dpy19l3 100756435 dpy-19-like 3 (C. elegans) GTnc Dpy19l4 100759810 dpy-19-like 4 (C. elegans) GTnc Fktn 100761516 fukutin GTnc Plod3 100768993 procollagen-lysine, 2-oxoglutarate 5- dioxygenase 3 GTnc Tmem5 100757873 transmembrane protein 5 — Dpagt1 100689054 dolichyl-phosphate (UDP-N- acetylglucosamine) N- acetylglucosaminephosphotransferase 1 .sup.(1)GT classification system (Lombard et al. (2013). Nucl Acid Res 42: D1P: D490-D495) .sup.(2)gene symbol HGNC .sup.(3)Gene ID GenBank .sup.(4)Protein name UniProt

    [0230] Similarly the transcriptome data for a CHO-K1 clone reported in Xu et al. (Xu, Nagarajan et al. 2011) missed several glycosyltransferase genes. We therefore performed RNA sequencing analysis of a panel of CHO lines including ones with ZFN mediated knockout of glycosyltransferase genes to assess the expression of all glycosyltransferase genes in CHO. TABLE 3 provides a list of the expression levels of all assigned CHO glycosyltransferase genes, and a few qualitative differences in expression levels were found compared to those reported previously (Xu, Nagarajan et al. 2011).

    TABLE-US-00003 TABLE 3 Comparison of GTfs expression levels from RNA_seq data for CHO-GS and CHO-K1 CHO-K1 GTf genes RNA_seq CAZy (hGTfs from CHO- depth (Xu et family Table 1)* GS_FPKM**.sup.(4) al 2011)**.sup.(4) GT1 Alg13 13 na GT1 Alg14 27 55 GT1 Ugt1a1-10.sup.(,21) 63 96 GT1 Ugt2a1.sup.(1) 0 0 GT1 Ugt2a3.sup.(1) 0 na GT1 Ugt2b10.sup.(1) na 0 GT1 Ugt2b11.sup.(1) na na GT1 Ugt2b15.sup.(1) na na GT1 Ugt2b17.sup.(1) na na GT1 Ugt2b28.sup.(1) na 0 GT1 Ugt2b4.sup.(1) na na GT1 Ugt2b7.sup.(1) na na GT1 Ugt3a1.sup.(1) na na GT1 Ugt3a2.sup.(1) na na GT1 Ugt8 na 0 GT2 Alg5 53 71 GT2 B3gntl1 11 na GT2 Dpm1 85 78 GT2 Has1 na na GT2 Has2 0 0 GT2 Has3 0 2 GT3 Gys1 47 na GT3 Gys2 0 na GT4 Alg11 16 20 GT4 Alg2 19 52 GT4 Glt1d1 0 na GT4 Gtdc1 10 na GT4 Piga 8 9 GT6 Abo 0 na GT6 Gbgt1 4 na GT6 Ggta1p na na GT6 Glt6d1 na na GT7 B4galnt3 0 0 GT7 B4galnt4 0 0 GT7 B4galt1 15 36 GT7 B4galt2 38 41 GT7 B4galt3 25 74 GT7 B4galt4 19 28 GT7 B4galt5 14 71 GT7 B4galt6 8 71 GT7 B4galt7 31 169 GT7/31 Chpf 53 332 GT7/31 Chpf2 na 130 GT7/31 Chsy1 26 0 GT7/31 Chys3 na na GT7 Csgalnact1 0 0 GT7 Csgalnact2 9 0 GT8 Glt8d1 20 na GT8 Glt8d2 0 na GT8 Gxylt1 10 na GT8 Gxylt2 0 na GT8 Gyg 72 na GT8 Gyg2 na na GT8/49 Gyltl1b 0 0 GT8/49 Large 14 22 GT8 Xxylt1 70 na GT10 Fut10 0 0 GT10 Fut11 5 0 GT10 Fut4 0 0 GT10 Fut5 na 0 GT10 Fut6a 0 0 GT10 Fut6b 0 0 GT10 Fut7 0 0 GT10 Fut9 0 0 GT11 Fut1 0 0 GT11 Fut2 0 0 GT12 B4galnt1 0 0 GT12 B4galnt2 0 0 GT13 Mgat1 24 61 GT13 Pomgnt1 64 101 GT14 Gcnt1 0 0 GT14 Gcnt2 0 na GT14 Gcnt3 0 0 GT14 Gcnt4 0 0 GT14 Gcnt6 na na GT14 Gcnt7 0 na GT14 Xylt1 0 0 GT14 Xylt2 11 6 GT16 Mgat2 29 138 GT17 Mgat3 0 0 GT18 Mgat5 13 20 GT18 Mgat5b 0 0 GT21 Ugcg 40 na GT22 Alg12 34 69 GT22 Alg9 25 98 GT22 Pigb 24 75 GT22 Pigz 0 na GT23 Fut8 18 166 GT24 Uggt1 27 0 GT24 Uggt2 6 95 GT25 Cercam 7 na GT25 Glt25d1/Colgalt1 129 0 GT25 Glt25d2/Colgalt2 0 0 GT27 Galnt1 39 0 GT27 Galnt10 9 na GT27 Galnt11 32 63 GT27 Galnt12 0 0 GT27 Galnt13 2 0 GT27 Galnt14 0 0 GT27 Galnt15/l2 0 0 GT27 Galnt16/l1 0 0 GT27 Galnt18 0 0 GT27 Galnt19/l3(Wbscr17) 0 63 GT27 Galnt2 60 324 GT27 Galnt3 0 0 GT27 Galnt4 3 na GT27 Galnt5 0 0 GT27 Galnt6 0 0 GT27 Galnt7 30 44 GT27 Galnt8 0 0 GT27 Galnt9 0 0 GT27 Galnt20/l5 0 0 GT27 Galnt17/l6 0 na GT29 StSgal1 54 195 GT29 St3gal2 17 28 GT29 St3gal3 13 75 GT29 St3gal4 44 33 GT29 St3gal5 21 44 GT29 St3gal6 13 29 GT29 St6gal1 0 0 GT29 St6gal2 0 na GT29 St6galnac1 0 0 GT29 St6galnac2 0 0 GT29 St6galnac3 0 0 GT29 St6galnac4 24 67 GT29 St6galnac5 0 0 GT29 St6galnac6 18 25 GT29 St8sia1 0 0 GT29 St8sia2 0 0 GT29 St8sia3 0 0 GT29 St8sia4 3 0 GT29 St8sia5 0 0 GT29 St8sia6 0 0 GT31 B3galnt1 12 37 GT31 B3galnt2 30 0 GT31 B3galt1 1 0 GT31 B3galt2 0 0 GT31 B3galt4 2 16 GT31 B3galt5 0 0 GT31 B3galt6 5 42 GT31 B3galtl 19 na GT31 B3gnt2 42 189 GT31 B3gnt3 0 0 GT31 B3gnt4 0 0 GT31 B3gnt5 0 0 GT31 B3gnt6 0 0 GT31 B3gnt7 0 0 GT31 B3gnt9 na na GT31 B3gntl1 11 0 GT31 C1galt1 15 26 GT31 C1galt1c1 26 120 GT31 Lfng 5 24 GT31 Mfng 0 0 GT31 Rfng 9 158 GT32 A4galt 0 0 GT32 A4gnt 0 0 GT33 Alg1 13 41 GT33 Alg1l na na GT33 Alg1l2 na na GT35 Pygb 61 na GT35 Pygl na na GT35 Pygm 1 na GT39 Pomt1 15 0 GT39 Pomt2 9 0 GT41 Ogt 14 39 GT43 B3gat1 0 0 GT43 B3gat2 0 0 GT43 B3gat3 23 31 GT47/64 Ext1 21 83 GT47/64 Ext2 43 136 GT47/64 Extl1 9 2 GT47/64 Extl3 24 79 GT49 B3gnt1 32 0 GT50 Pigm 6 54 GT54 Mgat4a 0 0 GT54 Mgat4b 37 0 GT54 Mgat4c 0 na GT57 Alg6 19 22 GT57 Alg8 18 22 GT58 Alg3 15 38 GT59 Alg10 na 0 GT59 Alg10b na 0 GT61 Eogt 6 0 GT61 Pomgnt2 10 na GT64 Extl2 31 179 GT65 Pofut1 44 126 GT66 Stt3a 71 0 GT66 Stt3b 85 0 GT68 Pofut2 68 15 GT76 Pigv na na GT90 Kdelc1 26 na GT90 Poglut1 22 na — Dpagt1.sup.(3) 40 59 GTnc Dpy19l1 25 na GTnc Dpy19l2 0 na GTnc Dpy19l3 11 na GTnc Dpy19l4 5 na GTnc Fkrp na na GTnc Fktn 16 na GTnc Plod3 61 na GTnc Tmem5 49 na *a total of 208 hGTfs are reduced to 200 plus Dpagt1 (a non GTf gene) resulting in total 201 genes included in the RNA_seq data comparison **the expression levels are not directly comparable that the CHO-GS data is FRKP and for the CHO-K1 data (Xu et al. 2011) depth of reads are takes as a measure for expression, na denoted genes not analyzed due to missing annotations .sup.(1)the Ugt1a and Ugt2a/b genes are very heterogeneous among primates and rodents, and generally encodes the rodent genomes larger and more heterogeneous set of glucuronyltransferase genes .sup.(2)the Ugt1a1-10 represent one locus with 9 genes, these have been combine into on gene in the RNA_seq data analysis .sup.(3)Dgagt1 is not included in the list of human GTfs .sup.(4)na—not analyzed

    [0231] To explore the functions of individual glycosyltransferase genes putatively involved in N-glycosylation, the present invention employed a ZFN-mediated KO screen in a CHO-GS cell line (Sigma), and also in other cell lines. The present invention designed a KO screen to dissect in vivo functions of all genes encoding isoenzymes with potential to regulate N-glycosylation branching, elongation, and terminal capping expressed in CHO (FIG. 14).

    [0232] The present invention probed the effects of the knockout screen on N-glycosylation capacity by recombinant expression of human erythropoietin (EPO) in CHO mutant cell lines and analysis of glycosylation of purified EPO by release of N-glycans and profiling using MALDI-TOF. EPO was used as reporter for the N-glycosylation capacity because this is one of the best characterized N-glycoproteins produced in CHO having three N-glycans with mainly tetraantennary structure, low level of poly-LacNAc, and α2,3 sialic acid capping (FIG. 15) (Sasaki, Ochi et al. 1988). EPO expressed in the unmodified CHO-GS production line grown in suspension in protein-free medium was glycosylated essentially identical to past reports of EPO produced in CHO-K1 (FIG. 15). Moreover, the glycosylation profile was essentially identical to therapeutic products of EPO produced in CHO and claimed for in drug filings (Sasaki, Bothner et al. 1987).

    [0233] The present invention used ZFNs, TALENs and CRISPR/Cas9 to target and knockout 19 glycosyltransferase genes (FIG. 14A) involved in N-glycan branching (Mgat1/2/3/4A/4B/4C/5/5B) (FIG. 5, FIG. 21B), galactosylation (B4galt1/2/3/4 (FIG. 17), poly-LacNAc elongation (B3gnt1/2/8) (FIG. 18), terminal capping by sialylation (st3gal3/4/6) (FIG. 19), and core fucosylation (fut8) (FIG. 22).

    [0234] N-glycan antennary status—The biosynthetic control of the N-glycan antennary status was explored first. MGAT1 and 2 each control formation of one of the two β2 branches in biantennary N-glycans, while potential partial functional redundancy is predicted for tri- and tetraantennary branch formation by MGAT4A/4B/4C (β4-branch) and MGAT5/5B (β6-branch), respectively. Only MGAT4B and 5 were found to be substantially expressed in CHO as evaluated by RNAseq results (TABLE 3), however, surprisingly, targeting the Mgat4a gene had a clear effect although minor, and only targeting both Mgat4a/4b completely eliminated β4-branched tetraantennary N-glycans (FIG. 16A-B).

    [0235] Targeting Mgat5 in contrast eliminated L-PHA lectin labeling of cells (FIG. 20) and β6-branched tetraantennary structures (FIG. 5), which is in agreement with studies of the Lec4 mutant (Patnaik and Stanley 2006; North, Huang et al. 2010). Moreover, stacking KO of Mgat4a/4b/5 produced almost homogenous biantennary N-glycans with a minor amount of poly-LacNAc (FIG. 16B), which is also found as a minor component in wildtype (WT) cells (North, Huang et al. 2010).

    [0236] Control of LacNAc—CHO cells express all seven known β4galactosyltransferases (TABLE 3), and our understanding of the in vivo functions of these isoenzymes is poor. Only B4galt1-4 are expected to serve functions in N-glycosylation and they have been suggested to have preferences for different N-glycan branches. The current invention first screened individual KO of B4galt1-4 in CHO-GS WT, and confirmed that B4galt1 appeared to have the major role in LacNAc formation using EPO as reporter molecule (FIG. 17). Thus, the invention could only assess contributions of the other isoforms in stacked combinations with KO of B4galt1. Probing stacked combinations by immunocytology with an antibody to LacNAc show surprisingly that only stacked KO of B4galt1/3, and not B4galt1/2/4, appeared to abolish galactosylation (FIG. 10). In agreement with this the invention found that EPO expressed in B4galt1/3 but not B4galt1/2 stacked KO clones had substantial reduction (>90%) in galactosylation (FIG. 17).

    [0237] The invention further tested stacked KO of individual B4galt's in CHO-GS Mgat4a/4b/5 KO cell lines with homogeneous biantennary N-glycans, and found that KO of B4galt1 eliminated immunoreactivity for LacNAc while KO of B4galt2, 3, and 4 had no substantial effects (FIG. 21A-B). This suggested that the B4galt1 encoded galactosyltransferase isoform is the major or only isoenzyme capable of transferring Gal to biantennary N-glycans, while the other isoforms also function with tri- and tetraantennary N-glycans. To further test this the invention included a human therapeutic IgG as a recombinant expressed reporter molecule (FIG. 22). Human IgGs most often only has one N-glycan in the conserved region at Asn297, and this site is generally only glycosylated with biantennary N-glycans with variable and heterogeneous degrees of galactosylation and sialylation. Some IgG molecules have additional N-glycan sites in the variable regions and these are usually glycosylated with more complex tri and tetraantennary N-glycans structures with efficient galactosylation and capping by sialic acids. Importantly, recombinant expression of an IgG in CHO-GS with KO of B4galt1 resulted in homogenous biantennary N-glycans without galactosylation (FIG. 22). Since CHO only produces IgG with biantennary structures normally, it follows that only knockout of B4galt1 is required to achieve this. This demonstrates that the inherent heterogeneity found in N-glycosylation on therapeutic monoclonal antibodies can be eliminated by use of this modified CHO cell line.

    [0238] Since CHO produce a high degree of α6Fuc on N-glycans and elimination of this glycosylation can be achieved by knockout of FUT8, it is clear that the combinations of knockout of Mgat4a/4b/5, B4galt1, and Fut8 as well as stacked KO of B4galt1 and Fut8, will generate CHO clones producing homogenous N-glycans without α6Fuc. Such production cell lines will be important for producing therapeutic IgG antibodies with enhanced ADCC.

    [0239] Control of poly-LacNAc—Poly-LacNAc on N-glycans has consistently been found to be incomplete and heterogeneous (Fukuda, Sasaki et al. 1989; Takeuchi, Inoue et al. 1989; North, Huang et al. 2010). CHO cells generally produce low amounts of poly-LacNAc on N-glycans and mainly on tetraantennary structures on the β6-branch controlled by MGAT5 (North, Huang et al. 2010). Biosynthesis of poly-LacNAc on N-glycans is poorly understood and three genes, B3gnt1, B3gnt2 and B3gnt8, are candidates (Narimatsu 2006). Using single gene KO of B3gnt1, B3gnt2, and B3gnt8 with LEL lectin immunocytology the current invention identified B3gnt2 as the key gene controlling the LacNAc initiation in CHO cells (FIG. 23), and EPO expressed in CHO with KO of B3gnt2 but not B3gnt1 were devoid of poly-LacNAc (FIG. 18). Moreover, KO of B3gnt2 in CHO with additional KO of Mgat4a/4b/5 resulted in EPO with homogenous biantennary N-glycans without poly-LacNAc (FIG. 18). It was surprising that B3GNT1 did not play a role as the gene was originally identified by expression cloning as the poly-LacNAc synthase (Sasaki, Kurata-Miura et al. 1997), although this gene was later shown to also function in O-mannosylation (Bao, Kobayashi et al. 2009). Surprisingly, KO of B3gnt8 did not weaken the LEL Lectin immunocytology. B3gnt8 was previously shown to form heterodimer in vitro with B3gnt2 and activate the enzyme activity of B3gnt2.

    [0240] Control of sialylation—CHO produce exclusively α2,3 linked NeuAc capping of N-glycans (Watson, Bhide et al. 1994). A few reports have suggested the presence of minor amounts of α2,6NeuAc as well as NeuGc, and genes for synthesis of both the α2,6linkage and CMP-NeuGc are found in CHO but these are not normally expressed (TABLE 3). Nevertheless, either or both genes may be inactivated by the current invention and in previous reports (US patent US20130004992). All six known st3gal1-6 sialyltransferases are expressed in CHO cells (TABLE 3) and the roles of each of these in sialylation of N-glycans are poorly understood (Tsuji, Datta et al. 1996). The sialyltransferase genes st3gal3, st3gal4, and st3gal6 were first targeted individually using immunocytology to evaluate exposure of LacNAc, and it was found that only KO of st3gal4 produced substantial exposure of LacNAc (FIG. 24). Analysis of EPO expressed in single and stacked KO clones showed that loss of st3gal4 and 6 produced substantial exposure. In CHO WT KO of st3gal4/6 resulted in EPO with heterogeneous tetraantennary N-glycans without sialylation (FIG. 19).

    [0241] Using the current invention it was shown KO of St3gal4/6 in combination with Mgat4a/4b/5 interestingly produced biantennary N-glycans without sialylation but increase in poly-LacNAc (FIG. 25). Thus, CHO with st3gal4/6 KO can produce EPO with uncapped LacNAc termini and this opens for the first time for de novo engineering of recombinant glycoproteins with α2,6NeuAc capping without competition by endogenous α2,3sialylation (El Mai, Donadio-Andrei et al. 2013).

    [0242] Monoantennary N-glycans—Using the current invention we also probed the effect of mgat2 KO alone and in combination with Mgat4a/4b/5 and st3gal4/6 (FIG. 32). KO of mgat2 alone produced a mixture of mono and biantennary N-glycan structures, and in further combination with Mgat4a/4b/5 homogeneous monoantennary N-glycans. To confirm that the monoantennary N-glycan was linked β1-2 to the α1-3Man branch controlled by mgat1, we reintroduced by knockin human MGAT4A as well as MGAT4A and 5 in combination together with ST6Gal-I, which resulted in tri and tetraantennary N-glycans, respectively (FIG. 32).

    Reconstruction of Homogeneous Glycosylation

    [0243] The present invention further provides strategies to develop mammalian cell lines with defined and/or more homogenous glycosylation capacities that serves as template for de novo engineering of desirable glycosylation capacities by introduction of one or more glycosyltransferases using site-directed gene insertions and/or classical random transfection of cDNA and/or genomic constructs. The strategy involves inactivating glycosyltransferase genes to obtain a homogenous glycosylation capacity in a particular desirable type of glycosylation, for example using the deconstruction matrix developed herein for N-glycosylation, and for example but not limited to inactivation of the St3gal4 and 6 sialyltransferase genes in a cell and obtaining a cell without sialic acid capping of N-glycans. In such a cell the de novo introduction of one or more new glycosylation capacities that utilize the more homogenous truncated glycan product obtained by one or more glycosyltransferase gene inactivation events, will provide for non-competitive glycosylation and more homogeneous glycosylation by the de novo introduced glycosyltransferases. For example but not limited to introduction of a α2,6sialyltransferase such as ST6GAL1 into a mammalian cell with inactivated St3gal4 and St3gal6 sialyltransferase genes. The general principle of the strategy is to simplify glycosylation of a particular pathway, e.g. N-glycosylation, to a point with reasonable homogeneous glycan structures being produced in the mammalian cell in which one or more glycosyltransferase gene inactivation events has been introduced in a deconstruction process as provided in the present invention for N-glycosylation. Taking such mammalian cell with deconstructed and simplified glycosylation capacity, and introduce de novo desirable glycosylation capacities that build on the glycan structures produced by the deconstruction.

    Reconstruction of N-Glycan Sialylation by Targeted Knockin—De Novo Design of α2,6NeuAc Capping

    [0244] Most glycoproteins in circulation in man are capped with α2,6NeuAc (El Mai, Donadio-Andrei et al. 2013), while essentially all recombinant therapeutics are produced with α2,3NeuAc in CHO, HEK293 and other current production cell lines. It is therefore clearly desirable to obtain mammalian cell lines like CHO with capacity for production of more human-like glycoproteins with homogeneous α2,6NeuAc capping. A number of research groups have approached this and attempted to produce stable CHO cells capable of producing homogenous N-glycans with α2,6NeuAc capping without success (El Mai, Donadio-Andrei et al. 2013).

    [0245] To demonstrate the perspectives for reconstruction and de novo glycoengineering enabled by our KO deconstruction screen, CHO clones capable of producing homogenous α2,6NeuAc capping were generated (FIG. 25). To circumvent past problems with random plasmid integration (El Mai, Donadio-Andrei et al. 2013), ZFN targeted knockin (KI) of ST6GAL1 with a modified ObLiGaRe strategy into a SafeHarbor integration site was used (Maresca, Lin et al. 2013). This strategy also does not involve or need antibiotic selection or maintenance for cloning and stability, which is important for potential in production of recombinant therapeutics for clinical use. Human ST6GAL1 introduced in CHO with KO of St3gal4/6 produced the complete range of N-glycan antennary structures with normal degree of NeuAc capping (FIG. 25), and when introduced in CHO with additional KO of Mgat4a/4b/5, EPO was produced with homogenous biantennary N-glycans capped by α2,6NeuAc (FIG. 25). That the introduced sialylation was indeed α2,6-linked NeuAc and not α2,3-linked was confirmed by negative ion ESI-MS/MS as described in FIG. 15.

    [0246] Surprisingly, de novo introduction of ST6Gal-I abrogated the minor amounts of poly-LacNAc formed on biantennary structures in CHO with KO of Mgat4a/4b/5 (FIG. 25). Knockout of B3gnt2 was required to eliminate poly-LacNAc in CHO WT and in CHO with KO of Mgat4a/4b/5 (FIG. 18). This example clearly demonstrates the intricate interplay between glycosyltransferases using the same acceptor substrate, and how different glycosylation reactions may out compete each other in unpredictable ways. Thus, it is possible to introduce capacity for α2,6NeuAc sialylation without competing α2,3sialylation, and to reconstruct a CHO cell capable of producing sialylated N-glycoproteins with homogeneous α2,6NeuAc capping either with the normal repertoire of N-glycan branching or with homogeneous biantennary N-glycans.

    Construction of Monoantennary N-Glycans Suitable for Homogeneous Enzymatic Glycomodification

    [0247] Enzymatic glycopegylation and other modifications of proteins is a well-established method for site-specific attachments of poly-ethylene glycol (PEG) chains or other compounds to prolong half-life of drugs (DeFrees, Wang et al. 2006). Site-specific glycomodification of N-glycans using an α2,3-sialyltransferase to introduce the modification through a modified CMP-NeuAc substrate relies on i) a purified recombinant expressed glycoprotein with one or more N-glycans; ii) removal of sialic acids capping the N-glycans on the glycoprotein using a recombinant neuraminidase; and iii) transfer of the modified sialic acid to exposed galactose residues on the N-glycans using a recombinant sialyltransferase and the modified donor substrate. N-glycans on recombinant glycoproteins have varying degree of bi, tri and tetra antennary structures and desialylation of recombinant glycoproteins expose multiple galactose residues from each antennary structure, which results in substantial heterogeneity in the enzymatic glycomodification process. To overcome the desialylation step we produced a number of CHO engineering designs that produce N-glycans without sialic acid capping (FIGS. 19, 25, and 32), and these would enable direct enzymatic glycomodification without pretreatment with neuraminidase to remove sialic acids. To overcome the heterogeneity induced by multiple exposed galactose acceptor sites for enzymatic transfer on each multiantennary N-glycan we targeted mgat2 to block formation of biantennary structures, but KO of mgat2 alone did not as originally expected generate homogeneous monoantennary structures (FIG. 32). Instead about 50% was still biantennary, but combined with KO of mgat4A/4B/5 rather homogeneous monoantennary structures were obtained. The only detectable heterogeneity was associated with poly-LacNAc, which does not provide exposure of multiple galactose residues (FIG. 18).

    [0248] Rather homogeneous mono-antennary structure may also be accomplished by the following double KO's: KO of Mgat2/4B or KO of Mgat2/5. (FIG. 35).

    [0249] For IgG antibody a homogeneous mono antennary structure and higher degree of sialylation may be obtained by KO of Mgat2 (FIG. 36).

    Knockout of Unnecessary Glycosylation Pathways

    [0250] The methods of the invention allowed investigating if inactivation of different O-glycosylation pathways would affect cell viability and glycosylation efficiencies of non-targeted glycosylation pathways. We first abrogated the Core1 elongation pathway of O-GalNAc glycosylation as described previously (Yang, Halim et al. 2014) by inactivation of the Cosmc chaperone for the core1 synthase, C1Gal-T1, which leads to CHO cells capable of producing EPO with truncated O-GalNAc glycosylation limited to a single GalNAc residue without sialylation at the single O-glycosite. CHO WT produces O-glycans with both α2,3 and α2,6 sialic acid capping and O-GalNAc glycosylation is one of the most abundant type of protein glycosylation in a cell, and hence demanding on the sugar nucleotide pool. In line with this we found that EPO produced in CHO with inactivation of Cosmc and O-glycan elongation, produced EPO with improved sialic acid capping of N-glycans at all three N-glycosites present in EPO (FIG. 29)

    [0251] Applying methods of current invention the elongation pathway of O-Man glycosylation was targeted by inactivation of Pomgnt1, which encodes the β2GlcNAc-transferase synthesizing the major elongation pathway of O-Man glycans (ref PNAS). Proteins like dystroglycan expressed in mammalian cells, including CHO (Yang, Halim et al. 2014), have dense coverage of the O-Man tetrasaccharide (NeuAcα2,3Galβ1,4GlcNAcβ1,2Manα). When EPO was expressed in a CHO cell with inactivation of Pomgnt1 the degree of galactose, polyLacNac and sialic acid capping was enhanced (FIG. 30).

    [0252] The current invention was applied to inactivate the elongation pathway of O-Xyl glycosylation by KO of B4galt7, which encodes the β4Galactosyltransferase synthesizing the second step in the linker region required for proteoglycan biosynthesis (Almeida, Levery et al. 1999). CHO cells produce proteoglycans and have efficient capacities for producing these on e.g. exogenously supplied saccharides. When EPO was expressed in a CHO cell with inactivation of B4galt7 the degree of galactose, poly-LacNac and sialic acid capping was enhanced (FIG. 30)

    [0253] Current invention was also used to inactivate combinations of two or three genes controlling O-GalNAc, O-Man, and O-Xyl glycosylation pathways. Specifically CHO cells were generated with inactivation of both B4galt7 and Pomgnt1, and with inactivation of B4galt7, Pomgnt1, and Cosmc. When EPO was expressed in such CHO cell lines with inactivation of two or three types of O-glycosylation pathways the degree of galactose and sialic acid capping was enhanced.

    [0254] These results clearly demonstrate that the capacity for more homogeneous glycosylation of recombinant expressed proteins in mammalian cells such as CHO can be improved by inactivation of unnecessary glycosylation pathways that utilize the common sugar nucleotide donor pools and other parts of the general cells metabolic and glycosylation capacities. It is known to the skilled in the art that inactivation of other genes listed in TABLES 1 and 2 in the above glycosylation pathways or other glycosylation pathways will have similar effects and may be desirable engineering events alone or in combination with any of the genetic engineering performed herein or conceivable from the glycosylation pathways outlined in FIG. 13.

    [0255] The general principle for selection of optimal inactivation strategies with the aim to direct use of sugar nucleotides in a mammalian host cell for glycosylation pathways that are relevant for recombinant production of a given glycoprotein, is to block non-relevant glycosylation pathways at an early step in the biosynthetic pathway where a single gene inactivation results in truncated glycan structures preferably without elongation and capping by sialic acid, and/or galactose, and/or GlcNAc. Examples are provided for inactivation of three distinct types of O-glycosylation by targeting the second step in their biosynthesis to avoid and/or limit use of CMP-NeuAc, UDP-Gal and UDP-GlcNAc for elongation of these pathways. It is evident that many other genes listed in Table 2 with assigned biosynthetic steps for the different glycosylation pathways in the mammalian CHO cell, may be targeted by inactivation to achieve the same or similar effects on the use of donor sugar nucleotides with consideration of the effects the inactivation has on the glycosylation pathway and the altered glycan structures.

    Knockout of Unnecessary Glycosyltransferases

    [0256] ER-Golgi resident glycosyltransferases are retained to function in the secretory pathway by a variety of partly known functions including kin-recognition, type and length of transmembrane region, interactions through the stem region (Colley 1997), and through COP-I vesicle retrograde transport presumably dependent on the cytosolic tails and TMs of the glycosyltransferase proteins by e.g. GOLPH3 (Eckert, Reckmann et al. 2014). When glycosyltransferases are not retained in their natural position in the secretory pathway, they may function different and adversely in glycosylation, and when glycosyltransferases loose their retention, e.g. by proteolytic cleavage in the stem region they become secreted and released with little or no influence left on the glycosylation processes in cells. With the many glycosyltransferases expressed in any given mammalian cell, and e.g. at least over 60 in CHO cells (TABLE 3), we hypothesized that there would be common mechanisms of retention of groups and/or classes of enzymes. A group or class of enzymes could be constituted without intention of limitations e.g. enzymes working in the same pathway, and/or in consecutive biosynthetic steps, and/or enzymes retained in the same subcellular topology, and/or enzymes having similar amino acid sequence and/or structural retention signals. The latter could without intention of limitations e.g. be found in homologous isoenzymes given that they have similar sequences, related catalytic properties, and at least in some cases have been shown to have similar subcellular topologies (Rottger, White et al. 1998). One such group of isoenzymes is the β4galactosyltransferases of which especially B4GAL-T1, T2, T3 and T4 have the highest degree of sequence similarity and related functions (Amado, Almeida et al. 1999; Togayachi, Sato et al. 2006). The understanding of the in vivo functions of these four enzymes is poor and all have been shown to produce the Galβ1-4GlcNAc linkage in vitro. As shown herein β4Galt1 and 3 appear to be the main β4galactosyltransferases involved in N-glycosylation, and previous studies have demonstrated that B4GALT4 primarily has roles in glycolipid biosynthesis and/or in sulfated glycans (Schwientek, Almeida et al. 1998). We therefore generated CHO cells with inactivation of B4galt4 in CHO WT as well as combined with inactivation of mgat4a/4b/5. Expression of EPO in CHO cells with inactivation of B4galt4 alone resulted in increased tetraantennary N-glycans with more complete sialic acid capping (FIG. 17). KO of B3gnt2 resulted in EPO glycostructures without poly LacNac (FIG. 35) whereas KO of B4galt5/6 gave more polyLacNac (FIG. 35). Along these lines IgG produced in CHO cells in which St3gal4/6 has been knocked out have higher galactosylation (FIG. 36). These results clearly demonstrate that the capacity for more homogeneous glycosylation of recombinant expressed proteins in mammalian cells such as CHO can be improved by inactivation of unnecessary glycosyltransferases that may compete for mechanisms directing ER-Golgi residence and/or utilize the common sugar nucleotide donor pools and other parts of the general metabolic and glycosylation capacities in a mammalian cell.

    [0257] These results clearly demonstrate that the capacity for more homogeneous glycosylation of recombinant expressed proteins in mammalian cells such as CHO can be improved by inactivation of unnecessary glycosylation pathways that utilize the common sugar nucleotide donor pools and other parts of the general cells metabolic and glycosylation capacities. It is known to the skilled in the art that inactivation of other genes listed in TABLES 1 and 2 in the above glycosylation pathways or other glycosylation pathways will have similar effects and may be desirable engineering events alone or in combination with any of the genetic engineering performed herein or conceivable from the glycosylation pathways outlined in FIG. 13.

    Knockout of Posttranslational N-Glycosylation Capacity

    [0258] The oligosaccharyltransferase complex initiating N-glycosylation of proteins consists of eight proteins of which one subunit involves two paralogous genes, STT3A and STT3B. Studies have suggested that an oligosaccharyltransferase complex containing the STT3A subunit primarily function in co-translational N-glycosylation, while an oligosaccharyltransferase complex containing the STT3B subunit primarily function in post-translational N-glycosylation. We hypothesized that the fidelity and stoichiometry of co-translational N-glycosylation naturally is better than that of post-translational N-glycosylation. Many recombinantly expressed glycoproteins have N-glycosites that are poorly utilized resulting in incomplete N-glycan occupancy (stoichiometry) and/or N-glycan processing (structure). We therefore next generated CHO cells with inactivation of Stt3b as well as CHO cells with combined inactivation of the Mgat4A/4B/5 genes. These CHO cells have improved capacity for producing homogenous glycoproteins with higher degree of N-glycan stoichiometry and/or glycan structures when proteins with naturally poorly utilized N-glycosites are expressed.

    Knockout Targeting Strategy

    [0259] It is clear to the known in the art that inactivation of a glycosyltransferase gene can have a multitude of outcomes and effects on the transcript and/or protein product translated from this. Targeted inactivation experiments performed herein involved PCR and sequencing of the introduced alterations in the genes as well as RNAseq analysis of clones to determine whether a transcript was formed and if potential novel splice variations introduced new protein structures. Moreover, methods for determining presence of protein from such transcripts are available and include mass spectrometry and SDS-PAGE Western blot analysis with relevant antibodies detecting the most N-terminal region of the protein products.

    [0260] The targeting constructs were generally designed to target the first 1/3 of the open reading frame (ORF) of the coding regions but other regions were targeted as well FIG. 14B. For most clones selected, out of frame mutations (Indels) that introduced stop or non-sense codons with the same exon were selected. This would be expected to produce truncated proteins if any protein at all and without the catalytic domain and hence enzymatic activity. The majority of KO clones exhibited insertions and/or deletions (indels) in the range of ±20 bps, and most targeted genes were present with two alleles, while some (mgat4B and mgat5) were present with 1 or 3 alleles, respectively (TABLE 4). In a few cases larger deletions were found and these disrupted one or more exons and exon/intron boundaries also resulting in truncated proteins.

    [0261] Most ER-Golgi glycosyltransferases share the common type 2 transmembrane structure with a short cytosolic tail that may direct retrograde trafficking and residence time, a non-cleaved signal peptide containing a hydrophobic transmembrane α-helix domain for retention in the ER-Golgi membrane, a variable length stem or stalk region believed to displace the catalytic domain into the lumen of the ER-Golgi, and a C-terminal catalytic domain required for enzymatic function (Colley 1997). Only polypeptide GalNAc-transferases have an additional C-terminal lectin domain (Bennett, Mandel et al. 2012). The genomic organization of glycosyltransferase genes varies substantially with some genes having a single coding exon and others more than 10-15 coding exons, although few glycosyltransferase genes produce different splice variants encoding different protein products.

    [0262] Inactivation of glycosyltransferase genes in the early coding regions may thus have a multitude of effects on transcript and protein products if these are made: i) one or more transcripts may be unstable and rapidly degraded resulting in little or no transcript and/or protein; ii) one or more transcripts may be stable but not or only poorly translated resulting in little or no protein translation; iii) one or more transcripts may be stable and translated resulting in protein translation; iv) one or more transcripts may result in protein translation but protein products are degraded due to e.g. truncations and/or misfolding; v) one or more transcripts may result in protein translation and stable protein products that are truncated and enzymatically inactive; and vi) one or more transcripts may result in protein translation and stable protein products that are truncated but have enzymatic activity.

    [0263] It is evident for the skilled in the art that gene inactivation that lead to protein products with enzymatic activity is undesirable, and these event are easily screened for by the methods used in the present invention, e.g. but not limited to lectin/antibody labeling and glycoprofiling of proteins expressed in mutant cell lines.

    [0264] However, it is desirable to eliminate potential truncated protein products that may be expressed from mutated transcripts as these may have undesirable affects on glycosylation capacity. Thus, truncated protein products from type 2 glycosyltransferase genes containing part of or entire part of the cytosolic, and/or the transmembrane retention signal, and/or the stem region, and/or part of the catalytic domain may exert a number of effects on glycosylation in cells. For example, the cytosolic tail may compete for COP-I retrograde trafficking of Golgi resident proteins (Eckert, Reckmann et al. 2014), the transmembrane domain may compete for localization in ER-Golgi and potential normal associations and/or aggregations of proteins, and the stem region as well as part of an inactive catalytic domain may have similar roles or part of roles in normal associations and/or aggregations of proteins in ER-Golgi. Such functions and other unknown ones may affect specific glycosylation pathways that the enzymes are involved in, specific functions of isoenzymes, or more generally glycosylation capacities of a cell. While these functions and effects are unknown and unpredictable today, it is an inherent part of the present invention that selection of mammalian cell clones with inactivated glycosyltransferase genes includes selection of editing events that do not produce truncated protein products.

    [0265] It is evident that the KO deconstruction screen performed identifies the key glycogenes that control decisive steps in N-glycosylation of proteins in CHO and provides a design matrix for genetic deconstruction of N-glycosylation capacity to desirable homogeneous structures that can serve as starting points for resconstruction of improved, novel and/or more homogenous glycosylation capacities by stable introduction of one or more glycosyltransferase genes. FIG. 28 provides general examples of N-glycan scaffolds that can be produced by the deconstruction design matrix, which serves as platforms for reconstruction of desirable more homogenous glycosylation capacities. The value of this strategy of combined deconstruction and reconstruction is clearly exemplified here by the design of CHO cells with capacity for production of EPO with homogeneous biantennary N-glycans with α2,3 and for the first time homogenous α2,6-sialic acid capped N-glycans. These CHO lines complement and clearly extend the milestone efforts performed previously to establish glycoengineered yeast with capacity for production of EPO with homogenous biantennary N-glycans as well as the tour-de-force chemical synthesis of EPO with biantennary N-glycans (Hamilton, Davidson et al. 2006; Wang, Dong et al. 2013). More specifically, the produced CHO lines enable production of EPO and other glycoproteins in a proven mammalian host cell with well-established protein folding and processing capabilities and decades long safety profile for human therapeutics.

    [0266] It is further evident from the KO deconstruction screen performed here that the CHO cell has remarkable plasticity and tolerance for glycoengineering. The glycosylation capacities achieved by KO's in CHO were found to be stable and consistent in production of recombinant glycoproteins, and it is expected that these CHO engineered CHO lines will perform similar to CHO WT in bioprocessing. Furthermore, the reconstruction of glycosylation capacities by KI exemplified by introduction of ST6Gal-1 without competing α2,3sialyltransferases demonstrates that stable and consistent glycoengineering can be achieved by the deconstruction and reconstruction strategy invented here, and this should be applicable to other desirable glycosylation capacities. This includes rebuilding endogenous glycosylation capacities of CHO WT, which are inconsistent and heterogenous such as for example N-glycan multi-antennary branch formation (tri and tetra antennary) and poly-LacNAc chains. Other examples include improving capacity for capping N-glycans on IgG. Furthermore, the engineering design matrix is expected to be transferable to any CHO host line as well as established production lines. Moreover, the engineering design matrix is expected to be transferable to any mammalian cell line with due expansion depending on existence of more complex glycosylation capacities. The panel of CHO cells generated here will enable dissection and de novo reconstruction design of N-glycosylation for any protein therapeutics. Moreover, this panel of CHO cells can be used to produce therapeutic glycoproteins with an array of different glycoforms, which for the first time will enable experimental evaluation of the biological properties of defined glycoforms and make rational selection of optimal designs. The panel of CHO cells produced here enables direct testing of the functional effects of specific N-glycan structures on any therapeutic glycoprotein, which will provide guidance for the optimal design of a glycoprotein drug. Thus, using the panel of CHO cells the effect of N-glycan branching, poly-LacNAc extension, and type of sialylation can be addressed in a systematic fashion. These effects for example include protein secretion, stability, yield, circulatory half-life in blood, biodistribution, bioactivity, and general pharmacokinetic properties of relevance for therapeutic drugs. The CHO panel will also enable e.g. design of de novo glycoprotein therapeutics, where introduction of N-glycans are used to enhance circulatory half-life without interfering with biological activity. In this instance the effect of position, size and structure of N-glycans introduced can be mapped in detail in order to design new glycoprotein biologics with optimal pharmacokinetic properties. The present invention thus provides a new era for the biggest producer of glycoprotein therapeutics, the CHO cell.

    [0267] An object of the present invention relates to a cell comprising one or more glycosyltransferase genes that have been inactivated.

    [0268] In one embodiment the cell has new and/or more homogeneous stable glycosylation capacities.

    [0269] In another embodiment of the present invention the cell comprises two or more glycosyltransferase genes that have been inactivated.

    [0270] In another embodiment of the present invention the cell comprises one or more glycosyltransferase genes that have been introduced stably by site-specific gene or non-site-specific knockin and with new and/or more homogeneous glycosylation capacities.

    [0271] Another object of the present invention relates to a cell comprising one or more glycosyltransferase genes that have been introduced stably by site-specific gene or non-site-specific knockin. The cell may have new and/or more homogeneous glycosylation capacities.

    [0272] In one embodiment of the present invention the cell comprises two or more glycosyltransferase that have been introduced stably by site-specific or non-site-specific gene knockin.

    [0273] An embodiment of the present invention relates to a cell comprising one or more glycosyltransferase genes introduced stably by site-specific or non-site-specific gene knockin, and furthermore comprising one or more endogenous glycosyltransferase genes that have been inactivated by knockout, and with improved and/or novel and/or more homogeneous glycosylation capacities.

    [0274] A further aspect of the present invention relates to a cell comprising two or more glycosyltransferase genes encoding isoenzymes with partial overlapping glycosylation functions in the same biosynthetic pathway and/or same biosynthetic step inactivated, and for which inactivation of two or more of these genes is required for loss of said glycosylation functions in the cell.

    [0275] In one embodiment of the present invention the cell comprises one or more glycosyltransferase genes inactivated to block and truncate one or more glycosylation pathways.

    [0276] In another embodiment of the present invention, the cell comprises two or more glycosyltransferase genes inactivated to block and truncate one or more glycosylation pathways.

    [0277] In one embodiment of the present invention the cell comprises targeted inactivation of one or more glycosyltransferase genes for which no transcripts are detectable.

    [0278] A further aspect of the present invention relates to a cell comprising targeted inactivation of one or more glycosyltransferase genes for which no protein products are detectable.

    [0279] Another aspect of the present invention relates to a cell comprising targeted inactivation of one or more glycosyltransferase genes for which no protein products with intact cytosolic and/or transmembrane region is detectable.

    [0280] In another embodiment of the present invention is the glycosyltransferase any one or more of the genes listed in Table 1, 2 or 3.

    [0281] In a further embodiment of the present invention is the glycosyltransferase that is inactivated a glycosyltransferase gene that is not involved in the biosynthesis of the glycans on a particular glycoprotein produced recombinantly in said cell.

    [0282] In one embodiment of the present invention are the glycosyltransferases that are inactivated working in the same glycosylation pathway.

    [0283] In another embodiment of the present invention are the glycosyltransferases that are inactivated working in the same glycosylation step.

    [0284] In yet another embodiment of the present invention are the glycosyltransferases that are inactivated working in consecutive biosynthetic steps.

    [0285] In one embodiment of the present invention are the glycosyltransferases that are inactivated retained in the same subcellular topology.

    [0286] In another embodiment of the present invention are the glycosyltransferases that are inactivated having similar amino acid sequence.

    [0287] In a further embodiment of the present invention are the glycosyltransferases that are inactivated belonging to the CAZy family.

    [0288] In yet another embodiment of the present invention are the glycosyltransferases that are inactivated belonging to same subfamily of isoenzymes in a CAZy family.

    [0289] In one embodiment of the present invention are the glycosyltransferases that are inactivated having similar structural retention signals (transmembrane sequence and length).

    [0290] In another embodiment of the present invention are the glycosyltransferase genes functioning in the same glycosylation pathway inactivated, and wherein they are not involved in the same glycosylation step.

    [0291] In a further embodiment of the present invention are the glycosyltransferase genes functioning in the same glycosylation pathway inactivated, and wherein they are involved in the same glycosylation step.

    [0292] In a further embodiment of the present invention has FUT8 been knocked out.

    [0293] In one embodiment of the present invention the cell or cell line is a mammalian cell or cell line, or an insect cell or cell line.

    [0294] In another embodiment of the present invention the cell is derived from Chinese hamster ovary or from human kidney.

    [0295] In a further embodiment of the present invention the cell is selected from the group consisting of CHO, NS0, SP2/0, YB2/0, CHO-K1, CHO-DXB11, CHO-DG44, CHO-S, HEK293, HUVEC, HKB, PER-C6, NS0, or derivatives of any of these cells.

    [0296] In one embodiment of the present invention is the cell a CHO cell.

    [0297] In another embodiment of the present invention encodes the cell furthermore an exogenous protein of interest.

    [0298] In yet another embodiment of the present invention is the protein of interest an antibody, an antibody fragment, or a polypeptide.

    [0299] In a further embodiment of the present invention is the antibody is an IgG antibody.

    [0300] In one embodiment of the present invention is the polypeptide EPO, a protein involved in hemostasis, including a coagulation factor.

    [0301] In one embodiment of the present invention is the glycosylation made more homogenous.

    [0302] In another embodiment of the present invention is the glycosylation non-sialylated.

    [0303] In yet another embodiment of the present invention is the glycosylation non-galactosylated.

    [0304] In one embodiment of the present invention comprises the glycosylation biantennary N-glycans.

    [0305] In another embodiment of the present invention does the glycosylation not comprise poly-LacNAc.

    [0306] In yet another embodiment of the present invention is the glycosylation any combination without fucose.

    [0307] In one embodiment of the present invention has B4galt1 been knocked out allowing generation of more homogeneous N-glycans without galactose.

    [0308] In another embodiment of the present invention has B4galt1 and fut8 been knocked out allowing generation of more homogeneous N-glycans without galactose and fucose.

    [0309] In yet another embodiment of the present invention has B4galt1 and B4galt3 been knocked out resulting in more homogeneous N-glycans without galactose than obtained with single ko of B4galt1 or B4galt3 (FIG. 36).

    [0310] In one embodiment of the present invention, the cell has knockout of one or more of the glycosyl transferase genes selected from the group consisting of mgat1, mgat2, mgat4A, mgat4B, mgat4C, mgat5 and mgat5B.

    [0311] In another embodiment of the present invention, the cell has knockout of one or more of the glycosyltransferase genes selected from the group consisting of mgat4A, mgat4B, and mgat4C.

    [0312] In a further embodiment of the present invention, the cell has knockout of mgat4A, mgat4B, and mgat4C.

    [0313] In another embodiment of the present invention, the cell has knockout of mgat5 and/or mgat5B.

    [0314] In yet another embodiment of the present invention, the cell has knockout of mgat5 and mgat5B.

    [0315] In one embodiment of the present invention, the cell has knockout of one or more of the galatosylation genes selected from the group consisting of B4gal1, B4gal2, B4gal3 and B4 gal.

    [0316] In another embodiment of the present invention, B4gal1 or B4gal3, or B4gal1 and B4gal3 has been knocked out.

    [0317] In a further embodiment of the present invention, the cell has knockout of one or more of the poly-LacNAc elongation genes selected from the group consisting of B3gnt1, B3gnt2 and B3gnt8.

    [0318] In yet another embodiment of the present invention, B3gnt2 has been knocked out.

    [0319] In one embodiment of the present invention, B3gnt2, mgat4A, mgat4B and mgat5 have been knocked out.

    [0320] In another embodiment of the present invention, the cell has knockout of one or more of the sialyltransferase genes selected from the group consisting of ST3gal3, ST3gal4 and ST3gal6.

    [0321] In yet another embodiment of the present invention, ST3gal3, ST3gal4 and ST3gal6 have been knocked out.

    [0322] In a further embodiment of the present invention, ST3gal4 and ST3gal6 have been knocked out.

    [0323] In one embodiment of the present invention, ST3gal4, ST3gal6, mgat4A, mgat4B and mgat5 have been knocked out.

    [0324] In another embodiment of the present invention, ST6gal1 has been knocked in and ST3gal4 and ST3gal6 have been knocked out.

    [0325] In yet another embodiment of the present invention, ST6gal1 has been knocked in and ST3gal4, ST3gal6, mgat4A, mgat4B and mgat5 have been knocked out.

    [0326] In one embodiment of the present invention, mgat2, ST3gal4, and ST3gal6 have been knocked out.

    [0327] In another embodiment of the present invention, mgat2, mgat4A, mgat4B and mgat5 have been knocked out.

    [0328] In yet another embodiment of the present invention, mgat2, ST3gal4, ST3gal6, mgat4A, mgat4B, and mgat5 have been knocked out.

    [0329] In a further embodiment of the present invention has mgat2 been knocked out with and without knockout of mgat4A and/or mgat4B and/or mgat5 allowing production of N-glycans with monoantennary structure.

    [0330] In yet another embodiment of the present invention has mgat2 been knocked out with and without knockout of mgat4A and/or mgat4B and/or mgat5 in combination with knockout of sialyltransferases allowing production of N-glycans with monoantennary structure and without sialic acid capping.

    [0331] In one embodiment of the present invention has mgat2 been knocked out with and without knockout of mgat4A and/or mgat4B and/or mgat5 in combination with KO of sialyltransferases and B3gnt2 allowing production N-glycans with monoantennary structure and without sialic acid capping and without poly-LacNAc.

    [0332] One aspect of the present invention relates to a glycoprotein according to the present invention, which is a homogeneous glycoconjugate produced from a glycoprotein having a simplified glycan profile.

    [0333] An object of the present invention is to provide a cell capable of expressing a gene encoding a polypeptide of interest, wherein the polypeptide of interest is expressed comprising one or more posttranslational modification patterns.

    [0334] In one embodiment of the present invention is the posttranslational modification pattern a glycosylation.

    [0335] The optimal glycoform of a glycoprotein may be identified by the following process:

    [0336] (i) producing a plurality of different glycoforms of said glycoprotein by expressing in cell lines harboring at least one novel glycosylation capacity for example by harboring two or more modifications of GT gene expression levels, and (ii) determination of the activity of the different glyco forms in comparison with a reference glycoprotein in (a) suitable bioassay(s); and (iii) selection of the glycoform with the higher/highest activity and determination of the production cell genotype fingerprint which is correlated with the higher/highest activity level of said glycoprotein.

    [0337] The above described process allows the identification of the optimal glycoform of a glycoprotein. For those skilled in the art by using the genotype fingerprint identified in (iii) may generate an efficient engineered cell line with the optimal genotype for producing glycoprotein with said glycoform.

    [0338] Another aspect of the present invention relates to a glycoprotein according to the present invention, which is a homogeneous glycoprotein conjugate comprising a polymer selected from, PEG, HEP, XTEN, PSA, HES.

    [0339] A further aspect of the present invention relates to a glycoprotein according to the present invention, which is a homogeneous PEGylated protein conjugate produced from a protein variant according to the invention having a simplified glycan profile.

    [0340] Another aspect of the present invention relates to a glycoprotein according to the present invention, which is a homogeneous PEGylated EPO conjugate produced from an EPO variant having a simplified glycan profile.

    [0341] One aspect of the present invention relates to a glycoprotein according to the present invention, which is a simplified enzymatic glycoPEGylation process using glycoengineered EPO variants that provides high yield of di- and triPEGylated EPO forms.

    [0342] Another aspect of the present invention relates to a glycoprotein according to the present invention, which is a protein conjugate according to the invention comprising FII, FV, FVIIa, FVIII, FIX, FX, FXIII, a Fab fragment of an antibody, or a Fc domain of an antibody.

    [0343] A further aspect of the present invention relates to a glycoprotein according to the present invention, which is a protein-protein conjugate produced from a glycoprotein with a simplified glycan profile.

    [0344] In one embodiment of the present invention is the glycoprotein according to the present invention a protein-protein conjugate produced from a glycoprotein with a simplified glycan profile comprising a Fab fragment and one of either FII, FV, FVIIa, FVIII, FIX, FX or FXIII.

    [0345] In another embodiment of the present invention is the glycoprotein according to the present invention a protein-protein conjugate produced from a glycoprotein with a simplified glycan profile comprising a Fc Domain and one of either FII, FV, FVIIa, FVIII, FIX, FX or FXIII.

    [0346] In a further embodiment of the present invention is the glycoprotein according to the present invention a homogeneous PEGylated EPO conjugate produced from an EPO variant having a simplified glycan profile.

    [0347] One aspect of the present invention relates to the use of recombinant glycoproteins comprising monoantennary N-glycans for enzymatic modification of polypeptides.

    [0348] One aspect of the present invention relates to a method for inactivation of one or more glycosyltransferase genes in a mammalian cell, the method comprising the step of inactivation of one or more glycosyltransferase genes in a mammalian cell, and determining that said gene inactivation can not result in protein product with a transmembrane retention signal, and/or stem region, and/or part of a catalytic domain.

    [0349] Another aspect of the present invention relates to a method for the production of a cell that can generate recombinant glycoproteins that do not carry specific glycans, the method comprising the step of inactivation of one or more glycosyltransferase genes in a cell, wherein the one or more glycosyltransferase genes are involved in the biosynthesis of the specific glycans, and determining that said gene inactivation can not result in protein product with a transmembrane retention signal, and/or stem region, and/or part of a catalytic domain.

    [0350] A further aspect of the present invention relates to a method for the production of di- and triPEGylated EPO glycoproteins, the method comprising the step of enzymatic glycoPEGylation of glycoengineered polypeptides variants, such as EPO variants.

    [0351] One aspect of the present invention relates to a method for producing a glycoproteins having modified glycan profile wherein the cell producing the glycoprotein has more than one modification of one or more glycosyltransferase genes.

    [0352] In one embodiment of the present invention has the cells been modified by glycosyltransferase gene knock-out and/or knock-in of an exogeneous DNA sequence coding for a glycosyltransferase.

    [0353] In one embodiment of the present invention is Cosmc knocked in or knocked out.

    [0354] One aspect of the present invention relates to a method for producing a glycoprotein having a simple glycan profile, the method comprising inactivation of one or more glycosyltransferases, and/or knockin of one or more glycosyltransferases, or a combination hereof in a cell, and expression of a protein in said cell.

    [0355] Another aspect of the present invention relates to a method for generating glycoproteins with improving glycosylation efficiency, the method comprising the step of inactivation of one or more glycosyltransferase genes to block and truncate one or more glycosylation pathways.

    [0356] A further aspect of the present invention relates to a method for the production of recombinant glycoproteins that do not have specific types of glycosylation, the method comprising the step of inactivating two or more glycosyltransferase genes to block and truncate one or more glycosylation pathways.

    [0357] One aspect of the present invention relates to a method for the production of recombinant glycoproteins, comprising the step of generating a mammalian cell with specific glycosylation properties.

    [0358] In one embodiment of the present invention is the specific glycosylation property the capacity for monoantennary N-glycan synthesis.

    [0359] A further aspect of the present invention relates to a glycoprotein obtainable from a method according to the present invention.

    [0360] In one embodiment of the present invention has the glycostructure outcome one or more of the following changes selected from the group consisting of simpler glycan structure, more homogeneous product, more sialic acids per molecule, non-sialylated, non-galactosylated, more homogeneous bi-antennary, more homogeneous monoantennary, more homogeneous triantennary, more homogeneous without poly-LacNAc, higher productivity in cell culture, new stable homogeneous glycosylation capacities, more human glycostructure, more homogeneous glycosylation and improved ADCC targeting of IgG, modified fucose level, no fucose, improved substrate for generating glycoconjugates.

    [0361] In another aspect of the present invention is one or more of the above mentioned genes knocked out using transcription activator-like effector nucleases (TALENs).

    [0362] TALENs are artificial restriction enzymes generated by fusing a TAL effector DNA binding domain to a DNA cleavage domain.

    [0363] In yet another aspect of the present invention is one or more of the above mentioned genes knocked out using CRISPRs (clustered regularly interspaced short palindromic repeats).

    [0364] CRISPRs are DNA loci containing short repetitions of base sequences. Each repetition is followed by short segments of “spacer DNA” from previous exposures to a virus.

    [0365] CRISPRs are often associated with cas genes that code for proteins related to CRISPRs. The CRISPR/Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages and provides a form of acquired immunity.

    [0366] CRISPR spacers recognize and cut these exogenous genetic elements in a manner analogous to RNAi in eukaryotic organisms.

    [0367] The CRISPR/Cas system is used for gene editing (adding, disrupting or changing the sequence of specific genes) and gene regulation in species throughout the tree of life. By delivering the Cas9 protein and appropriate guide RNAs into a cell, the organism's genome can be cut at any desired location.

    [0368] In a further embodiment of the present invention the mammalian cell does or does not have α-1,6-fucosyltransferase activity.

    [0369] The cell of the present invention may by a cell that does not comprise the gene of interest to be expressed or the cell may comprise the gene of interest to be expressed. The cell that does not comprise the gene of interest to be expressed is usually called “a naked cell”.

    [0370] The host cell of the present invention may be any host, so long as it can express an antibody molecule. Examples include a yeast cell, an animal cell, an insect cell, a plant cell and the like.

    [0371] In one embodiment of the present invention is the cell selected from the group consisting of CHO, NS0, SP2/0, YB2/0, YB2/3HL.P2.G11.16Ag.20, NSO, SP2/0-Ag14, BHK cell derived from a syrian hamster kidney tissue, antibody-producing hybridoma cell, human leukemia cell line (Namalwa cell), an embryonic stem cell, and fertilized egg cell.

    [0372] In a preferred embodiment of the present invention is the cell a CHO cell.

    [0373] The cell can be an isolated cell or in cell culture or a cell line.

    [0374] The protein of interest can be various types of protein, and in particular proteins that benefit from being expressed as glycoproteins

    [0375] In a preferred embodiment the protein is erythropoietin (EPO).

    [0376] In another embodiment is the protein α1-antitrypsin.

    [0377] In one aspect of the present invention is the protein a recombinant blood factor.

    [0378] In one embodiment of the present invention is the recombinant blood factor selected from the group consisting of one or more of factor VIII, factor IX, factor XIII A-subunit, thrombin, and factor VIIa.

    [0379] In yet another embodiment of the present invention the protein of interest is a coagulation factor such as coagulation factor II (FII), coagulation factor V (FV), coagulation factor VII (FVIIa), coagulation factor VIII (FVIII), coagulation factor IX (FIX), coagulation factor X (FX), or coagulation factor XIII (FXIII).

    [0380] In one aspect of the present invention is the protein human growth hormone.

    [0381] In yet another embodiment of the present invention is the protein of interest an antibody, an antibody fragment, such as a Fab fragment, an Fc domain of an antibody, or a polypeptide.

    [0382] A further aspect of the present invention relates to a method for producing an enzymatically modified glycoprotein, comprising the step of generating a cell with specific glycosylation properties, and the enzymatically modification of interest.

    [0383] In one embodiment of the present invention is the enzymatically modification a polymer.

    [0384] In another embodiment of the present invention is the enzymatically modification a conjugation to another protein.

    [0385] Another aspect of the present invention relates to a glycoprotein according to the present invention, which is a homogeneous glycoprotein conjugate comprising a polymer.

    [0386] The glycoprotein can be enzymatically modified with the polymer, and the glycoprotein can be produced by the cell according to the present invention.

    [0387] In one aspect of the present invention is the protein a recombinant thrombolytic, anticoagulant or another blood-related product.

    [0388] In one embodiment of the present invention is the recombinant thrombolytic, anticoagulant or another blood-related product selected from the group consisting of one or more of tissue plasminogen activator (tPA), hirudin, antithrombin, plasmin, plasma kallikrein inhibitor, and activated protein C.

    [0389] In one aspect of the present invention is the protein a recombinant hormone.

    [0390] In one embodiment of the present invention is the recombinant hormone selected from the group consisting of one or more of insulin, insulin degludec, human growth hormone, somatropin, pegvisomant, follicle-stimulating hormone, follitropin alfa, corifollitropin alfa, follitropin beta, metreleptin, liraglutide, parathyroid hormone, lutropin, teriparatide, nesiritide, and glucagon.

    [0391] In one aspect of the present invention is the protein a recombinant growth hormone.

    [0392] In one embodiment of the present invention is the recombinant growth hormone selected from the group consisting of one or more of EPO, filgrastim, sargramostim, mecaserim, and palifermin.

    [0393] In one aspect of the present invention is the protein a Recombinant interferon, interleukin or tumor necrosis factor.

    [0394] In one embodiment of the present invention is the Recombinant interferon, interleukin or tumor necrosis factor selected from the group consisting of one or more of interferon alfa, PEGinterferon alfa, PEGinterferon alfa-2a, PEGinterferon alfa, interferon beta-1b, algulcosidase alfa, and laronidase.

    [0395] In one aspect of the present invention is the protein an antigen or vaccine component.

    [0396] In one aspect of the present invention is the protein of the present invention relevant for a disease or disorder selected from the group consisting of one or more of Hemophilia A, Hemophilia B, Acute myocardial infarction, heparinassociated thrombocytopenia, venous thrombosis, Symptomatic vitreomacular adhesion/vitreomacular traction, Acute angioedema, Hereditary antithrombin deficiency, Hereditary angioedema, sepsis, diabetes, diabetes mellitus, Growth failure/growth hormone deficiency, infertility/subfertility, Type 2 diabetes, Osteoporosis, Hypoglycemia, Paget's disease, cancer, Anemia, Neutropenia, Hepatitis C, and Hyperuricemia, Rheumatoid arthritis, hepatitis A and B, Arthritis, colitis, Crohn's, psoriasis, ankylosing spondylitis, Ulcerative colitis.

    [0397] In one embodiment of the present invention the protein is an antibody.

    [0398] In a preferred embodiment of the present invention is the antibody an IgG antibody.

    [0399] In the present invention, the antibody molecule includes any molecule, so long as it comprises the Fc region of an antibody. Examples include an antibody, an antibody fragment, a fusion protein comprising an Fc region, and the like.

    [0400] The antibody is a protein which is produced in the living body by immune reaction as a result of exogenous antigen stimulation and has an activity to specifically bind to the antigen. Examples of the antibody include an antibody secreted by a hybridoma cell prepared from a spleen cell of an animal immunized with an antigen; an antibody prepared by a genetic recombination technique, namely an antibody obtained by introducing an antibody gene-inserted antibody expression vector into a host cell; and the like. Specific examples include an antibody produced by a hybridoma, a humanized antibody, a human antibody and the like.

    [0401] A hybridoma is a cell which is obtained by cell fusion between a B cell obtained by immunizing a mammal other than human with an antigen and a myeloma cell derived from mouse or the like and can produce a monoclonal antibody having the desired antigen specificity.

    [0402] Examples of the humanized antibody include a human chimeric antibody, a human CDR-grafted antibody and the like.

    [0403] A human chimeric antibody is an antibody which comprises an antibody heavy chain variable region (hereinafter referred to as “HV” or “VH”, the heavy chain being “H chain”) and an antibody light chain variable region (hereinafter referred to as “LV” or “VL”, the light chain being “L chain”), both of an animal other than human, a human antibody heavy chain constant region (hereinafter also referred to as “CH”) and a human antibody light chain constant region (hereinafter also referred to as “CL”). As the animal other than human, any animal such as mouse, rat, hamster, rabbit or the like can be used, so long as a hybridoma can be prepared therefrom.

    [0404] The human chimeric antibody can be produced by obtaining cDNA's encoding VH and VL from a monoclonal antibody-producing hybridoma, inserting them into an expression vector for host cell having genes encoding human antibody CH and human antibody CL to thereby construct a human chimeric antibody expression vector, and then introducing the vector into a host cell to express the antibody.

    [0405] As the CH of human chimeric antibody, any CH can be used, so long as it belongs to human immunoglobulin (hereinafter referred to as “hIg”) can be used. But those belonging to the hIgG class are preferable and any one of the subclasses belonging to the hIgG class, such as hIgG1, hIgG2, hIgG3 and hIgG4, can be used. Also, as the CL of human chimeric antibody, any CL can be used, so long as it belongs to the hIg class, and those belonging to the κ class or λ class can also be used.

    [0406] A human CDR-grafted antibody is an antibody in which amino acid sequences of CDR's of VH and VL of an antibody derived from an animal other than human are grafted into appropriate positions of VH and VL of a human antibody.

    [0407] The human CDR-grafted antibody can be produced by constructing cDNA's encoding V regions in which CDR's of VH and VL of an antibody derived from an animal other than human are grafted into CDR's of VH and VL of a human antibody, inserting them into an expression vector for host cell having genes encoding human antibody CH and human antibody CL to thereby construct a human CDR-grafted antibody expression vector, and then introducing the expression vector into a host cell to express the human CDR-grafted antibody.

    [0408] As the CH of human CDR-grafted antibody, any CH can be used, so long as it belongs to the hIg, but those of the hIgG class are preferable and any one of the subclasses belonging to the hIgG class, such as hIgG1, hIgG2, hIgG3 and hIgG4, can be used. Also, as the CL of human CDR-grafted antibody, any CL can be used, so long as it belongs to the hIg class, and those belonging to the κ class or λ class can also be used.

    [0409] A human antibody is originally an antibody naturally existing in the human body, but it also includes antibodies obtained from a human antibody phage library, a human antibody-producing transgenic animal and a human antibody-producing transgenic plant, which are prepared based on the recent advance in genetic engineering, cell engineering and developmental engineering techniques.

    [0410] Regarding the antibody existing in the human body, a lymphocyte capable of producing the antibody can be cultured by isolating a human peripheral blood lymphocyte, immortalizing it by its infection with EB virus or the like and then cloning it, and the antibody can be purified from the culture.

    [0411] The human antibody phage library is a library in which antibody fragments such as Fab, single chain antibody and the like are expressed on the phage surface by inserting a gene encoding an antibody prepared from a human B cell into a phage gene. A phage expressing an antibody fragment having the desired antigen binding activity can be recovered from the library, using its activity to bind to an antigen-immobilized substrate as the marker. The antibody fragment can be converted further into a human antibody molecule comprising two full B chains and two full L chains by genetic engineering techniques.

    [0412] A human antibody-producing transgenic non-human animal is an animal in which a human antibody gene is introduced into cells. Specifically, a human antibody-producing transgenic animal can be prepared by introducing a human antibody gene into ES cell of a mouse, transplanting the ES cell into an early stage embryo of other mouse and then developing it. By introducing a human chimeric antibody gene into a fertilized egg and developing it, the transgenic animal can be also prepared. Regarding the preparation method of a human antibody from the human antibody-producing transgenic animal, the human antibody can be produced and accumulated in a culture by obtaining a human antibody-producing hybridoma by a hybridoma preparation method usually carried out in mammals other than human and then culturing it.

    [0413] Examples of the transgenic non-human animal include cattle, sheep, goat, pig, horse, mouse, rat, fowl, monkey, rabbit and the like.

    [0414] Another aspect of the present invention relates to a method for producing an antibody composition, which comprises culturing the mammalian cell according to the present invention in a medium to produce and accumulate an antibody composition in the culture; and recovering the antibody composition from the culture

    [0415] Also, in the present invention, it is preferable that the antibody is an antibody which recognizes a tumor-related antigen, an antibody which recognizes an allergy- or inflammation-related antigen, an antibody which recognizes circulatory organ disease-related antigen, an antibody which recognizes an autoimmune disease-related antigen or an antibody which recognizes a viral or bacterial infection-related antigen, and a human antibody which belongs to the IgG class is preferable.

    [0416] An antibody fragment is a fragment which comprises the Fc region of an antibody. Examples of the antibody fragment include an H chain monomer, an H chain dimer and the like.

    [0417] A fusion protein comprising an Fc region is a composition in which an antibody comprising the Fc region of an antibody or the antibody fragment is fused with a protein such as an enzyme, a cytokine or the like.

    [0418] One embodiment of the present invention relates to a composition comprising the antibody of the present invention, also referred to as antibody composition.

    [0419] In one embodiment of the present invention shows the antibody or antibody composition high ADCC activity.

    [0420] In the present invention, the ADCC activity is a cytotoxic activity in which an antibody bound to a cell surface antigen on a tumor cell in the living body activate an effector cell through an Fc receptor existing on the antibody Fc region and effector cell surface and thereby obstruct the tumor cell and the like.

    [0421] The antibody composition of the present invention has potent antibody-dependent cell-mediated cytotoxic activity (ADCC). An antibody having potent antibody-dependent cell-mediated cytotoxic activity is useful for preventing and treating various diseases including cancers, inflammatory diseases, immune diseases such as autoimmune diseases, allergies and the like, circulatory organ diseases and viral or bacterial infections.

    [0422] In the case of cancers, namely malignant tumors, cancer cells grow. General anti-tumor agents inhibit the growth of cancer cells. In contrast, an antibody having potent antibody-dependent cell-mediated cytotoxic activity can treat cancers by injuring cancer cells through its cell killing effect, and therefore, it is more effective as a therapeutic agent than the general anti-tumor agents.

    [0423] In immune diseases such as inflammatory diseases, autoimmune diseases, allergies and the like, in vivo reactions of the diseases are induced by the release of a mediator molecule by immunocytes, so that the allergy reaction can be inhibited by eliminating immunocytes using an antibody having potent antibody-dependent cell-mediated cytotoxic activity.

    [0424] Examples of the circulatory organ diseases include arteriosclerosis and the like. The arteriosclerosis is treated using balloon catheter at present, but circulatory organ diseases can be prevented and treated by inhibiting growth of arterial cells in restricture after treatment using an antibody having potent antibody-dependent cell-mediated cytotoxic activity.

    [0425] Various diseases including viral and bacterial infections can be prevented and treated by inhibiting proliferation of cells infected with a virus or bacterium using an antibody having potent antibody-dependent cell-mediated cytotoxic activity.

    [0426] The glycoproteins of the present invention may there for be use to treat immune diseases, cancer viral or barterial infections or other diseases or disorders mentioned above.

    [0427] The medicament comprising the glycoprotein composition of the present invention can be administered as a therapeutic agent alone, but generally, it is preferable to provide it as a pharmaceutical formulation produced by an appropriate method well known in the technical field of manufacturing pharmacy, by mixing it with at least one pharmaceutically acceptable carrier.

    [0428] It is desirable to select a route of administration which is most effective in treatment. Examples include oral administration and parenteral administration, such as buccal, tracheal, rectal, subcutaneous, intramuscular, intravenous or the like. In an antibody preparation, intravenous administration is preferable.

    [0429] The dosage form includes sprays, capsules, tablets, granules, syrups, emulsions, suppositories, injections, ointments, tapes and the like.

    [0430] Examples of the pharmaceutical preparation suitable for oral administration include emulsions, syrups, capsules, tablets, powders, granules and the like.

    [0431] Liquid preparations, such as emulsions and syrups, can be produced using, as additives, water; saccharides, such as sucrose, sorbitol, fructose, etc.; glycols, such as polyethylene glycol, propylene glycol, etc.; oils, such as sesame oil, olive oil, soybean oil, etc.; antiseptics, such as p-hydroxybenzoic acid esters, etc.; flavors, such as strawberry flavor, peppermint, etc.; and the like.

    [0432] Capsules, tablets, powders, granules and the like can be produced using, as additive, fillers, such as lactose, glucose, sucrose, mannitol, etc.; disintegrating agents, such as starch, sodium alginate, etc.; lubricants, such as magnesium stearate, talc, etc.; binders, such as polyvinyl alcohol, hydroxypropylcellulose, gelatin, etc.; surfactants, such as fatty acid ester, etc.; plasticizers, such as glycerine, etc.; and the like.

    [0433] Examples of the pharmaceutical preparation suitable for parenteral administration include injections, suppositories, sprays and the like.

    [0434] Injections may be prepared using a carrier, such as a salt solution, a glucose solution, a mixture of both thereof or the like. Also, powdered injections can be prepared by freeze-drying the antibody composition in the usual way and adding sodium chloride thereto.

    [0435] Suppositories may be prepared using a carrier such as cacao butter, hydrogenated fat, carboxylic acid or the like.

    [0436] Also, sprays may be prepared using the antibody composition as such or using a carrier which does not stimulate the buccal or airway mucous membrane of the patient and can facilitate absorption of the antibody composition by dispersing it as fine particles.

    [0437] Examples of the carrier include lactose, glycerol and the like. Depending on the properties of the antibody composition and the carrier, it is possible to produce pharmaceutical preparations such as aerosols, dry powders and the like. In addition, the components exemplified as additives for oral preparations can also be added to the parenteral preparations.

    [0438] Although the clinical dose or the frequency of administration varies depending on the objective therapeutic effect, administration method, treating period, age, body weight and the like, it is usually 10 μg/kg to 20 mg/kg per day and per adult.

    [0439] It should be noted that embodiments and features described in the context of one of the aspects of the present invention also apply to the other aspects of the invention.

    Definitions

    General Glycobiology

    [0440] Basic glycobiology principles and definitions are described in Varki et al. Essentials of Glycobiology, 2nd edition, 2009.

    [0441] “N-glycosylation” refers to the attachment of the sugar molecule oligosaccharide known as glycan to a nitrogen atom residue of a protein

    [0442] “O-glycosylation” refers to the attachment of a sugar molecule to an oxygen atom in an amino acid residue in a protein.

    [0443] “Galactosylation” means enzymatic addition of a galactose residue to lipids, carbohydrates or proteins.

    [0444] “Sialylation” is the enzymatic addition of a neuraminic acid residue.

    [0445] “Neuraminic acid” is a 9-carbon monosaccharide, a derivative of a ketononose.

    [0446] “Monoantennary” N-linked glycan is a engineered N-glycan consist of the N-glycan core (Manα1-6(Manα1-3)Manβ1-4GlcNAcβ1-4GlcNAcβ1-Asn-X-Ser/Thr) that elongated with a single GlcNAc residue linked to C-2 and of the mannose α1-3. The single GlcNAc residue can be further elongated for example with Gal or Gal and NeuAc residues.

    [0447] “Biantennary” N-linked glycan is the simplest of the complex N-linked glycans consist of the N-glycan core (Manα1-6(Manα1-3)Manβ1-4GlcNAcβ1-4GlcNAcβ1-Asn-X-Ser/Thr) elongated with two GlcNAc residues linked to C-2 and of the mannose α1-3 and the mannose α1-6. This core structure can then be elongated or modified by various glycan structures.

    [0448] “Triantennary” N-linked glycans are formed when an additional GlcNAc residue is added to either the C-4 of the core mannose α1-3 or the C-6 of the core mannose α1-6 of the bi-antennary core structure. This structure can then be elongated or modified by various glycan structures.

    [0449] “Tetratantennary” N-linked glycans are formed when two additional GlcNAc residues are added to either the C-4 of the core mannose α1-3 or the C-6 of the core mannose α1-6 of the bi-antennary core structure. This core structure can then be elongated or modified by various glycan structures.

    [0450] “Poly-LacNAc” poly-N-acetyllactosamine ([Galβ1-4GlcNAc]n; n≧2.)

    [0451] “Glycoprofiling” means characterization of glycan structures resident on a biological molecule or cell.

    [0452] “Glycosylation pathway” refers to assembly of monosaccharides into a group of related complex carbohydrate structures by the stepwise action of enzymes, known as glycosyltransferases. Glycosylation pathways in mammalian cells are classified as N-linked protein glycosylation, different O-linked protein glycosylation (O-GalNAc, O-GlcNAc, O-Fuc, O-Glc, O-Xyl, O-Gal), different series of glycosphingolipids, and GPI-anchors.

    [0453] “Biosynthetic Step” means the addition of a monosaccharide to a glycan structure.

    [0454] “Glycosyltransferases” are enzymes that catalyze the formation of the glycosidic linkage to form a glycoside. These enzymes utilize ‘activated’ sugar phosphates as glycosyl donors, and catalyze glycosyl group transfer to a nucleophilic group, usually an alcohol. The product of glycosyl transfer may be an O-, N-, S-, or C-glycoside; the glycoside may be part of a monosaccharide, oligosaccharide, or polysaccharide.

    [0455] “Glycosylation capacity” means the ability to produce an amount of a specific glycan structure by a given cell or a given glycosylation process.

    [0456] “HEP” is an abbreviation for heparosan. Heparosan (HEP) is a natural sugar polymer comprising (-GlcUA-1,4-GlcNAc-1,4-) re-peats. It belongs to the glycosaminoglycan polysaccharide family and is a negatively charged polymer at physiological pH. It can be found in the capsule of certain bacteria's but it is also found in higher vertebrate where it serves as precursor for the natural polymers heparin and heparan sulphate.

    [0457] “PEG” is an abbreviation for polyethylene glycol. PEG polymers are generally used for increasing the half-life of therapeutic molecule. With their high hydrodynamic volume, PEG polymers increases the effective size of drugs and thus slows their clearance from the bloodstream via kidney filtration or by shielding the protein drug towards clearance receptors and proteolytical degradation.

    [0458] “XTEN” is well defined peptide sequences based on a limited subset of amino acids, and assembled into longer repeating sequences. XTEN also increases the size of therapeutic molecules and prolongs their presence in the bloodstream. “GlycoPEGylation” is the process of covalently attaching PEG to glycans of a protein of interest.

    [0459] “Enzymatic GlycoPEGylation” is the process of covalently attaching PEG to glycans of a protein of interest using a glycosyltransferase and suitable PEGylated glycosyl transfer groups, such as PEGylated NeuAc-CMP molecules.

    [0460] “Glycoconjugate” is a macromolecule that contains monosaccharides covalently linked to proteins or lipids

    [0461] “Simple(r) glycan structure” is a glycan structure containing fewer monosaccharides and/or having lower mass and/or having fewer antennae.

    [0462] “Human like glycosylation” means having glycan structures resembling those of human cells. Examples including more sialic acids with α2,6 linkage (more α2,6 sialyltransferase enzyme) and/or less sialic acids with α2,3 linkage and/or more N-acetylneuraminic acid (Neu5Ac) and/or less N-glycolylneuraminic acid (Neu5Gc).

    [0463] “Cleavage” refers to the breakage of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of either blunt ends or staggered ends. In certain embodiments, fusion polypeptides are used for targeted double-stranded DNA cleavage.

    [0464] “Deconstruction” means obtaining cells producing a simpler glycan structures by single or stacked knock out of glycosyltransferases. Deconstruction of a glycosylation pathway means KO of glycosyltransferases involved in each step in biosynthesis and identification of glycosyltransferases controlling each biosynthetic step.

    [0465] “Reconstruction” refers to inserting exogeneous gene(s) into cells or activation of endogenous silent gene(s) to obtain more complex glycan structures. Typically target cells are producing simple glycan structures as result of deconstruction.

    [0466] “Modified glycan profile” refers to change in number, type or position of oligosaccharides in glycans on a given glycoprotein.

    [0467] More “homogeneous glycosylation” or “homogeneous stable glycosylation capacities” means that the proportion of identical glycan structures observed by glycoprofiling a given protein expressed in one cell is larger than the proportion of identical glycan structures observed by glycoprofiling the same protein expressed in another cell. A more homogeneous glycosylation may be obtained by knock-in and/or knock-out of one or more glycosyltransferase genes in a cell. An example of such a modification could be knock-out of B4galt1 to generate more homogeneous N-glycans without galactose. Additional knock-out of fut8 allows production of more homogeneous N-glycans without galactose and fucose. Overall, this type of knock-in and/or knock-out modifications can result in changes of the glycostructure outcome of the modified cell, such as the non-limiting list of simpler glycan structure, more homogeneous product, more sialic acids per molecule, non-sialylated, non-galactosylated, more homogeneous bi-antennary, more homogeneous monoantennary, more homogeneous triantennary, more homogeneous glycosylation without poly-LacNAc, higher productivity in cell culture, new stable homogeneous glycosylation capacities, more human glycostructure, more homogeneous glycosylation and improved ADCC targeting of IgG, modified fucose level, no fucose, and improved substrate for generating glycoconjugates.

    [0468] General DNA, mol. biol. Any of various techniques used for separating and recombining segments of DNA or genes, commonly by use of a restriction enzyme to cut a DNA fragment from donor DNA and inserting it into a plasmid or viral DNA. Using these techniques, DNA coding for a protein of interest is recombined/cloned (using PCR and/or restriction enzymes and DNA ligases or ligation independent methods such as USER cloning) into a plasmid (known as an expression vector), which can subsequently be introduced into a cell by transfection using a variety of transfection methods such as calcium phosphate transfection, electroporation, microinjection and liposome transfection. Overview and supplementary information and methods for constructing synthetic DNA sequences, insertion into plasmid vectors and subsequent transfection into cells can be found in Ausubel et al, 2003 and/or Sambrook & Russell, 2001.

    [0469] “Gene” refers to a DNA region (including exons and introns) encoding a gene product, as well as all DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences or situated far away from the gene which function they regulate. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites, and locus control regions.

    [0470] “Targeted gene modifications”, “gene editing” or “genome editing” Gene editing or genome editing refer to a process by which a specific chromosomal sequence is changed. The edited chromosomal sequence may comprise an insertion of at least one nucleotide, a deletion of at least one nucleotide, and/or a substitution of at least one nucleotide. Generally, genome editing inserts, replaces or removes nucleic acids from a genome using artificially engineered nucleases such as Zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), the CRISPR/Cas system, and engineered meganuclease re-engineered homing endonucleases. Genome editing principles are described in Steentoft et al and gene editing methods are described in references therein and also broadly used and thus known to person skilled in the art.

    [0471] “Endogenous” sequence/gene/protein refers to a chromosomal sequence or gene or protein that is native to the cell or originating from within the cell or organism analyzed

    [0472] “Exogenous” sequence or gene refers to a chromosomal sequence that is not native to the cell, or a chromosomal sequence whose native chromosomal location is in a different location in a chromosome or originating from outside the cell or organism analyzed

    [0473] “Inactivated chromosomal sequence” refer to genome sequence that has been edited resulting in loss of function of a given gene product. The gene is said to be knocked out.

    [0474] “Heterologous” refers to an entity that is not native to the cell or species of interest.

    [0475] The terms “nucleic acid” and “polynucleotide” refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form. For the purposes of the present disclosure, these terms are not to be construed as limiting with respect to the length of a polymer. The terms can encompass known analogs of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g., phosphorothioate backbones). In general, an analog of a particular nucleotide has the same base-pairing specificity; i.e., an analog of A will base-pair with T.

    [0476] The term “nucleotide” refers to deoxyribonucleotides or ribonucleotides. The nucleotides may be standard nucleotides (i.e., adenosine, guanosine, cytidine, thymidine, and uridine) or nucleotide analogs. A nucleotide analog refers to a nucleotide having a modified purine or pyrimidine base or a modified ribose moiety. A nucleotide analog may be a naturally occurring nucleotide (e.g., inosine) or a non-naturally occurring nucleotide.

    [0477] The terms “polypeptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues. These terms may also refer to glycosylated variants of the “polypeptide” or “protein”, also termed “glycoprotein”. “polypeptide”, “protein” and “glycoprotein” is used interchangeably throughout this disclosure.

    [0478] The term “recombination” refers to a process of exchange of genetic information between two polynucleotides. For the purposes of this disclosure, “homologous recombination” refers to the specialized form of such exchange that takes place, for example, during repair of double-strand breaks in cells. This process requires sequence similarity between the two polynucleotides, uses a “donor” or “exchange” molecule to template repair of a “target” molecule (i.e., the one that experienced the double-strand break), and is variously known as “non-crossover gene conversion” or “short tract gene conversion,” because it leads to the transfer of genetic information from the donor to the target. Without being bound by any particular theory, such transfer can involve mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and/or “synthesis-dependent strand annealing,” in which the donor is used to resynthesize genetic information that will become part of the target, and/or related processes. Such specialized homologous recombination often results in an alteration of the sequence of the target molecule such that part or all of the sequence of the donor polynucleotide is incorporated into the target polynucleotide.

    [0479] As used herein, the terms “target site” or “target sequence” refer to a nucleic acid sequence that defines a portion of a chromosomal sequence to be edited and to which a targeting endonuclease is engineered to recognize, bind, and cleave.

    [0480] “Targeted integration” is the method by which exogenous nucleic acid elements are specifically integrated into defined loci of the cellular genome. Target specific double stranded breaks are introduced in the genome by genome editing nucleases that allow for integration of exogenously delivered donor nucleic acid element into the double stranded break site. Thereby the exogenously delivered donor nuclei acid element is stably integrated into the defined locus of the cellular genome.

    [0481] Sequence identity Techniques for determining nucleic acid and amino acid sequence identity are known in the art. Typically, such techniques include determining the nucleotide sequence of the mRNA for a gene and/or determining the amino acid sequence encoded thereby, and comparing these sequences to a second nucleotide or amino acid sequence. Genomic sequences can also be determined and compared in this fashion. In general, identity refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their percent identity. The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequences and multiplied by 100. An approximate alignment for nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981). This algorithm can be applied to amino acid sequences by using the scoring matrix developed by Dayhoff, Atlas of Protein Sequences and Structure, M. O. Dayhoff ed., 5 suppl. 3:353-358, National Biomedical Research Foundation, Washington, D.C., USA, and normalized by Gribskov, Nucl. Acids Res. 14(6):6745-6763 (1986). An exemplary implementation of this algorithm to determine percent identity of a sequence is provided by the Genetics Computer Group (Madison, Wis.) in the “BestFit” utility application. Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used using the following default parameters: genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+Swiss protein+Spupdate+PIR. Details of these programs can be found on the GenBank website. With respect to sequences described herein, the range of desired degrees of sequence identity is approximately 80% to 100% and any integer value therebetween. Typically the percent identities between sequences are at least 70-75%, preferably 80-82%, more preferably 85-90%, even more preferably 92%, still more preferably 95%, and most preferably 98% sequence identity.

    [0482] All patent and non-patent references cited in the present application, are hereby incorporated by reference in their entirety.

    [0483] The invention will now be described in further details in the following non-limiting examples.

    Examples

    [0484] The purpose of the following examples are given as an illustration of various embodiments of the invention and are thus not meant to limit the present invention in any way. Along with the present examples the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.

    Example 1—Deconstruction of N-glycosylation in CHO Cells

    Introductory Paragraph

    [0485] The Chinese hamster ovary cell (CHO) is the cell factory of choice for recombinant production of biological therapeutics. CHO is capable of handling many posttranslational modifications needed for production of bioactive proteins, and has a generic capacity for glycosylation of proteins compatible with human use. Glycosylation has wide ranges of effects on production, product consistency, solubility, stability, bioactivity, and circulatory half-life of protein therapeutics, and availability of a single generic CHO production platform is a limiting factor for design and development of biologics. This example shows a comprehensive knockout screen of glycosyltransferase genes involved in N-glycosylation in CHO that defines the key enzymes controlling antennary branching, elongation, and sialylation. A panel of stably engineered CHO lines with designer glycosylation capacities such as homogenous biantennary glycans with and without α2,3 and α2,6 sialic acid capping was established. The screen demonstrates great plasticity for CHO glycoengineering and provides clear pathways for custom designs.

    Introduction

    [0486] Glycoprotein biologics is the fastest growing class of therapeutics, and most of these can only be produced recombinantly in mammalian cells with capacity for human-like glycosylation. The Chinese hamster ovary (CHO) cell has gained a leading role as host cell for recombinant production of glycoprotein therapeutics mainly because it produces rather simple N-glycans with branching and capping similar to what is produced in some human cells.

    [0487] Notably, CHO produce complex-type heterogenous N-glycans with bi-, tri-, and tetraantennary structures with core α 6Fucose (Fuc), a minor amount of poly-N-Acetyllactosamine (poly-LacNAc) mainly on the α1,6 arm of tetraantennary structures, and exclusive capping of LacNAc with α2,3 linked neuraminic acid (NeuAc) (See FIG. 1a). CHO does not generally produce the non-human and in man immunogenic capping structures, such as N-glycolylneuraminic acid (NeuGc) or α3Gal, although the occurrence of these have been reported perhaps as a result of gene induction. N-glycosylation may vary for different proteins as well as for different glycosites in individual proteins, and e.g. IgG antibodies are produced with truncated N-glycan structures at the conserved Asn297 glycosite (biantennary structures with core α6Fuc, limited LacNAc, and NeuAc capping). A major concern with CHO is the substantial heterogeneity in N-glycan processing, which can be difficult to control during bioprocessing and can pose issues for bioactivity as well as biosafety. Thus, a major activity in bioprocessing of therapeutics is devoted to glycan analysis and control of fermentation to achieve consistency.

    [0488] Substantial efforts in the last two decades have been devoted to genetic glycoengineering of CHO cells with the aims to expand the capacity for glycosylation, reduce heterogeneity, and improve or alter especially sialylation.

    [0489] These studies have essentially all used random integration of cDNAs encoding glycosyltransferases and experienced problems with stability, consistency, and predictability of the introduced glycosylation capacity. The major obstacle has been the need to rely on overexpression of glycosyltransferases and competition with the endogenous expressed enzymes because of lack of simple methods to knock these out in cell lines. Thus, to our knowledge such glycoengineered CHO cells have not reached production of clinical therapeutics. One successful glycoengineering strategy has, however, emerged after the discovery that IgGs without core α 6Fuc on the Asn297 N-glycan exhibits markedly higher Antibody-Dependent Cell Cytotoxicity (ADCC).

    [0490] Thus, through a tour-de-force using two rounds of homologous recombination both alleles of the fut8 gene encoding the α 6fucosyltransferase controlling core fucosylation was knocked out in CHO, and at least one therapeutic IgG produced in CHO without the fut8 gene is now in clinical use. More recently, the fut8 gene was knocked out using precise gene editing with Zinc finger nuclease (ZFN) gene targeting with a fraction of time and resources spent. The emergence of precise gene editing technologies for knockout (KO) and knockin (KI) have opened up for an entirely different level of speed and ease with which stable genetic manipulation of host cell lines to remove and introduce glycosyltransferase genes can be achieved, and this will undoubtedly impact engineering of mammalian host cell factories for recombinant production of therapeutics.

    [0491] Here, we first employed a ZFN-mediated knockout screen in CHO to explore the potential for engineering N-glycosylation of recombinant glycoproteins. Many steps in the N-glycan biosynthetic pathway are potentially catalyzed by multiple isoenzymes, which leave genetic engineering unpredictable (FIG. 1a). Dissection of the in vivo functions of each of these isoenzymes is required to construct a matrix for design options. The KO screen included all genes encoding isoenzymes with potential to regulate N-glycosylation branching, elongation, and terminal capping expressed in CHO. The expression of the relevant genes in CHO GS was assessed by quantitative next generation RNA sequencing (RNAseq) (FIG. 4). The strategy has only been made possible with the recent sequencing of the CHO genome and analysis of the CHO-K1 transcriptome. We targeted individual genes and most relevant stacked combinations.

    [0492] We used a total of 15 ZFNs targeting glycosyltransferase genes (FIG. 1a) involved in antennary branching (mgat4A/4B/4C/5/5B) (FIG. 1c), galactosylation (B4galt1/2/3/4 (FIG. 1d), poly-LacNAc elongation (B3gnt1/2/8) (FIG. 1e), and terminal capping by sialylation (st3gal3/4/6) (FIG. 1f). We utilized recently developed methods for enriching KO clones by FACS (GFP/Crimson tagged ZFNs) and high throughput screening by an amplicon labelling strategy (IDAA). The majority of KO clones exhibited insertions and/or deletions (indels) in the range of ±20 bps, and most targeted genes were present with two alleles, while some (mgat4B and mgat5) were present with 1 or 3 alleles, respectively. To monitor effects of the glycogene KO screen we used stable recombinant expression of human erythropoietin (EPO), since this protein has three N-glycans with mainly tetraantennary structures, low level of poly-LacNAc, and α2,3 sialic acid capping (FIG. 1b), and is one of the best characterized N-glycoproteins produced in CHO. The engineering was performed in the CHO-GS production line (Sigma) grown in suspension in protein-free medium, and EPO expressed in the wildtype cell was found to be glycosylated similar to what has been reported in the past with other CHO lines (FIG. 1b).

    [0493] No apparent consistent morphology or growth phenotypic characteristics were noted apart from subtle clone variations. On average 5-50 clones for each were screened by ELISA and clones with the highest expression were selected. The final purification yields ranging from 0.2 mgs/L to 6.2 mgs/L, but this variation is mainly if not fully ascribable to chance and the limited number of clones screened for each KO clone. The selected CHO WT clone produced final yields of 0.9 mgs/L, while e.g. the KO clone mgat4A/4B/5/B3gnt2 with four deleted genes produced 3.4 mgs/L.

    Control of N-Glycan Antennary Status MGAT1 and 2 each control formation of one of the two β2 branches in biantennary N-glycans, while potential partial functional redundancy is predicted for tri- and tetraantennary branch formation by MGAT4A/4B/4C (β4 branch) and MGAT5/5B (β6 branch), respectively. Only mgat4B and 5 appear to be expressed in CHO (FIG. 4). Targeting mgat4A had minor effect while targeting both mgat4A/4B almost eliminated β4-branched tetraantennary N-glycans (FIG. 1c). Targeting mgat5 in contrast completely eliminated β6-branched tetraantennary structures (FIG. 1c) as well as L-PHA lectin labeling of cells (FIG. 5), which is in agreement with previous studies of lectin-resistant CHO mutants lacking mgat5. Stacking KO of mgat4A/4B and 5 produced homogenous biantennary N-glycans on EPO (FIG. 1c). A minor amount of poly-LacNAc on the biantennary N-glycans was, however, still found, and this is also found as a minor component in wildtype cells.

    Control of LacNAc

    [0494] CHO express all seven known β4galactosyltransferases and our understanding of the in vivo functions of these isoenzymes is poor, but only B4Gal-T1-4 are expected to serve functions in N-glycosylation. We first screened individual KO clones for B4galt1-4, and found that B4Gal-T1 appeared to have the major role (FIG. 1d). Thus, contributions of the other isoforms could only be assessed in stacked combinations with KO of B4galt1. We probed stacked combinations by immunocytology with an antibody to LacNAc showing that only stacked KO of B4galt1/3, but not B4galt1/2/4, appeared to abolish galactosylation (Supplementary FIG. 3). In agreement with this we found that EPO expressed in B4galt1/3 but not B4galt1/2 stacked KO clones had substantial reduction (>90%) in of galactosylation on N-glycans (FIG. 1d). However, complete loss of galactosylation capacity on EPO may require KO of three or more genes.

    Control of poly-LacNAc

    [0495] While poly-LacNAc on N-glycans can confer superior circulatory half-life properties to e.g. EPO, this modification is always incomplete and one of the most heterogeneous and difficult to control for product consistency. CHO cells generally produce low amounts of poly-LacNAc on N-glycans and mainly on tetraantennary structures on the β6arm controlled by MGAT5. Biosynthesis of poly-LacNAc on N-glycans is poorly understood and three genes may be involved, B3gnt1, B3gnt2, and B3gnt8. We screened single gene KO of B3gnt1, B3gnt2, and B3gnt8 with lectin immunocytology using the LEL lectin that recognize poly-LacNAc, and identified B3gnt2 as the key gene controlling the LacNAc initiation in CHO cells (FIG. 5B). In agreement with this, EPO expressed in CHO clones with KO of B3gnt2 and not B3gnt1, resulted in elimination of the minor fraction of poly-LacNAc on EPO (FIG. 1e).

    Control of Sialylation

    [0496] CHO produce almost exclusively α2,3 linked NeuAc capping of N-glycans. All six known ST3Gal transferases are expressed in CHO cells (FIG. 4) and the roles of each of these in sialylation of N-glycans are poorly understood, but candidates are mainly the ST3Gal-III, ST3Gal-IV, and ST3Gal-VI isoforms. We first targeted these three genes individually using immunocytology to evaluate exposure of LacNAc and found that only KO of st3gal4 produced substantial effects (FIG. 7). Analysis of EPO expressed in single and stacked KO clones, showed that loss of st3gal4 and 6 both produced substantial effects, while we found two patterns in clones with KO of st3gal4/6. In WT background KO of st3gal4/6 produced EPO with heterogeneous tetraantennary N-glycans without trace of sialylation (FIG. 1f). KO of st3gal4/6 in combination with mgat4A/413/5 produced biantennary N-glycans without sialylation but increase in poly-LacNAc (FIG. 2b), or in one clone no increase in poly-LacNAc but minor amounts of a mono-sialylated biantennary N-glycan. It is thus possible that targeting of st3gal3/4/6 may be required for complete lack of sialic acid. Regardless, CHO clones without st3gal4 and 6 produced EPO with uncapped LacNAc termini and this opens for de novo engineering of recombinant glycoproteins with α2,6NeuAc capping.

    Custom Glycoengineering of CHO to Produce α2,6NeuAc Capped N-Glycans

    [0497] Most glycoproteins in circulation are capped with α2,6NeuAc, while essentially all recombinant therapeutics are produced with α2,3NeuAc. It has been of longstanding interest to produce CHO cells capable of producing homogenous N-glycans with α2,6NeuAc capping. To demonstrate the perspectives for de novo glycoengineering provided by our KO screen, we generated CHO clones capable of producing homogenous α2,6NeuAc capping (FIG. 2). To circumvent past problems with random plasmid integration, we used ZFN targeted knockin (KI) of ST6Gal-I with a modified Obligare strategy into a SafeHarbor integration site. Human ST6GAL1 introduced in CHO with KO of st3gal4/6 produced the complete range of N-glycan antennary structures with normal degree of NeuAc capping (FIG. 2a), and when introduced in CHO with additional KO of mgat4A/4B/5 EPO was produced with homogenous biantennary N-glycans capped by α2,6NeuAc (FIG. 2b). Interestingly, de novo introduction of ST6GAL1 also abrogated the minor amounts of poly-LacNAc formed on biantennary structures when sialylation was eliminated (FIG. 2b), demonstrating that KO of B3gnt2 as well was unnecessary. Thus, we could introduce capacity for α2,6NeuAc sialylation and produce a CHO cell capable of producing N-glycoproteins with homogenous α2,6NeuAc capping. The Obligare KI strategy was highly efficient with approximately 30-50% single cloned cells expressing ST6Gal-I as evaluated by antibody and lectin immunocytology (FIG. 7), while relying on ZFN-mediated homologous recombination did not produce successful targeted integration in CHO cells. The ST6GAL1 KI clones were stable for over 20 passages as evaluated by immunocytology with SNA lectin and 1B2 MAb (not shown).

    [0498] In summary, the KO screen performed identifies the key glycogenes controlling decisive steps in N-glycosylation of proteins in CHO (FIG. 3), and demonstrates remarkable plasticity in tolerance for glycoengineering without evidence of unexpected compensatory changes in glycosylation. We provide design strategies for generation of CHO host cells with homogeneous biantennary N-glycans with and without sialylation that will serve as platforms for de novo build up of desired glycosylation capacities. The matrix provides general guidance for custom design of the N-glycosylation capacity of CHO, which likely can be used for any CHO host line and even established production lines. We demonstrate the feasibility of de novo engineering of homogenous glycosylation capacities by introducing α2,6sialylation in CHO by a precise KI strategy in CHO lines with KO of endogenous α2,3sialyltransferase genes. The panel of CHO cells generated will enable dissection and de novo design of N-glycosylation for any protein therapeutics, and production of a diverse array of glycoforms of therapeutic proteins will enable simple evaluation and selection of optimal design. The advent of precise gene engineering clearly holds promise for a new era for the biggest producer of glycoprotein therapeutics today, the CHO cell.

    Methods

    [0499] ZFN targeting of glycogenes in CHO cells. All gene targeting was performed in the CHOZN GS−/− (Glutamine Synthase) clone produced by ZFN KO and provided by Sigma-Aldrich, St. Louis, Mo., or in CHO-K1 obtained from ATCC. All CHO media, supplements and other reagents used were obtained from Sigma-Aldrich unless otherwise specified. CHO GS cells were maintained as suspension cultures in EX-CELL CHO CD Fusion serum-free media, supplemented with 4 mM L-glutamine. Cells were seeded at 0.5×10.sup.6 cells/mL in T25 flask (NUNC, Denmark) one day prior to transfection. 2×10.sup.6 cells and 2 μg endotoxin free plasmid DNA of each ZFN (Sigma, USA) were used for transfection. Each ZFN were tagged with GFP and Crimson by a 2A linker. Transfections were conducted by electroporation using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently placed in 3 mL growth media in a 6-well plate. Cells were moved to 30° C. for a 24h cold shock. 72h post nucleofection the 10-15% highest labelled cell pool for both GFP and Crimson were enriched by FACS. Cells were single cell FACS sorted again one week later to obtain single clones in round bottom 96 well plates. KO clones were identified by insertion deletion analysis (IDAA) as recently described, as well as when possible by immunocytology with appropriate lectins and monoclonal antibodies. Selected clones were further verified by TOPO for in detail characterization of mutations introduced. The strategy enabled fast screening and selection of KO clones with frameshift mutations, and on average we selected 2-5 clones from each targeting event. RNAseq analysis of CHO clones was performed by BGI.

    [0500] Recombinant expression of human EPO in CHO cells. An expression construct containing the entire coding sequence of human EPO cloned into pcDNA3.1/myc-His (C-terminal tags) was synthesised by Genewiz, USA. EPO is a 166 amino acid protein with N-glycans at Asn24, Asn38, and Asn83. CHO cells were co-transfected with EPO and GFP plasmids, followed by a FACS to enrich clones expressing GFP. Stable transfectants were selected in 0.4 mg/ml Zeocin (Invitrogen), Positive stable clones were screened by direct enzyme-linked immunosorbent assays (ELISA) using monoclonal anti-His antibody(C-Term)-HRP antibody (Invitrogen). His-tagged recombinant human EPO was purified by nickel affinity purification (Invitrogen, US). Media was mixed 3:1 (v/v) in 4× binding buffer (200 mM Tris, pH8.0, 1.2 M NaCl) and applied to 0.3ml packed NiNTA agarose (Invitrogen), pre-equilibrated in binding buffer (50 mM Tris, pH 8.0, 300 mM NaCl). The column was washed with binding buffer and then bound protein was eluted with binding buffer with additional 250 mM imidazole. Fractions containing EPO were determined by SDS-PAGE and further purified on a reverse-phase HPLC purification with a Jupiter C4 column (5 μm, 300 Å, column 250×4.6 mm) (Phenomenex), using 0.1% trifluoroacetic acid (TFA) and a gradient of 10-100% acetonitrile. Purity was evaluated by Coomassie staining of SDS-PAGE gels and proteins quantified by BCA Protein Assay Kit (Thermo Scientific).

    [0501] N-glycan profiling of recombinant EPO in CHO clones. Approximately 25 μg purified EPO was digested by 2 U PNGase F (Roche Diagnostics, Mannheim, Germany) in 50 mM ammonium bicarbonate at 37° C. for overnight. Released N-glycans were separated from rhEPO using in-house packed Stagetips (Empore disk-C18, 3M) and incubated in 100 mM ammonium acetate, pH 5.0 for 60 min at 22° C. The N-glycans were dried in glass vials and permethylated as described previously. Permethylated N-glycans were extracted with chloroform and desalted by washing the organic phase repeatedly with deionized water. The organic phase was evaporated over a stream of nitrogen gas and the permethylated N-glycans were dissolved in 20 μL 50% methanol. Finally, 1 μL sample was co-crystalized with 1 μL matrix composed of 2,5-dihydroxybenzoic acid (10 mg/ml) in 70% (v/v) acetonitrile, 0.1% (v/v) trifluoroacetic acid and 2.5 mM sodium acetate. Permethylated N-glycans were analyzed by positive mode MALDI-TOF (Autoflex Speed, BrukerDaltronics, Bremen) operated in the reflector mode with data acquisition in them/z 1000-7000 mass range.

    Example 2

    Determining the Glycosyltransferase Repertoire Expressed in a Mammalian CHO Cell Line.

    [0502] CHO-K1 was obtained from ATCC and CHO-GS (CHOZN GS.sup.−/− (Glutamine Synthase) clone produced by ZFN KO) was obtained from Sigma-Aldrich, St. Louis, Mo. All CHO media, supplements and other reagents used were obtained from Sigma-Aldrich unless otherwise specified. CHO-GS ells were maintained as suspension cultures in EX-CELL CHO CD Fusion serum and animal component free media, supplemented with 4 mM L-glutamine. CHO cells were seeded at 0.25×10.sup.6 cells/ml in 6 well plate and harvested at exponential phase 48h post inoculation for total RNA extraction with RNeasy mini kit (Qiagen). RNA intergrity and quality were checked by 2100-Bioanalyser (Agilent Technologies). Library construction and next generation sequencing was performed using Illumina HiSeq 2000 System (Illumina, USA) under standard conditions as recommended by the RNASeq service provider. The aligned data was used to calculate the distribution of reads on CHO reference genes and coverage analysis was performed. Only alignment results that passed QC were used for downstream gene expression analysis.

    [0503] RNAseq analysis was performed on two common CHO lines (CHO-K1, CHO-GS) and two independent CHO-GS triple mgat4a/4b/5 KO clones (ZFN91-1C8, ZFN91-2A6) (TABLE 3). The reported RNAseq analysis of CHO-K1 was included for reference, and this was largely similar to our analyses except that the relative expression levels were higher. Importantly, a few genes including e.g. galnt1 and mgat4b, which was reported not to be expressed in CHO-K1 previously (Xu, Nagarajan et al. 2011), were found to be expressed. Moreover, in the case of mgat4b this gene was found to be essential for the glycoengineering experiments carried out here.

    [0504] An important observation of the analysis of CHO transcriptomes was that the expression profiles of glycogenes in the two triple KO clones analyses were identical to those of the parental CHO lines, demonstrating that the targeted ko gene editing performed in the CHO cell lines did not alter expression of other glycosyltransferase genes.

    Example 3

    Gene Inactivation of Glycosyltransferase Genes in the N-Glycosylation Pathway (Deconstruction).

    [0505] All the glycosyltransferase gene targeted inactivation were performed in CHO-GS and/or in CHO-K1 and cells were grown as described in Example 2. Cells were seeded at 0.5×10.sup.6 cells/mL in T25 flask (NUNC, Denmark) one day prior to transfection. 2×10.sup.6 cells and 2 μg endotoxin free plasmid DNA of each ZFN (Sigma, USA) were used for transfection. Each ZFN was tagged with GFP and Crimson by a 2A linker (Duda, Lonowski et al. 2014). Transfections were conducted by electroporation using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently plated in 3 mL growth media in a 6-well plate. Cells were moved to 30° C. for a 24h cold shock. 72h post nucleofection the 10-15% highest labeled cell pool for both GFP and Crimson were enriched by FACS. We utilized recent developed methods for enriching KO clones by FACS (GFP/Crimson tagged ZFNs) (Duda, Lonowski et al. 2014) and high throughput screening by an amplicon labeling strategy (IDAA) (Zhang, Steentoft et al. submitted). Cells were single cell FACS sorted again one week later to obtain single clones in round bottom 96 well plates. KO clones were identified by IDAA, and when possible also by immunocytology with appropriate lectins and monoclonal antibodies. Selected clones were further verified by TOPO cloning of PCR products (Invitrogen, US) for in detail Sanger sequencing characterization of mutations introduced in individual TOPO clones. The strategy enabled fast screening and selection of KO clones with appropriate inactivation mutations as outlined herein, and on average we selected 2-5 clones from each targeting event.

    [0506] The majority of KO clones exhibited out of frame causing insertions and/or deletions (indels) in the range of ±20 bps, and most targeted genes were present with two alleles, while some (mgat4B and mgat5) were present with 1 or 3 alleles, respectively (TABLE 4).

    [0507] TABLE 4 lists all individual and stacked glycosyltransferase gene inactivation events and the order (ancestry line) of stacking of glycosyltransferase gene inactivation in cells to produce a deconstruction matrix of the N-glycosylation pathway.

    Example 4

    Gene Insertion of Glycosyltransferase Genes in the N-Glycosylation Pathway (Reconstruction).

    [0508] Target specific integration (knockin/KI) was directed towards the CHO Safe Harbor #1 locus (S. Bahr et al., BMC Proceedings 2013, 7(Suppl 6):P3.doi:10.1186/1753-6561-7-S6-P3). A modified ObLiGaRe strategy (33) was used where two inverted ZFN binding sites flank the donor plasmid gene of interest to be knocked in. Firstly a shuttle vector designated ObLiGaRe-2X-Ins was synthesized (TABLE 5). ObLiGaRe-2X-Ins was designed in such a way, that any cDNA sequence encoding protein of interest can be inserted into a multiple cloning site where transcription is driven by CMV IE promotor and a BgH terminator. In order to minimize epigenetic silencing, two insulator elements flanking the transcription unit were inserted. In addition an AAVS1 “landing pad” was included at the 3′ end of ObLiGaRe-2X-Ins just upstream of the 3′ inverted ZFN binding site. A full ST6GAL1 open reading frame was inserted directionally into ObLiGaRe-2X-Ins generating ObLiGaRe-2X-Ins-ST6GAL1 (TABLE 5). Transfection and sorting of clones were performed as described in EXAMPLES 2 and 3. Clones were initially screened by positive SNA lectin staining and selected clones further analyzed by 5′ and 3′ junction PCR to confirm correct targeted integration event into Safeharbor#1 site in the CHO st3gal4/6 KO clones. The allelic copy number of integration was determined by WT allelic PCR. Subsequently, full human MGAT4A open reading frame was inserted directionally into 2nd allele of Safe Harbor#1 in ST6GAL1 KI clone, followed by inserting full human MGAT5 to AAVS1 “landing pad”, which was included at the 3′ end of ObLiGaRe-2X-Ins just upstream of the 3′ inverted ZFN binding site (TABLE 5).

    Example 5

    Recombinant Production of Human EPO and IgG in Gene Edited Mammalian CHO Cells.

    [0509] Expression constructs containing the entire coding sequence of human EPO and a therapeutic IgG cloned into pcDNA3.1/myc-His (C-terminal tags) and pBUDCE4.1 (Invitrogen), respectively, were synthesized by Genewiz, USA. EPO is a 166 amino acid protein with N-glycans at Asn24, Asn38, and Asn83, and IgG has a single N-glycan at Asn297, respectively. Wt or KO CHO cells were transfected with EPO or IgG and maintained at 37° C. as suspension cultures in EX-CELL CHO CD Fusion serum-free media, supplemented with 4 mM L-glutamine and 400 ug/ml Zeocin in 5% CO.sub.2 incubator. Clones were scaled up and grown in T75 flasks at a seeding density of 0.5×10.sup.6 cells/ml, and harvested 72h or 96h later. Cell viability was higher than 90% in all reporter expressing clones and viable cell density are between 2-3×10.sup.6 cells/ml upon harvest. Cells were removed by centrifugation at 300 g for 5 min, and the supernatant were stored at −80° C. His-tagged recombinant human EPO was purified by nickel affinity purification (Invitrogen, US). Media was mixed 3:1 (v/v) in 4× binding buffer (200 mM Tris, pH 8.0, 1.2 M NaCl) and applied to 0.3ml packed NiNTA agarose (Invitrogen), pre-equilibrated in binding buffer (50 mM Tris, pH 8.0, 300 mM NaCl). The column was washed with binding buffer and then bound protein was eluted with binding buffer with additional 250 mM imidazole. Fractions containing EPO were determined by SDS-PAGE and further purified on a reverse-phase HPLC purification with a Jupiter C4 column (5 μm, 300 Å, column 250×4.6 mm) (Phenomenex), using 0.1% trifluoroacetic acid (TFA) and a gradient of 10-100% acetonitrile. IgG was purified by HiTrap™ Protein G HP (GE Healthcare, US) pre-equilibrated/washed in PBS and eluted with 0.1 M Glycine (pH 2.7). Purity of protein was evaluated by Coomassie staining of SDS-PAGE gels, and proteins were quantified by BCA Protein Assay Kit (Thermo Scientific, Rockford, US).

    Example 6

    N-Glycan Profiling of Purified EPO and IgG.

    [0510] Approximately 25 μg purified EPO was digested with 2 U PNGase F (Roche Diagnostics, Mannheim, Germany) in 50 mM ammonium bicarbonate at 37° C. for overnight. For IgG, 35 μg samples were initially digested (overnight, 37° C.) with trypsin in 50 mM ammonium bicarbonate, and then heated at 95° C. for 15 min and cooled to RT before PNGase F digestion as above. Released N-glycans were separated from intact EPO or IgG tryptic digest using in-house packed Stagetips (Empore disk-C18, 3M) and incubated in 100 mM ammonium acetate, pH 5.0 for 60 min at 22° C. The N-glycans were split in three equal aliquots. One-third was dried in glass vials and permethylated as described previously (Ciucanu and Costello 2003) and the remainder was saved for the native N-glycan analysis. Permethylated N-glycans were extracted with chloroform and desalted by washing the organic phase repeatedly with deionized water. The organic phase was evaporated over a stream of nitrogen gas and the permethylated N-glycans were dissolved in 20 μL 50% (v/v) methanol. Finally, 1 μL sample was co-crystalized with 1 μL matrix composed of 2,5-dihydroxybenzoic acid (10 mg/ml) in 70% (v/v) acetonitrile, 0.1% (v/v) trifluoroacetic acid and 2.5 mM sodium acetate. Permethylated N-glycans were analyzed by positive mode MALDI-TOF (Autoflex Speed, BrukerDaltronics, Bremen) operated in the reflector mode with data acquisition (2000 shots/spot) in the m/z 1000-7000 mass range. Glycan compositional analysis of all spectra was performed by the SysBioWare platform and is presented in Supplementary Table 4 (Vakhrushev, Dadimov et al. 2009). Released native N-glycans were reconstituted in MeOH/H.sub.2O (1/1; v/v, containing 50 mM Ammonium bicarbonate) at the concentration of 0.5 pmol/μl and analyzed on an OrbiTrap Fusion MS (Thermo San Hose, USA). Samples were directly infused via EASY-Spray and analysed by negative ion mode. Flow rate was set to 500nl/min, spray voltage 1,900-2,100 V, and ion transfer tube temperature 275° C. Precursor ions were selected (isolation width, m/z 3) and subjected to HCD fragmentation at 35% normalized collision energy (default charge state, z=2). All spectra were recorded at resolution 120,000.

    Example 7

    [0511] Inactivation of Glycosyltransferase Genes by Tandem Single Stranded Oligo Deoxy Nucleotide (ssODN)/ZFN Precise Multi Exon Gene Editing.

    [0512] In this example, gene inactivation is performed by eliminating exons encoding the N-terminal cytoplasmic tail, transmembrane region, and parts of the stem region of the targeted glycosyltransferase gene. The target region deletion is mediated by use of the tandem single stranded oligo deoxy nucleotide (ssODN)/ZFN approach (Duda, Lonowski et al. 2014). The ZFN target site is selected in or as close as possible around the sequence coding for the transmembrane region of the glycosyltransferase. As an example CHO mgat4a is targeted using CHO mgat4a ComposR ZFN's (Sigma) and an ssODN possessing 60 bp homology arm sequences flanking the 5′ UTR region including translational start site and 3′ flanking mgat4a exon2 ZFN target site (mgata ssODN: gagagagattggtcttgcttgtcatcaccaacgtatgaaccagtgtgatggtgaaatgagtcGCCGTGCAGGA GCAGCAACTAACGGAAGTAACACTGCATTGACTACATTTTCAGGTAC) (5′ UTR region shown in lower case, partial ZFN cut site in lower case italics and 3′ flanking exons 2 ZFN binding site in upper case), thus removing the exon 1-2 encoding cytoplasmic tail, transmembrane domain and stem of mgat4a. Gene inactivation is performed in CHO-GS as described in Example 2 including mgata ssODN. Transfections were conducted by electroporation using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently placed in 3 mL growth media in a 6-well plate. Cells were moved to 30° C. for a 24h cold shock. 72h post nucleofection the 10-15% highest labeled cell pool for both GFP and Crimson were enriched by FACS. Cells were single cell FACS sorted again one week later to obtain single clones in round bottom 96 well plates. Enrichment of KO clones was performed by FACS (GFP/Crimson tagged ZFNs). Clones are analyzed by PCR using primers Mgataex1F (5′-TATCCACTGTGTTGCTTGCTG-3′)/Mgataex2R (5′-Actgctcttccagaggtcctg d-3′), only detecting correctly target deleted clones. Mono/bi-allelic targeting was determined by PCR wt allele presence detection using primers Mgataex2F (5′-gaacgccttcgaatagctgaacatagg-3′)/Mgataex2R. Genetic PCR results are validated by Southern blot analysis using an intron2 specific probe detecting correct removal of 37 KBp intron1 target region carrying diagnostic KpnI sites.

    Example 8

    Inactivation of Glycosyltransferase Genes by Multi-Exon Dual CRISPR/Cas9 Gene Editing.

    [0513] Gene inactivation is ensured by removal of exons encoding the cytoplasmic tail/transmembrane and parts of the stem encoded sequences of the desired gene needed to be inactivated. Target region deletion is mediated by use of a pairs of CRISPR/Cas9-gRNAs targeting the flanking regions encoding Mgat4a signal sequence, transmembrane anchoring and stem-regions. CHO Mgat4a is targeted using CHO Mgat4a CRISPR/Cas9 gRNA's Mgat4aEx1gRNA (5′-GGTATACCACATGGCAAAATGGG-3′) specific for exon1 and Mgat4aEx2gRNA (5′-GTCCAACAGTTTCGCCGTGCAGG-3′) specific for exon2. Both gRNA's were cloned into the BbsI (NEB, USA) gRNA target site of px458 (Addgene, USA) encoding GFP tagged S. pyogenes Cas9 and U6 promoter driven gRNA casette, generating px458-CRISPR-Mgat4aex1gRNA and px458-CRISPR- Mgat4aex2gRNA. Precise gene editing by nucleofection using 2 ug of these CRISPR/Cas9-Mgat4a editing tools and target selection validation was performed in CHO-GS cells as described in Examples 3 and 7.

    Example 9

    Enzymatic GlycoPEGylation of Glycoproteins Monoantennary N-Glycans.

    [0514] KO of mgat2 in combination with mgat4a/4b/5 in CHO cells resulted in homogeneous monoantennary N-glycans when EPO was expressed (FIG. 32).

    [0515] Reintroduction of human MGAT4A as well as MGAT4A and 5 in combination by knockin resulted in tri and tetraantennary N-glycans, respectively (FIG. 32), demonstrating that the monoantennary N-glycan obtained is linked β1-2 to the α1-3Man branch controlled by mgat1. Enzymatic glycopegylation or transfer of other compounds by sialyltransferases and CMP-(PEG)NeuAc or relevant modified donor was tested using EPO as an example (FIGS. 33-34).

    [0516] Material and Methods Glycovariants of EPO-Myc-His6 were produced in CHO with KO mgat2/4a/4b/5 and purified on a nickel-NTA column and buffer exchanged into 100 mM Tris, 150 mM NaCl, 0.005% NaN3, pH 7.2 buffer as described in Example 4. Wild type EPO-Myc-His6 with normal glycosylation profile was produced in non modified CHO cells and in similar way purified on a nickel-NTA column before buffer exchanged into 100 mM Tris, 150 mM NaCl, 0.005% NaN3, pH 7.2 buffer. Protein concentrations were determined by NanoDrop Lite Spectrophotometer (Thermo Scientific™). Sialyltransferase (ST3Gal-III; 1.35 U/ml) in 20 mM HEPES, 120 mM NaCl, 50% glycerol, pH 7.0 was obtained from FujiFilm Diosynth Biotechnologies, Japan. Sialidase (Artherobacter urifaciens) was produced at Novo Nordisk A/S and used as a 200 U/ml solution in 20 mM HEPES, 120 mM NaCl, 50% glycerol, pH 7.0. Support bound neuraminidase (Clostridium perfringens) on agarose was obtained from Sigma (Cat. # N5254-10UN). The resin was washed extensively in MilliQ water before use. 10k-PSC (cytidine-5′-monophosphoryl-[5-(N-10 kDa-methoxypolyoxyethylene-oxycarboxamido)glycylamido-3,5-dideoxy-D-glycero-n-galacto-2-nonulopyranosuronate], Lot: 3605-A-R0-01-61-1) was obtained from Albany Molecular Research, Inc, Albany, N.Y. 12203, US. 10k-PSC was produced as described in WO03031464. The tris-buffer used in examples below contained 50 mM tris-HCl, 150 mM NaCl, pH 7.6.

    [0517] SDS-PAGE gel electrophoresis was performed on NuPage precast gels (NuPage 7 Tris-Acetate Gel, 15 wells, Invitrogen cat. No. EA03555BOX) using NuPage Tris-Acetate SDS Running buffer (Invitrogen cat. No. # LA0041). Samples (0.15 mg/ml) were added NuPage Sample Reducing Agent (Invitrogen cat. No. NP0004) and LDS sample buffer (Invitrogen cat. No. NP0008) and heated to 70° C. for 10 min before gel loading. HiMark HMW (Invitrogen cat. No. LC6060) was used as standard. Electrophoresis was performed at 150 V, 120 mA & 25 W for 60 min. Gels were stained with SimplyBlue SafeStain (Invitrogen cat. No. LC5688) according to Invitrogen protocols. Coomasie stained gels were analysed by densitometry using GelQuant software and methods described previously (Rehbein and Schwalbe 2015) (FIG. 34).

    [0518] HPLC analysis of GlycoPEGylated EPO-Myc-His6 conjugates of the invention was performed as follows. Samples were analysed in non-reduced form. A Zorbax 300SB-C3 column (4.6×50 mm; 3.5 um Agilent, Cat. No.: 865973-909) was used. Column was operated at 30° C. 2.5 ug sample was injected, and column eluted with a water (A)—acetonitrile (B) solvent system containing 0.1% trifluoroacetic acid. The gradient program was as follows: 0 min (25% B); 4 min (25% B); 14 min (46% B); 35 min (52% B); 40 min (90% B); 40.1 min (25% B).

    [0519] Enzymatic glycoPEGylation of EPO-Myc-His6 variants was performed by either an one-pot method using sialidase in combination with ST3Gal-III, or by a sequential method where the EPO-Myc-His6 variant was first reacted with agarose-neuraminidase gel for 3h at 25° C., then after transferring the supernatant to a fresh vial reacted with the ST3Gal-III and PSC reagent. The one-pot method relies on the fact that Artherobacter urifaciens sialidase is unable to desialylate PEGylated sialosides. Use of recombinant glycoproteins with monoantennary N-glycans without sialic acid capping as invented eliminates the need for prior desialylation.

    [0520] GlycoPEGylation of recombinant human erythropoietin—Recombinant wildtype EPO-Myc-His6 produced in CHO cell lines was dissolved in 100 mM Tris, 150 mM NaCl, 0.005% NaN3 (pH 7.2) to a concentration of 1.17 mg/ml. 10k-PSC reagent (2.0 mg) was dissolved in 100 ul 50 mM Tris-HCl, 150 mM NaCl (pH 7.6) to a concentration of 20 mg/ml. ST3Gal-III and AUS were both dissolved in 20 mM HEPES, 120 mM NaCl, 50% glycerol, pH 7.0 to a volumetric concentration of 1.35 U/ml and 200 U/ml respectively. Reagents were mixed according to scheme below:

    TABLE-US-00004 Unit Exp. 1 Exp. 2 Exp. 3 Exp. 4 Exp. 5 wtEPO ug 10 10 10 10 10 10k-PSC eq 1 5 10 25 50 ST3Gal3 mU/ug 0.196 0.196 0.196 0.196 0.196 wtEPO Sialidase U/ml 5 5 5 5 5 Tris buffer ul 9.0 8.4 7.6 5.3 1.3 Final volume ul 28.45 28.45 28.45 28.45 28.45 Final [wtEPO] mg/ml 0.35 0.35 0.35 0.35 0.35

    [0521] Reactions were incubated for 18h at 32° C. Samples were then analysed by HPLC and SDS-PAGE (FIG. 33, lanes 5-9).

    [0522] GlycoPEGylation of erythropoietin produced in CHO cells with KO of mgat2/4A/4B/5—Recombinant wtEPO-Myc-His6 glycosylation variant produced in Mgat2/4a/4b/5 knock-out CHO cell line was dissolved in 100 mM Tris, 150 mM NaCl, pH 7.2 to a concentration of 0.585 mg/ml. 10k-PSC reagent (2.0 mg) was dissolved in 100 ul 50 mM Tris-HCl, 150 mM NaCl, pH 7.6 to a concentration of 20 mg/ml. ST3GalIII and AUS were both dissolved in 20 mM HEPES, 120 mM NaCl, 50% glycerol, pH 7.0 to a volumetric concentration of 1.35 U/ml and 200 U/ml respectively. Reagents were mixed according to scheme below:

    TABLE-US-00005 Unit Exp. 1 Exp. 2 Exp. 3 Exp. 4 Exp. 5 EPO-Myc-His6 ug 10 10 10 10 10 10k-PSC eq 1 5 10 25 50 ST3Gal3 mU/ug 0.196 0.196 0.196 0.196 0.196 EPO Sialidase U/ml 5 5 5 5 5 Tris buffer ul 9.0 8.4 7.6 5.3 1.3 Final volume ul 28.45 28.45 28.45 28.45 28.45 Final [EPO] mg/ml 0.35 0.35 0.35 0.35 0.35

    [0523] Reactions were incubated for 18h at 32° C. Samples were then analysed by HPLC and SDS-PAGE (FIG. 22, lanes 11-15).

    [0524] Two step glycoPEGylation reaction of recombinant human erythropoietin—EPO-Myc-His6 (272 ug) in 100 mM Tris, 150 mM NaCl, 0.005% NaN3, pH 7.2 (0.214 mg/ml) was treated with prewashed immobilized sialidase (150 ul suspension, 150 mU) for 3h at room temperature. Resin was then removed by filtration. The filtrate was analysed by LC-MS to confirm formation of asialo EPO-Myc-His6 in monoantennary N-glycan form (calculated mass 25,464.97 Da, analysis 25,465.30 Da).

    TABLE-US-00006 Calc. average mass Found Assignment 26921.23 Da 26921.53 Da Penta sialylated EPO-myc-His6 containing 3 mono antennary N-glycanes and one O- glycan 26629.98 Da 26630.34 Da Tetra sialylated EPO-myc-His6 containing 3 mono antennary N-glycanes and one O- glycan 26338.72 Da 26339.16 Da Tri sialylated EPO-myc-His6 containing 3 mono antennary N-glycanes and one O- glycan 25464.97 Da 25465.30 Da Desialylated (neuraminidase treated) EPO-myc-His6 containing 3 mono antennary N-glycanes and one O-glycan

    [0525] The filtrate was then added 10k-PSC reagent dissolved in 100 ul 50 mM Tris-HCl, 150 mM NaCl, pH 7.6. ST3Gal-III and AUS were both dissolved in 20 mM HEPES, 120 mM NaCl, 50% glycerol, pH 7.0 to a volumetric concentration of 1.35 U/ml and 200 U/ml respectively. Reagents were mixed according to scheme below:

    TABLE-US-00007 Unit Exp. 1 Exp. 2 Exp. 3 Exp. 4 Exp. 5 asialo EPO- ug 20 20 20 20 20 Myc-His6 10k-PSC eq 1 3 5 10 20 St3Gal3 mU/ug 0.196 0.196 0.196 0.196 0.196 EPO Tris buffer ul 14.0 12.5 11.0 7.4 0 Final volume ul 117.6 117.6 117.6 117.6 117.6 Final EPO mg/ml 0.17 0.17 0.17 0.17 0.17

    [0526] Reactions were incubated for 20h at 32° C. Samples were then analysed by HPLC and SDS-PAGE.

    [0527] Further Tables

    TABLE-US-00008 TABLE 4  ZFN design and sequence analysis of CHO glycoengineered clones. Inser & Clone Del Alignment¤ KO:mgat4A mgat4A- ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt------------- WT tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-  −5 bp TTCTGAGTTGAATGCCATTGTCCAACAg------------------ alle1 CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A- +13 bp TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC alle2 AGGAGCAGCAACTAACGGAAG KO:mgat4A/4B mgat4A- ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt WT tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-  −5 bp TTCTGAGTTGAATGCCATTGTCCAACAg alle1 CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A- +13 bp TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC alle2 AGGAGCAGCAACTAACGGAAG mgat4B- ZFN GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT WT mgat4B-  −7 bp GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT alle1 KO:mgat5 mgat5-WT ZFN GGGGGATGATGCTTCTGCACTTCACCATCCAg-------------- cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5- +14 bp GGGGGATGATGCTTCTGCACTTCACCATCCAgcaTGAATTCTAGATGAgcgG alle1 ACTCAGCCTGAGAGCAGCTCCATGTT mgat5-  −1 bp GGGGGATGATGCTTCTGCACTTCACCATCCAg--------------- alle2 agcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5- +61 bp GGGGGATGATGCTTCTGCACTTCACCATCCAgcag-----(+61 bp)-- alle3 cgGACTCAGCCTGAGAGCAGCTCCATGTT KO:mgat4A/4B/5 mgat4A- ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt------------- WT tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-  −5 bp TTCTGAGTTGAATGCCATTGTCCAACAg------------------ alle1 CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A- +13 bp TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC alle2 AGGAGCAGCAACTAACGGAAG mgat4B-WT ZFN GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT mgat4B-  −7 bp GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT alle1 GGGGGATGATGCTTCTGCACTTCACCATCCAg---- mgat5-WT ZFN cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-  +4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG alle1 AGAGCAGCTCCATGTT mgat5-  −4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAg-------- alle2 gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5- −16 bp GGGGGATGATGCTTCTGCACTTC-------------------- alle3 CTCAGCCTGAGAGCAGCTCCATGTT KO:B3gnt1 B3gnt1-WT ZFN TGCAGCTGCTCTACCTGTC-----------gctgcTCTCCGGACTGCACG B3gnt1- +11 bp TGCAGCTGCTCTACCTGTCgcagcTGCTCTACCTGTCTCCGGACTGCACG alle1 B3gnt1-  −5 bp TGCAGCTGCTCTACCTGTC----------------TCTCCGGACTGCACG alle2 KO:B3gnt2 B3gnt2- ZFN TTCAGCCCTTCCcgggcGTACTGGAACAGAGAGCA WT B3gnt2-  −1 bp TTCAGCCCTTCC-gggcGTACTGGAACAGAGAGCA alle1 B3gnt2-  −4 bp TTCAGCCCTTCCcg----TACTGGAACAGAGAGCA alle2 KO:B4galt1 B4galt1- ZFN TGCATCCGGTCCTACAGCgccagc----AACTGGACTATGGTA WT B4galt1-  +4 bp TGCATCCGGTCCTACAGCgccagcCAGCAACTGGACTATGGTA alle1 KO:B4galt2 B4galt2- ZFN CAGCCCCGCCACTTTgcc-----------atcGCCATGGACAAGTTTGGCT WT B4galt2- +73 bp CAGCCCCGCCACTTTgcc--(+73 bp)--atcGCCATGGACAAGTTTGGCT alle1 KO:B4galt3 B4galt3- ZFN CTAGCCCTCAAGTCAGGAtgt-----tgCGGAGGCTGCTGGAGAGG WT B4galt3-  +5 bp CTAGCCCTCAAGTCAGGAtgtCGTGTtgCGGAGGCTGCTGGAGAGG alle1 B4galt3-  +2 bp CTAGCCCTCAAGTCAGGAtgt---tgCCCGGAGGCTGCTGGAGAGG alle2 KO:B4galt4 B4galt4- ZFN AACTGGGACTGCTTTat----attcCACGATGTGGACCTGGTG WT B4galt4-  +1 bp AACTGGGACTGCTTTat---TattcCACGATGTGGACCTGGTG alle1 B4galt4-  +4 bp AACTGGGACTGCTTTatattTATTcCACGATGTGGACCTGGTG alle2 KO:B4galt1/2 B4galt1- ZFN TGCATCCGGTCCTACAGCgccagc----AACTGGACTATGGTA WT B4galt1-  +4 bp TGCATCCGGTCCTACAGCgccagcCAGCAACTGGACTATGGTA alle1 B4galt2- ZFN CAGCCCCGCCACTTTgccatcGCCATGGACAAGTTTGGCT WT B4galt2-  −8 bp CAGCCCCGCCAC--------cGCCATGGACAAGTTTGGCT alle1 B4galt2- −14 bp CAGCCC--------------cGCCATGGACAAGTTTGGCT alle2 KO:st3Gal3 st3Gal3- ZFN CTCTCTCTTTGTCCTTGCtggcttCAAATGGCAGGACTTCAAG WT st3Gal3-  −5 bp CTCTCTCTTTGTCCTTGCt-----CAAATGGCAGGACTTCAAG alle1 st3Gal3-  −1 bp CTCTCTCTTTGTCCTTGCtggct-CAAATGGCAGGACTTCAAG alle2 KO:st3Gal4 st3Gal4- ZFN GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC WT st3Gal4-  +4 bp GGCAGCCTCCAGTGTCGTCgttgtTTGTgTTGTGGTGGGGAATGGGC alle1 st3Gal4-  −4 bp GGCAGCCTCCAGTGTCGTCg--------gTTGTGGTGGGGAATGGGC alle2 KO:st3Gal6 st3Gal6- ZFN CGGTACCTCTGATTTTGCTttgccCTATGGGACAAGGCC WT st3Gal6-  −4 bp CGGTACCTCTGATTTTGCTt----CTATGGGACAAGGCC alle1 st3Gal6- −22 bp CGGTACCTCTGA----------------------AGGCC alle2 KO:st3Gal3/4 st3Gal3- ZFN CTCTCTCTTTGTCCTTGCtggcttCAAATGGCAGGACTTCAAG WT st3Gal3-  −5 bp CTCTCTCTTTGTCCTTGCt-----CAAATGGCAGGACTTCAAG alle1 st3Gal3-  −1 bp CTCTCTCTTTGTCCTTGCtggct-CAAATGGCAGGACTTCAAG alle2 st3Gal4- ZFN GGCAGCCTCCAGTGTCGTCgttgt-----gTTGTGGTGGGGAATGGGC WT st3Gal4-  −4 bp GGCAGCCTCCAGTGTCGTCg---------gTTGTGGTGGGGAATGGGC alle1 st3Gal4-  +5 bp GGCAGCCTCCAGTGTCGTCgACACGttgtgTTGTGGTGGGGAATGGGC alle2 KO:st3Gal4/6 st3Gal4- ZFN GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC WT st3Gal4-  +4 bp GGCAGCCTCCAGTGTCGTCgttgtTTGTgTTGTGGTGGGGAATGGGC alle1 st3Gal4-  −4 bp GGCAGCCTCCAGTGTCGTCg--------gTTGTGGTGGGGAATGGGC alle2 st3Gal6- ZFN CGGTACCTCTGATTTTGCT-ttgccCTATGGGACAAGGCC WT st3Gal6-  +1 bp CGGTACCTCTGATTTTGCTTttgccCTATGGGACAAGGCC alle1 st3Gal6-  −7 bp CGGTACCTCTGATTTTG--------CTATGGGACAAGGCC alle2 KO:B3gnt2/mgat4A/4B/5 mgat4A- ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt------------- WT tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-  −5 bp TTCTGAGTTGAATGCCATTGTCCAACAg------------------ alle1 CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A- +13 bp TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC alle2 AGGAGCAGCAACTAACGGAAG mgat4B- ZFN GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT WT mgat4B-  −7 bp GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT alle1 mgat5-WT ZFN GGGGGATGATGCTTCTGCACTTCACCATCCAg---- cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-  +4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG alle1 AGAGCAGCTCCATGTT mgat5-  −4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAg-------- alle2 gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5- −16 bp GGGGGATGATGCTTCTGCACTTC-------------------- alle3 CTCAGCCTGAGAGCAGCTCCATGTT B3gnt2- ZFN TTCAGCCCTTCC--cgggcGTACTGGAACAGAGAGCA WT B3gnt2-  +2 bp TTCAGCCCTTCCCCcgggcGTACTGGAACAGAGAGCA alle1 B3gnt2-  +1 bp TTCAGCCCTTCCC-cgggcGTACTGGAACAGAGAGCA alle2 KO:st3Gal4/6/mgat4A/4B/5 mgat4A- ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt------------- WT tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-  −5 bp TTCTGAGTTGAATGCCATTGTCCAACAg------------------ alle1 CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A- +13 bp TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC alle2 AGGAGCAGCAACTAACGGAAG mgat4B- ZFN GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT WT mgat4B-  −7 bp GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT alle1 mgat5-WT ZFN GGGGGATGATGCTTCTGCACTTCACCATCCAg---- cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-  +4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG alle1 AGAGCAGCTCCATGTT mgat5-  −4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAg-------- alle2 gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5- −16 bp GGGGGATGATGCTTCTGCACTTC-------------------- alle3 CTCAGCCTGAGAGCAGCTCCATGTT st3Gal4- ZFN GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC WT st3Gal4-  −5 bp GGCAGCCTCCAGTGTCGTCgttgt---------gGTGGGGAATGGGC alle1 st3Gal4-  +4 bp GGCAGCCTCCAGTGTCGTCgTTGTttgtgTTGTGGTGGGGAATGGGC alle2 st3Gal6- ZFN CGGTACCTCTGATTTTGCTttgccCTATGGGACAAGGCC WT st3Gal6-  −4 bp CGGTACCTCTGATTTTGCTt----CTATGGGACAAGGCC alle1 st3Gal6-  −2 bp CGGTACCTCTGATTTTGCTttg--CTATGGGACAAGGCC alle2 KI:ST6GAL1/KO:st3gal4/6 st3Gal4- ZFN GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC WT st3Gal4-  +4 bp GGCAGCCTCCAGTGTCGTCgttgtTTGTgTTGTGGTGGGGAATGGGC alle1 st3Gal4-  −4 bp GGCAGCCTCCAGTGTCGTCg--------gTTGTGGTGGGGAATGGGC alle2 st3Gal6- ZFN CGGTACCTCTGATTTTGCT-ttgccCTATGGGACAAGGCC WT st3Gal6-  +1 bp CGGTACCTCTGATTTTGCTTttgccCTATGGGACAAGGCC alle1 st3Gal6-  −7 bp CGGTACCTCTGATTTTG--------CTATGGGACAAGGCC alle2 KI:ST6GAL1/KO:st3gal4/6/mgat4A/4B/5 mgat4A- ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt------------- WT tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-  −5 bp TTCTGAGTTGAATGCCATTGTCCAACAg------------------ alle1 CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A- +13 bp TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC alle2 AGGAGCAGCAACTAACGGAAG mgat4B- ZFN GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT WT mgat4B-  −7 bp GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT alle1 mgat5-WT ZFN GGGGGATGATGCTTCTGCACTTCACCATCCAg---- cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-  +4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG alle1 AGAGCAGCTCCATGTT mgat5-  −4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAg-------- alle2 gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5- -16 bp GGGGGATGATGCTTCTGCACTTC-------------------- alle3 CTCAGCCTGAGAGCAGCTCCATGTT st3Gal4- ZFN GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC WT st3Gal4-  −5 bp GGCAGCCTCCAGTGTCGTCgttgt---------gGTGGGGAATGGGC alle1 st3Gal4-  +4 bp GGCAGCCTCCAGTGTCGTCgTTGTttgtgTTGTGGTGGGGAATGGGC alle2 st3Gal6- ZFN CGGTACCTCTGATTTTGCTttgccCTATGGGACAAGGCC WT st3Gal6-  −4 bp CGGTACCTCTGATTTTGCTt----CTATGGGACAAGGCC alle1 st3Gal6-  −2 bp CGGTACCTCTGATTTTGCTttg--CTATGGGACAAGGCC alle2 KO:mgat2 mgat2-WT TALEN TCCTTTGTCGCCCATTGCTgctccagaggacgaagCCGCAGGCGGCCACCAC GA mgat2-  −4 bp TCCTTTGTCGCCCATTGCTgctcc---- alle1 gacgaagccgcaggcggccaccacga KO:mgat2/stgal4/6 mgat2-WT TALEN TCCTTTGTCGCCCATTGCTgctccagaggacgaagCCGCAGGCGGCCACCAC GA mgat2-  −4 bp TCCTTTGTCGCCCATTGCTgctccag---- alle1 cgaagCCGCAGGCGGCCACCACGA st3Gal4- ZFN GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC WT st3Gal4-  +4 bp GGCAGCCTCCAGTGTCGTCgttgtTTGTgTTGTGGTGGGGAATGGGC alle1 st3Gal4-  −4 bp GGCAGCCTCCAGTGTCGTCg--------gTTGTGGTGGGGAATGGGC alle2 st3Gal6- ZFN CGGTACCTCTGATTTTGCT-ttgccCTATGGGACAAGGCC WT st3Gal6-  +1 bp CGGTACCTCTGATTTTGCTTttgccCTATGGGACAAGGCC alle1 st3Gal6-  −7 bp CGGTACCTCTGATTTTG--------CTATGGGACAAGGCC alle2 KO:mgat2/mgat4A/4B/5 mgat2-WT TALEN TCCTTTGTCGCCCATTGCTgctccagaggacgaagCCGCAGGCGGCCACCAC GA mgat2-  −4 bp TCCTTTGTCGCCCATTGCTgctccag---- alle1 cgaagCCGCAGGCGGCCACCACGA mgat4A- ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt------------- WT tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-  −5 bp TTCTGAGTTGAATGCCATTGTCCAACAg------------------ alle1 CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A- +13 bp TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC alle2 AGGAGCAGCAACTAACGGAAG mgat4B- ZFN GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT WT mgat4B-  −7 bp GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT alle1 mgat5-WT ZFN GGGGGATGATGCTTCTGCACTTCACCATCCAg---- cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-  +4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG alle1 AGAGCAGCTCCATGTT mgat5-  −4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAg-------- alle2 gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5- −16 bp GGGGGATGATGCTTCTGCACTTC-------------------- alle3 CTCAGCCTGAGAGCAGCTCCATGTT KO:mgat2/st3gal4/6/mgat4A/4B/5 mgat2-WT TALEN TCCTTTGTCGCCCATTGCTgctccagaggacgaagCCGCAGGCGGCCACCAC GA mgat2-  −5 bp TCCTTTGTCGCCCATTGCTgctcca----- alle1 cgaaGCCGCAGGCGGCCACCACGA mgat4A- ZFN TTCTGAGTTGAATGCCATTGTCCAACAgtt------------- WT tcGCCGTGCAGGAGCAGCAACTAACGGAAG mgat4A-  −5 bp TTCTGAGTTGAATGCCATTGTCCAACAg------------------ alle1 CCGTGCAGGAGCAGCAACTAACGGAAG mgat4A- +13 bp TTCTGAGTTGAATGCCATTGTCCAACAgttGAATTCTAGATGAtcGCCGTGC alle2 AGGAGCAGCAACTAACGGAAG mgat4B- ZFN GCCCTCCAGCAGCCCTCTgaggaCTGGATGATCCTGGAGTT WT mgat4B-  −7 bp GCCCTCCAGCAGCCCTCTg-------GATGATCCTGGAGTT alle1 mgat5-WT ZFN GGGGGATGATGCTTCTGCACTTCACCATCCAg---- cagcgGACTCAGCCTGAGAGCAGCTCCATGTT mgat5-  +4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAgcagcCAGCgGACTCAGCCTG alle1 AGAGCAGCTCCATGTT mgat5-  −4 bp GGGGGATGATGCTTCTGCACTTCACCATCCAg-------- alle2 gGACTCAGCCTGAGAGCAGCTCCATGTT mgat5- −16 bp GGGGGATGATGCTTCTGCACTTC-------------------- alle3 CTCAGCCTGAGAGCAGCTCCATGTT st3Gal4- ZFN GGCAGCCTCCAGTGTCGTCgttgt----gTTGTGGTGGGGAATGGGC WT st3Gal4-  −5 bp GGCAGCCTCCAGTGTCGTCgttgt---------gGTGGGGAATGGGC alle1 st3Gal4-  +4 bp GGCAGCCTCCAGTGTCGTCgTTGTttgtgTTGTGGTGGGGAATGGGC alle2 st3Gal6- ZFN CGGTACCTCTGATTTTGCTttgccCTATGGGACAAGGCC WT st3Gal6-  −4 bp CGGTACCTCTGATTTTGCTt----CTATGGGACAAGGCC alle1 st3Gal6-  −2 bp CGGTACCTCTGATTTTGCTttg--CTATGGGACAAGGCC alle2 KO:fut8 fut8-WT CRISPR CAAATACTTGATCCGTCCACAACCT-TGGCTGGAAAGGGAA fut8-  −1 bp CAAATACTTGATCCGTCCACAACC--TGGCTGGAAAGGGAA alle1 fut8-  +1 bp CAAATACTTGATCCGTCCACAACCTTTGGCTGGAAAGGGAA alle2 KO:fut8/B4galt1 fut8-WT CRISPR CAAATACTTGATCCGTCCACAACCT-TGGCTGGAAAGGGAA fut8-  −4 bp CAAATACTTGATCCGTCCACAA-----GGCTGGAAAGGGAA alle1 fut8-  +1 bp CAAATACTTGATCCGTCCACAACCTTTGGCTGGAAAGGGAA alle2 B4galt1- ZFN TGCATCCGGTCCTACAGCgccagc----AACTGGACTATGGTA WT B4galt1-  +4 bp TGCATCCGGTCCTACAGCgccagcCAGCAACTGGACTATGGTA alle1 KO:mgat3 mgat3-WT ZFN TTCCTGGACCACTTCCCAcccggt----------GGCCGGCAGGATGGC mgat3- −21 bp TTCCTGGACCACT-------------------------------ATGGC alle1 mgat3- +293 bp  TTCCTGGACCACTGATACcc--+293 bp--cggtGGCCGGCAGGATGGC alle2 KO:mgat4C mgat4C- ZFN ATACTTCAGACTATtatgtAATGCTCGAAGATGATGTT WT mgat4C- −13 bp ATACTTCAGACT-------------CGAAGATGATGTT alle1 mgat4C-  −8 bp ATACTTCAGACTAT--------GCTCGAAGATGATGTT alle2 KO:mgat5B mgat5B- ZFN CGTGGCGCCCTCCGCAAGatgagtGACCTGCTGGAGCTG WT mgat5B-  −7 bp CAGCTCCAGCAGGT-------CTTGCGGAGGGCGCCACG alle1 mgat5B-  −5 bp CAGCTCCAGCAGGT-----ATCTTGCGGAGGGCGCCACG alle2 KO:B3gnt8 B3gnt8- TALEN TGGTCCAGAGATAGCTAATgaagcttctagggtgGAGAAGCTGGGGCTGCTG WT A B3gnt8- −17 bp TGGTCCAGAGG----------------- alle1 AGGGTGGAGAAGCTGGGGCTGCTGA KO:mgat1 mgat1-WT ZEN AACAAGTTCAAGTTCccagcaGCTGTGGTAGTGGAGGAC mgat1-  −2 bp AACAAGTTCAAGTTCc--gcaGCTGTGGTAGTGGAGGAC alle1

    [0528] Gene targeting region underlined.

    TABLE-US-00009 TABLE 5  tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgta agcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaac tatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaagga gaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctc ttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcc cagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtaccaagcttggttgcatgctgtccggag tctcagcgttataccagaagtgacctgggtcggggaagactatagtgtcacctaaatctctagagcccttcat taggcgcgccaatcccattgcaaattctacaaaaggagtgtttcccaactgctctatcaagaggaatgttgca cactgtgacctgaatgcaaacatcacacgcgccagcagagaggaagaagagaggcttccctgaccgggaatcg aacccgggccgcggcggtgagagcgccgaatcctaaccactagaccaccagggagcacgcgccaaagctcaat gagctataattatccccttggaaaacctacaaaaacagtgtttcaaaactgctctgtgaaaagggacctttgc tagcacgcggcgccaggcaaaacgtgggcacgctgcgttggccgggaatcgaacccgggtcaactgcttggaa ggcagctatgctcaccactataccaccaacgcgcacacgcgccagcagattctacgggaagagtgtttcaaaa ctgctctatcaagagaaatgttccaccttgtgtgtggaatgcagccatcacacgcgtccatgaaagggcttaa ttaagatatcgtttaaacgtcgacctgcagaggccggcggataactagctgatcgcggaatcctgtccctagg ccacccactgtggggtgcccttcattaggcgcgccaatcccattgcaaattctacaaaaggagtgtttcccaa ctgctctatcaagaggaatgttgcacactgtgacctgaatgcaaacatcacacgcgccagcagagaggaagaa gagaggcttccctgaccgggaatcgaacccgggccgcggcggtgagagcgccgaatcctaaccactagaccac cagggagcacgcgccaaagctcaatgagctataattatccccttggaaaacctacaaaaacagtgtttcaaaa ctgctctgtgaaaagggacctttgctagcacgcggcgccaggcaaaacgtgggcacgctgcgttggccgggaa tcgaacccgggtcaactgcttggaaggcagctatgctcaccactataccaccaacgcgcacacgcgccagcag attctacgggaagagtgtttcaaaactgctctatcaagagaaatgttccaccttgtgtgtggaatgcagccat cacacgcgtccatgaaagggcggttgcatgctgtccggagtctcagcgttataccagaagtgacctgggtcgg ggaagaaaagcttcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatac gagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctc actgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggc ggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgag cggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtg agcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccc cctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccagg cgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctt tctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgc tccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttg agtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggta tgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatc tgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctg gtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgat cttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaa aggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaactt ggtctgacagttagaaaaactcatcgagcatcaaatgaaactgcaatttattcatatcaggattatcaatacc atatttttgaaaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccataggatggcaagatcc tggtatcggtctgcgattccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggt tatcaagtgagaaatcaccatgagtgacgactgaatccggtgagaatggcaaaagtttatgcatttctttcca gacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaaccgttattcattcgt gattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatgcaacc ggcgcaggaacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctggaatgc tgttttcccagggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcgga agaggcataaattccgtcagccagtttagtctgaccatctcatctgtaacatcattggcaacgctacctttgc catgtttcagaaacaactctggcgcatcgggcttcccatacaatcgatagattgtcgcacctgattgcccgac attatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgcggcctagagcaagac gtttcccgttgaatatggctcatactcttcctttttcaatattattgaagcatttatcagggttattgtctca tgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagt gccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcccttt cgtc