MICRORNA COMBINATIONS FOR ANTI-CANCER THERAPEUTICS
20170369878 · 2017-12-28
Assignee
Inventors
Cpc classification
C12N15/111
CHEMISTRY; METALLURGY
A61K31/7088
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C12N2310/51
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61K31/7088
HUMAN NECESSITIES
G01N33/50
PHYSICS
Abstract
Described herein are methods and compositions of combinations of microRNAs that enhance the sensitivity of cancer cells to chemotherapeutic agents or reduce proliferation of cancer cells. Also described herein are methods for the identification of combinations of microRNAs that result in desired effects.
Claims
1. A composition comprising one or more recombinant expression vectors encoding a combination of three microRNAs selected from the combinations set forth in Table 7 or Table 10.
2. A composition comprising a combination of three microRNAs selected from the combinations set forth in Table 7 or Table 10.
3. The composition of claim 2, wherein the combination of three microRNAs are concatenated microRNAs, optionally with one or more linker and/or spacer sequence; conjugated to one or more nanoparticle, cell-permeating peptide, or polymer; or contained within a liposome.
4. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-16-1/15a cluster, let-7e/miR-99b cluster, and miR-128b.
5. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-181a, and miR-132.
6. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-451a/451b/144/4732 cluster, miR-211, and miR-132.
7. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-376a, miR-31, and miR-488.
8. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises mir-128b, mir-212, and let-7i or miR-451a/451b/144/4732 cluster.
9. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises mir128b, miR-451a/451b/144/4732 cluster, and miR-132 or miR-212.
10. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-128b, let-7i, and mir-212 or miR-196.
11. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-132, miR-15b/miR-16-2, and miR-31 or let-7i.
12. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-132, miR-451a/451b/144/4732 cluster, and miR-212 or miR-128b.
13. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-181c, let-7i, and miR-373 or miR-429.
14. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-181a, miR-429, and miR-29a or miR-31.
15. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-15b/miR-16-2, let-7i, and miR-132 or miR-181a.
16. The composition of any one of claims 1-3, wherein the combination of three microRNAs comprises miR-212, miR-451a/451b/144/4732 cluster, and miR-132 or miR-128b.
17. A composition comprising one or more recombinant expression vectors encoding a combination of two microRNAs selected from the combinations set forth in Table 3 or a combination of three microRNAs selected from the combinations set forth in Table 5 or Table 10.
18. A composition comprising a combination of two microRNAs selected from the combinations set forth in Table 3 or a combination of three microRNAs selected from the combinations set forth in Table 5 or Table 10.
19. The composition of claim 18, wherein the combination of two microRNAs or the combination of three microRNAs are concatenated microRNAs, optionally with one or more linker and/or spacer sequence; conjugated to one or more nanoparticle, cell-permeating peptide, or polymer; or contained within a liposome.
20. The composition of any one of claims 17-19, further comprising a chemotherapeutic agent.
21. The composition of claim 20, wherein the chemotherapeutic agent is an anti-mitotic/anti-microtubule agent.
22. The composition of claim 21, wherein the anti-mitotic agent is docetaxel.
23. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-16-1/15a cluster, let-7e/miR-99b cluster, and miR-128b.
24. The composition of any one of claims 17-22, wherein the combination of three microRNA comprises miR-15b/miR-16-2 cluster, miR-181a, and miR-132.
25. The composition of any one of claims 17-22, wherein the combination of three microRNA comprises miR-451a/451b/144/4732 cluster, miR-211, and miR-132.
26. The composition of any one of claims 17-22, wherein the combination of three microRNA comprises miR-376a, miR-31, and miR-488.
27. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR-376a and any one of the miRNAs selected from the group consisting of miR-16-1/15a cluster, miR-212, and miR-31.
28. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR-216 and any one of the miRNAs selected from the group consisting of miR-181c, let-7a, miR-15b/miR-16-2 cluster, and miR-181a.
29. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR-31 and miR-181a or miR-376a.
30. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR-93/106b cluster and miR-16-1/15a cluster or miR-181a.
31. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR-181a and any one of the miRNAs selected from the group consisting of miR-31, let-7i, miR-93/106b cluster, miR-373, miR-216, miR-15b/miR-16-2 cluster, and miR-16-1/15a cluster.
32. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR-16-1/15a cluster and any one of the miRNAs selected from the group consisting of miR-376a, miR-93/10b cluster, let-7a, miR-10b, miR-181a, miR-9-1, and miR-99a.
33. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR-10b and any one of the miRNAs selected from the group consisting of miR-16-1/15a cluster, miR-212, miR-196, and miR-15b/miR-16-2 cluster.
34. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR-15b/miR-161-2 cluster and any one of the miRNAs selected from the group consisting of miR-216, miR-181a, miR-9-1, and miR-10b.
35. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR181c and miR-9-1 or miR-216.
36. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR-212 and miR-376a or miR-10b.
37. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises miR-9-1 and any one of the miRNAs selected from the group consisting of miR-15b/miR-16-2 cluster, miR-16-1/15a cluster, miR-324, and miR-181c.
38. The composition of any one of claims 17-22, wherein the combination of two microRNAs comprises let-7a and miR-16-1/15a cluster or miR-216.
39. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises let-7c, miR-451a/451b/144/4732 cluster, and miR-324 or miR376a.
40. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises let-7d, miR-181c, and miR-10b or miR-9-1.
41. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises let-7e/miR-99b cluster, miR-15b/miR-16-2 cluster, and miR-181a or miR-16-1/miR-15a cluster.
42. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises let-7e/miR-99b cluster, miR-16-1/15a cluster and miR-15b/miR-16-2 cluster or miR-181c.
43. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises let-7e/miR-99b cluster, miR-181a, and miR-324 or miR-15b/miR-16-2 cluster.
44. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises let-7e/miR-99b cluster, miR-181c, and miR-429 or miR-16-1/15a cluster.
45. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises let-7e/miR-99b cluster, miR-376a, and miR-199b/3154 cluster or miR-188.
46. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises let-7i, miR-15b/miR-16-2 cluster, and miR-451a/451b/144/4732 cluster or let-7c.
47. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises let-7i, miR-199b/3154 cluster, and miR-10b or miR-29a.
48. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-10b, miR-15b/miR-16-2 cluster, and any one of the miRNAs selected from the group consisting miR-373, miR-211, and miR-126.
49. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-10b, miR-373, and miR-15b/miR-16-2 cluster or miR-451a/451b/144/4732 cluster.
50. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-10b, miR-451a/451b/144/4732 cluster, and any one of the microRNAs selected from the group consisting of miR-373, miR-429, and miR-708.
51. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-126, miR-15b/miR-16-2 cluster, and miR-10b or miR-181a.
52. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-126, miR-181a, and miR-451a/451b/144/4732 cluster or miR-15b/miR-16-2 cluster.
53. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-126, miR-181c, and miR-451a/451b/144/4732 cluster or miR-29a.
54. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-126, miR-29a, and miR-211 or miR-181c.
55. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-126, miR-451a/451b/144/4732 cluster, and miR-181a or miR-181c.
56. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-128b, miR-16-1/15a cluster, and miR-181c or miR-31.
57. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-128b, miR-31, and miR-24-2/27a/23a cluster or miR-16-1/15a cluster.
58. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-128b, miR-324, and miR-216 or miR-188.
59. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-16-1/15a cluster, and any one of the microRNAs selected from the group consisting of miR-216, miR-429, miR-451a/451b/144/4732 cluster, and let-7e/miR-99b cluster.
60. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-181a, and any one of the microRNAs selected from the group consisting of miR-9-1, miR-126, miR-489, let-7e/miR-99b cluster, miR-216, and miR-488.
61. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-181c, and miR-328 or miR-488.
62. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-216, and any one of the microRNAs selected from the group consisting of miR-373, miR-16-1/15a cluster, and miR-181a.
63. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-373, and any one of the microRNAs selected from the group consisting of miR-216, miR-9-1, and miR-10b.
64. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-376a, and miR-24-2/27a/23a cluster or miR-324.
65. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-451a/451b/144/4732 cluster, and any one of the microRNAs selected from the group consisting of let-7a, miR-16-1/15a cluster, miR-708, and let-7i.
66. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-488, and miR-181a or miR-181c.
67. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-489, and miR-128b or miR-181a.
68. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-15b/miR-16-2 cluster, miR-9-1, and miR-181a or miR-373.
69. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-16-1/15a cluster, miR-181c, and any one of the microRNAs selected from the group consisting of miR-489, miR-211, let-7e/miR-99b cluster, miR-128b, and miR-29a.
70. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-16-1/15a cluster, miR-216, and miR-126 or miR-15b/miR-16-2 cluster.
71. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-16-1/15a cluster, miR-451/451b/144/4732 cluster, and any one of the microRNAs selected from the group consisting of miR-489, miR-15b/miR-16-2 cluster, and miR-328.
72. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-16-1/15a cluster, miR-489, and miR-181c or miR-451/451b/144/4732 cluster.
73. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181a, miR-216, and any one of the microRNAs selected from the group consisting of miR-489, miR-15b/miR-16-2 cluster, and let-7i.
74. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181a, miR-324, and any one of the microRNAs selected from the group consisting of miR-708, miR-31, and let-7e/miR-99b cluster.
75. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181a, miR-376a, and miR-24-2/27a/23a cluster or miR-29c.
76. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181a, miR-451a/451b/144/4732 cluster, and miR-126 or mirR-128b.
77. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181a, miR-488, and miR-15b/miR-16-2 cluster or miR-29a.
78. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181a, miR-489, and miR-15b/miR-16-2 cluster or miR-216.
79. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181c, miR-29a, and any one of the microRNAs selected from the group consisting of miR-126, miR-16-1/15a cluster and miR-9-1.
80. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181c, miR-29c, and miR-31 or miR-324.
81. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181c, miR-31, and any one of the microRNAs selected from the group consisting of miR-328, miR-29c, and miR-99a.
82. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181c, miR-324, and miR-129-2 or miR-29c.
83. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181c, miR-328, and miR-15b/miR-16-2 cluster or miR-31.
84. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181c, miR-376a, and miR-708 or miR-212.
85. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181c, miR-451a/451b/144/4732 cluster, and any one of the microRNAs selected from the group consisting of miR-126, miR-196, and miR-9-1.
86. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181c, miR-488, and miR-15b/miR-16-2 cluster or miR-132.
87. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-181c, miR-9-1, and any one of the microRNAs selected from the group consisting of miR-451a/451b/144/4732 cluster, let-7d, and miR-29a.
88. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-24-2/27a/23a cluster, miR-37a, and any one of the microRNAs selected from the group consisting of miR-328, miR-181a and miR-15b/miR-16-2 cluster.
89. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-29a, miR-199b/3154 cluster, and let-7i or let-7c.
90. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-29a, miR-9-1, and miR-181c or miR-451a/451b/144/4732 cluster.
91. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-31, miR-376a, and miR-16-1/15a cluster or miR-488.
92. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-328, miR-451a/451b/144/4732 cluster, and let-7e/miR-99b cluster or miR-16-1/15a cluster.
93. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-373, miR-451a/451b/144/4732 cluster, and miR-10b or miR-708.
94. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-376a, miR-451a/451b/144/4732 cluster, and let-7c or miR-9-1.
95. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-451a/451b/144/4732 cluster, miR-708, and any one of the microRNAs selected from the group consisting of miR-10b, miR-15b/miR-16-2 cluster, and miR-373.
96. The composition of any one of claims 17-22, wherein the combination of three microRNAs comprises miR-451a/451b/144/4732 cluster, miR-9-1, and any one of the microRNAs selected from the group consisting of miR-181c, miR-29a, and miR-376a.
97. A method for enhancing sensitivity of a cell to a chemotherapeutic agent, comprising contacting the cell with a combination of two microRNAs selected from the combinations set forth in Table 3 or a combination of three microRNAs selected from the combinations set forth in Table 5 or Table 10.
98. The method of claim 97, further comprising contacting the cell with the chemotherapeutic agent.
99. The method of claim 97 or 98, wherein the cell is a cancer cell.
100. The method of any one of claims 97-99, wherein the combination of microRNAs are expressed from one or more recombinant expression vectors.
101. A method for treating cancer in a subject, comprising administering to the subject a combination of two microRNAs selected from the combinations set forth in Table 3 or a combination of three microRNAs selected from the combinations set forth in Table 5 or Table 10 and a chemotherapeutic agent in an effective amount.
102. The method of claim 101, wherein administering a combination of microRNAs comprises expressing the combination of microRNAs from one or more recombinant RNA expression vectors.
103. The method of claim 101 or 102, wherein the effective amount of the chemotherapeutic agent administered with the combination of microRNAs is less than the effective amount of the chemotherapeutic agent when administered without the combination of microRNAs.
104. The method of any one of claims 97-103, wherein the combination of microRNAs comprises a combination of microRNAs as set forth in any of claims 23-96.
105. A method for reducing cell proliferation, comprising contacting a cell with a combination of three microRNAs selected from the combinations set forth in Table 7 or Table 10.
106. The method of claim 105, wherein the cell is a cancer cell.
107. The method of claim 105 or 106, wherein the combination of microRNAs are expressed from one or more recombinant expression vectors.
108. A method of treating cancer in a subject, comprising administering to the subject a combination of three microRNAs selected from the combinations set forth in Table 7 or Table 10.
109. The method of claim 108, wherein administering a combination of microRNAs comprises expressing the combination of three microRNAs from one or more recombinant expression vectors.
110. The method of any one of claims 105-109, wherein the combination of microRNAs comprises a combination of microRNAs as set forth in any of claims 4-16.
111. A method for identifying a combination of microRNAs that enhances sensitivity of a cell to an agent, the method comprising: contacting a first population of cells and a second population of cells with a plurality of combinations of two or more microRNAs expressed from a recombinant expression vector; contacting the first population of cells with an agent, wherein the second population of cells is not contacted with the agent; identifying the combinations of two or more microRNAs in the first population of cells and the combinations of two or more microRNAs in the second population of cells; comparing the abundance of each combination of two or more microRNAs in the first population of cells to the abundance of each combination of two or more microRNAs in the second population of cells; identifying a combination of two or more microRNAs that is absent from or has reduced abundance in the first population of cells relative to the abundance of the same combination of two or more microRNAs in the second population of cells as a combination of microRNAs that enhances sensitivity a cell to the agent.
112. The method of claim 111, wherein the combinations of microRNAs that enhance sensitivity of a cell to the agent are compared to the combinations of microRNAs that reduce cell proliferation to identify the combinations of microRNAs that enhance sensitivity of a cell to the agent and reduce cell proliferation.
113. A method for identifying a combination of microRNAs that enhances resistance of a cell to an agent, the method comprising: contacting a first population of cells and a second population of cells with a plurality of combinations of two or more microRNAs expressed from a recombinant expression vector; contacting the first population of cells with an agent, wherein the second population of cells is not contacted with the agent; identifying the combinations of two or more microRNAs in the first population of cells and the combinations of two or more microRNAs in the second population of cells; comparing the abundance of each combination of two or more microRNAs in the first population of cells to the abundance of each combination of two or more microRNAs in the second population of cells; identifying a combination of two or more microRNAs that has increased abundance in the first population of cells relative to the abundance same combination of two or more microRNAs in the second population of cells as a combination of microRNAs that enhances resistance of a cell to the agent.
114. The method of any one of claims 111-113, wherein the agent is a cytotoxic agent.
115. The method of claim 114, wherein the cytotoxic agent is a chemotherapeutic agent.
116. The method of claim 114, wherein the chemotherapeutic agent is an anti-mitotic/anti-microtubule agent.
117. The method of claim 116, wherein the chemotherapeutic agent is docetaxel.
118. A method for identifying a combination of microRNAs that reduces cell proliferation, the method comprising: contacting a first population of cells and a second population of cells with a plurality of combinations of two or more microRNAs expressed from a recombinant expression vector; culturing the first population of cells and the second population of cells such that the second population of cells is cultured for a longer duration compared to the first population of cells; identifying the combinations of two or more microRNAs in the first population of cells and the combinations of two or more microRNAs in the second population of cells; comparing the abundance of each combination of two or more microRNAs in the first population of cells to the abundance of each combination of two or more microRNAs in the second population of cells; identifying a combination of two or more microRNAs that is absent from or in reduced abundance in the second population of cells but present in or in increased abundance in the first population of cells as a combination of microRNAs that reduces cell proliferation.
119. The method of claim 118, wherein the combinations of microRNAs that reduce cell proliferation are compared to the combinations of microRNAs that enhance sensitivity of a cell to an agent to identify the combinations of microRNAs that reduce cell proliferation and enhance sensitivity of a cell to the agent.
120. A method for identifying a combination of microRNAs that enhances cell proliferation, the method comprising: contacting a first population of cells and a second population of cells with a plurality of combinations of two or more microRNAs expressed from a recombinant expression vector; culturing the first population of cells and the second population of cells such that the second population of cells is cultured for a longer duration compared to the first population of cells; identifying the combinations of two or more microRNAs in the first population of cells and the combinations of two or more microRNAs in the second population of cells; comparing the abundance of each combination of two or more microRNAs in the first population of cells to the abundance of each combination of two or more microRNAs in the second population of cells; identifying a combination of two or more microRNAs that is present in or in increased abundance in the second population of cells but absent from or in reduced abundance in the first population of cells as a combination of microRNAs that enhances cell proliferation.
121. The method of any one of claims 111-120, wherein the microRNA expression vector is delivered to the first population of cells and/or the second population of cells by a virus.
122. The method of claim 121, wherein the virus is a lentivirus.
123. A method for determining a synergistic or antagonistic interaction of a combination of miRNAs on sensitivity of a cell to an agent and cell proliferation, comprising (1) contacting a first population of cells, a second population of cells, a third population of cells and a fourth population of cells with a plurality of combinations of two or more microRNAs expressed from a recombinant expression vector; (2) (a) contacting the first population of cells with an agent, wherein the second population of cells is not contacted with the agent; (b) culturing the third population of cells and the fourth population of cells such that the fourth population of cells is cultured for a longer duration compared to the third population of cells; (3) identifying the combinations of two or more microRNAs in the first population of cells, the second population of cells, the third population of cells and the fourth population of cells; (4) (a) comparing the abundance of each combination of two or more microRNAs in the first population of cells to the abundance of each combination of two or more microRNAs in the second population of cells; (b) comparing the abundance of each combination of two or more microRNAs in the third population of cells to the abundance of each combination of two or more microRNAs in the fourth population of cells; (5) (a) (1) identifying a combination of two or more microRNAs that is absent from or has reduced abundance in the first population of cells relative to the abundance of the same combination of two or more microRNAs in the second population of cells as a combination of microRNAs that enhances sensitivity a cell to the agent; and (2) identifying a combination of two or more microRNAs that has increased abundance in the first population of cells relative to the abundance same combination of two or more microRNAs in the second population of cells as a combination of microRNAs that enhances resistance of a cell to the agent (b) (1) identifying a combination of two or more microRNAs that is absent from or in reduced abundance in the fourth population of cells but present in or in increased abundance in the third population of cells as a combination of microRNAs that reduces cell proliferation, and (2) identifying a combination of two or more microRNAs that is present in or in increased abundance in the fourth population of cells but absent from or in reduced abundance in the third population of cells as a combination of microRNAs that enhances cell proliferation; (6) calculating a genetic interaction score for the effect of each combination of microRNAs on sensitivity of a cell to an agent and cell proliferation; (7) calculating an expected phenotype value for the effect of each combination of microRNAs on sensitivity of a cell to an agent and cell proliferation; and (8) comparing the genetic interaction score for the effect of each combination of microRNAs on sensitivity of a cell to an agent and cell proliferation with the expected phenotype value for the effect of each combination of microRNAs on sensitivity of a cell to an agent and cell proliferation, wherein a genetic interaction score greater than the expected phenotype value indicates a synergistic interaction between the microRNAs of the combination, or wherein a genetic interaction score less than the expected phenotype value indicates an antagonistic interaction between the microRNAs of the combination.
124. The method of claim 123, wherein the expected phenotype value is calculated based on the additive model or the multiplicative model.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The accompanying drawings are not intended to be drawn to scale. For purposes of clarity, not every component may be labeled in every drawing. In the drawings:
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
DETAILED DESCRIPTION
[0049] Therapies that target multiple cellular pathways or multiple factors that may have independent roles that synergize for disease development and progression has proven to be a more effective approach to therapy compared to convention monotherapies. However, methods for the identification of multiple genetic targets can be very limited and laborious due to the difficulty in generating high-order gene knock-out/silenced combinations, especially for high-throughput screening. The invention described herein is based on the surprising discovery of novel combinations of microRNAs that together have anti-cancer effects, such as enhancing sensitivity of cancer cells to chemotherapeutic agents and reducing proliferation of cancer. Also provided are methods of generating complex combinatorial microRNA expression libraries useful for a variety of high-throughput screening methods.
[0050] The methods and compositions described herein provide combinations of two or three microRNAs that enhance sensitivity of a cancer cell to a chemotherapeutic agent (see Tables 3 and 7). The methods and compositions also provide combinations of three microRNAs that reduce proliferation of cancer cells (see Table 7). As used herein, the terms “microRNA” and “miRNA” may be used interchangeably and refer to a small non-coding RNA molecule that plays a role in RNA interference (RNAi), particularly in a silencing an mRNA (“RNA silencing”) and regulation of gene expression. A microRNA that achieves RNA silencing or silences a mRNA means the target mRNA is not translated into protein. Without wishing to be bound by any particular theory, it is thought that RNA silencing with a microRNA may occur by any of several mechanisms, such as translational repression; mRNA cleavage, destabilization or decay; and deadenylation of the target mRNA. The terms “silence” or “RNA silencing” refers to complete silencing of a target mRNA, resulting in no detectable protein expression, or partial silencing, resulting in a reduction in protein expression as compared to protein expression in the absence of the microRNA.
[0051] A microRNA is complementary to at least one target mRNA or portion thereof. In some embodiments, the microRNA may be complementary to a portion of a mRNA in the 3′UTR of the mRNA. In other embodiments, the microRNA may be complementary to a portion of the protein coding region of the mRNA. In some embodiments, the miRNA is between 15-30 nucleotides, 18-28 nucleotides, or 21-25 nucleotides in length. In some embodiments, the miRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
[0052] It will be appreciated that a microRNA is complementary to a target mRNA in a cell if the microRNA is capable of hybridizing to the target mRNA to an extent sufficient to silence the mRNA. In some embodiments, the microRNA is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to a portion of the target mRNA. In some embodiments, a portion of the microRNA, referred to as a seed region, is complementary to a target mRNA. In some embodiments, the seed region is between 2-7 nucleotides of the microRNA. In some embodiments, the seed region of the microRNA is at least 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to a portion of the target mRNA.
[0053] In some embodiments, the combination of microRNAs is expressed in a cell (e.g., a cancer cell) as a pri-microRNA or a pre-mRNA and is subsequently processed into a pre-microRNA in the nucleus of the cell. In some embodiments, the pre-microRNA is further processed in the cytoplasm to form a microRNA that is capable of hybridizing to its complementary target mRNA and silencing expression.
[0054] The methods and compositions described herein may be useful for reducing proliferation of a cell, such as a cancer cell or other cell for which reduced proliferation is desired. In some embodiments, contacting a cell with a combination of three microRNAs partially or completely reduces proliferation of the cell. In some embodiments, contacting a cell with a combination of three microRNAs partially or completely reduces proliferation of the cell as compared to a cell that is not contacted with the combination of microRNAs. In some embodiments, contacting cells with a combination of three microRNAs reduces proliferation of the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or at least 65% as compared to cells that were not contacted with the combination of microRNAs. Cell proliferation may be assessed and quantified by any method known in the art, for example using cell viability assays or BrdU cell proliferation assays.
[0055] The methods and compositions of combinations of microRNAs described herein may also be useful for enhancing the sensitivity of cells (e.g., cancer cells) to a chemotherapeutic agent. In some embodiments, contacting a cell with a combination of two or three microRNAs leads to a reduction in the half minimal inhibitory concentration (IC.sub.50) of the chemotherapeutic agent. In some embodiments, contacting a cell with a combination of two or three microRNAs leads to a reduction in the IC.sub.50 of the chemotherapeutic agent as compared to the IC.sub.50 of the chemotherapeutic on a cell that is not contacted with the combination of microRNAs. In some embodiments, following contact with combination of microRNAs, the IC.sub.50 of the chemotherapeutic agent is reduced by at least 1.1-, 1.2-, 1.3-, 1.4-, 1.5-, 1.6-, 1.7-, 1.8-, 1.9-, 2.0-, 2.1-, 2.2-, 2.3-, 2.4-, 2.5-, 2.6-, 2.7-, 2.8-, 2.9-, 3.0-, 4.0-, or at least 5.0-fold. In some embodiments, following contact with combination of microRNAs, the IC.sub.50 of the chemotherapeutic agent is reduced by at least 1.1-, 1.2-, 1.3-, 1.4-, 1.5-, 1.6-, 1.7-, 1.8-, 1.9-, 2.0-, 2.1-, 2.2-, 2.3-, 2.4-, 2.5-, 2.6-, 2.7-, 2.8-, 2.9-, 3.0-, 4.0-, or at least 5.0-fold as compared to the IC.sub.50 of the chemotherapeutic agent on cells that have not been contacts with the combination of microRNAs. Methods for determining chemotherapeutic sensitivity and IC.sub.50 values will evident to one of skill in the art
[0056] The invention encompasses any cell type in which expression of a gene may be reduced or silenced using microRNAs. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell, including a human cell (e.g., a human embryonic kidney cell (e.g., HEK293T cell), a human dermal fibroblast, a MC7 cell, OVCAR8 cell, OVCAR8-ADR cell, T1074 cell, HOSE 11-12 cell, or HOSE 17-1 cell) or a rodent cell. In other embodiments, the cell is an algal cell, a plant cell, or an insect cell. In other embodiments, the cell is a fungal cell such as a yeast cell, e.g., Saccharomyces spp., Schizosaccharomyces spp., Pichia spp., Phaffia spp., Kluyveromyces spp., Candida spp., Talaromyces spp., Brettanomyces spp., Pachysolen spp., Debaryomyces spp., Yarrowia spp. and industrial polyploid yeast strains. Preferably the yeast strain is a S. cerevisiae strain. Other examples of fungi include Aspergillus spp., Penicillium spp., Fusarium spp., Rhizopus spp., Acremonium spp., Neurospora spp., Sordaria spp., Magnaporthe spp., Allomyces spp., Ustilago spp., Botrytis spp., and Trichoderma spp. In some embodiments, the cell is in an multicellular organism, for example a plant or a mammal. In some embodiments, the mammal is a human.
[0057] Aspects of the invention relate to methods and compositions for enhancing the sensitivity of a cancer cell to a chemotherapeutic agent or to reducing proliferation of a cancer cell. Cancer is a disease characterized by uncontrolled or aberrantly controlled cell proliferation and other malignant cellular properties. As used herein, the term “cancer” refers to any type of cancer known in the art, including without limitation, breast cancer, biliary tract cancer, bladder cancer, brain cancer, cervical cancer, choriocarcinoma, colon cancer, endometrial cancer, esophageal cancer, gastric cancer, hematological neoplasms, T-cell acute lymphoblastic leukemia/lymphoma, hairy cell leukemia, chronic myelogenous leukemia, multiple myeloma, AIDS-associated leukemias and adult T-cell leukemia/lymphoma, intraepithelial neoplasms, liver cancer, lung cancer, lymphomas, neuroblastomas, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, sarcomas, skin cancer, testicular cancer, thyroid cancer, and renal cancer. The cancer cell may be a cancer cell in vivo (i.e., in an organism), ex vivo (i.e., removed from an organism and maintained in vitro), or in vitro.
[0058] Other aspects of the invention relate to methods and compositions for treating cancer in a subject. In some embodiments, the subject is a subject having, suspected of having, or at risk of developing cancer. In some embodiments, the subject is a mammalian subject, including but not limited to a dog, cat, horse, cow, pig, sheep, goat, chicken, rodent, or primate. In some embodiments, the subject is a human subject, such as a patient. The human subject may be a pediatric or adult subject. Whether a subject is deemed “at risk” of having a cancer may be determined by a skilled practitioner.
[0059] As used herein “treating” includes amelioration, cure, prevent it from becoming worse, slow the rate of progression, or to prevent the disorder from re-occurring (i.e., to prevent a relapse). An effective amount of a composition refers to an amount of the composition that results in a therapeutic effect. For example, in methods for treating cancer in a subject, an effective amount of a chemotherapeutic agent is any amount that provides an anti-cancer effect, such as reduces or prevents proliferation of a cancer cell or is cytotoxic towards a cancer cell. The effective amount of a chemotherapeutic agent may be presented as the half minimal inhibitory concentration (IC.sub.50). In some embodiments, the effective amount of a chemotherapeutic agent is reduced when the chemotherapeutic agent is administered concomitantly with any of the combinations of microRNAs described herein as compared to the effective amount of the chemotherapeutic agent when administered in the absence of the combination of microRNAs. In some embodiments, the effective amount of a chemotherapeutic agent is reduced by at least 1.1-, 1.2-, 1.3-, 1.4-, 1.5-, 1.6-, 1.7-, 1.8-, 1.9-, 2.0-, 2.1-, 2.2-, 2.3-, 2.4-, 2.5-, 2.6-, 2.7-, 2.8-, 2.9-, 3.0-, 4.0-, 5.0-, 10.0-, 15.0-, 20.0-, 25.0-, 30.0-, 35.0-, 40.0-, 45.0-, 50.0-, 55.0-, 60.0-, 65.0-, 70.0-, 75.0-, 80.0-, 85.0-, 90.0-, 95.0-, 100-, 200-, 300-, 400-, or at least 500-fold or more when the chemotherapeutic agent is concomitantly administered with a combination of microRNAs (e.g., combinations of two microRNAs presented in Table 3 or combinations of three microRNAs presented in Table 5). In some embodiments, the IC.sub.50 of the chemotherapeutic agent is reduced by at least 1.1-, 1.2-, 1.3-, 1.4-, 1.5-, 1.6-, 1.7-, 1.8-, 1.9-, 2.0-, 2.1-, 2.2-, 2.3-, 2.4-, 2.5-, 2.6-, 2.7-, 2.8-, 2.9-, 3.0-, 4.0-, 5.0-, 10.0-, 15.0-, 20.0-, 25.0-, 30.0-, 35.0-, 40.0-, 45.0-, 50.0-, 55.0-, 60.0-, 65.0-, 70.0-, 75.0-, 80.0-, 85.0-, 90.0-, 95.0-, 100-, 200-, 300-, 400-, or at least 500-fold or more when the chemotherapeutic agent is concomitantly administered with any of the combinations of microRNAs described herein.
[0060] As used herein, the term “chemotherapeutic agent” refers to any agent that has an anti-cancer effect (e.g., kills or reduces proliferation of a cancer cell). Chemotherapeutic agents may include alkylating agents, such as mechlorethamine, chlorambucil, cyclophosphamide, ifosfamide, melphalan, streptozocin, carmustine (BCNU), lomustine, busulfan, dacarbazine (DTIC), temozolomide, thiotepa and altretamine (hexamethylmelamine); anti-mitotic agents (mitotic inhibitors), such as paclitaxel, docetaxel, izabepilone, vinblastine, vincristine, vinoreibine, and estramustine; antimetabolites, such as 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cladribine, clofarabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, pentostatin, and thioguanine; anti-tumor antibiotics, such as anthracyclines (daunorubicin, doxorubicin, epirubicin, idarubicin), actinomycin-D, bleomycin, and mitomycin-C; topoisomerase inhibitors, such as topoisomerase I inhibitors (topotecan and irinotecan (CPT-11)) and topoisomerase II inhibitors (etoposide (VP-16), teniposide, and mitoxantrone); and corticosteroids, such as prednisone, methylprednisolone, and dexamethasone. In some embodiments, the chemotherapeutic agent is an anti-mitotic agent. In some embodiments, the anti-mitotic agent is docetaxel.
[0061] Also within the scope of the present invention are methods for screening cell populations for combinations of microRNAs that, when administered to cells, result in an increase or decrease in sensitivity of the cells to an agent. In some embodiments, the agent is a chemotherapeutic agent. As depicted in
[0062] Other methods are provided for screening cell populations for combinations of microRNAs that, when administered to the cell populations, result in an enhancement or reduction of cell proliferation. As depicted in
[0063] The combinations of microRNAs described herein may be administered to a subject, or delivered to or contacted with a cell in any form known in the art. In some embodiments, the combination of microRNAs are concatenated microRNAs. In some embodiments, the concatenated microRNAs also contain one or more linker and/or spacer sequence. In other embodiments, the combination of microRNAs are conjugated to one or more nanoparticle, cell-permeating peptide, and/or polymer. In other embodiments, the combination of microRNAs are contained within a liposome.
[0064] The combinations of microRNAs described herein may be administered to a subject, or delivered to or contacted with a cell by any methods known in the art. In some embodiments, the combination of microRNAs are delivered to the cell by a nanoparticle, cell-permeating peptide, polymer, liposome, or recombinant expression vector.
[0065] In some embodiments, one or more genes encoding the microRNAs associated with the invention is expressed in a recombinant expression vector. As used herein, a “vector” may be any of a number of nucleic acids into which a desired sequence or sequences may be inserted by restriction digestion and ligation (e.g., using the CombiGEM method) or by recombination for transport between different genetic environments or for expression in a host cell (e.g., a cancer cell). Vectors are typically composed of DNA, although RNA vectors are also available. Vectors include, but are not limited to: plasmids, fosmids, plagemids, virus genomes, and artificial chromosomes. In some embodiments, the vector is a lentiviral vector. In some embodiments, each of the genes encoding the combination of two or three microRNAs are expressed on the same recombinant expression vector. In some embodiments, the genes encoding the combination of two or three microRNAs are expressed on two recombinant expression vectors. In some embodiments, the genes encoding the combination of three microRNAs are expressed on three recombinant expression vectors.
[0066] A recombinant expression vector is one into which a desired DNA sequence may be inserted by restriction digestion and ligation or recombination such that it is operably joined to regulatory sequences and may be expressed as an RNA transcript. Vectors may further contain one or more marker sequences suitable for use in the identification of cells which have or have not been transformed or transfected with the vector. Markers include, for example, genes encoding proteins which increase or decrease either resistance or sensitivity to antibiotics or other compounds, genes which encode enzymes whose activities are detectable by standard assays known in the art (e.g., galactosidase, fluorescence, luciferase or alkaline phosphatase), and genes which visibly affect the phenotype of transformed or transfected cells, hosts, colonies or plaques (e.g., green fluorescent protein, red fluorescent protein). Preferred vectors are those capable of autonomous replication and expression of the structural gene products present in the DNA segments to which they are operably joined.
[0067] As used herein, a coding sequence and regulatory sequences are said to be “operably” joined when they are covalently linked in such a way as to place the expression or transcription of the coding sequence under the influence or control of the regulatory sequences. If it is desired that the coding sequences be translated into a functional protein, two DNA sequences are said to be operably joined if induction of a promoter in the 5′ regulatory sequences results in the transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the coding sequences, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region would be operably joined to a coding sequence if the promoter region were capable of effecting transcription of that DNA sequence such that the resulting transcript can be translated into the desired protein or polypeptide.
[0068] When the nucleic acid molecule is expressed in a cell, a variety of transcription control sequences (e.g., promoter/enhancer sequences) can be used to direct its expression. The promoter can be a native promoter, i.e., the promoter of the gene in its endogenous context, which provides normal regulation of expression of the gene. In some embodiments the promoter can be constitutive, i.e., the promoter is unregulated allowing for continual transcription of its associated gene. A variety of conditional promoters also can be used, such as promoters controlled by the presence or absence of a molecule. In some embodiments, the promoter is a human cytomegalovirus promoter (CMVp).
[0069] The precise nature of the regulatory sequences needed for gene expression may vary between species or cell types, but shall in general include, as necessary, 5′ non-transcribed and 5′ non-translated sequences involved with the initiation of transcription and translation respectively, such as a TATA box, capping sequence, CAAT sequence, and the like. In particular, such 5′ non-transcribed regulatory sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined gene. Regulatory sequences may also include enhancer sequences or upstream activator 5 sequences as desired. The vectors of the invention may optionally include 5′ leader or signal sequences. The choice and design of an appropriate vector is within the ability and discretion of one of ordinary skill in the art.
[0070] Recombinant expression vectors containing all the necessary elements for expression are commercially available and known to those skilled in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press, 2012. Cells are genetically engineered by the introduction into the cells of heterologous DNA (RNA). That heterologous DNA (RNA) is placed under operable control of transcriptional elements to permit the expression of the heterologous DNA in the host cell. A nucleic acid molecule associated with the invention can be introduced into a cell or cells using methods and techniques that are standard in the art. For example, nucleic acid molecules can be introduced by standard protocols such as transformation including chemical transformation and electroporation, viral transduction, particle bombardment, etc. In some embodiments, the recombinant expression vector is introduced by viral transduction. In some embodiments, the viral transduction is achieved using a lentivirus. Expressing the nucleic acid molecule may also be accomplished by integrating the nucleic acid molecule into the genome.
[0071] Also disclosed herein are methods for determining a synergistic or antagonistic interaction by calculating a genetic interaction score for each combination of microRNAs (see Example and
EXAMPLE
Massively Parallel High-Order Combinatorial Genetics in Human Cells
Combinatorial Genetics En Masse (CombiGEM) for Human Systems
[0072] To address the limitations of conventional methods for generating high-order combinatorial libraries for high-throughput screening, a technology was developed for the scalable pooled assembly of barcoded high-order combinatorial genetic libraries for human cells. This approach, referred to as Combinatorial Genetics En Masse (CombiGEM), enables high-throughput tracking of the barcoded combinatorial populations with next-generation sequencing (
[0073] The final barcoded combinatorial genetic libraries were encoded in lentiviruses to enable efficient delivery and stable genomic integration in a wide range of human cell types. Lentiviral vectors have been widely used to deliver pooled libraries for large-scale genetic screening (Johannessen et al. Nature (2013) 504, 138-142; Koike-Yusa et al. Nat. Biotecnol. (2014) 32, 267-273; Shalem et al. Science (2014) 343, 84-87; Wang et al. Science (2014) 343, 80-84; Bassik et al. Cell (2013) 152, 909-922). After delivering combinatorial libraries into human cells, pooled assays were performed and genomic DNA was extracted for unbiased amplification of the integrated barcodes. Illumina HiSeq sequencing was used to quantify the abundances of the contiguous DNA barcode sequences, which represent each genetic combination within the pooled populations, and to identify shifts in representation of each combination under the different experimental conditions. The CombiGEM strategy was applied to identify genetic combinations (miRNAs in this study) that sensitize cancer cells to drugs and/or inhibit cancer cell proliferation, with the ultimate goal to validate novel and promising combinatorial effectors for anti-cancer treatment.
Combinatorial miRNA Expression System
[0074] Previous work showed that multiple miRNAs can be expressed by arranging their precursor sequences in tandem (Yoo et al. Nature (2011) 476, 228-231). The lentiviral vector was confirmed to express combinatorial sets of functional miRNAs. Lentiviral vectors were generated to encode miRNA precursors cloned downstream of a green fluorescent protein (GFP) gene to monitor expression from the cytomegalovirus (CMVp) promoter (
[0075] It was anticipated that active miRNAs would target their sensor sequences, thus reducing RFP fluorescence levels. Flow cytometry analysis showed that cells expressing miRNAs but without sensors produced both GFP and RFP, whereas those cells expressing miRNAs and harboring cognate sensors lost RFP fluorescence, indicating repression by miRNAs (
Generation of High-Coverage Combinatorial miRNA Libraries
[0076] Given the high efficiency of gene repression achieved by the lentiviral combinatorial miRNA expression system, high-coverage barcoded combinatorial miRNA libraries were generated. The goal of these studies was to systematically evaluate the combinatorial effects of miRNA overexpression on anti-cancer phenotypes since rational combination therapy can enhance therapeutic efficacy (Al-Lazikani et al. Nat. Biotechnol. (2012) 30, 679-692) and miRNA-based therapeutics have been shown to be effective in various animal models and are in preclinical and clinical development (Li et al. Nat. Rev. Drug Discov. (2014) 13, 622-638). To build the libraries, 39 miRNAs were selected that were previously reported to be down-regulated in drug-resistant cancer cells or exhibited altered expression in ovarian cancer cells (Tables 1 and 2). The expression of these 39 miRNAs in human ovarian cancer (OVCAR8) cells and its drug-resistant derivative OVCAR8-ADR cells (Patnaik et al. PLoS One (2012) 7) was previously shown in miRNA profiling studies (Creighton et al. Breast Cancer Res. (2010) 12, R40; Gholami et al. Cell Rep. (2008) 4, 609-620; Hsu et al. Nucleic Acid Res. (2014) 42, D78-85). Using ProteomicsDB (Honma et al. Nat. Med. (2008) 14, 939-948), it was found that at least ˜60% (2716 out of 4532) of the experimentally validated targets of these 39 miRNAs, which were retrieved from miRTarBase (Strezoska et al. PLoS One (2012) 7, e42341) are expressed in OVCAR8-ADR cells. A barcoded library comprising the 39 miRNA precursor sequences was first cloned into storage vectors. Using CombiGEM, two-wise (39×39 miRNAs=1,521 total combinations) and three-wise (39×39×39 miRNAs=59,319 total combinations) pooled miRNA libraries were generated in just two subsequent steps (
[0077] Specifically, a library of barcoded miRNAs was first cloned into storage vectors with BamHI and EcoRI sites in between the miRNA sequences and the barcode sequences and BglII and MfeI sites at the ends (
[0078] Lentiviral pools were then produced to deliver the combinatorial libraries into human cells. To facilitate single-copy lentiviral integration in most infected cells, lentiviruses were titrated to a multiplicity of infection (MOI) of about 0.3 to 0.5. To ensure high-quality screens with high-coverage libraries containing a significant representation for most combinations (Bhattacharya et al. Cancer Res. (2009) 69, 9090-9095), ˜300-fold more cells for lentiviral infection were used than the size of the combinatorial library being tested. Thus, any spurious phenotype resulting from any given random integrant should be diminished by averaging over the population.
[0079] Genomic DNA from pooled populations was isolated for barcode amplification by polymerase chain reaction (PCR). The PCR conditions were optimized to achieve unbiased amplification in order to ensure accurate quantification of the barcodes (
[0080] In addition, high coverage of the three-wise library within the plasmid and infected cell pools (˜89% and ˜87%, respectively) was achieved with ˜30 million reads per sample (
High-Throughput Two-Wise Combinatorial Screen
[0081] To identify combinatorial miRNAs that modify chemotherapy drug sensitivity, OVCAR8-ADR cells were infected with the two-wise barcoded combinatorial miRNA library (
[0082] The drug-sensitizing or resistance-enhancing effects of selected miRNA pairs from these hits were confirmed with individual drug sensitivity assays. It was further revealed that miRNA combinations could enhance drug sensitivity over their individual components. Previous work has shown that expression of the miR-16/15 precursor family sensitized drug-resistant gastric cancer cells to chemotherapeutic drugs (Kastl et al. Breast Cancer Res. Treat. (2012) 131, 445-454). In line with this finding, it was found that expression of the miR-16-1/15a cluster increased docetaxel sensitivity in OVCAR8-ADR cells, resulting in a ˜10-20% decrease in cell viability when co-applied with docetaxel compared to the vector control (
[0083] MicroRNA combinations that enhanced docetaxel resistance in OVCAR8-ADR cells were also evaluated. It has been demonstrated that overexpression of miR-34a conferred docetaxel resistance in breast cancer cells (Krek et al. Nat. Genet. (2005) 37, 495-500). Consistent with this observation, miR-34a was frequently represented in combinations that showed increased docetaxel resistance in OVCAR-ADR cells (23 out of 36 combinations) (Table 4). It was confirmed that cells expressing miR-34a in combination with the miR-199b/3154 cluster, miR-328, or miR-429 developed profound resistance towards 25 nM of docetaxel treatment, resulting in increased cell viability by ˜1.6 to 1.9-fold in the presence of drug when compared to the vector control (
Massively Parallel Three-Wise Combinatorial Screens
[0084] High-throughput genetic screens with higher-order combinatorial libraries were performed to demonstrate the scalability of the CombiGEM approach (
[0085] Using the same three-wise combinatorial miRNA library and experimental pipeline, the effect of combinatorial miRNAs on cancer cell proliferation was systematically evaluated (
MicroRNA Interactions Control Anti-Cancer Phenotypes
[0086] Combining the high-throughput screening data for drug sensitization and inhibition of cell proliferation, miRNA combinations were profiled based on their ability to modulate drug resistance as well as cancer cell growth (
[0087] These plots revealed insights into previously unexamined roles that combinatorial miRNAs play in modulating drug resistance and cell growth phenotypes. For instance, most two wise and three-wise combinations that contained miR-34a conferred cellular resistance against docetaxel and anti-proliferative effects (
[0088] Genetic interaction (GI) scores were defined for each two-wise and three-wise combinations using a previously described scoring system (Bassik et al. Cell (2013) 152, 909-922). Generally, combinations that exhibited stronger phenotypes than predicted via the additive effect of individual phenotypes were defined as synergistic, whereas combinations with weaker than expected phenotypes based on an additive model were defined as buffering (see Materials and Methods and
MicroRNA Combinations with Both Drug-Sensitizing and Anti-Proliferation Phenotypes
[0089] Combining the high-throughput screening data for drug sensitization and inhibition of cell proliferation, miRNA combinations were profiled based on their ability to modulate both drug resistance and cancer cell growth (
[0090] The results also identified interacting miRNAs that regulate cancer cell growth. It was found that miR-181c expression inhibited cancer cell growth by ˜30% and that this anti-proliferative effect was potentiated to ˜50-60% when miR-181c was expressed in combination with the let-7e/miR-99b cluster (
[0091] Via these analyses, miRNA combination that could modulate both drug-sensitization and cell-growth phenotypes were identified and validated. These miRNA combinations may serve as candidates for novel anti-cancer therapeutics. For example, the integrated docetaxel-sensitizing and anti-proliferative functions of the miR-16-1/15a cluster, the let-7e/miR-99b cluster, and miR-128b together (
Methods
[0092] Construction of Combinatorial miRNA Expression and Sensor Vectors
[0093] The vectors used (Table 8) were constructed using standard molecular cloning techniques, including PCR, restriction enzyme digestion, ligation, and Gibson assembly. Custom oligonucleotides and gene fragments were purchased from Integrated DNA Technologies and GenScript. The vector constructs were transformed into E. coli strain DH5α, and 50 μg/ml of carbenicillin (Teknova) was used to isolate colonies harboring the constructs. DNA was extracted and purified using Qiagen Plasmid Mini or Midi Kit (Qiagen). Sequences of the vector constructs were verified with Genewiz's DNA sequencing service.
[0094] To create a lentiviral vector for expression of dual fluorescent protein reporters (pAWp7; pFUGW-UBCp-RFP-CMVp-GFP), turboRFP (Addgene #31779) (Yoo et al. Nature (2011) 476, 228-231), and CMV promoter sequences were amplified by PCR using Phusion DNA polymerase (New England Biolabs) and cloned into the pAWp6 vector backbone (pFUGW-UBCp-GFP) using Gibson Assembly Master Mix (New England Biolabs). To express miRNAs, miRNA precursor sequences of miR-124 (Addgene #31779) (Yoo et al. Nature (2011) 476, 228-231), miR-128 (Bruno et al. Mol. Cell (2011) 42, 500-510), and miR-132 (Klein et al. Nat. Neurosci. (2007) 10, 1513-1514) were amplified by PCR and cloned downstream of the GFP sequence in pAWp7 vector using Gibson assembly. During PCR, four restriction digestion sites (BglII, BamHI, EcoRI and MfeI) were added to flank the miRNA precursor sequences, resulting in a BglII-BamHI-EcoRI-miRNA precursor-MfeI configuration that facilitated cloning of additional miRNA precursors for generating combinatorial miRNA expression cassettes. To construct two-wise miRNA precursor expression cassettes, the single miRNA precursor expression vectors were digested with BamHI and EcoRI (Thermo Scientific), and ligated using T4 DNA ligase (New England Biolabs) with the compatible sticky ends of the miRNA precursor inserts prepared from digestion of the respective PCR product with BglII and MfeI (Thermo Scientific) Likewise, three-wise miRNA precursor expression cassettes were built by ligating the BglII- and MfeI-digested two-wise miRNA precursor expression vectors with BamHI- and EcoRI-digested miRNA precursor inserts. To report on miRNA activities, miRNA sensors harboring four tandem repeats of the reverse-complemented sequences of the mature miRNAs were amplified by PCR from synthesized gene fragments, and inserted via a SbfI cleavage site into the 3′ UTR of RFP of pAWp7 or the combinatorial miRNA precursor expression vectors using Gibson assembly.
Creation of the Barcoded Single miRNA Precursor Library
[0095] Each of the 39 miRNA precursor sequences (with lengths of ˜261-641 base pairs) was amplified from human genomic DNA (Promega) as described previously (Voorhoeve et al. Cell (2007) 131, 102-114) by PCR using Phusion (New England Biolabs) or Kapa HiFi (Kapa Biosystems) DNA polymerases and primers listed in Table 1. Eight-base pair barcodes unique to each miRNA precursor were added during PCR. The barcode sequences differed from each other by at least two bases. In addition, restriction enzyme sites BglII and MfeI were added to flank the ends, and cleavage sites BamHI and EcoRI were introduced in between the miRNA precursor and the barcode sequences. Each PCR product herein was thus configured as BglII-miRNA precursor-BamHI-EcoRI-Barcode-MfeI. The PCR product of each barcoded miRNA precursor was then ligated into the pBT264 storage vector (Addgene #27428)57 using sites BglII and MfeI.
Pooled Combinatorial miRNA Library Assembly for High-Throughput Screening
[0096] Storage vectors harboring the 39 barcoded miRNA precursors were mixed at equal molar ratios. Pooled inserts were generated by single-pot digestion of the pooled storage vectors with BglII and MfeI. The destination lentiviral vector (pAWp11; modified from the pAWp7 vector) was digested with BamHI and EcoRI. The digested inserts and vectors were ligated via their compatible sticky ends (i.e., BamHI+BglII & EcoRI+MfeI) to create a pooled one-wise miRNA precursor library in lentiviral vector. The one-wise miRNA precursor vector library was digested again with BamHI and EcoRI, and ligated with the same 39 miRNA precursor insert pool to assemble the two-wise miRNA precursor library (39×39 miRNAs=1,521 total combinations). Ligation was performed with the BamHI- and EcoRI-digested two-wise miRNA precursor vector library and the same pooled inserts to generate the three-wise miRNA precursor library (39×39×39 miRNAs=59,319 total combinations). After each pooled assembly step, the miRNA precursors were localized to one end of the vector construct and their respective barcodes were concatenated at the other end.
Generation of Combinatorial miRNA Vectors for Individual Validation Assays
[0097] Lentiviral vectors harboring single, two-wise, or three-wise miRNA precursors were constructed with same strategy as for the generation of combinatorial miRNA libraries described above, except that the assembly was performed with individual inserts and vectors, instead of pooled ones.
Human Cell Culture
[0098] HEK293T and MCF7 cells were obtained from ATCC. T1074 cells were obtained from Applied Biological Materials. HOSE 11-12 and HOSE 17-1 cells were obtained from G. S. W. Tsao (University of Hong Kong, Hong Kong). OVCAR8 and OVCAR8-ADR cells were previously described (Gaj et al. Trends Biotechnol. (2013) 31, 397-405; Patnaik et al. PLoS One (2007) 7). The identity of the OVCAR8-ADR cells was confirmed by a cell line authentication test (Genetica DNA Laboratories). HEK293T cells were cultured in DMEM supplemented with 10% heat-inactivated fetal bovine serum and 1× antibiotic-antimycotic (Life Technologies) at 37° C. with 5% CO.sub.2. MCF7, T1074, HOSE 11-12, HOSE 17-1, OVCAR8, and OVCAR8-ADR cells were cultured in RPMI supplemented with 10% heat-inactivated fetal bovine serum and 1× antibiotic-antimycotic (Life Technologies) at 37° C. with 5% CO.sub.2. For drug sensitivity assays, docetaxel (LC Laboratories) or vehicle control was added to the cell cultures at indicated doses and time periods.
Lentivirus Production and Transduction
[0099] Lentiviruses were produced in 6-well plates with 250,000 HEK293T cells per well. Cells were transfected using FuGENE HD transfection reagents (Promega) with 0.5 μg of lentiviral vector, 1 μg of pCMV-dR8.2-dvpr vector, and 0.5 μg of pCMV-VSV-G vector mixed in 100 μl of OptiMEM medium (Life Technologies) for 10 minutes. The medium was replaced with fresh culture medium one day after transfection. Viral supernatants were then collected every 24 hours between 48 to 96 hours after transfection, pooled together, and filtered through a 0.45 μm polyethersulfone membrane (Pall). For transduction with individual vector constructs, 500 μl filtered viral supernatant was used to infect 250,000 cells in the presence of 8 μg/ml polybrene (Sigma) overnight. For transduction with pooled libraries, lentivirus production was scaled up using the same experimental conditions. Filtered viral supernatant was concentrated at 50-fold using an Amicon Ultra Centrifugal Filter Unit (Millipore) and used to infect a starting cell population containing ˜300-fold more cells than the library size to be tested. MOIs of 0.3 to 0.5 were used to give an infection efficiency of about 30 to 40% in the presence of 8 μg/ml polybrene. Cells were washed with fresh culture medium one day after infection, and cultured for three more days prior to experiments.
Sample Preparation for Barcode Sequencing
[0100] For the combinatorial miRNA vector libraries, plasmid DNA was extracted from E. coli transformed with the vector library using the Qiagen Plasmid Mini kit (Qiagen). For the human cell pools infected with the combinatorial miRNA libraries, genomic DNA of cells collected from various experimental conditions was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA concentrations were measured by Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies).
[0101] PCR amplification of a 359 base-pair fragment containing unique CombiGEM barcodes representing each combination within the pooled vector and infected cell libraries was performed using Kapa HiFi Hotstart Ready-mix (Kapa Biosystems). During the PCR, each sample had Illumina anchor sequences and an 8 base-pair indexing barcode for multiplexed sequencing added. The forward and reverse primers used were 5′-AATGATACGGCGACCACCGAGATC TACACGGATCCGCAACGGAATTC-3′ (SEQ ID NO:1) and 5′-CAAGCAGAAGACGGCAT ACGAGATNNNNNNNNGGTTGCGTCAGCAAACACAG-3′ (SEQ ID NO:2), where NNNNNNNN denotes a specific indexing barcode assigned for each experimental sample.
[0102] 0.5 ng of plasmid DNA was added as template in a 12.5 μl PCR reaction, while 800 ng of genomic DNA was used per 50-μl PCR reaction. Eight and 80 PCR reactions were performed for human cell pools infected with two-wise and three-wise miRNA library respectively to reach at least 50-fold representation for each combination. To prevent PCR bias that would skew the population distribution, PCR conditions were optimized to ensure the amplification occurred during the exponential phase. PCR products were run on a 1.5% agarose gel, and the 359 basepair fragment was isolated using QIAquick Gel Extraction Kit (Qiagen). Concentrations of the PCR products were determined by quantitative PCR using Kapa SYBR Fast qPCR Master Mix (Kapa Biosystems) with a Mastercycler Ep Realplex machine (Eppendorf). Forward and reverse primers used for quantitative PCR were 5′-AATGATACGGCGACCACCGA-3′ (SEQ ID NO:3) and 5′-CAAGCAGAAGACGGCATACGA-3′ (SEQ ID NO:4), respectively. The quantified PCR products were then pooled at desired ratio for multiplexing samples and run for Illumina HiSeq using CombiGEM barcode primer (5′-CCACCGAGATCTACACGGATCCGC AACGGAATTC-3′ (SEQ ID NO:5)) and indexing barcode primer (5′-GTGGCGTGGTGTGCA CTGTGTTTGCTGACGCAACC-3′ (SEQ ID NO:6)).
Data Analysis
[0103] Screens were performed in two biological replicates with independent infections of the same lentiviral libraries, and the mean log.sub.2 ratio was used as a measure of drug sensitivity or cell proliferation. A majority (78-90%) of combinations showed a small difference (<0.3) of log.sub.2 ratios between biological replicates (
[0104] To determine miRNA interactions, a scoring system similar to one previously described for measuring genetic interactions was applied (Bassik et al. Cell (2013) 152, 909-922), and genetic interaction (GI) scores for each two- and three-wise combination were calculated. Combinations were grouped based on their GI scores to evaluate the frequency of genetic interactions as shown in the histograms in
[0105] As described above, positive and negative phenotypes had averaged fold changes of normalized barcode reads of >1 and <1 respectively, while no phenotypic change resulted in a fold change=1. For miRNA [A] and [B] with individual phenotypes “A” and “B”, the expected phenotype for the two-wise combination [A,B] is (“A”+“B”−1), according to the additive model, where “A” and “B” are calculated based on the median fold changes of normalized barcode reads determined for combinations [A,X] and [B,X] respectively and [X] represents all 39 library members. Similarly, the expected phenotype for three-wise combination [A,B,C] is (“A,B”+“C”−1), where “A,B” and “C” are the median fold changes of normalized barcode reads determined for combinations [A,B,X] and [C,X,X] respectively and [X] represents all 39 library members.
[0106] The GI score of a given two-wise combination was determined as follows (
Definition of Deviation=Observed phenotype−Expected phenotype,
[0107] 1) If phenotype “A” and “B” are both >1 and Deviation>0, the interaction is defined as synergistic. GI score=|Deviation|
[0108] 2) If phenotype “A” and “B” are both >1 and Deviation<0, the interaction is defined as buffering. GI score=−|Deviation|
[0109] 3) If phenotype “A” and “B” are both <1 and Deviation>0, the interaction is defined as buffering. GI score=−|Deviation|
[0110] 4) If phenotype “A” and “B” are both <1 and Deviation<0, the interaction is defined as synergistic. GI score=|Deviation|
[0111] 5) If phenotype “A”>1 and “B”<1, or vice versa, and Observed Phenotype>both “A” and “B”, the interaction is defined as synergistic. GI score=|Deviation|
[0112] 6) If phenotype “A”>1 and “B”<1, or vice versa, and Observed Phenotype<both “A” and “B”, the interaction is defined as synergistic. GI score=|Deviation|
[0113] 7) If phenotype “A”>1 and “B”<1, or vice versa, and Observed Phenotype is neither >both “A” and “B” nor <both “A” and “B”, the interaction is defined as buffering.
GI score=−|Deviation|
[0114] The GI score for a given three-wise combination was calculated using the same method. For each three-wise combination, three GI scores were determined for the three possible permutations (i.e. “A,B”+“C”, “A,C”+“B”, “B,C”+“A”). The GI score of “B,A”+“C” was the same as of “A,B”+“C” since the fold changes for different orders of the same pair of miRNAs were averaged as described above. In
[0115] To determine the significance of GI, the GI scores were Z-score-normalized as previously described.sup.61, and a |Z-score| cut-off value of 2 was considered statistically significant (P<0.05). The GI scores for significant synergistic and buffering interactions were determined to be >0.198 and <−0.186 respectively for the drug-sensitivity screen with the two-wise miRNA combinations (
Flow Cytometry
[0116] Four days post-infection, cells were washed and resuspended with 1× PBS supplemented with 2% heat-inactivated fetal bovine serum, and assayed with a LSRII Fortessa flow cytometer (Becton Dickinson). Cells were gated on forward and side scatter. At least 20,000 cells were recorded per sample in each data set.
Fluorescence Microscopy
[0117] To visualize GFP and RFP, cells were directly observed under an inverted fluorescence microscope (Zeiss) after four days post-infection.
Cell Viability Assays
[0118] For the MTT assay, 100 μl of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) solution (Sigma) was added to the cell cultures in 96-well plates and incubated at 37° C. with 5% CO.sub.2 for 2 hours. Viable cells convert the soluble MTT salt to insoluble blue formazan crystals. Formazan crystals formed were dissolved with 100 μl of solubilization buffer at 37° C. The absorbance of the solubilized formazan was measured at an optical density (OD) of 570 nm (along with the reference OD at 650 nm) using a Synergy H1 Microplate Reader (BioTek). For the trypan blue exclusion assay, cells were trypsinized and stained with 0.4% trypan blue dye solution (Sigma). Viable cells were counted in four different fields of a hemacytometer under microscopy.
Colony Formation Assay
[0119] 10,000 cells were plated in 96-well plates and treated with 25 nM of docetaxel. Cells were trypsinized and transferred to 6-well plates. After eleven days, cells were fixed in ice-cold 100% methanol for 10 minutes, and stained with crystal violet solution for 20 minutes. The colony area percentage and number of colonies in each sample were determined using ImageJ software.
RNA Extraction and Quantitative RT-PCR (qRT-PCR)
[0120] RNA was extracted from cells using TRIzol Plus RNA Purification Kit (Invitrogen) and treated with DNase using PureLink DNase Set (Invitrogen), according to the manufacturer's protocols and quantified using a Nanodrop Spectrophotometer. RNA samples were reverse-transcribed using GoScript Reverse Transcriptase (Promega), Random Primer Mix (New England Biolabs) and RNAse OUT (Invitrogen). qRT-PCR was performed on the LightCycler480 system (Roche) using SYBR FAST qPCR Master Mix (KAPA). LightCycler 480 SW 1.1 was used for TM curves evaluation and quantification. PCR primers are listed in Table 9.
TABLE-US-00001 TABLE 1 List of Candidate miRNAs and Primers Used for Barcoded Library Cloning miRNA precursor Forward primer (5′ to 3′) Reverse primer (5′ to 3′) let-7a CTCTAGAGATCTGGAGCGGAT ATCGCAATTGTCGCGTTTGAATTCCGTTGCG TCAGATAACCAAGC (SEQ ID GATCCGGTTTCCCCACCCCCATCCAGTG NO: 7) (SEQ ID NO: 8) let-7b/miR-4763 CTCTAGAGATCTGGCAGACAG ATCGCAATTGATGACCTTGAATTCCGTTGCG cluster TGGCTCCTCTGTACC (SEQ ID GATCCCACTGTCCCGCAGCAGACGCGC NO: 9) (SEQ ID NO: 10) let-7c CTCTAGAGATCTGGCAGGTTA ATCGCAATTGCGTTCTGTGAATTCCGTTGCG GATGGTCAGAAGAC (SEQ ID GATCCCTCGACGGCTCAAGTGTGCTCCA NO: 11) (SEQ ID NO: 12) let-7d CTCTAGAGATCTCAGGTTAAT ATCGCAATTGCGAAAGGTGAATTCCGTTGC TTGAAGTGCATCTGCC (SEQ GGATCCGAGGAGGAACAGCTGAGAGTCTC ID NO: 13) (SEQ ID NO: 14) let-7e/miR-99b CTCTAGAGATCTGGCTGAGTC ATCGCAATTGCTCCTTCGGAATTCCGTTGCG cluster CTTGGATTCCAGGAAC (SEQ GATCCGAAAGCTAGGAGGCCGTATAGTG ID NO: 15) (SEQ ID NO: 16) let-7i CTCTAGAGATCTCACCCGGGC ATCGCAATTGTTGGCAGTGAATTCCGTTGC GCCGGCGCCGCCTC (SEQ ID GGATCCGCATCGCGGTCCACCCCACTC (SEQ NO: 17) ID NO: 18) miR-10b CTCTAGAGATCTAGAAGAATA ATCGCAATTGTATGACGTGAATTCCGTTGC TTCTGGTTGTTCGCCTG (SEQ GGATCCAGGATACTCTGTTTAAAGGTGAGG ID NO: 19) (SEQ ID NO: 20) miR-126 CTCTAGAGATCTGGAAGGCGG ATCGCAATTGTGGTAACGGAATTCCGTTGC TGGGGACTCCCTCTCC (SEQ ID GGATCCGCCTGCCTGGCGCTGGCCAGAGG NO: 21) (SEQ ID NO: 22) miR-128b CTCTAGAGATCTGAAGAGAGT ATCGCAATTGTTGCGTGCGAATTCCGTTGCG GCTTCCTCTGTTCTTAAG (SEQ GATCCCAGTGCAGAAATCAGATCACGGAG ID NO: 23) (SEQ ID NO:24) miR-129-2 CTCTAGAGATCTCCTTCTCGC ATCGCAATTGGTCTATGCGAATTCCGTTGCG CCTCCACACACTTCTC (SEQ ID GATCCGAAGACAGGTGACCAAAGCCTCG NO: 25) (SEQ ID NO: 26) miR-132 CTCTAGAGATCTTGATCAACG ATCGCAATTGTAGGACGCGAATTCCGTTGC CAGGCGCCGCCATC (SEQ ID GGATCCGAGCCCTGGCTGGGATACCTTGG NO: 27) (SEQ ID NO: 28) miR-15b/16-2 CTCTAGAGATCTCGGCCTGCA ATCGCAATTGCTATGACTGAATTCCGTTGCG cluster GAGATAATACTTCTGTC (SEQ GATCCTAGTTGCTGTATCCCTGTCACAC ID NO: 29) (SEQ ID NO: 30) miR-16-1/15a CTCTAGAGATCTAGTTGTATT ATCGCAATTGGGGATACTGAATTCCGTTGC cluster GCCCTGTTAAGTTGGC (SEQ GGATCCACAGAATCATACTAAAAATAACA ID NO: 31) (SEQ ID NO: 32) miR-181a CTCTAGAGATCTCTGCACAGT ATCGCAATTGTATAAGCCGAATTCCGTTGC CTATCCCACAGTTC (SEQ ID GGATCCATCATGGACTGCTCCTTACCTTG NO: 33) (SEQ ID NO: 34) miR-181c CTCTAGAGATCTAGGTGCAAA ATCGCAATTGATTTGGACGAATTCCGTTGC CAGCACCTGAAAAGCG (SEQ GGATCCGGAAGGTCAGAGTCACCGGCAGG ID NO: 35) (SEQ ID NO: 36) miR-188 CTCTAGAGATCTGCATGAGCA ATCGCAATTGTACGCCACGAATTCCGTTGC CATGGACAGGTACACC (SEQ GGATCCCTGAGATGGGAGAAAGGACATGG ID NO: 37) (SEQ ID NO: 38) miR-196 CTCTAGAGATCTGTCTCTGGA ATCGCAATTGGATTACAGGAATTCCGTTGC ATCTGAGCTATCAGG (SEQ ID GGATCCGTTGCTCCTGGATGAAGGACCTC NO: 39) (SEQ ID NO: 40) miR-199b/3154 CTCTAGAGATCTCTGGAACCG ATCGCAATTGTCATCTTCGAATTCCGTTGCG cluster TTCGAGAGAGGCC (SEQ ID GATCCCCACATCCCCAGTCCCCATTGA (SEQ NO: 41) ID NO: 42) miR-211 CTCTAGAGATCTCGAAGAATA ATCGCAATTGTCCATTCCGAATTCCGTTGCG CATTGGTCGATGACTG (SEQ GATCCGCTGTGTCCACCAGAGTAATTA (SEQ ID NO: 43) ID NO: 44) miR-212 CTCTAGAGATCTTCTGCGAGC ATCGCAATTGCTCTAAACGAATTCCGTTGC GGAGCTGTCCTCTCA (SEQ ID GGATCCTGCGTTGATCAGCACCGCGGACA NO: 45) (SEQ ID NO: 46) miR-216 CTCTAGAGATCTCAGCAAGAG ATCGCAATTGCAGTCACCGAATTCCGTTGC GAGTAGCTTGATAATGTCGC GGATCCGGTTTCCTTTCCAGCACAACAG (SEQ ID NO: 47) (SEQ ID NO: 48) miR-24-2/27a/23a CTCTAGAGATCTCCTGTGATC ATCGCAATTGAACTCCGGGAATTCCGTTGC cluster AAAGGAAGCATCTGGG (SEQ GGATCCCATCTCTGCTCCAAGCATCAGCC ID NO: 49) (SEQ ID NO: 50) miR-29a CTCTAGAGATCTGGGGCTTTC ATCGCAATTGTGGTGGATGAATTCCGTTGC TGGAACCAATCCCTCA (SEQ GGATCCTCATGATATGCTAATAGTGAACC ID NO: 51) (SEQ ID NO: 52) miR-29b CTCTAGAGATCTCCATCAATA ATCGCAATTGTCACAGATGAATTCCGTTGC ACAAATTCAGTGAC (SEQ ID GGATCCGCCAGTGCAGAGACCTGACTGCC NO: 53) (SEQ ID NO: 54) miR-29c CTCTAGAGATCTGATTGTCAT ATCGCAATTGGGTCTTTGGAATTCCGTTGCG GGGGCAGGGGAGAG (SEQ ID GATCCCAGAATTTAGAACAGCACTAC (SEQ NO: 55) ID NO: 56) miR-31 CTCTAGAGATCTTAGTCCATA ATCGCAATTGATCGTCCGGAATTCCGTTGC AACATTCTCGAGGTTC (SEQ GGATCCGGACACAATACATAGCAGGACAG ID NO: 57) (SEQ ID NO: 58) miR-324 CTCTAGAGATCTCCAAGATAA ATCGCAATTGCGAACTGAGAATTCCGTTGC GGGCTGACCTAGCTTG (SEQ GGATCCCATCCAGCGTAGACTGAACTCTG ID NO: 59) (SEQ ID NO: 60) miR-328 CTCTAGAGATCTCCAAGCTCA ATCGCAATTGCTGTGGACGAATTCCGTTGC GCTCAGGGCCTAAGC (SEQ ID GGATCCCCAGCGCGTACAGCCGGGTCGG NO: 61) (SEQ ID NO: 62) miR-34a CTCTAGAGATCTCTGGCCTCT ATCGCAATTGAGGATGTGGAATTCCGTTGC CCAGTAGCTAGGACTAC (SEQ GGATCCCTGGCTACTATTCTCCCTACGTG ID NO: 63) (SEQ ID NO: 64) miR-373 CTCTAGAGATCTGCAGCTGTG ATCGCAATTGTGGAGATAGAATTCCGTTGC ACCAAGGGGCTGTA (SEQ ID GGATCCCTGCAGGTGAACCCCGTATCCT NO: 65) (SEQ ID NO: 66) miR-376a CTCTAGAGATCTCCGTAGGGC ATCGCAATTGGGTAGTCAGAATTCCGTTGC CTGAGTAGGTGC (SEQ ID GGATCCCAGCCCACTCAGGTATTCTC (SEQ NO: 67) ID NO: 68) miR-429 CTCTAGAGATCTTAACCCGAC ATCGCAATTGCTGAATGAGAATTCCGTTGC CGAGCTTCAGGAAGC (SEQ ID GGATCCCTCCGGGTATCTGTGACTGTGAC NO: 69) (SEQ ID NO: 70) miR-451/144/4732 CTCTAGAGATCTCAGCCCTGA ATCGCAATTGGGCAACGAGAATTCCGTTGC cluster CCTGTCCTGTTCTG (SEQ ID GGATCCCCTGCCTTGTTTGAGCTGGAGTC NO: 71) (SEQ ID NO: 72) miR-488 CTCTAGAGATCTGGCGTAGTA ATCGCAATTGAACGCGAAGAATTCCGTTGC GAGGTAGGAATGATAG (SEQ GGATCCCCTCAACTACACTGCCCCCAATC ID NO: 73) (SEQ ID NO: 74) miR-489 CTCTAGAGATCTATCAGATTC ATCGCAATTGATGACTCAGAATTCCGTTGC CTTTCCTGTGGAT (SEQ ID GGATCCAAGTGTTATGTCTATACTACTT NO: 75) (SEQ ID NO: 76) miR-708 CTCTAGAGATCTGTGAAGGGG ATCGCAATTGCTGACCAAGAATTCCGTTGC CAAGCTCTACTAAAGG (SEQ GGATCCCTCAGGAGACAATTCAGGCCTAG ID NO: 77) (SEQ ID NO: 78) miR-9-1 CTCTAGAGATCTTTCGGTCTC ATCGCAATTGCGTGAGCTGAATTCCGTTGC TGTCGTGTCTGTATCTC (SEQ GGATCCTGCTGGGGGAAAAATATGGCACC ID NO: 79) (SEQ ID NO: 80) miR-93/106b CTCTAGAGATCTCATGTGCCG ATCGCAATTGATCTTGAGGAATTCCGTTGC cluster CGAGAAGCAGCCCATG (SEQ GGATCCAGTGCTAGCTCAGCAGTAGGTTG ID NO: 81) (SEQ ID NO: 82) miR-99a CTCTAGAGATCTTTTAGTTTTG ATCGCAATTGGGATTCGGGAATTCCGTTGC AATATTTATGAAGGCC (SEQ GGATCCGTACATGGAATCGAACTTGAATG ID NO: 83) (SEQ ID NO: 84)
TABLE-US-00002 TABLE 2 Reported Expression of Candidate miRNAs in Cancer Cells miRNA expression in cancer cells miRNAs References miRNAs reported to be miR-15b/16-2 cluster, miR-24-2/27a-23a 62-64 down-regulated in cancer cluster, miR-29a, miR-29b, miR-126, miR- cells resistant to taxanes 128b, and miR-324 miRNAs reported to be let-7a, let-7b, let-7c, let-7d, let-7i, miR-9-1, 64-79 down-regulated in cancer miR-10b, miR-29a, miR-29c, miR-31, miR34a, cells resistant to other miR-126, miR-129-2, miR-132, miR-181a, miR- chemotherapy drugs 181c, miR-196, miR199b, miR-211, miR-212, miR-216, miR-328, miR373, miR-429, miR- 451/144/4732 cluster, and miR-489 miRNAs reported to have miR-16-1/15a cluster, miR-93/106b cluster, 30, 80, 81 altered expression in miR-99, miR-376a, and miR-488 ovarian cancer cell lines
TABLE-US-00003 TABLE 3 List of Two-Wise miRNA Hits that Increase Docetaxel Sensitivity in OVCAR8-ADR Cells Based on Pooled Screening with log.sub.2 ratio <−0.42 and >25% fewer barcode counts in experimental vs. control group Log.sub.2 ratio - Drug/ miR-A miR-B Vehicle miR-376a miR-16-1/15a cluster −0.92 miR-216 miR-181c −0.89 miR-31 miR-181a −0.88 miR-376a miR-212 −0.73 let-7i miR-181a −0.70 miR-93/106b cluster miR-16-1/15a cluster −0.66 miR-181a miR-93/106b cluster −0.64 miR-15b/miR-16-2 cluster miR-9-1 −0.62 miR-373 miR-181a −0.62 miR-16-1/15a cluster let-7a −0.58 miR-10b miR-16-1/15a cluster −0.57 miR-216 miR-15b/miR-16-2 cluster −0.56 miR-10b miR-212 −0.49 miR-216 miR-181a −0.48 miR-15b/miR-16-2 cluster miR-181a −0.47 miR-181a miR-16-1/15a cluster −0.47 miR-16-1/15a cluster miR-9-1 −0.46 miR-324 miR-9-1 −0.46 miR-181c miR-9-1 −0.46 miR-10b miR-196 −0.44 miR-99a miR-16-1/15a cluster −0.44 miR-31 miR-376a −0.44 miR-216 let-7a −0.44 miR-10b miR-15b/mir-16-2 cluster −0.44
TABLE-US-00004 TABLE 4 List of Two-Wise miRNA Hits that Increase Docetaxel Resistance in OVCAR8-ADR Cells Based on Pooled Screening with log.sub.2 ratio <−0.42 and >25% fewer barcode counts in experimental vs. control group Log.sub.2 ratio - Drug/ miR-A miR-B Vehicle miR-199b/3154 cluster miR-34a 0.68 miR-24-2/27a/23a cluster miR-93/106b cluster 0.64 miR-93/106b cluster miR-34a 0.62 miR-24-2/27a/23a cluster miR-34a 0.62 miR-376a miR-29b 0.61 miR-126 miR-34a 0.59 miR-196 miR-34a 0.55 miR-328 miR-34a 0.54 miR-34a miR-29a 0.52 miR-34a miR-29c 0.51 miR-128b miR-34a 0.51 miR-129-2 miR-34a 0.50 miR-29b miR-16-1/15a cluster 0.48 miR-429 miR-93/106b cluster 0.47 miR-34a let-7b/miR-4763 cluster 0.46 miR-199b/3154 cluster miR-93/106b cluster 0.46 miR-429 miR-34a 0.44 miR-489 miR-34a 0.43 miR-376a miR-34a 0.42 miR-429 miR-199b/3154 cluster 0.40 miR-324 miR-34a 0.40 miR-29b let-7b/miR-4763 cluster 0.40 miR-132 miR-34a 0.39 miR-24-2/27a/23a cluster miR-129-2 0.38 miR-34a let-7c 0.38 miR-211 miR-34a 0.38 let-7e/miR-99b cluster miR-34a 0.38 let-7i miR-34a 0.37 miR-24-2/27a/23a cluster miR-29c 0.37 miR-212 miR-188 0.37 miR-24-2/27a/23a cluster let-7d 0.36 miR-31 miR-34a 0.36 miR-451a/451b/144/4732 cluster miR-34a 0.35 miR-451a/451b/144/4732 cluster miR-24-2/27a/23a cluster 0.34 miR-488 miR-34a 0.33 miR-489 miR-93/106b cluster 0.33
TABLE-US-00005 TABLE 5 List of Three-Wise miRNA Hits that Increase Docetaxel Sensitivity in OVCAR8-ADR Cells Based on Pooled Screening with log.sub.2 ratio <−0.42 and >25% fewer barcode counts in experimental vs. control group Log.sub.2 ratio - miR-A miR-B miR-C Drug/Vehicle miR-16-1/15a cluster miR-29a miR-181c −0.95 miR-129-2 miR-181c miR-324 −0.94 let-7c miR-29a miR-199b/3154 cluster −0.83 miR-181a miR-126 miR-451a/451b/144/4732 cluster −0.80 miR-181a miR-181c miR-199b/3154 cluster −0.77 let-7e/miR-99b cluster miR-328 miR-451a/451b/144/4732 cluster −0.76 miR-9-1 miR-376a miR-451a/451b/144/4732 cluster −0.70 miR-16-1/15a cluster miR-15b/miR-16-2 cluster miR-429 −0.66 miR-324 miR-24-2/27a/23a cluster miR-373 −0.66 let-7c miR-128b miR-10b −0.65 miR-29a let-7i miR-199b/3154 cluster −0.63 miR-16-1/15a cluster miR-126 miR-216 −0.62 miR-16-1/15a cluster miR-15b/miR-16-2 cluster miR-216 −0.61 miR-708 miR-451a/451b/144/4732 cluster miR-10b −0.61 miR-29a miR-181a miR-488 −0.59 miR-181a let-7i miR-216 −0.59 miR-16-1/15a cluster miR-128b miR-181c −0.58 let-7d miR-181c miR-10b −0.58 miR-181a miR-216 miR-489 −0.57 miR-324 miR-376a miR-15b/miR-16-2 cluster −0.55 miR-708 miR-373 miR-451a/451b/144/4732 cluster −0.55 miR-181c miR-196 miR-451a/451b/144/4732 cluster −0.55 miR-181a miR-324 miR-708 −0.55 miR-16-1/15a cluster miR-451a/451b/144/4732 cluster miR-489 −0.54 let-7a miR-16-1/15a cluster miR-199b/3154 cluster −0.54 miR-16-1/15a cluster let-7e/miR-99b cluster miR-15b/miR-16-2 cluster −0.54 let-7c miR-376a miR-451a/451b/144/4732 cluster −0.54 miR-181c miR-212 miR-376a −0.54 miR-9-1 miR-29a miR-181c −0.54 miR-15b/miR-16-2 cluster miR-31 miR-196 −0.54 miR-128b miR-24-2/27a/23a cluster miR-31 −0.53 let-7c miR-324 miR-451a/451b/144/4732 cluster −0.53 miR-128b miR-188 miR-324 −0.53 miR-181a miR-15b/miR-16-2 cluster miR-489 −0.53 miR-429 miR-451a/451b/144/4732 cluster miR-10b −0.52 miR-16-1/15a cluster miR-376a miR-31 −0.51 let-7e/miR-99b cluster miR-181a miR-324 −0.51 let-7e/miR-99b cluster miR-188 miR-376a −0.51 miR-128b miR-324 miR-216 −0.51 miR-93/106b cluster miR-181c miR-373 −0.51 miR-181a miR-15b/miR-16-2 cluster miR-126 −0.50 miR-181c miR-15b/miR-16-2 cluster miR-328 −0.50 miR-181a miR-488 miR-15b/miR-16-2 cluster −0.50 miR-29c miR-181a miR-376a −0.50 let-7c let-7i miR-15b/miR-16-2 cluster −0.50 miR-708 miR-15b/miR-16-2 cluster miR-451a/451b/144/4732 cluster −0.50 miR-181c miR-488 miR-15b/miR-16-2 cluster −0.50 let-7e/miR-99b cluster miR-181a miR-15b/miR-16-2 cluster −0.49 miR-181a miR-376a miR-24-2/27a/23a cluster −0.49 miR-376a miR-488 miR-31 −0.49 miR-181c miR-376a miR-708 −0.48 miR-128b miR-15b/miR-16-2 cluster miR-489 −0.48 miR-16-1/15a cluster miR-15b/miR-16-2 cluster miR-451a/451b/144/4732 cluster −0.48 miR-9-1 miR-181c miR-451a/451b/144/4732 cluster −0.48 miR-29c miR-181c miR-31 −0.47 miR-29a miR-181c miR-126 −0.47 miR-708 let-7i miR-429 −0.47 miR-29a miR-126 miR-211 −0.47 miR-16-1/15a cluster miR-128b miR-31 −0.47 miR-132 miR-181c miR-488 −0.47 miR-376a miR-15b/miR-16-2 cluster miR-24-2/27a/23a cluster −0.47 let-7a miR-15b/miR-16-2 cluster miR-451a/451b/144/4732 cluster −0.47 miR-16-1/15a cluster miR-328 miR-451a/451b/144/4732 cluster −0.47 miR-99a miR-181c miR-31 −0.46 miR-16-1/15a cluster miR-181c miR-489 −0.46 let-7e/miR-99b cluster miR-376a miR-199b/3154 cluster −0.46 miR-128b miR-376a miR-373 −0.46 miR-9-1 miR-29a miR-451a/451b/144/4732 cluster −0.46 miR-376a miR-24-2/27a/23a cluster miR-328 −0.46 miR-373 miR-10b miR-15b/miR-16-2 cluster −0.46 miR-181a miR-324 miR-31 −0.46 miR-16-1/15a cluster miR-181c miR-211 −0.45 miR-16-1/15a cluster let-7i miR-196 −0.45 miR-15b/miR-16-2 cluster miR-126 miR-10b −0.45 miR-29c miR-181c miR-324 −0.45 let-7e/miR-99b cluster miR-181c miR-429 −0.44 miR-181c miR-126 miR-451a/451b/144/4732 cluster −0.44 miR-181c miR-31 miR-328 −0.44 miR-9-1 miR-15b/miR-16-2 cluster miR-373 −0.44 let-7d miR-29a miR-15b/miR-16-2 cluster −0.43 miR-9-1 let-7d miR-181c −0.43 miR-16-1/15a cluster let-7e/miR-99b cluster miR-181c −0.43 miR-15b/miR-16-2 cluster miR-373 miR-216 −0.43 miR-93/106b cluster let-7i miR-324 −0.43 let-7i miR-199b/3154 cluster miR-10b −0.43 miR-373 miR-10b miR-451a/451b/144/4732 cluster −0.43 miR-15b/miR-16-2 cluster miR-10b miR-211 −0.43 miR-128b miR-451a/451b/144/4732 cluster miR-181a −0.43 let-7i miR-451a/451b/144/4732 cluster miR-15b/miR-16-2 cluster −0.43 miR-9-1 miR-15b/miR-16-2 cluster miR-181a −0.43 miR-181a miR-216 miR-15b/miR-16-2 cluster −0.43
TABLE-US-00006 TABLE 6 List of Three-Wise miRNA Hits that Increase Docetaxel Resistance in OVCAR8-ADR Cells Based on Pooled Screening with log.sub.2 ratio <−0.42 and >25% fewer barcode counts in experimental vs. control group Log.sub.2 ratio - miR-A miR-B miR-C Drug/Vehicle miR-34a miR-376a miR-31 0.67 miR-29a miR-34a miR-31 0.52 miR-132 miR-429 miR-451a/451b/144/4732 cluster 0.46 miR-34a miR-376a let-7i 0.46 miR-128b miR-181c miR-188 0.45 miR-181c miR-212 miR-31 0.43 miR-34a miR-93/106b cluster miR-181c 0.41 miR-34a miR-128b miR-15b/miR-16-2 cluster 0.41 miR-129-2 miR-181c miR-376a 0.40 miR-132 miR-376a miR-211 0.40 miR-34a miR-376a miR-429 0.39 miR-34a miR-24-2/27a/23a cluster miR-196 0.38 miR-132 miR-181c miR-376a 0.38 miR-29b miR-34a miR-93/106b cluster 0.38 miR-34a miR-128b miR-132 0.38 miR-29b miR-376a miR-328 0.38 miR-34a miR-93/106b cluster miR-132 0.37 miR-34a miR-93/106b cluster miR-199b/3154 cluster 0.37 miR-29c miR-34a miR-429 0.37 miR-181c miR-211 miR-10b 0.37 let-7a miR-212 miR-376a 0.36 miR-29a let-7e/miR-99b cluster miR-31 0.36 miR-34a let-7e/miR-99b cluster miR-196 0.36 miR-128b miR-132 miR-31 0.36 miR-34a miR-132 miR-181c 0.36 miR-29c miR-34a miR-132 0.35 miR-29c miR-34a miR-93/106b cluster 0.34 miR-29c miR-34a miR-24-2/27a/23a cluster 0.34 miR-34a miR-93/106b cluster miR-429 0.34 miR-34a miR-211 miR-429 0.34 miR-34a miR-132 miR-196 0.34 miR-34a let-7e/miR-99b cluster miR-429 0.34 miR-29a miR-34a miR-429 0.33 miR-29a miR-34a miR-93/106b cluster 0.33 miR-16-1/15a cluster let-7e/miR-99b cluster miR-429 0.33 miR-29b miR-181c miR-489 0.33
TABLE-US-00007 TABLE 7 List of Three-Wise miRNA Hits that Inhibit OVCAR8-ADR Cell Proliferation Based on Pooled Screening with log.sub.2 ratio <−0.42 and >25% fewer barcode counts in experimental vs. control group Log.sub.2 ratio - miR-A miR-B miR-C Day 4/Day 1 let-7d miR-488 let-7i −0.87 miR-128b miR-212 let-7i −0.85 miR-132 miR-15b/miR-16-2 cluster miR-31 −0.82 miR-708 let-7i miR-451a/451b/144/4732 cluster −0.72 miR-181c let-7i miR-373 −0.70 miR-132 miR-212 miR-451a/451b/144/4732 cluster −0.64 let-7d miR-132 miR-181c −0.62 miR-9-1 miR-181c miR-324 −0.56 miR-29a miR-99a miR-376a −0.56 miR-128b miR-132 miR-451a/451b/144/4732 cluster −0.55 miR-16-1/15a cluster let-7e/miR-99b cluster miR-128b −0.51 miR-132 let-7i miR-15b/miR-16-2 cluster −0.51 miR-181a let-7i miR-15b/miR-16-2 cluster −0.51 miR-16-1/15a cluster miR-29a miR-488 −0.50 miR-34a miR-328 miR-451a/451b/144/4732 cluster −0.49 miR-128b miR-212 miR-451a/451b/144/4732 cluster −0.48 let-7c miR-128b miR-376a −0.48 miR-29a let-7i miR-126 −0.47 miR-181c miR-212 miR-199b/3154 cluster −0.47 miR-29a miR-29b miR-451a/451b/144/4732 cluster −0.47 miR-181a miR-31 miR-429 −0.45 miR-34a miR-181a miR-181c −0.45 miR-181c let-7i miR-429 −0.45 miR-29a miR-181a miR-429 −0.44 miR-181a miR-24-2/27a/23a cluster miR-451a/451b/144/4732 cluster −0.44 miR-34a miR-324 miR-376a −0.44 miR-128b let-7i miR-196 −0.44
TABLE-US-00008 TABLE 8 Constructs Used in this Work Construct ID Design pAWp6 pFUGW-UBCp-GFP pAWp12 pFUGW-CMVp-GFP pAWp7 pFUGW-UBCp-RFP-CMVp-GFP pAWp7-1 pFUGW-UBCp-RFP-CMVp-GFP-[miR-124] pAWp7-2 pFUGW-UBCp-RFP-CMVp-GFP-[miR-128] pAWp7-3 pFUGW-UBCp-RFP-CMVp-GFP-[miR-132] pAWp7-4 pFUGW-UBCp-RFP-CMVp-GFP-[miR-124 + miR-128] pAWp7-5 pFUGW-UBCp-RFP-CMVp-GFP-[miR-128 + miR-132] pAWp7-6 pFUGW-UBCp-RFP-CMVp-GFP-[miR-124 + miR-128 + miR-132] pAWp7-7 pFUGW-UBCp-RFP-[miR-124 sensor]-CMVp-GFP pAWp7-8 pFUGW-UBCp-RFP-[miR-128 sensor]-CMVp-GFP pAWp7-9 pFUGW-UBCp-RFP-[miR-132 sensor]-CMVp-GFP pAWp7-10 pFUGW-UBCp-RFP-[miR-124 sensor]-CMVp-GFP-[miR-124] pAWp7-11 pFUGW-UBCp-RFP-[miR-128 sensor]-CMVp-GFP-[miR-124] pAWp7-12 pFUGW-UBCp-RFP-[miR-132 sensor]-CMVp-GFP-[miR-124] pAWp7-13 pFUGW-UBCp-RFP-[miR-124 sensor]-CMVp-GFP-[miR-128] pAWp7-14 pFUGW-UBCp-RFP-[miR-128 sensor]-CMVp-GFP-[miR-128] pAWp7-15 pFUGW-UBCp-RFP-[miR-132 sensor]-CMVp-GFP-[miR-128] pAWp7-16 pFUGW-UBCp-RFP-[miR-124 sensor]-CMVp-GFP-[miR-132] pAWp7-17 pFUGW-UBCp-RFP-[miR-128 sensor]-CMVp-GFP-[miR-132] pAWp7-18 pFUGW-UBCp-RFP-[miR-132 sensor]-CMVp-GFP-[miR-132] pAWp7-19 pFUGW-UBCp-RFP-[miR-124 sensor]-CMVp-GFP-[miR-124 + miR-128] pAWp7-20 pFUGW-UBCp-RFP-[miR-128 sensor]-CMVp-GFP-[miR-128 + miR-132] pAWp7-21 pFUGW-UBCp-RFP-[miR-132 sensor]-CMVp-GFP-[miR-124 + miR-128 + miR-132] pAWSV-1 pBT264-[let-7a] pAWSV-2 pBT264-[let-7b/miR-4763 cluster] pAWSV-3 pBT264-[let-7c] pAWSV-4 pBT264-[let-7d] pAWSV-5 pBT264-[let-7e/miR-99b cluster] pAWSV-6 pBT264-[let-7i] pAWSV-7 pBT264-[miR-10b] pAWSV-8 pBT264-[miR-126] pAWSV-9 pBT264-[miR-128b] pAWSV-10 pBT264-[miR-129-2] pAWSV-11 pBT264-[miR-132] pAWSV-12 pBT264-[miR-15b/16-2 cluster] pAWSV-13 pBT264-[miR-16-1/15a cluster] pAWSV-14 pBT264-[miR-181a] pAWSV-15 pBT264-[miR-181c] pAWSV-16 pBT264-[miR-188] pAWSV-17 pBT264-[miR-196] pAWSV-18 pBT264-[miR-199b/3154 cluster] pAWSV-19 pBT264-[miR-211] pAWSV-20 pBT264-[miR-212] pAWSV-21 pBT264-[miR-216] pAWSV-22 pBT264-[miR-24-2/27a/23a cluster] pAWSV-23 pBT264-[miR-29a] pAWSV-24 pBT264-[miR-29b] pAWSV-25 pBT264-[miR-29c] pAWSV-26 pBT264-[miR-31] pAWSV-27 pBT264-[miR-324] pAWSV-28 pBT264-[miR-328] pAWSV-29 pBT264-[miR-34a] pAWSV-30 pBT264-[miR-373] pAWSV-31 pBT264-[miR-376a] pAWSV-32 pBT264-[miR-429] pAWSV-33 pBT264-[miR-451/144/4732 cluster] pAWSV-34 pBT264-[miR-488] pAWSV-35 pBT264-[miR-489] pAWSV-36 pBT264-[miR-708] pAWSV-37 pBT264-[miR-9-1] pAWSV-38 pBT264-[miR-93/106b cluster] pAWSV-39 pBT264-[miR-99a] pAWp11 pFUGW-CMVp pAWp11-1 pFUGW-CMVp-[let-7e/miR-99b cluster + miR-15b/16-2 cluster] pAWp11-2 pFVGW-CMVp-[let-7e/miR-99b cluster] pAWp11-3 pFUGW-CMVp-[let-7i + miR-128b + miR-212] pAWp11-4 pFUGW-CMVp-[let-7i + miR-128b] pAWp11-5 pFUGW-CMVp-[let-7i + miR-132 + miR-15b/16-2 cluster] pAWp11-6 pFUGW-CMVp-[let-7i + miR-132] pAWp11-7 pFUGW-CMVp-[let-7i + miR-15b/16-2 cluster] pAWp11-8 pFUGW-CMVp-[let-7i + miR-181c] pAWp11-9 pFUGW-CMVp-[let-7i + miR-212] pAWp11-10 pFUGW-CMVp-[let-7i + miR-373 + miR-181c] pAWp11-11 pFUGW-CMVp-[let-7i + miR-373] pAWp11-12 pFUGW-CMVp-[let-7i] pAWp11-13 pFUGW-CMVp-[miR-126 + miR-181a + miR-451/144/4732 cluster] pAWp11-14 pFUGW-CMVp-[miR-128b + let-7e/miR-99b cluster] pAWp11-15 pFUGW-CMVp-[miR-128b + miR-212] pAWp11-16 pFUGW-CMVp-[miR-128b] pAWp11-17 pFUGW-CMVp-[miR-132 + miR-15b/16-2 cluster] pAWp11-18 pFUGW-CMVp-[miR-132] pAWp11-19 pFUGW-CMVp-[miR-15b/16-2 cluster] pAWp11-20 pFUGW-CMVp-[miR-16-1/15a cluster + let-7e/miR-99b cluster + miR-15b/16-2 cluster] pAWp11-21 pFUGW-CMVp-[miR-16-1/15a cluster + let-7e/miR-99b cluster] pAWp11-22 pFUGW-CMVp-[miR-16-1/15a cluster + miR-128b + let-7e/miR-99b cluster] pAWp11-23 pFUGW-CMVp-[miR-16-1/15a cluster + miR-128b] pAWp11-24 pFUGW-CMVp-[miR-16-1/15a cluster + miR-15b/16-2 cluster] pAWp11-25 pFUGW-CMVp-[miR-16-1/15a cluster + miR-181c + let-7e/miR-99b cluster] pAWp11-26 pFUGW-CMVp-[miR-16-1/15a cluster + miR-181c] pAWp11-27 pFUGW-CMVp-[miR-16-1/15a cluster] pAWp11-28 pFUGW-CMVp-[miR-181c + let-7e/miR-99b cluster] pAWp11-29 pFUGW-CMVp-[miR-181c] pAWp11-30 pFUGW-CMVp-[miR-199b/3154 cluster] pAWp11-31 pFUGW-CMVp-[miR-212] pAWp11-32 pFUGW-CMVp-[miR-29a + miR-34a] pAWp11-33 pFUGW-CMVp-[miR-29a] pAWp11-34 pFUGW-CMVp-[miR-31 + miR-132 + miR-15b/16-2 cluster] pAWp11-35 pFUGW-CMVp-[miR-31 + miR-132] pAWp11-36 pFUGW-CMVp-[miR-31 + miR-15b/16-2 cluster] pAWp11-37 pFUGW-CMVp-[miR-31 + miR-29a + miR-34a] pAWp11-38 pFUGW-CMVp-[miR-31 + miR-29a] pAWp11-39 pFUGW-CMVp-[miR-31 + miR-34a] pAWp11-40 pFUGW-CMVp-[miR-31 + miR-376a + miR-34a] pAWp11-41 pFUGW-CMVp-[miR-31] pAWp11-42 pFUGW-CMVp-[miR-328] pAWp11-43 pFUGW-CMVp-[miR-34a + miR-199b/3154 cluster] pAWp11-44 pFUGW-CMVp-[miR-34a + miR-328] pAWp11-45 pFUGW-CMVp-[miR-34a + miR-429] pAWp11-46 pFUGW-CMVp-[miR-34a] pAWp11-47 pFUGW-CMVp-[miR-373 + miR-181c] pAWp11-48 pFUGW-CMVp-[miR-373] pAWp11-49 pFUGW-CMVp-[miR-376a + miR-16-1/15a cluster] pAWp11-50 pFUGW-CMVp-[miR-376a] pAWp11-51 pFUGW-CMVp-[miR-429] pAWp11-52 pFUGW-CMVp-[miR-93/106b cluster + miR-16-1/15a cluster] pAWp11-53 pFUGW-CMVp-[miR-93/106b cluster]
TABLE-US-00009 TABLE 9 List of Primers used for qRT-PCR Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′) AKT3 TGCAGCCACCATGAAGACAT GTCCTCCACCAAGGCGTTTA (SEQ (SEQ ID NO: 85) ID NO: 86) BCL2 GGAGGCTGGGATGCCTTTGT GACTTCACTTGTGGCCCAGAT (SEQ (SEQ ID NO: 87) ID NO: 88) BMI1 GCTGGTTGCCCATTGACAG AAAAATCCCGGAAAGAGCAGC (SEQ ID NO: 89) (SEQ ID NO: 90) CAPRIN1 CTGGCTATCAACGGGATGGA GCCAGAACAGAAGCTCCACT (SEQ (SEQ ID NO: 91) ID NO: 92) CCND1 GGC AGC AGA AGC GAG AGC CTC GCA GAC CTC CAG CAT (SEQ (SEQ ID NO: 93) ID NO: 94) CCND3 GAGCTGCTGTGTTGCGAAGG CGCTGCTCCTCACATACCTCC (SEQ (SEQ ID NO: 95) ID NO: 96) CCNE1 CCCATCATGCCGAGGGAG TATTGTCCCAAGGCTGGCTC (SEQ (SEQ ID NO: 97) ID NO: 98) CCNT2 CGGAGGAGGAAGTGTCATGG GCTGAGAGACATTGAGACGCT (SEQ ID NO: 99) (SEQ ID NO: 100) CDC14B TAAACTTCGGGGGTGTGGTC CAAAATCTGCGTAGAAGTTCTCAT (SEQ ID NO: 101) (SEQ ID NO: 102) CDK1 AAGCCGGGATCTACCATACC CATGGCTACCACTTGACCTGT (SEQ (SEQ ID NO: 103) ID NO: 104) CDK6 GCTGGTAACTCCTTCCCCAG GTCCAGAATCATTGCACCTGAG (SEQ ID NO: 105) (SEQ ID NO: 106) CHEK1 AGGGATCAGCTTTTCCCAGC CTCCAATCCATCACCCTGATTC (SEQ ID NO: 107) (SEQ ID NO: 108) DMTF1 TGGTGGACCATCAAAAGGCA AGGAGAGTCTGCTGAAGAAACA (SEQ ID NO: 109) (SEQ ID NO: 110) E2F3 TCTACACCACGCCGCAC (SEQ CCTTCGCTTTGCCGGAGG (SEQ ID ID NO: 111) NO: 112) FBXW7 AGTTTTGTTGCCGGTTCTGC TGGTCCAACTTTCTTTTCATTTTGT (SEQ ID NO: 113) (SEQ ID NO: 114) HMGA1 TGCTGCGCTCCTCTAATGG GCAGGTGGAAGAGTGATGG (SEQ (SEQ ID NO: 115) ID NO: 116) KLF4 CTGGGTCTTGAGGAAGTGCT GGCATGAGCTCTTGGTAATGG (SEQ (SEQ ID NO: 117) ID NO: 118) KMT2A AAGGCGAAGTGGTTCCTGAG AGGACGGCACTCCACTATCT (SEQ (SEQ ID NO: 119) ID NO: 120) PIM1 CTGGGGAGAGCTGCCTAATG GCTCCCCTTTCCGTGATGAA (SEQ (SEQ ID NO: 121) ID NO: 122) PURA GGCGCTCAAAAGCGAGTTC CTCCTCCACTCCGTAGTCGT (SEQ (SEQ ID NO: 123) ID NO: 124) RUNX1 AATCGGCTTGTTGTGATGCG GCCACCACCTTGAAAGCGAT (SEQ (SEQ ID NO: 125) ID NO: 126) ZYX CTGCTTCACCTGTGTGGTCT GGCGTACTGCTTGTGGTAGT (SEQ (SEQ ID NO: 127) ID NO: 128)
TABLE-US-00010 TABLE 10 List of Three-Wise miRNA Hits that Both Inhibit Cell Proliferation and Increase Docetaxel Sensitivity in OVCAR8-ADR Cells Based on Pooled Screening with log.sub.2 ratio <−0.32 and >20% fewer barcode counts in experimental vs. control group Log.sub.2 ratio - Log.sub.2 ratio - Day 4/ Drug/ miR-A miR-B miR-C Day 1 Vehicle miR-15b/miR-16-2 miR-181a miR-132 −0.33 −0.32 cluster miR-451a/451b/144/ miR-211 miR-132 −0.35 −0.42 4732 cluster miR-376a miR-31 miR-488 −0.34 −0.49
REFERENCES
[0121] 1. Dixon, S. J., Costanzo, M., Baryshnikova, A., Andrews, B. & Boone, C. Systematic mapping of genetic interaction networks. Annu. Rev. Genet. 43, 601-625 (2009). [0122] 2. Vierbuchen, T. & Wernig, M. Molecular Roadblocks for Cellular Reprogramming. Mol. Cell. 47, 827-838 (2012). [0123] 3. Al-Lazikani, B., Banerji, U. & Workman, P. Combinatorial drug therapy for cancer in the post-genomic era. Nat. Biotechnol. 30, 679-692 (2012). [0124] 4. Zuk, O., Hechter, E., Sunyaev, S. R. & Lander, E. S. The mystery of missing heritability: Genetic interactions create phantom heritability. Proc. Natl. Acad. Sci. 109, 1193-1198 (2012). [0125] 5. Eichler, E. E. et al. Missing heritability and strategies for finding the underlying causes of complex disease. Nat. Rev. Genet. 11, 446-450 (2010). [0126] 6. Manolio, T. A. et al. Finding the missing heritability of complex diseases. Nature 461, 747-753 (2009). [0127] 7. Johannessen, C. M. et al. A melanocyte lineage program confers resistance to MAP kinase pathway inhibition. Nature 504, 138-42 (2013). [0128] 8. Voorhoeve, P. M. et al. A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell 131, 102-114 (2007). [0129] 9. Moffat, J. & Sabatini, D. M. Building mammalian signaling pathways with RNAi screens. Nat. Rev. Mol. Cell Biol. 7, 177-187 (2006). [0130] 10. Zhou, Y. et al. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature 509, 487-491 (2014). [0131] 11. Koike-Yusa, H., Li, Y., Tan, E.-P., Velasco-Herrera, M. D. C. & Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat. Biotechnol. 32, 267-73 (2014). [0132] 12. Shalem, O. et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84-7 (2014). [0133] 13. Wang, T., Wei, J. J., Sabatini, D. M. & Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science 343, 80-4 (2014). [0134] 14. Metzker, M. L. Sequencing technologies—the next generation. Nat. Rev. Genet. 11, 31-46 (2010). [0135] 15. Yu, H. et al. Next-generation sequencing to generate interactome datasets. Nat. Methods 8, 478-480 (2011). [0136] 16. Bassik, M. C. et al. A systematic mammalian genetic interaction map reveals pathways underlying ricin susceptibility. Cell 152, 909-922 (2013). [0137] 17. Engler, C., Kandzia, R. & Marillonnet, S. A one pot, one step, precision cloning method with high throughput capability. PLoS One 3, e3647 (2008). [0138] 18. Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343-345 (2009). [0139] 19. Zelcbuch, L. et al. Spanning high-dimensional expression space using ribosome-binding site combinatorics. Nucleic Acids Res. 41, e98 (2013). [0140] 20. Yoo, A. S. et al. MicroRNA-mediated conversion of human fibroblasts to neurons. Nature 476, 228-231 (2011). [0141] 21. Brown, B. D. & Naldini, L. Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat. Rev. Genet. 10, 578-585 (2009). [0142] 22. Li, Z. & Rana, T. M. Therapeutic targeting of microRNAs: current status and future challenges. Nat. Rev. Drug Discov. 13, 622-638 (2014). [0143] 23. Patnaik, S. K. et al. Expression of MicroRNAs in the NCI-60 Cancer Cell-Lines. PLoS One 7, (2012). [0144] 24. Creighton, C. J. et al. Proteomic and transcriptomic profiling reveals a link between the PI3K pathway and lower estrogen-receptor (ER) levels and activity in ER+ breast cancer. Breast Cancer Res. 12, R40 (2010). [0145] 25. Gholami, A. M. et al. Global proteome analysis of the NCI-60 cell line panel. Cell Rep. 4, 609-620 (2013). [0146] 26. Hsu, S. Da et al. MiRTarBase update 2014: An information resource for experimentally validated miRNA-target interactions. Nucleic Acids Res. 42, D78-85 (2014). [0147] 27. Honma, K. et al. RPN2 gene confers docetaxel resistance in breast cancer. Nat. Med. 14, 939-948 (2008). [0148] 28. Strezoska, {hacek over (Z)}. et al. Optimized PCR conditions and increased shRNA fold representation improve reproducibility of pooled shRNA screens. PLoS One 7, e42341 (2012). [0149] 29. Bhattacharya, R. et al. MiR-15a and MiR-16 control Bmi-1 expression in ovarian cancer. Cancer Res. 69, 9090-9095 (2009). [0150] 30. Cheng, A. A., Ding, H. & Lu, T. K. Enhanced killing of antibiotic-resistant bacteria enabled by massively parallel combinatorial genetics. Proc. Natl. Acad. Sci. 111, 12462-7 (2014). [0151] 31. Xia, L. et al. miR-15b and miR-16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells. Int. J. Cancer 123, 372-379 (2008). [0152] 32. Kastl, L., Brown, I. & Schofield, A. C. MiRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res. Treat. 131, 445-454 (2012). [0153] 33. Krek, A. et al. Combinatorial microRNA target predictions. Nat. Genet. 37, 495-500 (2005). [0154] 34. Jacobsen, A. et al. Analysis of microRNA-target interactions across diverse cancer types. Nat. Struct. Mol. Biol. 20, 1325-32 (2013). [0155] 35. Lewis, B. P., Burge, C. B. & Bartel, D. P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120, 15-20 (2005). [0156] 37. Guillamot, M. et al. Cdc14b regulates mammalian RNA polymerase II and represses cell cycle transcription. Sci. Rep. 1: 189, (2011). [0157] 38. Huntinger, E. & Izaurralde, E. Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nat. Rev. Genet. 12, 99-110 (2011). [0158] 39. McLornan, D. P., List, A. & Mufti, G. J. Applying Synthetic Lethality for the Selective Targeting of Cancer. N. Engl. J. Med. 371, 1725-35 (2014). [0159] 40. Van Rooij, E., Purcell, A. L. & Levin, A. A. Developing MicroRNA therapeutics. Circ. Res. 110, 496-507 (2012). [0160] 41. The Cancer Genome Atlas Research Network et al. The Cancer Genome Atlas Pan-Cancer analysis project. Nat. Genet. 45, 1113-20 (2013). [0161] 42. Andersson, R. et al. An atlas of active enhancers across human cell types and tissues. Nature 507, 455-61 (2014). [0162] 43. Consortium, T. F., Pmi, R. & Dgt, C. A promoter-level mammalian expression atlas. Nature 507, 462-70 (2014). [0163] 44. Gandhi, S. & Wood, N. W. Genome-wide association studies: the key to unlocking neurodegeneration? Nat. Neurosci. 13, 789-794 (2010). [0164] 45. Peden, J. F. & Farrall, M. Thirty-five common variants for coronary artery disease: the fruits of much collaborative labour. Hum. Mol. Genet. 20, R198-205 (2011). [0165] 46. Gobeil, S., Zhu, X., Doillon, C. J. & Green, M. R. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene. Genes Dev. 22, 2932-2940 (2008). [0166] 47. Park, J. et al. RAS-MAPK-MSK1 pathway modulates ataxin 1 protein levels and toxicity in SCA1. Nature 498, 325-331 (2013). [0167] 48. Chia, N.-Y. et al. A genome-wide RNAi screen reveals determinants of human embryonic stem cell identity. Nature 468, 316-320 (2010). [0168] 49. Ebert, M. S., Neilson, J. R. & Sharp, P. A. MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat. Methods 4, 721-726 (2007). [0169] 50. Guttman, M. et al. lincRNAs act in the circuitry controlling pluripotency and differentiation. Nature 477, 295-300 (2011). [0170] 51. Gilber, L. A. et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell 159, 647-661 (2014). [0171] 52. Hsu, P. D., Lander, E. S. & Zhang, F. Development and Applications of CRISPR-Cas9 for Genome Engineering. Cell 157, 1262-1278 (2014). [0172] 53. Gaj, T., Gersbach, C. A. & Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013). [0173] 54. Zhu, F. et al. DICE, an efficient system for iterative genomic editing in human pluripotent stem cells. Nucleic Acids Res. 42, e34 (2013). [0174] 55. Bruno, I. G. et al. Identification of a MicroRNA that Activates Gene Expression by Repressing Nonsense-Mediated RNA Decay. Mol. Cell 42, 500-510 (2011). [0175] 56. Klein, M. E. et al. Homeostatic regulation of MeCP2 expression by a CREB-induced microRNA. Nat. Neurosci. 10, 1513-1514 (2007). [0176] 57. Miyamichi, K. et al. Cortical representations of olfactory input by trans-synaptic tracing. Nature 472, 191-196 (2011). [0177] 58. Ren, Y. et al. Targeted Tumor-Penetrating siRNA Nanocomplexes for Credentialing the Ovarian Cancer Oncogene ID4. Sci. Transl. Med. 4, 147ra112-147ra112 (2012). [0178] 59. Kampmann, M., Bassik, M. C. & Weissman, J. S. Integrated platform for genome-wide screening and construction of high-density genetic interaction maps in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 110, E2317-26 (2013). [0179] 60. Pierce, S. E., Davis, R. W., Nislow, C. & Giaever, G. Genome-wide analysis of barcoded Saccharomyces cerevisiae gene-deletion mutants in pooled cultures. Nat. Protoc. 2, 2958-2974 (2007). [0180] 61. Butland, G. et al. eSGA: E. coli synthetic genetic array analysis. Nat. Methods 5, 789-795 (2008). [0181] 62. Kastl, L., Brown, I. & Schofield, A. C. MiRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res. Treat. 131, 445-454 (2012). [0182] 63. Salter, K. H. et al. An integrated approach to the prediction of chemotherapeutic response in patients with breast cancer. PLoS One 3, e1908 (2008). [0183] 64. Zhou, M. et al. MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) expression. J. Biol. Chem. 285, 21496-21507 (2010). [0184] 65. Bitarte, N. et al. MicroRNA-451 is involved in the self-renewal, tumorigenicity, and chemoresistance of colorectal cancer stem cells. Stem Cells 29, 1661-1671 (2011). [0185] 66. Chen, G. Q., Zhao, Z. W., Zhou, H. Y., Liu, Y. J. & Yang, H. J. Systematic analysis of microRNA involved in resistance of the MCF-7 human breast cancer cell to doxorubicin. Med. Oncol. 27, 406-415 (2010). [0186] 67. Donzelli, S. et al. MicroRNAs: short non-coding players in cancer chemoresistance. Mol. Cell. Ther. 2, 16 (2014). [0187] 68. Laios, A. et al. Potential role of miR-9 and miR-223 in recurrent ovarian cancer. Mol. Cancer 7, 35 (2008). [0188] 69. Liang, Z. et al. Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol 79, 817-824 (2010). [0189] 70. Mitamura, T. et al. Downregulation of miRNA-31 induces taxane resistance in ovarian cancer cells through increase of receptor tyrosine kinase MET. Oncogenesis 2, e40 (2013). [0190] 71. Mosakhani, N., Mustjoki, S. & Knuutila, S. Down-regulation of miR-181c in imatinibresistant chronic myeloid leukemia. Mol. Cytogenet. 6, 27 (2013). [0191] 72. Pogribny, I. P. et al. Alterations of microRNAs and their targets are associated with acquired resistance of MCF-7 breast cancer cells to cisplatin. Int. J. Cancer 127, 1785-1794 (2010). [0192] 73. Pogribny, I. P. et al. Alterations of microRNAs and their targets are associated with acquired resistance of MCF-7 breast cancer cells to cisplatin. Int. J. Cancer 127, 1785-1794 (2010). [0193] 74. Weidhaas, J. B. et al. MicroRNAs as potential agents to alter resistance to cytotoxic anticancer therapy. Cancer Res. 67, 11111-11116 (2007). [0194] 75. Xin, F. et al. Computational analysis of microRNA profiles and their target genes suggests significant involvement in breast cancer antiestrogen resistance. Bioinformatics 25, 430-434 (2009). [0195] 76. Yang, N. et al. MicroRNA microarray identifies Let-7i as a novel biomarker and therapeutic target in human epithelial ovarian cancer. Cancer Res. 68, 10307-10314 (2008). [0196] 77. Yu, P. N. et al. Downregulation of miR-29 contributes to cisplatin resistance of ovarian cancer cells. Int. J. Cancer 134, 542-551 (2013). [0197] 78. Karaayvaz, M., Zhai, H. & Ju, J. miR-129 promotes apoptosis and enhances chemosensitivity to 5-fluorouracil in colorectal cancer. Cell Death Dis. 4, e659 (2013). [0198] 79. Luo, G. et al. Highly lymphatic metastatic pancreatic cancer cells possess stem cell-like properties. Int J Oncol 42, 979-984 (2013). [0199] 80. Nam, E. J. et al. MicroRNA expression profiles in serous ovarian carcinoma. Clin. Cancer Res. 14, 2690-2695 (2008). [0200] 81. Zhang, L. et al. Genomic and epigenetic alterations deregulate microRNA expression in human epithelial ovarian cancer. Proc. Natl. Acad. Sci. U.S.A. 105, 7004-7009 (2008).
[0201] Having thus described several aspects of at least one embodiment of this invention, it is to be appreciated various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure, and are intended to be within the spirit and scope of the invention. Accordingly, the foregoing description and drawings are by way of example only.
Equivalents
[0202] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. In addition, any combination of two or more of such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
[0203] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0204] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
[0205] The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and/or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0206] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or,” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0207] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0208] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited. All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0209] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United 30 States Patent Office Manual of Patent Examining Procedures, Section 2111.03.