TGF-BETA INHIBITION, AGENTS AND COMPOSITION THEREFOR

Abstract

The present disclosure relates to TGF-beta inhibition utilizing certain agents such as Artemisinin and antisense oligonucleotides including OT-101. The present invention also provides the composition comprising the said agents optionally along with one or more additional therapeutic agent, method of treating various viral diseases including COVID-19 and method of use involving said agents. The present invention further provides a substantially pure Artemisinin having a purity of more than 90%. The present invention also provides Artemisinin for use in the treatment of COVID-19. The present invention provides a process of extraction of artemisinin and a composition of matter comprising artemisinin. The present invention also provides a method of treating TGF-beta storm. The present invention also provides a method of use of anti-sense oligonucleotide by suppression of TGF-beta induced proteins including IL-6, TGFBIp.

Claims

1-79. (canceled)

80. A method for treating or ameliorating a viral disease due to SARS-CoV-2 in a patient in need, the method comprising administering to the patient a composition comprising an agent for inhibiting or suppressing expression of TGF-β.

81. The method of claim 80, wherein the method ameliorates one or more symptoms comprising cytokine storm, multiorgan inflammatory syndrome, Kawasaki syndrome, IgA vasculitis, cytokine induced pneumonia, or suppresses TGF-β-induced proteins.

82. The method of claim 80, wherein the SARS-CoV-2 is any variant of COVID-19.

83. The method of claim 80, wherein the route of administration is intravenous, intrathecal, intramuscular, subcutaneous, or oral.

84. The method of claim 80, wherein the agent for inhibiting or suppressing expression of TGF-β is an antisense oligonucleotide.

85. The method of claim 84, wherein the antisense oligonucleotide is selected from SEQ ID NOs:5-13 as follows TABLE-US-00025 SEQ ID NO: 5, gtaggtaaaa acctaatat SEQ ID NO: 6, gttcgtttag agaacagatc SEQ ID NO: 7, taaagttcgt ttagagaaca g SEQ ID NO: 8, agccctgtat acgac SEQ ID NO: 9, gtaggtaaaa acctaatat SEQ ID NO: 10, cgtttagaga acagatctac SEQ ID NO: 11, cattgtagat gtcaaaagcc SEQ ID NO: 12, ctccctcatg gtggcagttg a SEQ ID NO: 13, cggcatgtct attttgta (OT-101) and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.

86. The method of claim 84, wherein the antisense oligonucleotide is SEQ ID NO:13 cggcatgtct attttgta (OT-101) and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.

87. The method of claim 84, wherein the antisense oligonucleotide is in a sterile saline solution at a concentration of from 1000 μg/mL to 20 mg/mL.

88. The method of claim 80, wherein the agent for inhibiting or suppressing expression of TGF-β comprises an Artemisia annua extract.

89. The method of claim 88, wherein the Artemisia annua extract is at least 90% pure Artemisinin, and pharmaceutically acceptable salts, esters, polymorphs, stereoisomers, and mixtures thereof.

90. The method of claim 88, wherein the Artemisia annua extract comprises Artemisinin in an amount of 250-750 mg.

91. The method of claim 88, wherein the Artemisia annua extract comprises an oral dosage form comprising Artemisinin in capsules, tablets, powders, pouches, sachets, or suppositories.

92. The method of claim 88, wherein the Artemisia annua extract is substantially free of Artemisitene, 9-epiartemisinin, and Thujone.

93. The method of claim 88, wherein the Artemisia annua extract comprises one or more of artemether (ARM), artesunate (ARS), and dihydroartemisinin.

94. The method of claim 88, wherein the Artemisia annua extract comprises 45-99% w/w of Artemisinin.

95. The method of claim 88, wherein the Artemisia annua extract comprises 88-97 weight % of Artemisinin.

96. The method of claim 88, wherein the Artemisia annua extract is formulated with one or more pharmaceutically-acceptable excipients selected from diluents, stabilizers, disintegrants, and anticaking agents.

97. The method of claim 88, wherein the Artemisia annua extract is formulated with 1-5 weight % of stabilizers, 0.2-1 weight % of diluents, 1-4 weight % of disintegrants, and 1-2 weight % of anticaking agents.

98. The method of claim 88, wherein the Artemisia annua extract is formulated with stabilizer polysorbate 80, diluent microcrystalline cellulose, disintegrant crospovidone or croscarmellose, and anticaking agent magnesium stearate.

99. The method of claim 88, wherein the Artemisia annua extract is formulated with one or more of Curcumin, Boswellia, Vitamin C, Piperiquine, and Pyronaridine.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0186] The present disclosure broadly lies in the field of pharmaceutics, particularly, TGF-beta inhibition. Specifically, the present invention relates to TGF-beta inhibition utilizing certain agents such as Artemisinin, antisense oligonucleotides. The present invention also provides the composition comprising the said agents, method of treatment and method of use involving said agents.

[0187] FIG. 1: FIG. 1 shows a process flow chart for extraction of Artemisinin.

[0188] FIG. 2A: FIG. 2A shows a chart of the time dependent improvement in symptoms for patients treated with ARTIVeda™+SOC versus SOC alone.

[0189] FIG. 2B: FIG. 2B shows a chart of the time dependent improvement in symptoms for patients treated with SOC alone.

[0190] FIG. 3: FIG. 3 shows a site specific SOC.

[0191] FIG. 4: FIG. 4 shows days to reduction of 1 WHO scale i.e. 2 to 1 and 4 to 3. The solid line is SOC+ARTIVeda™ and the dotted line is SOC alone.

[0192] FIG. 5: FIG. 5 shows Log-Rank Statistical Analysis for rate of recovery between ARTIVeda™+SOC and SOC alone. ARTIVeda™ is benefiting the patients and the sicker the patients as shown by increasing WHO scale, the more obvious the differences between ARTIVeda™ treated versus ARTIVeda™ untreated.

[0193] FIG. 6: FIG. 6 shows a Manufacturing Process Flow Chart for Artemisinin Immediate Release Capsules 500MG.

[0194] FIG. 7: FIG. 7 shows OT-101 Treatment Suppressed IL-6.

DETAILED DESCRIPTION

[0195] The principal objective of the present invention is to provide TGF-beta inhibition by administering agent selected from the group comprising of Artemisinin, OT-101 antisense oligonucleotide.

[0196] One of objective of the present invention is to provide composition comprising the agents selected from the group comprising of Artemisinin, OT-101 antisense oligonucleotide and other anti-sense oligonucleotides.

[0197] Yet another objective of the present invention is to provide TGF-beta inhibition by administering Artemisinin.

[0198] Yet another objective of the present invention is to provide TGF-beta inhibition by administering OT-101.

[0199] Another objective of the present invention is to provide a substantially pure Artemisinin having a purity of more than 90%.

[0200] Yet another objective of the present invention is to provide a substantially pure Artemisinin free of the impurity Thujone.

[0201] Yet another object of the present invention is to provide a substantially pure Artemisinin with negligible amount of the impurities such as Artemisinin, 9-epiartemisinin.

[0202] One more objective of the present invention is to provide Artemisinin for use in the treatment or prophylaxis of viral or pulmonary diseases.

[0203] Yet another objective of the present invention is to provide Artemisinin for use in the treatment of COVID-19.

[0204] One more objective of the present invention is to provide Artemisinin for use in the treatment of COVID-19.

[0205] Yet another objective of the present invention is to provide composition comprising the agents selected from the group comprising of Artemisinin, OT-101 antisense oligonucleotide along with one or more additional therapeutic agents.

[0206] Yet another objective of the present invention is to provide a method of treating a fibrosis or any collagen related diseases, cancers, viral diseases, bacterial diseases, fungal diseases, parasite born diseases by administering to a subject agent selected from the group comprising of Artemisinin, OT-101 antisense oligonucleotide and other anti-sense oligonucleotides optionally with one or more additional therapeutic agents.

[0207] Yet another objective of the present invention is to provide a method of treating COVID-19 by administering to a subject agent selected from the group comprising of Artemisinin, OT-101 antisense oligonucleotide and other anti-sense oligonucleotides optionally with one or more additional therapeutic agents.

[0208] Yet another objective of the present invention is to provide a method of treatment by administering the agents by intravenous, intrathecal, intramuscular, oral, and any other acceptable route of administration.

[0209] Yet another objective of the present invention is to provide a pharmaceutically acceptable oral dosage form comprising artemisinin.

[0210] Yet another objective of the present invention is to provide a process of extraction of artemisinin.

[0211] Yet another objective of the present invention is to provide a composition of matter comprising artemisinin.

[0212] Yet another objective of the present invention is to provide a composition of matter of derivatives of artemisinin such as artemether (ARM), artesunate (ARS) and dihydroartemisinin.

[0213] Yet another objective of the present invention is to provide Artemisia annua extract comprising Artemisinin, Artemisitene, 9 -epiartemisinin and Thujone.

[0214] Yet another objective of the present invention is to provide the composition of matter comprising Artemisinin formulated as drug product.

[0215] Yet another objective of the present invention is to provide a composition of matter comprising an anti-sense oligonucleotide OT-101 or OT-101 in combination with anti-sense oligonucleotide sequence selected from SEQ ID NOS:5-12 wherein the backbone is modified as OME or LNA, pharmaceutical composition thereof, and use thereof in treatment of viral diseases including COVID-19.

[0216] Yet another objective of the present invention is to provide method of treating TGF-beta storm.

[0217] One more objective of the present invention is to provide a method of use of anti-sense oligonucleotide by suppression of TGF-beta induced proteins including IL-6, TGFBIp.

[0218] The present disclosure broadly lies in the field of pharmaceutics, particularly, TGF-beta inhibition. Specifically, the present invention relates to TGF-beta inhibition utilizing certain agents such as Artemisinin, antisense oligonucleotides. The present invention also provides the composition comprising the said agents, method of treatment and method of use involving said agents.

[0219] At the very outset of the detailed description, it may be understood that the ensuing description only illustrates a particular form of this invention. However, such a particular form is only exemplary embodiment, and without intending to imply any limitation on the scope of this invention. Accordingly, the description is to be understood as an exemplary embodiment and teaching of invention and not intended to be taken restrictively.

[0220] Accordingly, an important embodiment of the present invention relates TGF-beta inhibition by administering agent selected from the group comprising of Artemisinin, OT-101 antisense oligonucleotide.

[0221] In one aspect of the embodiment, the present invention relates to the TGF-beta inhibition by administering agent selected from the group comprising of Artemisinin, OT-101 antisense oligonucleotide wherein TGF-beta can be TGF-beta1, or TGF-beta2 or TGF-beta3.

[0222] In another aspect of the embodiment, the present invention, the present invention relates to the TGF-beta inhibition by administering Artemisinin.

[0223] In yet another aspect of the embodiment, the present invention relates to the TGF-beta inhibition by administering anti-sense oligonucleotide, preferably OT-101.

[0224] In one more aspect of the embodiment, the present invention relates to the TGF-beta inhibition by administering anti-sense oligonucleotide, preferably OT-101 or OT-101 wherein the backbone is modified as OME or LNA.

[0225] In yet another aspect of the embodiment, the present invention relates to TGF-beta inhibition by administering anti-sense oligonucleotide OT-101 or OT-101 in combination with antisense oligonucleotide sequence selected from SEQ ID NOS:5-12.

[0226] In one more aspect of embodiment the agents are administered to a human or an animal.

[0227] Another embodiment of the present invention relates composition comprising the agents selected from the group comprising of Artemisinin, OT-101 antisense oligonucleotide and other anti-sense oligonucleotides for TGF-beta inhibition.

[0228] In one aspect of the embodiment, the present invention relates to a composition comprising the agent Artemisinin for TGF-beta inhibition.

[0229] In another aspect of the embodiment, the present invention relates to a composition comprising the agent OT-101 or OT-101 the backbone is modified as OME or LNA, for TGF-beta inhibition. Another important embodiment of the present invention relates to a substantially pure Artemisinin having a purity of more than 90%.

[0230] In one aspect of the embodiment the present invention relates to substantially pure Artemisinin free of the impurities such as Thujone.

[0231] In another aspect of the embodiment the present invention relates to substantially pure Artemisinin negligible amount of the impurities such as Artemisinin, 9-epiartemisinin.

[0232] In yet another aspect of the embodiment the present invention relates to substantially pure Artemisinin free of the impurities such as Artemisinin, 9-epiartemisinin and Thujone.

[0233] In one of the embodiment the present invention relates to a process of extraction of artemisinin, from the plant Artemisia annua comprising the steps of extracting the plant extract with water, partitioning the extract between water and petroleum ether, chromatographing the extracted solution on silica gel adsorbent with a solvent comprising petroleum ether and ethyl acetate to obtain artemisinin in eluted solution and evaporating the eluted solution to obtain oily material followed by crystallization to produce substantially pure artemisinin.

[0234] In one more embodiment the present invention relates to Artemisinin for use in the treatment or prophylaxis of viral or pulmonary diseases.

[0235] In one more aspect of the embodiment the present invention relates to Artemisinin for use in the treatment or prophylaxis of viral diseases including but not limited to SARS, MERS, RSV, Coronavirus, HIV, Ebola, Cytomegalovirus (CMV). Human herpes virus type 6 (HHV-6), Herpes simplex virus (HSV-1 and HSV2), Epstein-Barr virus (EBV), Hepatitis B virus (HBV).

[0236] In another aspect of the embodiment the present invention relates to Artemisinin for use in the treatment or prophylaxis of viral disease such as COVID-19.

[0237] In one of the embodiment the present invention relates to a pharmaceutical composition comprising Artemisinin in free, or pharmaceutically acceptable salts form, polymorphs or stereoisomers or mixtures thereof, optionally along with pharmaceutically acceptable excipients.

[0238] In one aspect of the embodiment the present invention relates to the composition Artemisinin, stabilizers selected from polysobate 80 and polysorbate 80 dry powder, diluents selected from microcrystalline cellulose, disintegrants selected from crospovidone and croscarmellose and anticaking agent selected from magnesium stearate.

[0239] In another aspect of the embodiment the present invention provides the pharmaceutical composition wherein the composition comprises 88-97 weight % of Artemisinin, 1-5 weight % of stabilizers, 0.2-1 weight % of diluents, 1-4 weight % of disintegrants and 1-2 weight % of anticaking agents.

[0240] In another aspect of the embodiment the present invention provides a pharmaceutical composition comprising Artemisinin in free, or pharmaceutically acceptable salts form, polymorphs or stereoisomers or mixtures thereof and one or more pharmaceutically acceptable excipient selected from the group consisting of diluents, stabilizers, disintegrants and anticaking agent, wherein composition comprises 45-99% w/w of Artemisinin, 1-50% w/w of diluents and 2-20% w/w anticaking agent.

[0241] In another aspect of the embodiment the present invention provides the pharmaceutical composition comprising substantially pure Artemisinin having a purity of more than 90%.

[0242] In another aspect of the embodiment the present invention provides the pharmaceutical composition comprising substantially pure Artemisinin free from Artemisinin, 9-epiartemisinin and Thujone impurities.

[0243] In yet another embodiment the present invention provides a method of treating a fibrosis or any collagen related diseases, cancers, viral diseases, bacterial diseases, fungal diseases, parasite born diseases wherein the method comprises administering to a subject a therapeutically effective amount of Artemisinin.

[0244] In one aspect of the embodiment the method is for treating viral disease induced by, but not limited to SARS, MERS, RSV, coronavirus, HIV, Ebola, Cytomegalovirus (CMV). Human herpes virus type 6 (HHV-6), Herpes simplex virus (HSV-1 and HSV2), Epstein-Barr virus (EBV), Hepatitis B virus (HBV).

[0245] In one more aspect of the embodiment the present invention relates a method of treating COVID-19 administering to a subject a therapeutically effective amount of Artemisinin.

[0246] In one more aspect of the embodiment the Artemisinin inhibits TGF-beta, wherein TGF-beta is TGF-beta1, or TGF-beta2 or TGF-beta3.

[0247] In one more aspect the administration includes intravenous, intrathecal, intramuscular, oral, and any other acceptable route of administration. In yet another embodiment, the present invention relates to Artemisinin for use in the treatment of COVID-19.

[0248] Another important embodiment of the present invention relates to provides composition comprising the Artemisinin.

[0249] Another important embodiment of the present invention relates to a pharmaceutically acceptable oral dosage form comprising artemisinin.

[0250] In one aspect of the embodiment the present invention relates a pharmaceutically acceptable oral dosage form comprising artemisinin in an amount of 250-750 mg each day for five days, preferably in an amount 500 mg each day for five days.

[0251] Efficacy of ARTIVeda™ (Artemisinin/Artemisia absinthium plant extract/Damanaka per Ayurvedic text)—Artemisia extract—was found to have activity against COVID-19 based on our own internal studies (clinical and cell based) with independent confirmation from others across the globe. The data is strongly supportive of ARTIVeda™ as therapeutic against COVID-19.

[0252] Bioactives in plants, such as Artemesia, are secondary metabolites that are intimately involved in the cellular metabolism and plant physiology that are created to further improve survival of plant as part of the coevolution of plant within the ecosystem as defense against pathogens such as viruses, as attractor for pollinators such as insects, and the health of the disseminators such as grazing animals. What started out as pharmacophore to confer survival advantage is exploited by human to treat maladies afflicted them. Over thousands of years, the traditional herbal medicine is codified into various system of traditional medicines. Ethnobiology take insights garnered from traditional medicine information for the development of pharmaceutical drug.

[0253] Artemisia species are widely use in traditional medicine. Artemisia are mostly herb, and sometimes shrubs, usually with strong aroma. Plant bodies are often densely hairy. Leaves are pinnatifid to pinnatisect with variable dimensions. Capitulum inflorescence is generally in the form of a paniculate-raceme arrangement. Herbaceous involucral bracts are present. Receptacles are convex or flat and naked or covered by hairs. Ray florets are pistillate. Corolla color is yellow or green and rarely brown. Disk florets are bisexual. Cypselas are obovoid to oblong and mostly brown. There are three well known species that are in cultivation in India. Artemisia annua, though not indigenous to India, is now cultivated widely in Kashmir valleys, hills of Himachal Pradesh, Uttar Pradesh, and other parts of the country. The chemical composition of Artemisia consists of volatile and nonvolatile constituents, mainly sesquiterpenoids, including artemisinin. [0254] 1. A. absinthium L. (Vilayati afsantin, Afsantin, Kakamush, Afsantheen, Zoon). Ethnobotanical uses: 1. The dried plant is used to protect clothes against insects and as an insecticide. 2. The whole plant decoction is used as a tonic for general health. 3. Leaf powder is used for gastric problems and intestinal worms. 4. Seed powder is taken orally to treat rheumatism. 5. Seed powder paste is applied on teeth for pain relief. Trade name: Dvipantara Damanaka. [0255] 2. A. annua L. (Afsantin, Afsantin jari). Ethnobotanical uses: 1. A decoction of the whole plant is used for treatment of Malaria. 2. Leaves are used for fever, cough and common cold. 3. Dry powder of leaves is taken to treat diarrhea. 4. Oil of afsantin is used in local perfumes (ettar) due to its pleasant fragrance. Trade name: Seeme Davana. [0256] 3. A. vulgaris L. (Tatwan, Nagdowna, Tarkha). Ethnobotanical uses: 1. A leaf infusion is used in fever. 2. The tomentum is used as moxa. Trade name: Dvipantara Damanaka.

Pharmaceutical Vegetable Capsule Compositions Comprising Artemisinin

[0257] In one more embodiment the present disclosure relates to pharmaceutical vegetable capsules comprising artemisinin, in free, or pharmaceutically acceptable salts form, polymorphs or stereoisomers or mixtures thereof, optionally in combination with one or more additional therapeutic agents, processes or manufacture thereof and methods of use in the treatment or prophylaxis of COVID-19 disease.

[0258] In another embodiment, a pharmaceutically acceptable dosage form for pulmonary health support is provided. The pharmaceutically acceptable oral dosage can include a therapeutically effective amount of artemisinin and a pharmaceutically acceptable carrier. The oral dosage form can, when measured using a USP Type-II dissolution apparatus in 900 mL of sodium phosphate buffer of pH 6.8 with 2% (w/v) sodium lauryl sulfate at 75 rpm at 37° C., releases at least 70 wt % of artemisinin after 45 minutes, or in the alternative release at least 20 wt % more after 45 minutes than an equivalently dosed oral dosage form without the carrier.

[0259] In another embodiment, the pharmaceutical composition of the present invention of vegetable capsule of oral dosage form can be packaged in HDPE bottles or blister packs.

Artemisinin Dosing: Selection of 500 Mg Oral Dose Each Day for Five Days as the Optimal Dose.

[0260] The pharmacokinetics of artemisinin was studied in multiple clinical trials previously for malaria at the various dose level. By analyzing the data from those clinical trials we arrived at the optimal dose of 500 mg dose level once a day for five days follow by 5 days break. This completed one cycle of treatment and patients are allowed to continue up to 3 cycles of treatment as necessary to achieve complete recovery.

[0261] Another embodiment the present invention relates to a composition comprising the Artemisinin along with one or more additional therapeutic agents.

[0262] In one more aspect of the embodiment the present invention provides a pharmaceutical composition Artemisinin in free, or pharmaceutically acceptable salts form, polymorphs or stereoisomers or mixtures thereof, further comprising one or more additional therapeutic agents.

[0263] In one of the aspect one or more additional therapeutic agent is selected from Piperiquine, Pyronaridine, Curcumin, Frankincense, or SOC.

[0264] In another aspect of the embodiment, SOC is defined as the treatment with the drugs selected from Remdesivir, Sompraz D, Zifi CV/Zac D, CCM, Broclear, Budamate, Rapitus, Montek LC, lower molecular weight heparine, prednisolone, Doxycylline Paracetamol, B. complex, Vitamin-C, Pantoprozol, Doxycycline, Ivermectin, Zinc, Foracort-Rotacaps inhalation, Injection Ceftriaxone, Tab Paracetamol, Injection Fragmin, Tablet Covifor, Azithromycin, pantoprazole, Injection Dexamethasone, Injection Odndansetron, Tablet Multivitamin, Tablet Ascorbic Acid, Tablet Calcium Carbonate, Tablet Zinc Sulfate.

[0265] In one more aspect of the embodiment, the present invention relates to a pharmaceutical composition comprising Artemisinin, Curcumin, Frankincense, and vitamin C.

[0266] In one more aspect of the embodiment, the present invention relates to a pharmaceutical composition comprising Artemisinin and piperaquine.

[0267] In another aspect of the embodiment, the present invention relates to a pharmaceutical composition comprising Artemisinin and pyronaridine in 70:30 to 30:70 weight %.

[0268] In yet another aspect of the embodiment, the composition is in form of a nanoparticular formulation.

[0269] In yet another aspect of the embodiment, the composition is in form of a spray.

[0270] In one of the aspects the present invention provides a composition comprising Artemisinin along with Curcumin. The product ArtemiC is a medical spray comprised of Artemisinin Curcumin, Frankincense and vitamin C. ArtemiC demonstrates the following distinct advantages: [0271] 1. A full safety and efficacy profile with no drug-adverse events; [0272] 2. The ability to prevent deterioration of COVID-19 patients and achieve faster clinical improvement; [0273] 3. The ability to assist in reducing the pressure on the medical system and support coping with hospitalised patients; [0274] 4. The ability to improve symptoms and pain associated with COVID-19; [0275] 5. The versatility to be used in community as well as in hospitals; and [0276] 6. As the mechanism of action of ArtemiCTM is focused on the anti-inflammatory effect and prevention of cytokine storm, a wide spectrum of potential indications will be considered for future development.

[0277] In one more aspect of the embodiment, the present invention provides a preparation of ArtemiC, comprising Artemisinin, Curcumin, Boswellia, and Vitamin C in a nanoparticular formulation, is proposed as a treatment for the disease associated with the novel corona virus SARS-CoV-2. It is readily available in light of its status as a food supplement. This initiative is presented under the urgent circumstances of the fulminant pandemic caused by this lethal disease, which is known as COVID-19 and has spread across the globe causing death and disrupting the normal function of modern society. The grounds for the proposal are rooted in existing knowledge on the components and pharmacological features of this formulation and their relevance to the current understanding of the disease process being addressed.

[0278] Leading among these considerations are well established immuno-modulatory activities of the active ingredients as established in vitro and in vivo and published over the years. These activities as apparent, for example, in diminishing activity of TNF alpha and IL-6 levels are acknowledged to be relevant to the pathophysiology processes involved in the progressive form of COVID-19. The active agents have in addition prominent anti-oxidant, anti-inflammatory as well as anti-aggregant and anti-microbial activities.

[0279] Based on these activities and observations in animal models, together with clinical experience of the separate ingredients and in various combinations in other contexts it is proposed to evaluate their effect in the context of COVID-19.

[0280] In one of the embodiments the present invention relates a Composition of matter comprising artemisinin.

[0281] In one embodiment the present invention relates a composition of matter of derivatives of artemether (ARM), artesunate (ARS) and dihydroartemisinin. artemisinin such as.

[0282] In one embodiment the present invention relates a Artemisia annua extract comprising Artemisinin, Artemisitene, 9-epiartemisinin and Thujone.

[0283] In one aspect of the embodiment the present invention relates a composition of matter formulated as drug product.

[0284] In one more aspect of the embodiment the drug product is capsules, tablets, powders, pouches, sachets, suppository.

[0285] In yet another aspect of the embodiment the drug product is encapsulated in vegetable, hard gelatin or soft gelatin capsules.

[0286] In another aspect of the embodiment the present invention relates to drug product formulated as capsules, tablets, powders, pouches, sachets, suppository for release of the drug immediate release, sustained release or modified release.

[0287] In yet another aspect of the embodiment dissolution profile is such that greater 40% dissolution is achieved within 15 min.

[0288] Another important embodiment of the present invention relates to a composition of matter comprising an anti-sense oligonucleotide OT-101 or OT-101 in combination with anti-sense oligonucleotide sequence selected from SEQ ID NOS:5-12 wherein the backbone is modified as OME or LNA, pharmaceutical composition thereof, and use thereof in treatment of viral diseases including COVID-19.

[0289] Anti-sense oligonucleotides of this invention include the following:

TABLE-US-00002 SEQ ID NO: 5, gtaggtaaaa acctaatat. SEQ ID NO: 6, gttcgtttag agaacagatc. SEQ ID NO: 7, taaagttcgt ttagagaaca g. SEQ ID NO: 8, agccctgtat acgac. SEQ ID NO: 9, gtaggtaaaa acctaatat. SEQ ID NO: 10, cgtttagaga acagatctac. SEQ ID NO: 11, cattgtagat gtcaaaagcc. SEQ ID NO: 12, ctccctcatg gtggcagttg a. SEQ ID NO: 13, cggcatgtct attttgta. (OT-101)

[0290] Antisense oligonucleotides given in SEQ ID NOs:5-13 herein can be chemically-modified, as known in the art.

[0291] Antisense oligonucleotide OT-101 is SEQ ID NO:13.

[0292] Another important embodiment of the present invention relates to a pharmaceutical composition comprising antisense oligonucleotide selected from sequences OT-101, any of SEQ ID NOS:5-12, or a combination thereof, optionally along with one or more pharmaceutically acceptable excipients.

[0293] In one of the aspects one or more pharmaceutically acceptable excipients is selected from the group comprising of vehicles, stabilizers, diluents, disintegrants, anticaking agents and/or additives.

[0294] In one more aspect of the embodiment the present invention relates to a pharmaceutical composition comprising OT-101 in combination with any of SEQ ID NOS:5-12 in ratio of 1:1 to 1:100.

[0295] In one more aspect of the embodiment the present invention relates to a pharmaceutical composition comprising OT-101 in combination with any of SEQ ID NOS:5-12 wherein the backbone is modified as OME or LNA, further comprising one or more additional therapeutic agents.

[0296] In yet another aspect of the embodiment the composition is in form of a nanoparticular formulation.

Design of ASO Against SARS-CoV2

[0297] Success or failure of an anti-sense experiment fundamentally depends on first selecting the right target sequence within the particular mRNA of interest. The antisense oligonucleotide (ASO), along with its appropriate chemical modifications, is then designed around that sequence. The following should be taken into consideration when selecting the mRNA target sequence:

ASO Length.

[0298] The ASO comprises at least 8 nucleotides, optimally 20 nucleotides. The ratio of residues forming 3 hydrogen bonds and 2 hydrogen bonds should be >=2.9.

[0299] ASO should be about 20 bases long; such oligos are easy to synthesize, form stable DNA-RNA duplexes, and are long enough to be unique, at least in the human genome. Uniqueness is important; it is critical that the ASO does not bind, even partially, to a non-target mRNA. If as few as 6-7 base pairs are formed between the ASO and non-target mRNA, that likely would be sufficient to initiate RNase H activity, leading to cleavage of the wrong target.

[0300] Blast search to identify mRNA with 100% match was negative for the entire sequence; 100% matches for the partial sequence were found — except TRS-1, the T.sub.m is not above 37° C. to be of concern. Another sequence, the FS, exhibited abnormally short sequence and low T.sub.m and therefore would not be suitable as therapeutic antisense.

[0301] The following ASOs are being evaluated against COVID-19.

TABLE-US-00003 Off Target Name Sequence (5′-3′) mRNA 5TERM GGTAGGTAAAAACCTAATAT (SEQ ID NO: 14) Highest (1-20) match = 14 nt/T.sub.m of 25.0 Homo sapiens protein geranylgeranyltransferase type I subunit 14 nt/25.0° C. beta (PGGT1B), mRNA Sequence ID: NM_005023.4Length: 9550Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 28.2 bits(14) 12 14/14(100%) 0/14(0%) Plus/Plus Query 7 TAAAAACCTAATAT 20 (SEQ ID NO: 15) Sbjct 4678 TAAAAACCTAATAT 4691 (SEQ ID NO: 16) Homo sapiens CA5BP1-CA5B readthrough (CA5BP1-CA5B), 14 nt/27.0° C. transcript variant 1, long non-coding RNA Sequence ID: NR_160544.1 Length: 8116Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 28.2 bits(14) 12 14/14(100%) 0/14(0%) Plus/Plus Query 6 GTAAAAACCTAATA 19 (SEQ ID NO: 17) Sbjct 1271 GTAAAAACCTAATA 1284 (SEQ ID NO: 18) Homo sapiens integrator complex subunit 14 (INTS14), 13 nt/27.0° C. transcript variant 3, non-coding RNA Sequence ID: NR_045105.3Length: 2678Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 26.3 bits(13) 49 13/13(100%) 0/13(0%) Plus/Plus Query 3 TAGGTAAAAACCT  15 (SEQ ID NO: 19) Sbjct 2099 TAGGTAAAAACCT 2111 (SEQ ID NO: 20) TRS1 GTTCGTTTAGAGAACAGATC (SEQ ID NO: 21) Highest (53-72) match = 14 nt/T.sub.m of 31.0° C. PREDICTED: Homo sapiens uncharacterized LOC105375623 14 nt/31.0° C. (LOC105375623), transcript variant X1, ncRNA Sequence ID: XR_928373.3Length: 743Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 28.2 bits(14) 12 14/14(100%) 0/14(0%) Plus/Plus Query 5 GTTTAGAGAACAGA 18 (SEQ ID NO: 22) Sbjct 296 GTTTAGAGAACAGA 309 (SEQ ID NO: 23) Homo sapiens plakophilin 4 (PKP4), transcript variant 8, mRNA 13 nt/29.0° C. Sequence ID: NM_001377220.1Length: 5842Number of Matches: 1 Range 1: 1292 to 1304GenBankGraphicsNext Match Previous Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 26.3 bits(13) 49 13/13(100%) 0/13(0%) Plus/Plus Query 5 GTTTAGAGAACAG 17 (SEQ ID NO: 24) Sbjct 1292 GTTTAGAGAACAG 1304 (SEQ ID NO: 25) Homo sapiens golgin, RAB6 interacting (GORAB), transcript 13 nt/29.0° C. variant 1, mRNA Sequence ID: NM_152281.3Length: 2540Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 26.3 bits(13) 49 13/13(100%) 0/13(0%) Plus/Plus Query 1 GTCGTTTAGAGA 13 (SEQ ID NO: 26) Sbjct 971 GTTCGTTTAGAGA 983 (SEQ ID NO: 27) TRS2 TAAAGTTCGTTTAGAGAACAG (SEQ ID NO: 28) Highest (56-76) match = 13 nt/T.sub.m of 29.0 Homo sapiens plakophilin 4 (PKP4), transcript variant 8, mRNA 13 nt/29.0° C. Sequence ID: NM_001377220.1Length: 5842Number of Matches: 1 Range 1: 1292 to 1304GenBankGraphicsNext Match Previous Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 26.3 bits(13) 61 13/13(100%) 0/13(0%) Plus/Plus Query 9 GTTTAGAGAACAG 21 (SEQ ID NO: 29) Sbjct 1292 GTTTAGAGAACAG 1304 (SEQ ID NO: 30) Homo sapiens golgin, RAB6 interacting (GORAB), transcript variant 1, mRNA Sequence ID: NM_152281.3Length: 2540Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 26.3 bits(13) 61 13/13(100%) 0/13(0%) Plus/Plus Query 5 GTCGTTAGAGA 11 (SEQ ID NO: 31) Sbjct 971 GTTCGTTTAGAGA 983 (SEQ ID NO: 32) Homo sapiens zinc finger protein 57 (ZNF57), transcript variant 1, mRNA Sequence ID: NM_173480.3Length: 1970Number of Matches: 2 Alignment statistics for match #1 Score Expect Identities Gaps Strand 26.3 bits(13) 61 13/13(100%) 0/13(0%) Plus/Plus Query 8 CGTTTAGAGAACA 20 (SEQ ID NO: 33) Sbjct 1251 CGTTTAGAGAACA 1263 (SEQ ID NO: 34) Range 2: 1419 to 1431GenBankGraphicsNext Match Previous Match First Match Alignment statistics for match #2 Score Expect Identities Gaps Strand 26.3 bits(13) 61 13/13(100%) 0/13(0%) Plus/Plus Query 8 CGTTTAGAGAACA 20 (SEQ ID NO: 35) Sbjct 1419 CGTTTAGAGAACA 1431 (SEQ ID NO: 36) FS AGCCCTGTATACGAC (SEQ ID NO: 37) match = 13 nt/T.sub.m of (13,458- 33.0 13,472) Homo sapiens BAI1 associated protein 3 (BAIAP3), transcript 13 nt/33.0° C. variant 6, mRNA Sequence ID: NM_001286464.2Length: 4582Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 26.3 bits(13) 24 13/13(100%) 0/13(0%) Plus/Plus Query 3 CCCTGTATACGAC 15 (SEQ ID NO: 38) Sbjct 3289 CCCTGTATACGAC 3301 (SEQ ID NO: 39) Homo sapiens osteoclast stimulating factor 1 (OSTF1), mRNA 13 nt/33.0° C. Sequence ID: NM_012383.5Length: 1348Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 26.3 bits(13) 24 13/13(100%) 0/13(0%) Plus/Plus Query 1 AGCCCTGTATACG 13 (SEQ ID NO:4 0) Sbjct 233 AGCCCTGTATACG 245 (SEQ ID NO: 41) Homo sapiens ubiquitin specific peptidase 18 (USP18), mRNA 13nt/33.0° C. Sequence ID: NM_017414.4Length: 1858Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 26.3 bits(13) 24 13/13(100%) 0/13(0%) Plus/Plus Query 2 GCCCTGTATACGA 14 (SEQ ID NO: 42) Sbjct 655 GCCCTGTATACGA 667 (SEQ ID NO: 43) TRS2-2 CGTTTAGAGAACAGATCTAC (SEQ ID NO: 44) Highest (53-72) match = 15 nt/T.sub.m of 35.5 PREDICTED: Homo sapiens uncharacterized LOC105378374 15 nt/35.5.sup.O C. (LOC105378374), ncRNA Sequence ID: XR_002957084.1 Length:12122Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 30.2 bits(15) 3.1 15/15(100%) 0/15(0%) Plus/Minus Query 2 GTTTAGAGAACAGAT 16 (SEQ ID NO: 45) Sbjct 4057 GTTTAGAGAACAGAT 4043 (SEQ ID NO: 46) Homo sapiens DGUOK antisense RNA 1 (DGUOK-AS1), 14 nt/31.0° C. transcript variant 1, long non-coding RNA Sequence ID: NR_104029.1 Length: 582Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 28.2 bits(14) 12 14/14(100%) 0/14(0%) Plus/Plus Query 6 AGAGAACAGATCTA 19 (SEQ ID NO: 47) Sbjct 477 AGAGAACAGATCTA 490 (SEQ ID NO: 48) Homo sapiens plakophilin 4 (PKP4), transcript variant 8, mRNA 13 nt/29.0° C. Sequence ID: NM_001377220.1Length: 5842Number of Matches: 1 Range 1: 1292 to 1304GenB ankGraphicsNext Match Previous Match Alignment statistics for match #1 Score Expect Identities  Gaps Strand 26.3 bits(13) 49 13/13(100%)  0/13(0%) Plus/Plus Query 2 GTTTAGAGAACAG 14 (SEQ ID NO: 49) Sbjct 1292 GTTTAGAGAACAG 1304 (SEQ ID NO: 50) FS-2a CATTGTAGATGTCAAAAGCC (SEQ ID NO: 51) Max 15 nt/38.9.sup.O C. (13539- PREDICTED: Homo sapiens uncharacterized LOC101927182 15 nt/38.9.sup.O C. 13558) (LOC101927182), transcript variant X7, ncRNA Sequence ID: XR_001754612.1 Length:1663Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 30.2 bits(15) 3.1 15/15(100%) 0/15(0%) Plus/Plus Query 4 TGTAGATGTCAAAAG 18 (SEQ ID NO: 52) Sbjct 931 TGTAGATTGTCAAAAG 945 (SEQ ID NO: 53) Homo sapiens ryanodine receptor 3 (RYR3), transcript variant 1, mRNA Sequence ID: NM_001036.6Length: 15568Number of Matches: 1 Range 1: 10080 to 10093GenB ankGraphics Next Match Previous Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 28.2 bits(14) 12 14/14(100%) 0/14(0%) Plus/Plus Query 7 AGATGCCAAAAGCC 20 (SEQ ID NO: 54) Sbjct 10080 AGATCTCAAAAGCC 10093 (SEQ ID NO: 55) Homo sapiens zinc finger protein 600 (ZNF600), transcript variant 2, mRNA Sequence ID: NM_001321866.2Length: 4618Number of Matches: 1 Alignment statistics for match #1 Score Expect Identities Gaps Strand 28.2 bits(14) 12 14/14(100%) 0/14(0%) Plus/Plus Query 1 CATTGTAGATGTCA 14 (SEQ ID NO: 56) Sbjct 1668 CATTGTAGATGTCA 1681 (SEQ ID NO: 58) RSV1 CTCCCTCATGGTGGCAGTTGA (SEQ ID NO: 58)
Presence of CG Motifs in Target mRNA/ASO

[0302] Because unmethylated CG motifs are common in bacterial, but not eukaryotic, DNA, their presence in an anti-sense oligo may trigger an immune response in in vivo experiments if the organism's immune system interprets it as a bacterial infection. CG-mediated immune response is particularly strong when the CG sequence is embedded as part of a purine-purine-C-G-pyrimidine-pyrimidine sequence. One way to avoid this problem is to be careful to choose oligos that either lack CG, or at least lack the above flanking sequences around a CG. If elimination of CG is not possible, then a good alternative is to replace the C in CG with 5-methyl-C, which does not stimulate the immune system or deleteriously affect hybridization.

[0303] Oligonucleotides containing CG can act as immunostimulators by causing proliferation of B lymphocytes; by activating macrophages, dendritic cells, and T cells; and by inducing cytokine release. These CG-mediated immune effects depend on the sequences flanking the CG dimer, and are strongest with the purine.purine.CG.pyrimidine.pyrimidine motif. These CG effects occur with phosphorothioates as well as with phosphodiesters, and may be responsible for some of the activities of oligonucleotides reported in vivo.

Formation of Tetraplexes within ASO

[0304] ASOs should not contain 4 or more consecutive elements/nucleotides (CCCC or GGGG). Furthermore, ASOs should not contain 2 or more series of 3 consecutive elements/nucleotides (CCC or GGG).

[0305] ASOs containing either single GGGG runs or repeated GG or GGG runs in close proximity can form intra-strand tetraplexes (single structures of four strands). G tetraplexes often have high affinity for proteins, which can result in potent, non-antisense biological effects that may interfere with an anti-sense experiment, particularly when such effects mimic anti-sense activity. Whenever possible, such G motifs should be avoided. When elimination of such motifs is unavoidable, then a good alternative is to replace one or more of the Gs with 7-deaza-G or 6-thio-G, which block G-tetraplex formation.

[0306] Formation of tetraplexes with potent biological activity has caused some problems in the antisense field. Investigators should carefully examine all oligonucleotides very rich in a particular nucleoside, particularly if they show repeated sequences or have multiple occurrences of two or more adjacent identical bases. Oligomers with multiple repeats of two or more consecutive Gs or Cs may form tetraplexes and other non-Watson-Crick structures. Not all oligomers with such features will necessarily form these higher order structures, particularly in physiological conditions. Nonetheless, such sequences raise warning flags and there is a well-documented danger in ascribing biological effects to an antisense mechanism without careful investigation.

[0307] The most extensively studied tetraplexes are formed by oligonucleotides containing multiple adjacent guanine residues. These may occur in a single run of around four residues but they can also be found in repeated GG or GGG motifs that occur in close proximity. Even if they do not form tetraplexes, G-rich sequences with multiple GG dimers may form other unusual structures depending on sequence context. Tetraplex-forming runs of Gs seem to have an affinity for various proteins and when included in synthetic oligonucleotides, they produce a multitude of biological effects. For example, researchers have identified tetraplexes that bind to thrombin and to the HIV envelope protein. Other tetraplexes have been shown to bind to transcription factors or to produce antiproliferative effects by protein binding. The ability to form tetraplexes can be blocked by replacing guanosine residues with 7-deazaG or 6-thioG . It should also be noted that a phosphorothioate oligonucleotide containing only C residues was shown to have activity similar to one containing a G-tetraplex.

Anti-Sense Activity-Increasing/Decreasing Motifs

[0308] Several studies have conclusively shown that the activity of an ASO against its mRNA target is sequence-motif content-dependent. A major study of over 1000 phosphorothiolated ASOs showed that the presence of motifs CCAC, TCCC, ACTC, GCCA, and CTCT positively correlated with anti-sense activity, while GGGG, ACTG, TAA, CCGG, and AAA negatively correlated with anti-sense activity.

[0309] Investigators have suggested that stretches of purines in the target might stabilize the heteroduplex formed. From examining the sequences of active antisense oligonucleotides in many published studies, investigators have proposed that selecting a target containing the sequence GGGA gives a much better chance of success.

Conformational and Thermodynamic Considerations

[0310] The major problem lies with the secondary and tertiary folding that can make much of the RNA inaccessible to a molecule as large as an oligonucleotide. Even those sequences that appear to be accessible may already be involved in intramolecular hydrogen bonding, stacking interactions, or in solvation that would be disrupted by hybridization of an oligonucleotide. Consequently, hybridization-induced rearrangement of the existing RNA structure may carry a prohibitive thermodynamic penalty. On the other hand, single-stranded sequences within the RNA may be preordered by stacking into helical conformations that are particularly favorable for hybridization. The exceptional stability of hybrids formed between the loops of two hairpins (kissing interactions) is well known and is important in the association of natural antisense RNAs with their targets. Even though the rules for base-pairing are very simple, additional subtleties govern the hybridization of oligonucleotides to RNA that are not well understood. The behavior of oligonucleotides is very dependent on the terminal nucleotides. Moreover, small changes in the length or a shift in binding site of one or two nucleotides can profoundly affect the kinetics of hybrid formation. Even a few base changes that do not change the thermodynamic stability of the duplex may greatly change the kinetics of hybridization. These effects may partially account for the efficacy of different antisense oligonucleotides in vivo.

Phosphorothioates

[0311] The easy-to-synthesize phosphorothioate oligonucleotides assume the native Watson-Crick nucleotide hydrogen-bonding patterns, can activate RNase H-mediated degradation of cellular mRNA, and are nuclease-resistant. The antisense effects of the phosphorothioates can be observed for over 48 hours after a single application to tissue culture cells. This degree of stability is needed for in vivo work. However, the actual stability of a phosphoro-thioate oligonucleotide in a specific experiment can vary with each sequence and cell line examined. Although early work using these compounds was very encouraging, it has become clear that some of the most exciting results were actually due to sequence independent biological effects of phosphorothioate DNA (sulfated polyanion) and immunostimulation properties of CpG islands and did not result from true antisense mechanisms. Careful planning to avoid these pitfalls should make for strong platform for antisense with phosphorothioate backbone.

[0312] Phosphorothioates show increased binding to cellular proteins and components of the extracellular matrix as compared to natural phosphodiester oligonucleotides. This binding appears to be due to the polyanionic nature of these compounds; they behave similar to dextran sulfate and heparin sulfate. This binding can displace or mimic the binding of natural ligands to assorted proteins, such as receptors or adhesion molecules. In fact, any of the heparin-binding class of proteins may also bind phosphorothioates. Phosphodiester DNA is a polyanion and may nonspecifically bind proteins, but due to nuclease action has such a shortened lifespan that the impact of this effect is most likely limited.

[0313] In one more embodiment the present invention relates to an anti-sense oligonucleotide for use in treatment of viral diseases wherein the anti-sense oligonucleotide is selected from OT-101 or OT-101 in combination with any of SEQ ID NOS:5-12.

[0314] In one aspect the embodiment the present invention relates to the anti-sense oligonucleotide for use in the treatment of the viral disease induced by, but not limited to SARS, MERS, RSV, coronavirus, HIV, Ebola., Cytomegalovirus (CMV). Human herpes virus type 6 (HHV-6), Herpes simplex virus (HSV-1 and HSV2), Epstein-Barr virus (EBV), Hepatitis B virus (HBV).

[0315] In one more aspect of the embodiment the viral disease is COVID-19.

[0316] In one more embodiment of the present invention relates to a method of treating a fibrosis or any collagen related diseases, cancers, viral diseases, bacterial diseases and parasitic diseases, wherein the method comprises administering to the subject a therapeutically effective amount of anti-sense oligonucleotide sequence selected from OT-101, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or a combination thereof.

[0317] In one aspect of the embodiment the method is for treating viral disease induced by, but not limited to SARS, MERS, RSV, corona, Ebola, Cytomegalovirus (CMV). Human herpes virus type 6 (HHV-6), Herpes simplex virus (HSV-1 and HSV2), Epstein-Barr virus (EBV), Hepatitis B virus (HBV).

[0318] In one more aspect of the embodiment the method is for treating bacterial, viral, or other forms cytokine induced pneumonia.

[0319] In yet another aspect of the embodiment the viral disease is COVID-19.

[0320] In yet another aspect of the embodiment the administration includes intravenous, intrathecal, intramuscular, oral, and any other acceptable route of administration.

[0321] In yet another aspect of the embodiment OT-101 anti-sense oligonucleotide inhibits TGF-beta. In yet another aspect of the embodiment TGF-beta is TGF-beta1, or TGF-beta2 or TGF-beta3.

[0322] In yet another aspect of the embodiment the antisense oligonucleotide being any combinations of antisense against TGF-beta, viral 5′Terminal, viral Transcription Regulatory Site, and the viral Frame Shift site.

[0323] Another important embodiment of the present invention relates to a method of treating TGF-beta storm.

[0324] In yet another aspect of the embodiment the present invention relates to a method of treating TGF-beta storm, the method involving treatment of TGF-beta storm with TGF-beta inhibitor, antiviral agents, IL-6 inhibitors, or any combination thereof.

[0325] In yet another aspect of the embodiment the present invention relates to TGF-beta inhibitor including mAb, small molecules target the active domain of TGF-beta.

[0326] In yet another aspect of the embodiment the present invention relates to TGF-beta inhibitor including mAb, small molecules, antisense, RNA therapeutics targets the activation of TGF-beta or activating protein.

[0327] In yet another aspect of the embodiment the present invention relates to TGF-beta inhibitor including mAb, small molecules, antisense, RNA therapeutics targets the virus replication or the virus binding and uptake or virus protein synthesis or virus replication.

[0328] In yet another aspect of the embodiment the present invention relates to the method of use of anti-sense oligonucleotides wherein the method comprises inhibition of viral binding to target cells.

[0329] In yet another aspect of the embodiment the present invention relates to the method of treatment of symptoms associated with viral infection.

[0330] In yet another aspect of the embodiment the present invention relates to the method including treatment of symptoms associated with respiratory viral infection.

[0331] In yet another aspect of the embodiment the present invention relates to the method including treatment of symptoms associated with coronavirus viral infection.

[0332] In yet another aspect of the embodiment A method of use of anti-sense oligonucleotide wherein the method comprises suppression of TGF-beta induced proteins including IL-6, TGFBIp.

[0333] In yet another aspect of the embodiment the method comprises suppression of symptoms due to TGF-beta inducible proteins such as IL-6, TGFBIp.

[0334] In yet another aspect of the embodiment the present invention relates anti-sense oligonucleotide is OT-101.

[0335] In yet another embodiment the present invention relates to a method of use of OT-101 to treat cytokine storm.

[0336] In yet another embodiment the present invention relates to a method of use of OT-101 to treat multiorgan inflammatory syndrome.

[0337] In yet another embodiment the present invention relates to a method of use of OT-101 to treat Kawasaki syndrome.

[0338] In yet another embodiment the present invention relates to a method of use of OT-101 to treat IgA vasculitis.

[0339] Throughout the description and claims of this specification, the phrases “comprise” and “contain” and variations of them mean “including but not limited to”, and are not intended to exclude other moieties, additives, components, integers or steps. Thus, the singular encompasses the plural unless the context otherwise requires. Wherever there is an indefinite article used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

[0340] Embodiments are further defined in the following examples. The following examples are for the purpose of illustration of the invention and not intended in any way to limit the scope of the invention.

EXAMPLES

Example 1. Artemisinin Antiviral Activity Against SARS-CoV2

[0341] Cao et al has demonstrated that TGF-β protein levels and mRNA levels in 4T1 breast cancer cells decrease after ART treatment. Sub-confluent 4T1 cells were harvested, washed once in serum-free media, and resuspended in PBS at a concentration of 5×105 cells/0.1 mL PBS. 0.1 mL of the cell suspension was then implanted into the abdominal mammary fat pad of female BALB/c mice subcutaneously. Once the tumor was palpable (5-7 days after implantation), the mice were randomized into either the control group (n=7; intraperitoneal injection with 200 μl sterile PBS daily for 20 days) or the ART group (n=10; intraperitoneal injection with 100 mg/kg ART dissolved in 0.2% DMSO daily for 20 days). TGF-β mRNA levels within the tumor significantly decreased after ART treatment (P<0.01).

[0342] Artemisinin could reduce early renal oxidative stress damage in diabetic nephropathy (DN) rats by inhibiting TGF-β1 protein expression in kidney tissues as well as activating the Nrf2 signaling pathway and enhancing the expression of antioxidant proteins, thereby exerting the protective effects on DN kidney. The western blot analysis showed that the expression of TGF-β1 in the kidney tissues of DN model rats (p<0.05) was significantly increased when compared with the normal control group. Artemisinin (25, 50, 75 mg/kg) restored near normal expression of TGF-β1 suppressing the expression of TGF-β1. Similarly, in lupus nephritis mice there was an increase in TGF-β expression. This overexpression was also ameloriated with Artemisinin treatment. Both RNA and protein levels were significantly reduced in comparison to the untreated control mice.

[0343] Suppression of TGF-β expression by OT-101 (an antisense against TGF-β) suppressed SARS-CoV and SARS-CoV-2 replication in the viral replication assays on Vero 76 cells was demonstrated in collaboration with Dr. Brett Hurst at Utah State University, part of the NIAID Antiviral Testing Consortium.

[0344] In this assay, compounds were serially diluted using eight half-log dilutions in test medium (MEM supplemented with 2% FBS and 50 μg/mL gentamicin) so that the starting (high) test concentration was 1000 μg/mL. Each dilution was added to 5 wells of a 96-well plate with 80-100% confluent Vero 76 cells.

[0345] Three wells of each dilution were infected with virus, and two wells remained uninfected as toxicity controls. Six wells were infected and untreated as virus controls, and six wells were uninfected and untreated as cell controls. SARS-CoV-2 virus suspensions were prepared to achieve the lowest possible multiplicity of infection (MOI) that would yield >80% cytopathic effect (CPE) within 5 days. M128533 was tested in parallel as a positive control.

[0346] On day 5 post-infection, once untreated virus control wells reached maximum CPE, plates were stained with neutral red dye for approximately 2 hours (15 minutes). Supernatant dye was removed and wells rinsed with PBS, and the incorporated dye was extracted in 50:50 Sorensen citrate buffer/ethanol for >30 minutes and the optical density was read on a spectrophotometer at 540 nm. Optical densities were converted to percent of cell controls and normalized to the virus control, then the concentration of test compound required to inhibit CPE by 50% (EC.sub.50) was calculated by regression analysis. The concentration of compound that would cause 50% cell death in the absence of virus was similarly calculated (CC.sub.50). The selective index (SI) is the CC.sub.50 divided by EC.sub.50.

[0347] Artemisinin, being a reported TGF-β inhibitor, also suppressed SARS-CoV-2 replication. OT-101 activity was superior to antisense specifically designed against SAR-CoV-2 genome along selected 5′-TERM, FS, and LTR. Nonspecific antisense (RSV) did not demonstrate any suppression. The data are shown in the table 1 below.

TABLE-US-00004 TABLE 1 Compound Virus EC.sub.50 CC.sub.50 SI OT-101 SARS-CoV 7.6 (1.24 uM) >1000 >130 (Urbani strain) OT-101 SARS-CoV 26 (4.23 uM) >1000 >38 (Urbani strain) OT-101 SARS-COV-2 2.0 (0.33 uM) >1000 >500 USA_WA1/2020 RSV SARS-COV-2 620.0 >1000 >1.6 USA_WA1/2020 Artemisinin SARS-COV-2 0.45 (1.59 uM) 61.0 140 USA_WA1/2020 M128533 SARS-COV-2 0.012 >10 >830 USA_WA1/2020 Remdesivir SARS-COV-2 (0.77 uM) (>100 uM) >129.87

[0348] OT-101: TGF-β antisense; RSV: Negative control antisense; M128533: positive control; EC.sub.50: 50% effective antiviral concentration (in μg/ml); CC.sub.50: 50% cytotoxic concentration of compound without virus added (in μg/ml); SI=CC.sub.50/EC.sub.50; Source of SARS-CoV: Centers for Disease Control Stock 809940 (200300592). Source of SARS-CoV-2: World Reference Center for Emerging Viruses and Arboviruses (WRCEVA) at UTMB.

[0349] The anti-SARS-CoV-2 activity of Artemisinin was confirmed subsequently by two other laboratories: [0350] 1) By RTPCR method. For the antiviral assay, 4.8×106 Vero E6 cells were seeded onto 48-well cell-culture Petri dishes and grown overnight. After pretreatment with a gradient of diluted experimental compounds for 1 h at 37° C., cells were infected with virus at an MOI of 0.01 for 1 h. After incubation, the inoculum was removed, cells were washed with PBS, and culture vessels were replenished with fresh drug containing medium. At 24 h post-infection, total RNA was extracted from the supernatant and qRT-PCR was performed to quantify the virus yield. [0351] 2) by immunostaining for spike protein. VeroE6 cells seeded the previous day in 96-well plates were infected with SARS-CoV-2 and treated with the specified concentrations of test articles. After a 2-day incubation, infected cells were visualized by immunostaining for SARS-CoV-2 spike glycoprotein and counted automatically.

[0352] Furthermore, docking studies were performed to show that it is active against the initial binding and uptake of the virus. Artemisinin produced better Vina docking score than hydroxychloroquine (−7.1 kcal mol-1 for the best scoring artemisinin derivative vs. −5.5 kcal mol-1 for hydroxychloroquine). Artesunate, artemisinin and artenimol, showed two mode of interactions with Lys353 and Lys31 binding hotspots of the Spike protein.

[0353] Independently, when the ZINC natural library with a total of ˜203,458 Natural ligands was tested through blind docking against the S protein: human ACE2 complex, artemisinin was one of the top 4 candidates (Andrographolide, Artemisinin, Pterostilbene, and Resveratrol).

[0354] Artemisinin showed binding between the interface of S protein: human ACE2 complex. It is characterized: 1) 1 H-bond with Tyr-505 residue of the ACE2 receptor, 2) His-34 and Ala-387 formed alkyl and pi-alkyl contacts with the receptor and 3) Pro-389 forms a carbon H-bond.

Example 2. Artemisinin-ARTI-19 Trial

[0355] Given our observation that artemisinin is potent antiviral against SARS-CoV-2 (COVID-19) better than remdesivir and chloroquine, and that artemisinin is commonly used herbal remedy worldwide, we set out to evaluate artemisinin in COVID-19 patients, to determine whether it is an effective treatment option for these patients. The ARTI-19 trial was cleared by Indian regulatory authorities, and is registered under the Clinical Trials Registry India (CTRI) with three active sites and additional sites to be added as the trial progresses and expands. ARTI-19 trial registration information can be found at: CTRI/2020/09/028044. Phase IV study to evaluate the safety and efficacy of Artemisinin on COVID-19 subjects as Interventional. http://ctri.nic.in/Clinicaltrials/advsearch.php.Site specific information is: 1) Government Medical College & Government General Hospital, Srikakulam, ANDHRA PRADESH. 2) Rajarshi Chhatrapati Shahu Maharaj Government Medical College and Chhatrapati Pramila Raje Hospital, MAHARASHTRA. And 3) Seven Star Hospital, MAHARASHTRA.

[0356] Aim of the study: A clinical study to observe the effect of Artemisinin in COVID-19 patients. These patients will have confirmed SARS-CoV-2 infection by RT-PCR and mild and moderate (hospitalized, without oxygen therapy) symptoms of COVID-19. These are patients with scores of 2-4 on the WHO Clinical Progression Scale.

[0357] Objective of the study: To evaluate the clinical effect of Artemisinin in COVID-19 patients (see above description of patients).

[0358] Primary endpoints of the study: Primary endpoints: Days to recovery in the signs and symptoms in COVID-19 patients by adding Artemisinin to SOC (see above description of patients) based on the WHO Clinical Progression Scale and (2) Assessment Criteria of Symptoms.

[0359] Description of the population to be studied: This pilot study will be carried out in 120 adult COVID-19 patients in Bangalore. These patients will have confirmed SARS-CoV-2 infection by RT-PCR and mild and moderate (hospitalized, without oxygen therapy) symptoms of COVID-19 and scores of 2-4 on the WHO Clinical Progression Scale. These patients are diagnosed at the hospital and fulfilling the criteria of diagnosis and inclusion criteria, willing to give their consent to participate in the clinical trial will be registered. These registered patients will be then randomly divided by computer generated randomization sequence in Group 1 or Group 2. Each registered patient will be provided the details of clinical trial by patient information sheet and after taking their consent, detailed history will be taken as per clinical research Perform a and generated data will be used for research. If the pilot study shows that Artemisinin improves on symptoms of COVID-19 patients when administered with SOC, an Expanded Clinical study will be carried out in 1,080 adult COVID-19 patients with the same study design as the Pilot Study. [0360] Group 1—Treatment group: Artemisinin+SOC (Physician's choice). [0361] Group 2—Control group: SOC (physician's choice).

[0362] Diagnostic criteria: These patients will have confirmed SARS-CoV-2 infection by RT-PCR and mild and moderate (hospitalized, without oxygen therapy) symptoms of COVID-19. These are patients with scores of 2-4 on the WHO Clinical Progression Scale.

Inclusion Criteria:

[0363] 1. Confirmed case of COVID-19 infection by laboratory tests for COVID-19. [0364] 2. Age limit: 21 to 60 years of age male, or non-pregnant or non-lactating female. [0365] 3. Patients with oxygen saturation higher than 95% and without any requirement of oxygen therapy or assisted ventilation. [0366] 4. Patients willing to give their informed consent to participate in the clinical trial.

Exclusion Criteria:

[0367] 1. COVID-19 positive patients above 60 years of age or below 21 years. [0368] 2. Patients on Immuno-suppression therapy. [0369] 3. Patients with associated renal or hepatic impairment. [0370] 4. Pregnant Women or lactating mothers. [0371] 5. Patients in advanced stage of disease requiring emergency medical intervention like pneumonia, bronchial asthma, organ failure. [0372] 6. Patients whom ventilator support is required. [0373] 7. Patients not willing to give their informed consent to participate in the clinical trial. [0374] 8. Patients with the following co-morbidities: insulin-dependent diabetes, hypertension with cardiac symptoms, morbid obesity with diabetes and/or hypertension. Uncontrolled diabetes. Uncontrolled hypertension. [0375] Posology: In this, along with ongoing allopathic medicines will be given to patients who are confirmed for SARS-CoV-2 infection by RT-PCR and have mild or moderate (hospitalized, without oxygen therapy) symptoms of COVID-19. These are patients with scores of 2-4 on the WHO Clinical Progression Scale. [0376] Results: The India arm of ARTI-19 global study is on track to complete enrollment of the first 120 cohort by Jan. 15th, 2021, of which 78 patients have already been randomized. Interim analysis of the first 78 pts (8 WHO scale 2 and 70 WHO scale 4 on randomization) was performed. WHO 10 point scale was used in this study. [0377] 1) Of significant is 75% of WHO scale 4 patients exhibited a drop to WHO scale 3 by Day 2 of treatment with ARTIVeda™. WHO scale 3 does not require hospitalization. [0378] 2) 40% of WHO scale 4 patients exhibited a drop to WHO scale 1 on day 5 of treatment with ARTIVeda™. Note: WHO scale 1 is asymptomatic. [0379] 3) SOC=Standard of care including remdesivir/dex/heparin.
Site specific analyses: [0380] The SOC varied from site to site. Despite these patients being heavily treated with a range of antiviral agents as well as agents meant for COVID-19 symptoms such as Paracetamol for fever, these patients all improved faster when treated with ARTIVeda™+SOC.

Recovery Analysis:

[0381] The median time to asymptomatic WHO scale of 1 was 5 days for ARTIVeda™ plus SOC as compared to 14 days for SOC alone. The differences were statistically significant meaning unlikely to happen by chance. The trend was more pronounced with higher initial disease status. Log rank statistics: WHO-scale 2,3,4: p=0.0369/RR=1.476 (0.8957-2.433), WHO-scale 3,4: p=0.026/RR=1.581 (0.9094-2.747), WHO-scale 4: p=0.0043/RR=2.038 (0.9961-4.168). RR=rate ratio for recovery.

[0382] Pharmaceutical Vegetable Capsule Compositions Comprising Artemisinin

Example 3: Excipient Compatibility Study

[0383] The chemical compatibility of artemisinin with selected excipients is investigated. Excipients evaluated are: (1)Diluent (microcrystalline cellulose PH112, USP); (2) Stabilizer (Polysorbate 80 Dry Powder, IH); (3) Disintegrants (crospovidone USP, and croscarmellose sodium USP); (4) Antisticking agent (magnesium stearate, USP). Artemisinin is mixed in a 1:1 weight ratio with each excipient and the mixture is evaluated immediately after mixing, as well as after one month of accelerated aging at 40° C. and 75% relative humidity. Comparisons are made to artemisinin under the same conditions without excipient. It is found that there are no chemical incompatibilities with the selected excipients. All samples measurements of compatibility stability samples indicate artemisinin potency of 98.1% to 99.2% compared to control. There is no appreciable changes in the impurity profiles

TABLE-US-00005 TABLE 2 Excipients and artemisinin compatibility data Artemisinin Impurity Impurity Impurity Excipient/Grade (%) RC1 (%) RC2 (%) RC3 (%) No Excipient 99.20 0.11 0.12 ND* (Control) Microcrystalline 99.00 0.10 0.13 ND Cellulose Polysorbate 80 98.50 0.10 0.14 ND dry powder Crospovidone 98.10 0.08 0.10 ND Croscarmellose 98.30 0.09 0.15 ND sodium Magnesium 98.20 0.09 0.11 ND Stearate *Not detectable; Impurity Artemisitene (RC1); Impurity 9-epiartemisinin (RC2); Impurity Thujone (RC3)

Example 4: Small Scale Testing of Capsule Formulations

[0384] Initial trials of capsule formulation development are performed for capsules comprising about 500 mg of artemisinin. Each formulation comprises a single diluent, a stabilizer, two disintegrants and an anticaking agent as described in Example 1. Formulations are prepared in 400 capsule sizes. The initial dry-blend process includes screening both the API (artemisinin) and each excipient through a 40-mesh screen, followed by manual bag blending. The API and all excipients, other than anticaking agent, are blended first, passed through 60-mesh screen followed by addition of anticaking agent and further blending. The resulting mixture is further screened through 40-mesh and then encapsulated in Size 0 vegetable capsule using a bench top filling machine using dosing discs and tamping pins to obtain consistent fill weights. Table 3 below shows the compositions tested in weight percentage.

TABLE-US-00006 TABLE 3 Trial Batch Composition Details S.No. Ingredients Specification WND20244A WND20254A WND20255A WND20263A 1 Artemisia IH 99.2% 97.4% 94.6% 94.6% Annua Extract 2 Microcrystalline USP 0.3% 0.3% 0.5% 0.5% Cellulose PH112 3 Polysorbate 80 USP 0.0% 1.9% 0.0% 0.0% 4 Polysorbate 80 IH 0.0% 0.0% 2.5% 2.5% Dry Powder 5 Cross povidone USP 0.0% 0.0% 1.0% 1.0% 6 Cross USP 0.0% 0.0% 1.0% 1.0% Carmellose 7 Magnesium USP 0.5% 0.5% 0.5% 0.5% stearate

[0385] Each of the compositions is tested for release of the artemisinin using a USP Type II apparatus, at 75 rpm in 900 mL of sodium phosphate buffer at pH 6.8 having 2% sodium lauryl sulfate. The percent of the artemisinin released from each composition is analyzed using HPLLC.

[0386] The First Trial (WND20244A) of the Artemisia annua Capsules was done as per formula given in Table-3. The capsule dissolution in sodium phosphate buffer of pH 6.8 with 2% (w/v) sodium lauryl sulfate at 75 rpm at 37° C. was observed very less i.e around 20%.

[0387] In this trial of WND20254A, with objective of improving the dissolution rate in sodium phosphate buffer of pH 6.8 with 2% (w/v) sodium lauryl sulfate at 75 rpm at 37° C., the surfactant liquid Polysorbate 80 was added which results in improving the dissolution rate up to 35% which is still far from the acceptable range. Also the texture of formulation was also found undesirable. The problem of dissolution was still not resolved in this trial so to achieve our target next trial batch was planned.

[0388] In the WND20255A trial dissolution rate problem was tried to be solved by replacing the liquid Polysorbate 80 with Polysorbate 80 Dry Powder and incorporating the disintegrant and superdisintegrant Crospovidone and Croscarmellose into the formula improved the dissolution rate and observed more than 70% at 45 minutes sodium phosphate buffer of pH 6.8 with 2% (w/v) sodium lauryl sulfate at 75 rpm at 37° C. during analysis .The final average fill weight of capsule was finalized with 500 mg. The problem of dissolution was resolved. Also found under the acceptance range. All physical parameters were complying as per target limit. Thus, all parameters were found satisfactory and send for analysis. Physical and chemical parameters also complies as per the requirement of an immediate release capsules for an oral dose.

Example 5: Reproducibility Testing of Capsule Formulations

[0389] Artemisinin capsule dosage form was prepared by dry granulation process by using formula as given in Table 4.

TABLE-US-00007 TABLE 4 Trial Composition Details for Batches of Reproducibity Testing S. Functional No. Ingredients Category WND20263A WND20266A WND20266A 1 Artemisia Annua Active Ingredient 94.6% 94.6% 94.6% Extract, IH 2 Microcrystalline Diluent 0.5% 0.5% 0.5% Cellulose PH112, USP 3 Polysorbate 80, Stabilizer 0.0% 0.0% 0.0% USP 4 Polysorbate 80 Dry Stabilizer 2.5% 2.5% 2.5% Powder, IH 5 Cross povidone, Disintergrant 1.0% 1.0% 1.0% USP 6 Crosscarmellose Disintegrant 1.0% 1.0% 1.0% sodium, USP 7 Magnesium Anticaking agent 0.5% 0.5% 0.5% stearate, USP

[0390] Formulations are prepared in 1000 capsule sizes. The initial dry-blend process includes screening both the API (artemisinin) and each excipient through a 40-mesh screen, followed by Octagonal Blender (GR-17) blending. The API and all excipients, other than anticaking agent, are blended first, passed through 60-mesh screen followed by addition of anticaking agent and further blending. The resulting mixture is further screened through 40-mesh and then encapsulated in Size 0 vegetable capsule using a Semi Autometic Capsules Filling Machine (SA-9) to obtain consistent fill weights. Table 3 below shows the compositions tested in weight percentage.

[0391] To check reproducibility of the finalized formula and process, three reproducible batches of WND20263A, WND20266A & WND20268A were planned with same batch size, same formula and parameters, using similar equipment. Physical and chemical parameters were found satisfactory and reproducible in all aspects as shown in Table 4. These batches were also charged for stability.

[0392] Each batch is tested in a dissolution study of Type II, paddle using 900 sodium phosphate buffer of pH 6.8 with 2% (w/v) sodium lauryl sulfate at 75 rpm at 37° C. The results are shown below in Table 5. Results are similar across batches for artemisinin assay and dissolution values. The results for the batches are acceptable for an immediate release oral capsule, and this batch formula is therefore chosen for preparation of the large scale capsule preparation (GMP).

TABLE-US-00008 TABLE 5 Characteristics of capsules from Batches of the Reproducibility Testing with the Final Lab Batch Formula S. No. Parameters Limits WND20263A WND20266A WND20268A 3 Av. Fill weight of 555.0 mg ± 5.0% 549.87 mg 552.23 mg 554.68 mg capsule 4 Av. Weight [555 mg blend part + 652.13 mg 647.23 mg 649.68 mg of capsule 95.0 mg empty HPMC Cap)] = 650.0 mg ± 5.0% 5 Group weight of 13.00 g ± 3.0% 13.04 g 12.94 g 12.99 g 20 capsules 6 Dissolution Not less than Min: 85.62% Min: 86.43% Min: 85.08% 70.00% of labeled Max: 89.55% Max: 89.98% Max: 90.05% amount in 45 minutes Av: 87.58% Av: 88.20% Av: 87.56% 8 Assay Each 450.00 mg to 515.69 mg 518.84 mg 513.22 mg HPMC 550.00 mg capsule contains Artemesia 90.00% to 103.14% 103.77% 102.64% Annua(Artemisinin) 110.00% labelled amount

Example 6: Scale Up of Vegetable Capsule Formulation (GMP)

[0393] Further studies are performed to prepare 11 kg batches of artemisinin vegetable capsules for GMP evaluation (current Good Manufacturing Practices as set by Food and Drug Administration). Based on the small-scale study results, the formula in Table 6is selected for further development.

TABLE-US-00009 TABLE 6 Batch formula for the Exhibit Batch (GMP) of 20,000 Capsules Rational for % Component Grade Use (w/w) Artemisia annua Extract IH API 94.59 Microcrystalline Cellulose USP Diluent 0.45 PH112 Polysorbate 80 Dry Powder IH Stabilizer 2.45 Cros povidone USP Disintegrant 1.03 Croscarmellose sodium USP Disintegrant 1.03 Magnesium Stearate USP Antisticking 0.45 agent

[0394] The processing steps in involved in the manufacturing of capsule dosage form is given below:

[0395] Sifting: Sift Artemisia annua Extract, and Microcrystalline cellulose PH112 through 40# sieve in double poly bag and load in Octagonal Blender & mix for 10 min,

[0396] Sifting of Lubricants: Sift Crospovidone, Cross Carmellose Sodium & Polysorbate 80 dry powder through 40# Sieve and Magnesium stearate through 60#.

[0397] Lubrication: Add sifted materials of step No: 2 (except Magnesium Stearate) to blend of Step no: 1 in Octagonal Blender and mix for 5.0 minutes.

[0398] Add sifted Magnesium stearate to blend in Octagonal Blender and mixed further for 3.0 minutes.

[0399] The blend is ready for analysis and further for filling in “0” size Transparent/C. Transparent # HPMC capsule shell. The theoretical average weight of veg capsule should be 96 mg±5.0%

[0400] Capsule Filling: Fill the dry mix blend into the Hopper of Semi—Automatic capsule filling machine. Set the capsule filling machine. After setting the machine, the in-process parameters are set and capsule filling in process control. First set the average fill weight

[0401] Average fill weight should be kept at 650.0 mg and theoretical Average weight of capsule should be 650.0 mg±3.0% [555 mg blend part+(95.0 mg empty HPMC Cap)] & all capsule filling parameters should be monitored and recorded.

[0402] Before taking capsule for polishing, dedust & Inspect the capsule for any denting, broken, spotted appearance.

[0403] The GMP analytical studies are performed, and it is found that the batch meets all GMP requirements. No adverse sticking of the blend to the tamping pins is observed.

Artemisinin Dosing

Example 7. Selection of 500 mg Daily for Five Days Oral Dose

[0404] 12 healthy male Vietnamese subjects after a single, 500-mg, oral dose. The relatively small interindividual variation in pharmacokinetics does not seem to be of clinical significance. Tolerance to the single dose of artemisinin was good: no adverse effects were detected. Based on these results, a treatment schedule of 2×500 mg of artemisinin (oral dose) per day can be advised. This will result in adequate antimalarial plasma concentrations, despite poor bioavailability, and rapid elimination.

[0405] Eight healthy male, Vietnamese subjects were administered 1×250, 2×250 and 4×250 mg artemisinin capsules in a cross-over design with randomized sequence with a 7-day washout period between administrations. The pharmacokinetic results suggested artemisinin to be subject to high pre-systemic extraction. Artemisinin oral plasma clearance was about 400 L h-1 exhibiting a slight decrease with dose, although the effect was weak. There was a high correlation between artemisinin plasma concentrations determined at various time-points after drug administration and the AUCs after the 500 and 1000 mg doses, but less so after the 250 mg dose. Artemisinin was well tolerated with no apparent dose or time dependent effects on blood pressure, heart rate or body temperature.

[0406] A single-center, randomized, 4-sequence, open-label, crossover study conducted in 15 healthy male Vietnamese volunteers under fasting conditions with a washout period of 3 weeks between study visits was performed. A single oral dose of 160 or 500 mg of artemisinin was administered alone or in combination with piperaquine. Potential adverse events were monitored daily by the clinician and by using laboratory test results. Frequent blood samples were drawn for 12 hours after dose. Artemisinin was quantified in plasma using LC-MS/MS. Pharmacokinetic parameters were computed from the plasma concentration-time profiles using a noncompartmental analysis method.

[0407] This single-dose study found that the dose-normalized C.sub.max, AUC.sub.0-last, and AUC.sub.0-∞. mean geometric differences between the test and reference formulations were relatively small (<40%) and will probably not have a clinical impact in the treatment of malaria infections.

[0408] The pharmacokinetics of artemisinin was studied in 11 Vietnamese patients with uncomplicated falciparum malaria after a single 500 mg oral dose. Parasites disappeared rapidly, with a mean parasite clearance time of 36 hr. No relationship was found between pharmacokinetics and the parasite elimination rate. Tolerance to the single dose of artemisinin was good. No adverse effects were detected. In conclusion, pharmacokinetics of a single dose of artemisinin for uncomplicated falciparum malaria is not different from findings in healthy subjects. A single dose of 500 mg of artemisinin is effective in reducing parasitemia in nonsevere falciparum malaria and is well-tolerated.

[0409] The immediate efficacies of two oral dosage regimens of artemisinin were investigated in 77 male and female adult Vietnamese falciparum malaria patients randomly assigned to treatment with either 500 mg of artemisinin daily for 5 days (group A; n=40) or artemisinin at a dose of 100 mg per day for 2 days, with the dose increased to 250 mg per day for 2 consecutive days and with a final dose of 500 mg on the fifth day (group B; n=37). Parasitemia was monitored every 4 h. The average parasite clearance time was longer in group B than in group A (means±standard deviations, 50±23 and 34±14 h, respectively; P<0.01). Artemisinin's pharmacokinetic parameters were similar on day 5 in both groups, although a significant increase in oral clearance from day 1 to day 5 was evident. Thus, artemisinin exhibited both dose- and time-dependent pharmacokinetics. The escalating dose studied did not result in higher artemisinin concentrations toward the end of the treatment period.

Example 8. Establishment of 5 Day on/5 Day Off Cycle as Treatment Regimens

[0410] Artemisinin is mainly eliminated by hepatic transformation. To investigate whether the clearance of artemisinin in patients with liver cirrhosis is different from healthy volunteers, pharmacokinetic study was performed in male Vietnamese patients with Child B cirrhosis of the liver who received 500 mg of artemisinin orally. The results were compared to those found in a previous study in healthy subjects. The mean (±SD) area under the concentration time curve was 2365 (±1761) h ng/ml; the mean (±SD) clearance, 382 (±303)/L/h. The elimination half-life was 4 (±1.3) h extimated by log-linear regression and 2.4±0.9 h estimated by non-linear regression using a one-compartment first order elimination model. The mean (±SD) absorption time was 1.55 (±0.8) h. These results were not different from the results of healthy subjects and show that liver disease has no effect on the availability and clearance of oral artemisinin, indicating that artemisinin has an intermediate hepatic extraction ratio and that there is no significant first pass effect.

[0411] The influence of food intake on the pharmacokinetics of artemisinin was studied with six healthy Vietnamese male subjects. In a crossover study, artemisinin capsules (500 mg) were administered with and without food after an overnight fast. Plasma samples were obtained up to 24 h after intake of each drug. Measurement of artemisinin concentrations was performed by high-performance liquid chromatography with electrochemical detection. Tolerance was evaluated according to subjective and objective findings, including repeated physical examinations, routine blood investigations, and electrocardiograms. Pharmacokinetics were analyzed with a noncompartmental method and with a one-compartment model. This model had either zero-order or first order input. No statistically significant differences were found between the results of the two experimental conditions. Specifically, there were no consistent differences in parameters most likely to be affected by food intake, including absorption profile, absorption rate, bioavailability (f) (as reflected in area under the concentration time curve [AUC]), and drug clearance. Some mean±standard deviation parameters after food were as follows: maximum concentration of drug in serum (C.sub.max), 443±224 μg×liter.sup.−1; time to C.sub.max, 1.78±1.2 h; AUC, 2,092±1,441 ng×ml.sup.−1×h, apparent clearance/f, 321±167 liter×h.sup.−1; mean residence time, 4.42±1.31 h; and time at which half of the terminal value was reached, 0.97±0.68 h. The total amount of artemisinin excreted in urine was less than 1% of the dose. We conclude that food intake has no major effect on artemisinin pharmacokinetics. In addition, we conclude tentatively that artemisinin is cleared by the liver, that this clearance does not depend on liver blood flow (i.e., that artemisinin is a so-called low-clearance drug), and that absorption of the drug is not affected by food intake.

[0412] Another important pharmacokinetic factor influenced by food is liver blood flow, and therefore bioavailability and/or systemic clearance. Because we found only trace amounts of unchanged artemisinin in urine, enzymatic, and thus most probably, hepatic, metabolism seems to the main route of elimination of artemisinin. Theoretically, biliary excretion is another possible route of elimination. The influence of changes in liver blood flow on pharmacokinetics depends on the relationship between liver blood flow and the intrinsic capacity of the liver to metabolize a drug (the so-called “intrinsic clearance”). When intrinsic clearance is high compared to liver blood flow, the rate-limiting factor in drug clearance is liver blood flow; changes in liver blood flow are thus expected to have an influence on pharmacokinetic parameters. When intrinsic clearance is low compared to liver blood flow, changes in liver blood flow do not affect clearance. Because we found no differences in the pharmacokinetics of artemisinin after food versus those before food, liver blood flow has no influence on the elimination or the bioavailability of artemisinin. Artemisinin is therefore probably a so-called low-clearance drug.

[0413] Fifteen subjects received four different dose regimens of a single dose of artemisinin as a conventional formulation (160 and 500 mg) and as a micronized test formulation (160 mg alone and in combination with piperaquine phosphate, 360 mg) with a washout period of 3 weeks between each period (i.e. four-way cross-over). Venous plasma samples were collected frequently up to 12 h after dose in each period. Artemisinin was quantified in plasma using liquid chromatography coupled with tandem mass spectrometry. A nonlinear mixed-effects modelling approach was utilized to evaluate the population pharmacokinetic properties of the drug and to investigate the clinical impact of different formulations.

[0414] The plasma concentration-time profiles for artemisinin were adequately described by a transit-absorption model with a one-compartment disposition, in all four sequences simultaneously. The mean oral clearance, volume of distribution and terminal elimination half-life was 417 L/h, 1210 L and 1.93 h, respectively. Influence of formulation, dose and possible interaction of piperaquine was evaluated as categorical covariates in full covariate approaches. No clinically significant differences between formulations were shown which was in accordance with the previous results using a non-compartmental bioequivalence approach.

[0415] The pharmacokinetics of the antimalarial artemisinin exhibited an unusual time dependency during a 7-day oral daily regimen of 500 mg in 10 healthy, male Vietnamese adults. Artemisinin areas under the plasma concentration-time curve (AUC) decreased to 34% (median) by day 4 with a further decrease by day 7 to only 24% of values obtained after the first day of administration. In seven subjects restudied after a 2-week washout period, artemisinin AUCs had almost normalized, demonstrating the reversibility of the time dependent drug disposition. The results suggest artemisinin exhibits an auto-inductive effect on drug metabolism of an unusual magnitude. This may partly explain why some patients on standard doses, due to sub-parasiticidal drug levels toward the end of a standard regimen, do not completely clear parasites.

[0416] Artemisinin induces its own metabolism even after a single dose, resulting in decreased concentrations after repeated administration. Increasing amounts of artemisinin in the liver compartment increased the rate of production of an enzyme precursor in a linear fashion, resulting in greater amounts of enzyme.

[0417] Twenty-four healthy males were randomized to receive either a daily single dose of 500 mg oral artemisinin for 5 days, or single oral doses of 100/100/250/250/500 mg on each of the first 5 days. Two subjects from each group were administered a new dose of 500 mg on one of the following days after the beginning of the study: 7, 10, 13, 16, 20, or 24. Artemisinin concentrations in saliva samples collected on days 1, 3, 5, and on the final day were determined by HPLC. Data were analysed using a semiphysiological model incorporating (a) autoinduction of a precursor to the metabolizing enzymes, and (b) a two-compartment pharmacokinetic model with a separate hepatic compartment to mimic the processes of autoinduction and high hepatic extraction.

[0418] Artemisinin was found to induce its own metabolism with a mean induction time of 1.9 h, whereas the enzyme elimination half-life was estimated to 37.9 h. The hepatic extraction ratio of artemisinin was estimated to be 0.93, increasing to about 0.99 after autoinduction of metabolism. The model indicated that autoinduction mainly affected bioavailability, but not systemic clearance. Non-linear increases in AUC with dose were explained by saturable hepatic elimination affecting the first-pass extraction.

[0419] Therefore, either scaling in dose or a break of 5 day following dosing for 5 days is necessary to prevent enzyme induction and to achieve high plasma concentration. Importantly, the dosing of artemisinin should not be affected by food intake or hepatic status.

Example 9 Manufacturing: Physical, Chemical, and Pharmaceutical Properties, Formulation, and Route of Administration

[0420] Physical and Chemical Characterization

[0421] The product, ARTIVeda™, is a formulated Artemisinin derived from Artemisia annua.

[0422] Pharmaceutical Properties of the Investigational Medicinal Product

[0423] ARTIVeda™ is manufactured in a facility in compliance with current GMP and legal requirements. The final product is quality controlled by appropriate analytical methods (e.g. HPLC, pH, etc.) to confirm the identity and purity of ARTIVeda™. Analytical testing is performed according to common pharmaceutical standards (e.g. Pharm. Eur. and/or United States Pharmacopeia) for parenteral drugs.

[0424] ARTIVeda™ is supplied as a gelatin capsule for oral administration. The capusles are package in strips of 10 sufficient for two cycles of ARTIVeda™. The primary as well as secondary containers of the closure system fulfill international quality standards.

[0425] Administration: Preparation and Application Drug Product Manufacturing

[0426] ARTIVeda™ is administered as oral capsule as part of a 10 day treatment regimen of one capsule per day for 5 days follow by 5 days washout; and the cycle can be repeated. The drug product complies with The International Pharmacopoeia—Ninth Edition, 2019 Artemisinin (Artemisininum). The product is USP compliant as to USP 231, USP 232, and USP 233. The product is ICH and FDA compliant as to ICH Q3D and FDA Q3D(R1).

[0427] The manufacturing process is as shown in FIG. 6 and the batch formula for the commercial batches is shown in Table 1. The narrative summary of each unit operations of the manufacturing of the artemisinin capsule is described below: [0428] 1. Sifting: Sift Artemisia annua Extract, and Microcrystalline cellulose PH112 through 40# sieve in double poly bag and load in Octagonal Blender & mix for 10 min. [0429] 2. Sifting of Lubricants: Sift Crospovidone, Cross Carmellose Sodium & Polysorbate 80 dry powder through 40# Sieve and Magnesium stearate through 60#. [0430] 3. Lubrication: Add sifted materials of step No: 2 (except Magnesium Stearate) to blend of Step no: 1 in Octagonal Blender and mix for 5.0 minutes. [0431] 4. Add sifted Magnesium stearate to blend in Octagonal Blender and mixed further for 3.0 minutes [0432] 5. The blend is ready for analysis and further for filling in “0” size Transparent/C. Transparent #. HPMC capsule shell. The theoretical average weight of veg capsule should be 96 mg±5.0%. [0433] 6. CAPSULE FILLING: Fill the dry mix blend into the Hopper of Semi-Automatic capsule filling machine. Set the capsule filling machine. After setting the machine, the in-process parameters are set and capsule filling in process control. First set the average fill weight [0434] 7. Average fill weight should be kept at 650.0 mg and theoretical Average weight of capsule should be 650.0 mg±3.0% [555 mg blend part+(95.0 mg empty HPMC Cap)] & all capsule filling parameters should be monitored and recorded. [0435] 8. Before taking capsule for polishing, dedust & Inspect the capsule for any denting, broken, spotted appearance [0436] 9. POLISHING: Polish the capsule using polishing machine. Record the yield & store the capsule in double polyethylene bags [0437] 10. STORAGE OF FILLED CAPSULES: Store in controlled temperature of NMT 25° C. & NMT 32% respectively before sample will be released for packing.

TABLE-US-00010 TABLE 7 Batch Formula for the Commercial Batch Rational for Qty/Cap, Commercial Batch % Component Grade Use mg 200000 Units (w/w) Artemisinin IH API 525.00 105.00 kg 94.59 Microcrystalline USP Diluent 2.500 0.500 kg 0.45 Cellulose PH112 Polysorbate 80 Dry IH Stabilizer 13.600 2.720 kg 2.45 Powder Cros povidone USP Disintegrant 5.700 1.140 kg 1.03 Croscarmellose USP Disintegrant 5.700 1.140 kg 1.03 sodium Magnesium Stearate USP Antisticking 2.500 0.500 kg 0.45 agent Total Weight 555.00 111.00 kg
The following batches were manufactured with three exhibit batches matching the proposed commercial batch formula (Table 8). The batch descriptions are shown in Table 9 and testing results are shown in Table 10. The batches produces to date demonstrated robustness of the manufacturing process and stability of the product.

TABLE-US-00011 TABLE 8 Drug Product Batches S. No. Batch No. Mfg. Date Batch Size 1. WND20244A 19 Sep. 2020 400 Capsules 2. WND20254A 28 Sep. 2020 400 Capsules 3. WND20255A 29 Sep. 2020 400 Capsules 4. WND20263A 5 Oct. 2020 1,000 Capsules 5. WND20266A 9 Oct. 2020 1,000 Capsules 6. WND20268A 9 Oct. 2020 1,000 Capsules

TABLE-US-00012 TABLE9 Drug Product Formula Ingredients Specs. WND20244A WND20254A WND20255A WND20263A WND20266A WND20268A 1 Artemisinin IH 525.00 525.00 525.00 525.00 525.00 525.00 2 Microcrystalline USP 1.50 1.50 2.50 2.50 2.50 2.50 Cellulose PH112 3 Polysorbate 80 USP . . . 10.00 . . . . . . . . . . . . 4 Polysorbate 80 IH . . . . . . 13.60 13.60 13.60 13.60 Dry Powder 5 Cross povidone USP . . . . . . 5.70 5.70 5.70 5.70 6 Cross USP . . . . . . 5.70 5.70 5.70 5.70 Carmellose Sodium 7 Magnesium USP 2.50 2.50 2.50 2.50 2.50 2.50 Stearate Total Weight 529.00 539.00 555.00 555.00 555.00 555.00 8 Transparent IH 95.00 mg 95.00 mg 95.00 mg 95.00 mg 95.00 mg 95.00 mg # ‘0’

TABLE-US-00013 TABLE 10 Drag Product Testing Results S. No. Parameters Limits WND20263A WND20266A WND20268A 1 Description HPMC Capsule size “0” Complies Complies Complies of filled clear transparent/clear capsule transparent containing white crystalline white powder 2 Identification Should be positive for Complies Complies Complies Artemisinin as per assay method 3 Av. Fill 555.0 mg ± 5.0% 549.87 mg 552.23 mg 554.68 mg weight of capsule 4 Av. Weight [555 mg blend part + 652.13 mg 647.23 mg 649.68 mg of capsule 95.0 mg empty HPMC Cap)] = 650.0 mg ± 5.0% 5 Group 13.00 g ± 3.0% 13.04 g 12.94 g 12.99 g weight of 20 capsules 6 Dissolution Not less than 70.00% of Min: 85.62% Min: 86.43% Min: 85.08% labeled amount in Max: 89.55% Max: 89.98% Max: 90.05% 45 minutes Av: 87.58% Av: 88.20% Av: 87.56% 7 Related Substances Impurity A Not more than 0.5% 0.04% 0.03% 0.04% Impurity B Not more than 0.5% 0.11% 0.11% 0.11% Any other Not more than 0.2% Not detected Not detected Not detected secondary impurity Total Not more than 2.0% 0.15% 0.15% Impurity 8 Assay Each 450.00 mg to 550.00 mg 515.69 mg 518.84 mg 513.22 mg HPMC capsule contains Artemisinin 90.00% to 110.00% 103.14%  103.77%  102.64%  labelled amount 9 Microbial Limit Test Total Not more than 100,000 50 cfu/g 60 cfu/g 50 cfu/g Microbial cfu/g Plate Count Total Yeast Not more than 1,000 cfu/g <10 cfu/g <10 cfu/g <10 cfu/g & Mould Pathogens E coli Should be absent/g Absent/g Absent/g Absent/g Salmonella Should be absent/10 g  Absent/10 g  Absent/10 g  Absent/10 g spp. P. Should be absent/g Absent/g Absent/g Absent/g aeruginosa S. aureus Should be absent/g Absent/g Absent/g Absent/g

Example 10 Drug Stability: Handling and Storage Conditions Temperature Stability

[0438] Stability studies were performed according to International Conference on Harmonisation guidelines to obtain stability data of ARTIVeda™. According to these stability studies, ARTIVeda™ demonstrated at least 2 year shelf life when stored at RT [+25° C.±2° C./60% relative humidity (RH) for at least 24 months].

[0439] Stability plan includes accelerated stability (40° C./75% RH) at 0, 4, 8, and 12 weeks, and room temperature (25° C./60% RH) stability data at 0, 3, 6, 9, and 12 months for the drug product (Table 11). Current available stability data is summarized in Table 12.

TABLE-US-00014 TABLE 11 Stability Plan Strength Container/Closure Conditions Sample Times Batches 500 mg Alu-PVDC clear 40° C. ± 2° C. 0, 1, 3 and 6 Batch# blister 75% ± 5% RH months WND20263A 30° C. ± 2° C. 0.3, 6, 9, 12, 24 and 75% ± 5% RH 36 months 25° C. ± 2° C. 0, 3, 6, 9, 12 and 24 60% ± 5% RH months 5° C. ± 3° C. 0, 3, 6, 9, 12 and 24 No humidity months 500 mg Alu-PVDC clear 40° C. ± 2° C. 0, 1, 3 and 6 Batch# blister 75% ± 5% RH months WND20266A 30° C. ± 2° C. 0, 3, 6, 9, 12, 24 and 75% + 5% RH 36 months 25° C. ± 2° C. 0, 3, 6, 9, 12 and 24 60% ± 5% RH months 5° C. ± 3° C. 0, 3, 6, 9, 12 and 24 No humidity months 500 mg Alu-PVDC clear 40° C. ± 2° C. 0, 1, 3 and 6 Batch# blister 75% ± 5% RH months WND20268A 30° C. ± 2° C. 0, 3, 6, 9, 12, 24 and 75% ± 5% RH 36 months 25° C. ± 2° C. 0, 3, 6, 9, 12 and 24 60% ± 5% RH months 5° C. ± 3° C. 0, 3, 6, 9, 12 and 24 No humidity months

TABLE-US-00015 TABLE 12 Stability Data Summary Accelerated Room Temperature (40° C./75% RH), (25° C./60% RH), Specifications 0, 4, 8, 12 weeks 0, 3, 6, 9, 12 months Assay (90-110%) No Trend, All values vary No Trend, All values vary between 98-102.1% between 98.7-101.6% Impurity RC1 (NMT 0.2%) No Trend, All values No Trend, All values (0.1-0.2%) (0.1-0.2%) Impurity RC2 (NMT 1.0%) No Trend, All values No Trend, All values (0.2-0.5%) (0.2-0.5%) Impurity RC3 (NMT 0.1%) No Trend, Not detectable No Trend, Not detectable Any Unspecified Impurity No Trend, All values are No Trend, All values are (NMT 0.1%) (0.05-0.1%) (0.05-0.1%) Total Impurities (NMT Upward Trend (0.7%), All No trend (<0.3%), All values 3.0%) values are (0.5-0.7%) are <0.3% Dissolution All Comply (70-80%) in 12 h All Comply (70-80%) in 12 h Moisture (NMT 5.0%) No Trend, Values vary No Trend, Values vary between between 3.1-4.2% 2.1-2.5% Description and Physical All Comply All Comply Appearance

[0440] Recommended Storage and Handling Conditions

[0441] To date, the recommended temperature condition for storage and transport of ARTIVeda™ is

+25° C.±2° C./60% RH.

Example 11. Artemisinin Combination Products:

[0442] ArtemiC is a medical spray comprised of Artemisinin (6 mg/ml), Curcumin (20 mg/ml), Frankincense (=Boswellia) (15 mg/ml) and vitamin C (60 mg/ml) in micellar formulation for spray administration.

[0443] Patients were given up to 6 mg Artemisinin, 20 mg Curcumin, 15 mg Frankincense and 60 mg vitamin C given daily as an add-on therapy (in addition to standard care) in two divided doses, on Days 1 and 2.

[0444] Patients were randomized in a manner of 2:1 for study drug (ArtemiC) and Standard of Care to Placebo and Standard of Care.

[0445] Patients were followed-up last 2 weeks. During this time, patients were be monitored for adverse events.

[0446] Additional time is required for follow up (until hospital discharge) in order to check side effects and study drug efficacy.

[0447] Placebo, composed of the same solvent but without active ingredients, was given in the placebo group as add-on therapy, 2 times a day, on Days 1 and 2.

[0448] Study Purpose: This study is designed to evaluate the safety and efficacy of ArtemiC on patients diagnosed with COVID-19.

[0449] Methodology 50 adult patients who suffer from COVID-19 infection studied in parallel groups treated with active agent or placebo as add on to standard care.

[0450] Safety was assessed through collection and analysis of adverse events, blood and urine laboratory assessments and vital signs.

[0451] Phase II double-blind, placebo-controlled clinical trial for anti-inflammatory treatment ArtemiC, based on Swiss PharmaCan AG MyCell Enhanced™ delivery system technology, on those diagnosed with COVID-19, has met all the Phase II primary and secondary endpoints and demonstrated to improve the clinical recovery of the patients.

[0452] Key Trial Results

[0453] The comparison between the study and placebo groups before and after treatment is presented in table 13.

TABLE-US-00016 Study visit Study group NEWS Score P Before treatment ArtemiC ™ 1.5152 0.54 Placebo 1.8824 Day 15 ArtemiC ™ .5152 0.04 Placebo 2.2353

[0454] The Phase II trial involved 50 infected patients across three independent hospital sites in Israel and India, with 33 in the treatment group and 17 in the placebo group.

[0455] The full results have demonstrated to improve the health status of COVID-19 patients delivering a NEWS score of less than or equal to 2.

[0456] None of the patients in the treatment group required additional oxygen, mechanical ventilation or admission to intensive care where all of these events were reported in the placebo group.

[0457] The average NEWS score of patients in the placebo group was 2.25 statistically significantly higher (p<0.04) than in the treatment group −0.5.><0.04) than in the treatment group −0.5 NEWS score determines the degree of illness of a patient and prompts critical care intervention.

[0458] This was defined as a main tool for the estimation of COVID-19 patients clinical health status and improvement.

[0459] Different indications related to inflammation and cytokine storm, will be considered as future development goals and include a wide range of diseases related to cytokine storm such as autoimmune diseases, inflammatory GI diseases, flu and chemotherapy patients.

[0460] Primary Outcome Measures: [0461] 1. Time to clinical improvement, defined as a national Early Warning Score 2 (NEWS2) of </=2 Maintained for 24 Hours in comparison to routine treatment [Time Frame: 24 hours] patient will be assessed using a scoring table for changes in clinical signs [0462] 2. Percentage of participants with definite or probable drug related adverse events [Time Frame: 14 days] Adverse events caused by the study drug will be assessed

[0463] Secondary Outcome Measures: [0464] 1. Time to negative COVID-19 PCR [Time Frame: 14 days ] [0465] 2. Proportion of participants with normalization of fever and oxygen saturation through day 14 since onset of symptoms [Time Frame: 14 days ] [0466] 3. COVID-19 related survival [Time Frame: 14 days ] [0467] 4. Incidence and duration of mechanical ventilation [Time Frame: 14 days ] [0468] 5. Incidence of Intensive Care Init (ICU) stay [Time Frame: 14 days ] [0469] 6. Duration of ICU stay [Time Frame: 14 days ] [0470] 7. Duration of time on supplemental oxygen [Time Frame: 14 days ]

[0471] Inclusion Criteria: [0472] 1. Confirmed SARS-CoV-2 infection. [0473] 2. Hospitalized COVID-19 patient in stable moderate condition (i.e., not requiring ICU admission). [0474] 3. Subjects must be under observation or admitted to a controlled facility or hospital (home quarantine is not sufficient).

[0475] Exclusion Criteria: [0476] 1. Tube feeding or parenteral nutrition. [0477] 2. Patients who are symptomatic and require oxygen (Ordinal Scale for Clinical Improvement score >3) at the time of screening. [0478] 3. Respiratory decompensation requiring mechanical ventilation. [0479] 4. Uncontrolled diabetes type 2. [0480] 5. Autoimmune disease. [0481] 6. Pregnant or lactating women. [0482] 7. Any condition which, in the opinion of the Principal Investigator, would prevent full participation in this trial or would interfere with the evaluation of the trial endpoints.

Example 12: ASOs Synthesized in the Present Invention:

[0483]

TABLE-US-00017 Anti-sense oligonucleotides Name Sequence (5′-3′) 2′MOE 5TERM (1-20) (SEQ ID NO: 59) No G*G*T*A*G*G*T*A*A*A*A*A*C*C*T*A*A*T*A*T* TRS1 (53-72) (SEQ ID NO: 60) No G*T*TC*.sup.MeG*T*T*T*A*G*A*G*A*A*C*.sup.Me*G*A*T*C*.sup.Me TRS2 (56-76) (SEQ ID NO: 61) No T*A*A*A*G*T*T*C*.sup.Me*T*T*T*A*G*A*G*A*A*C*.sup.Me*G* FS (13,458- (SEQ ID NO: 62) No 13,472) A*G*C*.sup.Mec*.sup.MeC*.sup.MeT*G*T*A*G*A*C*.sup.Me*A*C*.sup.Me 5TERM (1-20) (SEQ ID NO: 63) Yes G*G*T*A*G*G*T*A*A*A*A*A*C*C*T*A*A*T*A*T* TRS2-2 53-72 (SEQ ID NO: 64) No C*G*T*T*T*A*G*A*G*A*A*C*A*G*A*T*C*T*A*C* TRS2-2 53-72 (SEQ ID NO: 65) Yes C*G*T*T*T*A*G*A*G*A*A*C*A*G*A*T*C*T*A*C* FS (13,458- (SEQ ID NO: 66) Yes 13,472) A*G*C*.sup.Mec*.sup.MeC*.sup.MeT*G*T*A*T*A*C*.sup.Me*A*C*.sup.Me FS-2a (13539- (SEQ ID NO: 67) No 13558) C*A*T*T*G*T*A*G*A*T*G*T*C*A*A*A*A*G*C*C* RSV1 (SEQ ID NO: 68) No C*T*C*C*C*T*C*A*T*G*G*T*G*G*C*A*G*T*T*G*A* 1) *PS 2) Substitution at the 5-position of the cytosine (C) with a methyl group is indicated by .sup.Me

[0484] Analysis by OligoEvaluator (Sigma)

TABLE-US-00018 5TERM (1-20) 5′ G*G*T*A*G*G*T*A*A*A*A*A*C*C*T*A*A*T*A*T-3′ (SEQ ID NO: 69) Base Molecular Extinction Oligo μg/OD Length Tm GC GC Run Secondary Primer Count Weight Coefficient Type at 260 nm (bp) (.sup.O C.) % Clamp Length (bp) Structure Dimer BLAST A = 9, 6173.1 212.7 No 29.0 20 48.5 30.0 0 5 Moderate Yes Sequence U = 0, Mod G = 4, C = 2, T = 5, I = 0, Total = 20 TRS1 (53-72) 5′-G*T*TC*G*T*T*T*A*G*A*G*A*A*C*A*G*A*T*C 3′ (SEQ ID NO: 70) Base Molecular Extinction Oligo μg/OD Length Tm GC GC Run Secondary Primer Count Weight Coefficient Type at 260 nm (bp) (.sup.O C.) % Clamp Length (bp) Structure Dimer BLAST A = 6, 6156.1 2020.0 No 30.5 20 52.8 40.0 1 3 Moderate Yes Sequence U = 0, Mod G = 5, C = 6, T = 6, I = 0, Total = 20 TRS2 (56-76) 5′T*A*A*A*G*T*T*C*G*T*T*T*A*G*A*G*A*A*C*A*G 3′ (SEQ ID NO: 71) Base Molecular Extinction Oligo μg/OD Length Tm GC GC Run Secondary Primer Count Weight Coefficient Type at 260 nm (bp) (.sup.O C.) % Clamp Length (bp) Structure Dimer BLAST A = 8, 6493.3 218.9 No 29.7 21 53.1 33.3 1 3 Moderate No Sequence U = 0, Mod G = 5, C = 2, T = 6, I = 0, Total = 21 FS (13,458-13,472) 5′ A*G*C*C*C*T*G*T*A*T*A*C*G*A*C 3′ (SEQ ID NO: 72) Base Molecular Extinction Oligo μg/OD Length Tm GC GC Run Secondary Primer Count Weight Coefficient Type at 260 nm (bp) (.sup.O C.) % Clamp Length (bp) Structure Dimer BLAST A = 4, 4761.9 144.8 No 32.9 15 47.4 53.3 2 3 None No Sequence U = 0, Mod G = 3, C = 5, T = 3, I = 0, Total = 15 RSV1 5′-C*T*C*C*C*T*C*A*T*G*G*T*G*G*C*A*G*T*T*G*A-3′ (SEQ ID NO: 73) Base Molecular Extinction Oligo μg/OD Length Tm GC GC Run Secondary Primer Count Weight Coefficient Type at 260 nm (bp) (.sup.O C.) % Clamp Length (bp) Structure Dimer BLAST A = 3, 6734.4 193.0 No 34.9 21 69.7 57.1 1 3 Very Weak No Sequence U = 0, Mod G = 6, C = 6, T = 6, I = 0, Total = 21

[0485] Results: SARS antiviral assay result for OT-101 [0486] 1. Prepare 96-well plates of the desired cell line and incubate overnight. Seed platesat a cell concentration that will yield 80-100% confluent monolayers in each well after overnight incubation. [0487] 2. Prepare 8 half-log, serial dilutions in test medium with the highest test compound concentration of 1000 μg/mL. [0488] 4. Add 100 μL of each concentration to 5 test wells on the 96-well plate. Infect 3 wells of each dilution with the test virus in test medium (≤100 CCID.sub.50 per well for most viruses). Add test medium with no virus to 2 wells (uninfected toxicity controls). [0489] 5. Infect 6 wells as untreated virus controls. [0490] 6. Add media only to 6 wells as cell controls. [0491] 7. Test a known active compound in parallel as a control. [0492] 8. Incubate at 37 C +5% CO2 until CPE is apparent. [0493] 9. After cytopathic effect (CPE) is observed microscopically, stain with 0.011% neutral red dye for approximately 2 hours. Siphon off neutral red dye (optionally rinse once with PBS to remove residual, unincorporated dye). [0494] 10. Perform CPE quantitation versus drug concentration to determine EC50 [0495] 11. OT-101 had an 50% effective concentration of 7.6 μg/ml and was not toxic at the highest dose of 1000 μg/ml giving a Safety Index (SI) value of >130 which we would consider highly active. [0496] 12. Safety Index=Toxic dose/Efficacy dose. The wider the range the more safe the drug is. [0497] 13. As OT-101 has been through multiple clinical trials with more than 200 pts treated, there should be no problem putting OT-101 into clinical testing against COVID19 [0498] 14. OT-101 is expected to have multiple mechanism of action against COVID-19: 1) Antiviral activity, 2) Anti-pneumonia activity and 3) Anti-viral binding to its receptor.

[0499] Test media:

[0500] MEM+2% FBS and 50 ug/mL gentamicin for most viruses

[0501] For flu: MEM+10 U/mL trypsin & 1 ug/mL EDTA for influenza Other special media if required depending on the virus and cell type

Example 13. Testing for SARS-CoV2 with Antisense. Antisense Molecules Described in Example 1 and Also OT-101 (Antisense Against TGF-beta 2)

[0502] OT-101 (Trabedersen) and the ten antisense compounds against SARS-CoV-2 were solubilized in sterile saline to prepare 20 mg/mL stock solutions which were sterile filtered through a 0.2 μM low protein binding filter. Compounds were serially diluted using eight half-log dilutions in test medium (MEM supplemented with 2% FBS and 50 μg/mL gentamicin) so that the starting (high) test concentration was 1000 μg/mL. Each dilution was added to 5 wells of a 96-well plate with 80-100% confluent Vero 76 cells.

[0503] Three wells of each dilution were infected with virus, and two wells remained uninfected as toxicity controls. Six wells were infected and untreated as virus controls, and six wells were uninfected and untreated as cell controls. SARS-CoV-2 virus suspensions were prepared to achieve the lowest possible multiplicity of infection (MOI) that would yield >80% cytopathic effect (CPE) within 5 days. M128533 was tested in parallel as a positive control.

[0504] On day 5 post-infection, once untreated virus control wells reached maximum CPE, plates were stained with neutral red dye for approximately 2 hours (15 minutes). Supernatant dye was removed and wells rinsed with PBS, and the incorporated dye was extracted in 50:50 Sorensen citrate buffer/ethanol for >30 minutes and the optical density was read on a spectrophotometer at 540 nm. Optical densities were converted to percent of cell controls and normalized to the virus control, then the concentration of test compound required to inhibit CPE by 50% (EC.sub.50) was calculated by regression analysis. The concentration of compound that would cause 50% cell death in the absence of virus was similarly calculated (CC.sub.50). The selective index (SI) is the CC.sub.50 divided by EC.sub.50.

[0505] Antiviral activity against SARS-CoV-2 for each compound is shown in below. Cytotoxicity was observed for TRS1 (53-72), FS (13,458-13,472), and STERM (1-20) MOE. High antiviral activity was observed with the following compounds: OT-101, 5TERM (1-20), TRS1 (53-72), FS (13,458-13,472), 5TERM (1-20) MOE, TRS2-2 53-72, FS-2a (13539-13558). The positive control compound performed as expected.

TABLE-US-00019 TABLE 14 EC.sub.50 CC.sub.50 SI OT-101 2.0 >1000 >500 5TERM (1-20) 7.1 >1000 >140 TRS1 (53-72) 7.6 720 95 TRS2 (56-76) 73 >1000 >14 FS (13,458-13,472) 5.2 430 53 5TERM (1-20) MOE 4.9 610 120 TRS2-2 53-72 1.9 >1000 >530 TRS2-2 53-72 MOE 62 >1000 >16 FS (13.458-13.274)MOE 25 >1000 >40 FS-2a (13539-13558) 17 >1000 >59 RSV 620 >1000 >1.6 Remdesivir (0.77 uM) (>200 uM) >130 M128533 (positive 0.012 >10 >830 control)

[0506] RSV-Negative control antisense/M128533-positive control. EC.sub.50: 50% effective antiviral concentration (in μg/ml)/CC.sub.50: 50% cytotoxic concentration of compound without virus added (in μg/ml)/SI=CC.sub.50/EC.sub.50. Source of SARS-COV-2: the World Reference Center for Emerging Viruses and Arboviruses (WRCEVA) at UTMB. Units are in μg/mL for test compounds and M128533.

Example 14. TGF-Beta Inhibition Activity of OT-101.

[0507] The effect of trabedersen on TGF-β2 secretion was analyzed in cell lines of human HGG, human pancreatic carcinoma, malignant melanoma, colorectal carcinoma, and other tumors (prostate carcinoma, renal cell carcinoma, and non-small cell lung carcinoma). The TGF-β2 concentration in cell culture supernatants after treatment with trabedersen for 7 days was analyzed. Trabedersen reduced TGF-β2 secretion in the human HGG cell line A-172 compared to untreated controls at all concentrations tested; the highest inhibitory effect of 64% was observed with 10 trabedersen (Also known as OT-101). Trabedersen displayed very potent activity also in other cell lines, and concentration-dependently reduced TGF-β2 secretion compared to untreated control. The trabedersen concentration required to achieve half maximal inhibition of TGF-β2 secretion (half maximal inhibitory concentration [IC.sub.50 ]) in vitro (without carrier) was determined for human HGG, pancreatic carcinoma, malignant melanoma, and colorectal carcinoma cells to be in the range of 2 to 5 Furthermore, down-regulation of TGF-β2 was also demonstrated in human malignant melanoma cells, i.e. MER 116 and RPMI 7951 (OT-101) and human cell lines originating from other tumor types such as non-small cell lung carcinoma, prostate carcinoma, renal clear cell carcinoma.

[0508] Results from in vitro experiments clearly demonstrated that trabedersen has high potency to inhibit TGF-β2 secretion.

[0509] Reversal of TGF-β-Induced Immunosuppression

[0510] TGF-β2 inhibits proliferation of lymphocytes and suppresses lymphocyte-mediated cytotoxicity directed against tumor cells. Targeted inhibition of TGF-β2 by trabedersen should re-establish cytotoxic activity of immune cells against human tumors.

[0511] Human HGG cells were obtained from surgical specimens of 5 patients. PBMCs from these patients were activated with human recombinant IL-2 to generate lymphokine-activated killer (LAK) cells as effector cells, which are known to lyse most autologous and allogenic fresh human tumor cells. LAK cell-mediated cytotoxicity against the patient derived autologous HGG cells (target cells) was tested in a cell co-culture system using the calcein-release assay. Trabedersen clearly enhanced autologous cytotoxicity against human HGG cells with a mean of 40% (untreated control 16%). The increase in antitumor activity ranged from 41% to 520% compared to untreated control.

[0512] The effects of trabedersen were evaluated in an allogenic cellular cytotoxicity test system using human pancreatic cancer cell lines as target cells and PBMCs from healthy donors as effector cells. Effector cells were incubated in cell supernatants of trabedersen-treated tumor cells before coincubation with the target cells in the cell-mediated cytotoxicity assay. Human immune cells cultivated with supernatants of tumor cells (PA-TU-8902) treated with trabedersen/Lipofectin showed an increased antitumor activity in comparison to untreated control and Lipofectin control at different ratios of human immune effector and pancreatic cancer target cells. These results were confirmed with PBMCs from a different healthy donor as well as another human pancreatic carcinoma cell line (Hup-T3).

[0513] Trabedersen reversed the suppression of immune cells by human tumor cells via inhibition of TGF-β2 secretion. These results showed that the antitumor activity of the human immune cells was clearly enhanced after treatment with trabedersen and underscored the potential therapeutic benefit of this approach.

[0514] Efficacy in TGF-β Expressing Xenograft Models

[0515] Studies in functional in vivo test systems demonstrated that: (i) OT-101 has minor antitumor activities on its own. However it was able to synergize and increase the activity of Paclitaxel and Dacarbazine. OT-101 was unable to synergize with Gemcitabine. Significant antitumor activity was achieved at human dose equivalent to 80 mg/m.sup.2/day which is well below the optimized clinical dose used for IV infusion of patients at 140 mg/m.sup.2/day.

[0516] Evaluation of 0T-101-Induced Anti-Tumor Activity in Orthotopic C8161 Human Melanoma Model in Female BALB/c nu/nu Mice C8161. Sixty female athymic nude mice were intradermally inoculated with 0.5×106 C8161 human melanoma cells and randomized into six groups of 10 mice. Three groups received monotherapy treatment with either OT-101 (16 mg/kg) (Group 2) or DTIC (1 or 10 mg/kg; Groups 3, 4). Two groups received combination therapy with OT-101/DTIC at 16/1 mg/kg or 16/10 mg/kg (Groups 5 and 6). Vehicle (0.9% saline, Groups 1, 3, and 4) and OT-101 were administered 3 times/week via subcutaneous injection (SC). Vehicle (0.9% saline, Groups 1 and 2) and DTIC (1 or 10 mg/kg) were administered via intraperitoneal injection (ip) four times/week beginning day 14. Mice were monitored for adverse effects, body weight and tumor size three times weekly. The tumor, lungs, liver and kidneys were excised from all mice at termination and weighed. Tumor growth was suppressed versus control group 1 by 2%, −2%, 78%, 27%, and 92% on day 42 for group 2, 3, 4, 5, and 6, respectively. Using Kruskal-Wallis test to compare all 6 groups, there is a significant difference in the tumor volume growth (P<0.0001). ANOVA statistic of repeated measurements versus control group 1 was performed and the P-values are non significant (ns), ns, <0.0001, ns, and <0.0001 for group 2, 3, 4, 5, and 6, respectively. DTIC inhibition of tumor growth was enhanced when OT-101 was combined with either the low dose DTIC (group 5 vs. 3) or high dose DTIC (group 6 vs. 4), with 29% and 14% improvement, respectively. Anti-tumor activity of the combination, group 6, was significantly better than high dose DTIC, group 4 (P=0.038).

[0517] In Vivo Evaluation of Taxol and Trabedersen (OT-101) Against Human Glioblastoma U87 MG Xenograft Model in Nude Mice. A subcutaneous U87 MG xenograft model was established in nude mice to test the efficacy of monotherapy of paclitaxel (Taxol) and Trabedersen (OT-101) and combination therapy of Taxol with Trabedersen in two dosing schedules against human glioblastoma. The optimal dosages of test agents were decided based on previous dose-finding studies at a given schedule and their clinical doses for a better prediction of clinical outcomes. Overall, the combination of Taxol with Trabedersen appeared tolerable and demonstrated enhanced anti-tumor efficacy in the U87 glioblastoma xenograft model. The combination of Taxol with Trabedersen was shown to have a significant synergistic relationship in vivo with a schedule of Trabedersen followed by Taxol resulting in enhanced antitumor activity as well as increased survival in mice.

[0518] In Vivo Evaluation of Taxol and Trabedersen (OT-101) Against Human Ovarian Adenocarcinoma in SK-OV-3 Xenograft Model in Nude Mice. A subcutaneous SK-OV-3 ovarian cancer xenograft model was established in nude mice to test the efficacy of monotherapy of paclitaxel (Taxol) and Trabedersen (OT-101) and combination therapy of Taxol with Trabedersen in two dosing schedules against human ovarian cancer. The optimal dosages of test agents were decided based on previous dose-finding studies at a given schedule and their clinical doses for a better prediction of clinical outcomes. Overall, the combination of 10 mg/kg Taxol with 32 mg/kg Trabedersen appeared tolerable and demonstrated enhanced anti-tumor efficacy in the SK-OV-3 ovarian cancer xenograft model. The combination of Taxol with Trabedersen was shown to have a significant synergistic relationship in vivo with a schedule of Trabedersen followed by Taxol (D7 administration) resulting in enhanced antitumor activity as well as increased survival in mice.

[0519] Biological Activity of 3′-Truncated (n-1)-(n-4) Trabedersen

[0520] The biological activity of truncated trabedersen, i.e. metabolites, in comparison to full-length trabedersen with respect to inhibition of TGF-β2 secretion was tested in the human HGG cell line A-172. Depending on the concentration, the biological activity of 3′-truncated (n-1) and (n-2) trabedersen was in the same range as full-length trabedersen at 5 or 10 μM, whereas the biological activity of the shorter fragments (3′-truncated (n-3) and (n-4)) was lower.

[0521] Effect on Viability and Proliferation of Human Peripheral Blood Mononuclear Cells

[0522] Cell viability was assessed following treatment of human PBMCs with trabedersen in vitro using the Trypan blue exclusion test. Freshly isolated, IL-2 activated PBMCs from healthy donors and HGG patients were incubated either without trabedersen or with 1, 5, 10 or 80 μM trabedersen for 2, 3, 6, 7, 14, and 21 day. No relevant effects on the viability of PBMCs either from healthy donors or HGG patients were observed up to 21 day. There was no difference in cell viability between untreated and trabedersen treated cells. Proliferation of PBMCs treated with 5, 10 or 50μM trabedersen, respectively, was within the range of variation. PBMC proliferation after 7 days of treatment with 80 μM trabedersen was slightly reduced (67% of untreated control cells).

[0523] While tumor cell proliferation was inhibited by trabedersen, viability and proliferation of PBMCs was not significantly negatively affected at clinically applied concentrations.

Example 14. Clinical Efficacy of OT-101 Against TGF-Beta Expressing Solid Tumors

[0524] The clinical development program currently comprises 1 Phase I/II study of i.v. administered trabedersen in patients with solid tumors and 3 Phase I/II studies, 1 randomized and active-controlled Phase IIb study, and 1 Phase III study of locally administerd (intratumoral) trabedersen in patients with recurrent or refractory high-grade glioma.

[0525] Intravenous Administration in Patients with Solid Tumors

[0526] A Phase I/II Study P001 was conducted to investigate the i.v. administration of trabedersen in patients with solid tumors (i.e. advanced pancreatic carcinoma, malignant melanoma, or colorectal carcinoma).

[0527] Study Description

[0528] P001 is a completed Phase I/II dose escalation study. Primary objective is the determination of the MTD as well as the DLT of 2 cycles as core treatment and up to 8 optional extension cycles of trabedersen administered i.v. for 4 or 7 d every other week, as described in the following. The study followed a classical cohort design with 3 evaluable patients per cohort. Patients treated with the 1.sup.st schedule received trabedersen continuously for 7 d, followed by a treatment-free interval of 7 d for each treatment cycle (7-d-on, 7-d-off). After the MTD had been reached for this schedule, a 2.sup.nd schedule of 4 d trabedersen administration, followed by a treatment-free interval of 10 d for each treatment cycle was started (4-d-on, 10-d-off). In this treatment schedule the MTD has not been reached.

[0529] Objectives and Treatment

[0530] Primary objective of the study is the determination of the maximum tolerated dose (MTD) as well as the dose limiting toxicity (DLT) of two cycles of Trabedersen administered every other week. Secondary objectives include safety and tolerability, pharmacokinetic profile and potential antitumor activity of intravenous Trabedersen treatment.

[0531] Trabedersen was administered as i.v. continuous infusion for 4 or 7 days every other week via an implanted subcutaneous port system connected to a portable pump and with a flow rate of 0.8 mL/h. The core treatment consisted of 2 treatment cycles. Up to 8 optional extension cycles were administered in case of clinical benefit.

[0532] Main Inclusion and Exclusion Criteria

[0533] The study population included adult patients (18-75 years) with a histologically or cytologically confirmed diagnosis of either [0534] pancreatic cancer Stage III or IV (American Joint Committee on Cancer, AJCC 2002; corresponds to AJCC 1997 Stage IVA or IVB), [0535] malignant melanoma Stage III or IV (AJCC 2002), or [0536] colorectal cancer Stage III or IV (AJCC 2002).

[0537] Other important inclusion criteria were a Karnofsky performance status of ≥80%, adequate organ function and recovery from acute toxicity caused by any previous therapy. Patients were either not or no longer amenable to established forms of therapy.

[0538] Main exclusion criteria included a history of brain metastasis and radiation therapy within 12 weeks, tumor surgery within 4 weeks or any other therapy with established antitumor effects within 2 weeks before study entry.

[0539] Dose Escalation

[0540] The dose escalation followed a classical cohort design with at least 3 and up to 6 patients per cohort receiving Trabedersen. The starting dose was chosen based on the Lowest-Observed-Adverse-Effect Level (LOAEL) determined in monkeys as the most relevant species. LOAEL was found to be equivalent to 48 mg/m.sup.2/day in human adults and therefore, the starting dose was set at 40 mg/m.sup.2/day (equivalent to approx. 1 mg/kg b.w./day). The Data and Safety Monitoring Board (DSMB) regularly reviewed available safety and efficacy data before each escalation step. Generally, if patients of one cohort had tolerated the therapy, the next cohort received the next higher dose. Toxicity was assessed based on National Cancer Institute-Common Toxicity Criteria (NCI-CTC, version 2). A DLT was defined as an at least possibly related, medically important adverse event, of NCI-CTC grade 3 or 4, a worsening by ≥2 grades from baseline for renal or hepatic toxicities, a worsening by ≥3 grades from baseline for other laboratory parameters, or other toxicities considered dose-limiting by the investigator. If more than 2 patients of a cohort had DLTs, the next lower dose was defined as MTD. Dose-escalation had to be stopped if MTD was reached.

[0541] Two different Trabedersen Treatment schedules (7-d-on, 7-d-off and 4-d-on, 10-d-off) were tested. Following completion of dose escalation another cohort of patients was enrolled for the treatment with one defined treatment schedule and dose to collect further safety and efficacy data in a larger group of patients.

[0542] Efficacy Assessments

[0543] Tumor size and response are determined through CT scan evaluation according to the RECIST criteria, version 1.0. Each change in tumor size as compared to baseline is classified into CR (complete response), PR (partial response), SD (stable disease) and PD (progressive disease).

[0544] The overall survival is calculated for all patients as the survival time from the onset of treatment with study medication to death due to any cause and analyzed with the Kaplan-Meier method.

[0545] Study Course and Efficacy Outcome Study Course

[0546] Altogether 33 patients with advanced pancreatic cancer, malignant melanoma, or colorectal cancer were enrolled for dose escalation (Table 15). Patients treated in the first treatment schedule received Trabedersen continuously for 7 days, followed by a treatment-free interval of 7 days for each treatment cycle (7-days-on, 7-days-off). The dose was successively increased from 40 to 80, 160, and 240 mg/m.sup.2/day. Three dose-limiting toxicities (2 thrombocytopenias, 1 exanthema) occurred with the dose of 240 mg/m.sup.2/day and established the MTD at 160 mg/m.sup.2/day in the 7-days-on, 7-days-off schedule.

[0547] After the MTD had been reached in the 7-days-on, 7-days-off schedule, a second dose escalation was started using a modified treatment schedule with 4 days Trabedersen administration, followed by a treatment-free interval of 10 days for each treatment cycle (4-days-on, 10-days-off). The dose was successively increased from 140 to 190, 250, and 330 mg/m.sup.2/day. As this modified treatment schedule proved to be well tolerated and as early signs of efficacy were seen already in the lowest dose group, dose escalation was stopped after the 4th cohort without reaching an MTD before the cumulative dose of the next dose level (440 mg/m.sup.2/day) would have exceeded the MTD-cumulative dose as established in the 7-days-on, 7-days-off schedule.

[0548] Subsequently, following the recommendations of the DSMB, a further cohort of 14 patients with advanced pancreatic cancer and 14 patients with malignant melanoma were enrolled and treated with a dose of 140 mg/m.sup.2/day Trabedersen within the 4-days-on, 10-days-off schedule.

[0549] A total of 61 patients were treated with Trabedersen. Of these, 50 patients completed the core study, i.e. received 2 cycles of Trabedersen, and a total of 42 patients participated in extension cycles. A summary of treatment schedule and patient disposition is given in Table 15.

TABLE-US-00020 TABLE 15 Treatment Schedule and Patient Disposition - Total Population Treatment Dose No. of patients Dose limiting toxicities schedule [mg/m.sup.2/day] (PC/MM/CRC) (NCI-CTC grade) 7-days-on, 40 4 (4/0/0) — 7-days-off 80 3 (2/1/0) — 160 6 (3/1/2) — 240 4 (2/0/2) — 2 thrombocytopenias (3) — 1 exanthema (3) 4-days-on, 140 5 (5/0/0) — 1 gastrointestinal bleeding (3) 10-days-off 190 3 (2/1/0) — 250 5 (4/1/0) — 330 3 (1/1/1) — 4-days-on, 140 28 (14/14/0) — 10-days-off (additional patients) Enrolled 62 (38/19/5) Treated 61 (37/19/5) Discontinued before start of study 1 (1/0/0) Dropped out in core study 11 (7/1/3) Completing core study 50 (30/18/2) Participating in extension cycles 42 (25/16/1) CRC = Colorectal cancer, MM = Malignant melanoma, NCI-CTC = National Cancer Institute - Common Toxicity Criteria, PC = Pancreatic Cancer

[0550] 1.1.1.1.1 Patient Characteristics at Baselineen.

[0551] Table 16 shows patient demographic and baseline characteristics for the safety population (i.e. all patients that were treated with Trabedersen).

TABLE-US-00021 TABLE 16 Demographic and Baseline Characteristics - Safety Population Pancreatic Malignant Colorectal Cancer Melanoma Cancer (N = 37) (N = 19) (N = 5) Gender n (%) Male 17 (45.9%) 8 (42.1%) 5 (100%) Female 20 (54.1%) 11 (57.9%) 0 (0%) Median age range (years) 63 (40-76) 61 (44-74) 61 (43-67) Race n (%) Caucasian 37 (100%) 19 (100%) 5 (100%) Previous radiation n (%) 3 (8.1%) 5 (26.3%) 2 (40.0%) Previous surgery n (%) 14 (37.8%) 19 (100%) 5 (100%) Previous chemotherapy n 37 (100%) 19 (100%) 5 (100%) (%)  1 16 (43.2%) 7 (36.8%) 0 (0%)  2 13 (35.1%) 9 (47.4%) 0 (0%)  ≥3 8 (21.6%) 3 (15.8%) 5 (100%) Previous immunotherapy 1 (2.7%) 14 (73.7%) 0 (0%) n (%) Median time since first 11.4 65.6 25.6 diagnosis [months] KPS n (%)  80 18 (48.6%) 1 (5.3%) 2 (40.0%)  90 13 (35.1%) 7 (36.8%) 2 (40.0%) 100 6 (16.2%) 11 (57.9%) 1 (20.0%) N = Number of patients in the respective group; n = number of patients with the respective characteristic; KPS = Karnofsky Performance Status; Percentages refer to “N”. n.a. = not available

[0552] Survival and Antitumor Activity in Patients with Advanced Pancreatic Cancer

[0553] Overall Survival in the Treatment Schedules of the Dose Escalation

[0554] Altogether 21 patients with pancreatic cancer were treated during dose escalation. The median Overall Survival (mOS) of patients treated within the 7-days-on, 7-days-off schedule during dose escalation was comparable to the mOS of patients treated with the 4-days-on, 10-days-off schedule (5.7 months vs. 9.3 months, p=0.0645).

[0555] Overall Survival per Treatment Cohort

[0556] Table 17 shows the mOS per cohort of all 35 patients with pancreatic cancer treated. There was no clear dose-response relationship, neither in the 7-days-on, 7-days-off schedule nor in the 4-days-on, 10-days-off schedule. A similar pattern is seen when the 5 patients with malignant melanoma and 5 patients with colorectal cancer treated during dose-escalation are also included.

TABLE-US-00022 TABLE 17 Median Overall Survival per Dose Cohort Median Overall Survival in months [95% CI] Treatment Dose No. of patients Patients with schedule [mg/m.sup.2/day] (PC/MM/CRC) pancreatic cancer All patients 7-days-on, 40 4 (4/0/0) 6.9 [1.1, 11.1] 6.9 [1.1, 11.1] 7-days-off 80 2 (1/1/0) 4.6 [ND, ND] 9.2 [4.6, 13.8] 160 6 (3/1/2) 3.9 [3.2, 8.9] 2.9 [1.7, 8.9] 240 4 (2/0/2) 5.5 [1.8, 9.2] 6.5 [1.8, 9.2] 4-days-on, 140 4 (4/0/0) 14.5 [5.5, 39.7] 14.5 [5.5, 39.7] 10-days-off 190 3 (2/1/0) 6.2 [3.0, 9.3] 9.3 [3.0, 11.4] 250 5 (4/1/0) 7.3 [2.8, 16.1] 9.8 [2.8, 18.6] 330 3 (1/1/1) 2.4 [ND, ND] 3.0 [2.4, ND] 4-days-on, 140 28 (14/14/0) 3.3 [2.2, 5.5] 6.0.sup.2 [4.6, 8.9] 10-days-off (additional patients) CI = confidence interval CRC = Colorectal cancer, MM = Malignant melanoma, ND = not determined, PC = Pancreatic cancer.

[0557] The 14 additional patients with pancreatic cancer treated with the 140 mg/m.sup.2/day dose in the 4-days-on, 10-days-off schedule had a lower mOS than the 4 patients with the same dose in the dose-escalation part of the study. However, these patients had an unfavorable prognosis as indicated by a long median time from first diagnosis (15.1 months), a high proportion of patients with a current diagnosis of AJCC Stage IV pancreatic cancer (86%), and a high proportion of patients receiving Trabedersen as 3.sup.rd- or 4.sup.th-line treatment (64%).

[0558] Overall Survival per Patient

[0559] Combining survival data from all 35 pancreatic carcinoma patients treated during dose escalation and in the last cohort, independent of Trabedersen dose and treatment schedule, resulted in an mOS of 4.9 months [95% CI: 3.0, 6.9 months]. Generally, patients receiving Trabedersen as 2.sup.nd-line treatment had a better survival than patients receiving Trabedersen as 3.sup.rd- to 4.sup.th-line treatment: 11 of 17 patients (64.7%) who survived >5.0 months had received Trabedersen as 2nd-line treatment while only 4 of 18 patients (22.2%) who survived ≤5.0 months had received Trabedersen as 2.sup.nd-line treatment. There was no obvious influence of baseline characteristics such as age, KPS, or disease duration on survival.

[0560] Overall Survival of Patients Treated 2.sup.nd-Line with Trabedersen

[0561] In line with the finding that several patients treated 2.sup.nd-line with Trabedersen showed a favorable survival, the mOS of all patients treated with Trabedersen as 2.sup.nd-line therapy during the study independent of the dose and schedule was 8.9 months (95% CI: 2.9, 13.4). Restriction of the survival analysis to patients treated with the 140 mg/m.sup.2/day dose in the 4-days-on, 10-days-off schedule as 2nd-line treatment resulted in an mOS of 14.5 months (95% CI: 2.2, 18.9). Further sub-group analysis of patients treated with the 140 mg/m.sup.2/day dose in the 4-days-on, 10-days-off schedule as 2.sup.nd-line treatment receiving subsequent chemotherapy after the end of Trabedersen treatment resulted in an mOS of 16.9 months (95% CI: 5.5, 39.7) compared to an mOS of 2.6 months (95% CI: 2.2, 2.9) in patient who did not receive subsequent chemotherapy after the end of Trabedersen treatment. Similar analysis of similar patient population treated with 5B1—an anti CA19 mAb—did not demonstrate the observed subsequent chemotherapy effect observed for Trabedersen.

[0562] Cytokine Profile Following Treatment with Trabedersen

[0563] An analyses of the effect from Trabedersen treatment on cyto-/chemokine levels was evaluated in 12 pancreatic cancer patients treated at 140 mg/m.sup.2/day on the 4-days-on, 10-days-off treatment schedule. A panel of 31 cyto-/chemokines were evaluated from clinical plasma samples over 3 cycles of Trabedersen at 8 separate timepoints (Baseline, Cycle 1 Day 2 and Day 5, Cycle 2 Day 1, Day 2 and Day 5, Final Visit, Cycle 3 Day 5). Cyto-/chemokine levels for each patient was standardized using log 10 transformed values calculated using the mean and standard deviation of each cyto-/chemokine within patients. To investigate the effect of Trabedersen on cyto-/chemokine levels and its correlation with OS, an ANCOVA model was developed.

[0564] The ANCOVA model was constructed such that at each of the cycle and timepoints, 2 variables (cyto-/chemokine, Overall Survival as a co-variate) and an interaction term (cyto-/chemokine×Overall Survival to profile the dependent variable response for each of the cyto-/chemokines and the Overall Survival) described changes in cyto-/chemokines and OS. Timepoints at which the model exhibited significant effects were further examined for the association of the cyto-/chemokine response and OS across the 12 patients. To test whether the assumptions of the model were satisfied, Normal-Quantile plots were examined for distribution of the residuals of the model. Significance of the relationship of the cyto-/chemokine and OS was assessed from the interaction term parameters and model error determination for each of the cyto/chemokines (P-values <0.05 were deemed significant if the false discovery rate was less than 10% considering all the relationships in the interaction term).

[0565] The developed ANCOVA model explained a significant proportion of the observed data for Cycle 1 Day 2 measurements of cyto-/chemokines (R.sup.2=0.3, F59,217=1.575, P<0.0103). Other timepoints did not exhibit a significant model fit and significant relationships in the interaction term (Baseline, R.sup.2=0.271, P =0.0542 (no significant relationships in the interaction term); Cycle 1 Day 5 R.sup.2=0.26, P=0.0984; Cycle 2 Day 1 R.sup.2=0.2, P=0.892; Cycle 2 Day 2 R.sup.2=0.26, P=0.368; Cycle 2 Day 5 R.sup.2=0.400, P=0.0256 (no significant relationships in the interaction term); Final Visit R.sup.2=0.170, P=0.996; Cycle 3 Day 5 R.sup.2=0.229, P=0.463).

[0566] Survival and Antitumor Activity in Patients with Advanced Melanoma and Colorectal Cancer

[0567] Five patients each with advanced malignant melanoma and colorectal cancer were enrolled into the dose escalation part of the study.

[0568] One patient with AJCC Stage IV colorectal cancer treated in the 240 mg/m.sup.2/day cohort of the 7-day-on, 7-day-off schedule was assessed with stable disease and survived for 7.3 months. The mOS of all patients independent of dose and schedule was 3.0 months (95% CI: 2.1, 7.3)

[0569] One patient with metastatic and dacarbazine (DTIC)-resistant melanoma treated in the 330 mg/m.sup.2/day cohort of the 4-day-on, 10-day-off schedule had stable disease and survived 25.7 months after start of study treatment. Further 3 patients with Stage IV melanoma survived for 11.4, 13.8 and 18.6 months (mOS of all patients: 13.8 months). All these patients had previously been treated with DTIC and PEG-Intron, i.e. received Trabedersen as 3.sup.rd- or 4.sup.th-line treatment.

[0570] Evaluation of 14 additional patients with malignant melanoma treated with 140 mg/m.sup.2/day in the 4-days-on, 10-days-off schedule showed a mOS of 10.4 months (95% CI: 5.4, 13.5). Survival between patients treated with the 7-days-on, 7-days-off schedule and the 4-days-on, 10-days-off schedule was not significantly different (7.8 months vs 11.4 months, p=0.501). At the time of database lock and final analysis, 4 patients were still alive with Overall Survival of 25.7, 13.8, 12.2, and 10.3 months. Overall survival of these 4 patients was censored during analysis, resulting in mOS 11.4 months (95% CI: 6.5, 13.8) for all patients independent of dose and schedule. Restricting survival analysis only to patients on the 4-days-on, 10-days-off schedule showed improved mOS in patients treated with subsequent therapies (chemotherapy or immunotherapy) compared to patients without (13.5 months vs 6.0 months). There was an even distribution of treatment with immunotherapy or chemotherapy only (4 patients vs 3 patients) or a combination of both (4 patients). Further limiting analysis to patients in the last cohort (140 mg/m2/day treated 4-days-on, 10-days-off) revealed significant improvements in mOS (13.5 months vs 6.0 months, p=0.0015) when trabedersen was followed by subsequent therapy.

[0571] Two melanoma patients were treated 2.sup.nd-line with 140 mg/m.sup.2/day in the 4-days-on, 10-days-off schedule and showed a mOS of 9.5 months (95% CI: 5.4, 13.5).

Example 15—Antiviral Activity of Oncotelic Compounds vs Sudden Acute Respiratory Syndrome-Associated Coronaviruses Procedure

[0572] OT-101 (Trabedersen) and the ten antisense compounds were received from sponsor in lyophilized form. Compounds were solubilized in sterile saline to prepare 20 mg/mL stock solutions which were sterile filtered through a 0.2 μM low protein binding filter. Compounds were serially diluted using eight half-log dilutions in test medium (MEM supplemented with 2% FBS and 50 mg/mL gentamicin) so that the starting (high) test concentration was 1000 mg/mL. Each dilution was added to 5 wells of a 96-well plate with 80-100% confluent Vero 76 cells. Three wells of each dilution were infected with virus, and two wells remained uninfected as toxicity controls. Six wells were infected and untreated as virus controls, and six wells were uninfected and untreated as cell controls. SARS-CoV and SARS-CoV-2 virus suspensions were prepared to achieve the lowest possible multiplicity of infection (MOI) that would yield >80% cytopathic effect (CPE) within 5 days. M128533 was tested in parallel as a positive control. Plates were incubated at 37±2° C., 5% CO2.

[0573] On day 5 post-infection, once untreated virus control wells reached maximum CPE, plates were stained with neutral red dye for approximately 2 hours (±15 minutes). Supernatant dye was removed and wells rinsed with PBS, and the incorporated dye was extracted in 50:50 Sorensen citrate buffer/ethanol for >30 minutes and the optical density was read on a spectrophotometer at 540 nm. Optical densities were converted to percent of cell controls and normalized to the virus control, then the concentration of test compound required to inhibit CPE by 50% (EC50) was calculated by regression analysis. The concentration of compound that would cause 50% cell death in the absence of virus was similarly calculated (CC50). The selective index (SI) is the CC50 divided by EC50.

[0574] Results

[0575] Antiviral activity against SARS-CoV for each compound is shown in Table 1. Cytotoxicity was observed for TRS2 (56-76) and 5TERM (1-20) MOE and OT-101 exhibited moderate antiviral activity. The positive control compound performed as expected.

[0576] Antiviral activity against SARS-CoV-2 for each compound is shown in Table 2. Cytotoxicity was observed for TRS1 (53-72), FS (13,458-13,472), and 5TERM (1-20) MOE. High antiviral activity was observed with the following compounds: OT-101, 5TERM (1-20), TRS1 (53-72), FS (13,458-13,472), 5TERM (1-20) MOE, TRS2-2 53-72, FS-2a (13539-13558), and artemisinin. The positive control compound performed as expected.

TABLE-US-00023 TABLE 18 In vitro antiviral activity of Onctotelic compounds against SARS-CoV. EC.sub.50 CC.sub.50 SI OT-101 26 >1000 >38 5TERM (1-20) >1000 >1000 0 TRS1 (53-72) >1000 >1000 0 TRS2 (56-76) 340 >1000 >2.9 FS (13,458-13,472) >1000 >1000 0 5TERM (1-20) MOE 380 >1000 >2.6 TRS2-2 53-72 >1000 >1000 0 TRS2-2 53-72 MOE >1000 >1000 0 FS (13,458-13,274)MOE >1000 >1000 0 FS-2a (13539-13558) >1000 >1000 0 RSV1 >1000 >1000 0 M128533 (positive control) 0.16 >100 >630 [0577] Units are in mg/mL for test compounds and
M128533 EC.sub.50: 50% effective antiviral concentration [0578] CC.sub.50: 50% cytotoxic concentration of compound without virus added SI=CC.sub.50/EC.sub.50

TABLE-US-00024 TABLE 19 In vitro antiviral activity of Onctotelic compounds against SARS-CoV-2. EC.sub.50 CC.sub.50 SI OT-101 2.0 >1000 >500 5TERM (1-20) 7.1 >1000 >140 TRS1 (53-72) 7.6 720 95 TRS2 (56-76) 73 >1000 >14 FS (13,458-13,472) 5.2 430 53 5TERM (1-20) MOE 4.9 610 120 TRS2-2 53-72 1.9 >1000 >530 TRS2-2 53-72 MOE 62 >1000 >16 FS (13,458-13,274)MOE 25 >1000 >40 FS-2a (13539-13558) 17 >1000 >59 RSV1 620 >1000 >1.6 Artemisinin 0.45 61 140 M128533 (positive control) 0.012 >10 >830 [0579] Units are in mg/mL for test compounds and M128533 EC50: 50% effective antiviral concentration [0580] CC.sub.50: 50% cytotoxic concentration of compound without virus added SI=CC.sub.50/EC.sub.50

Example 16-OT-101 Treatment Suppressed IL-6

[0581] Cytokine levels of clinical plasma samples of pancreatic cancer patients of the P001 study of OT-101 in advanced solid tumor patients were measured using the ImmunoSignal cytokine storm assay developed by Eurofins. [0582] Nine patients with elevated IL-6 were examined further. More than 50% of these patients (6 of 9) exhibited significant reduction in IL-6 level following 1st cycle of dosing with OT-101. Of significant are pts 1041 and 1051 who exhibited a rebound following treatment stop on cycle 1 which decreased again on subsequent cycle 2. All patients exhibited elevated IL-6 on disease progression.
Various modifications of the invention, in addition to those described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference cited in the present application, including all patent, patent applications and publications, is incorporated herein by reference in its entirety.

REFERENCES

[0583] Schuftan C. A story to be shared: the successful fight against malaria in Vietnam. WHO WPRO and the global Roll Back Malaria Programme, 2000 https://www.panna.org/sites/default/files/vietnam Malara Study 20 071106.

[0584] Li Q, Weina P J. Severe embryotoxicity of artemisinin derivatives in experimental animals, but possibly safe in pregnant women. Molecules. 2009; 15(1):40-57.

[0585] Kovacs S D, Rijken M J, Stergachis A. Treating severe malaria in pregnancy: a review of the evidence. Drug Saf. 2015; 38(2):165-181.

[0586] Nosten F, McGready R, d'Alessandro U, et al. Antimalarial drugs in pregnancy: a review Curr Drug Saf. 2006; 1(1):1-15.

[0587] Clark R L. Embryotoxicity of the artemisinin antimalarials and potential consequences for use in women in the first trimester. Reprod Toxicol. 2009; 28(3):285-296.

[0588] Guidelines for the Treatment of Malaria. 2nd ed. Geneva: World Health Organization; 2010.

[0589] Visser B J, van Vugt M, Grobusch M P. Malaria: an update on current chemotherapy. Expert Opin Pharmacother. 2014; 15(15):2219-2254.

[0590] McGready R, Lee S J, Wiladphaingern J, et al. Adverse effects of falciparum and vivax malaria and the safety of antimalarial treatment in early pregnancy: a population-based study. Lancet Infect Dis. 2012; 12(5):388-396.

[0591] Savage R L, Hill G R, Barnes J, Kenyon S H, Tatley M V. Suspected Hepatotoxicity With a Supercritical Carbon Dioxide Extract of Artemisia annua in Grapeseed Oil Used in New Zealand. Front Pharmacol. 2019; 10:1448.

[0592] Barnes J. Pharmacovigilance of herbal medicines: a UK perspective. Drug Saf. 2003; 26(12):829-851.

[0593] Uppsala Monitoring Centre. VigiBase: Uppsala Monitoring Centre. 2019. Available from: https://www.who-umc.org/vigibase/vigibase/.

[0594] Uppsala Monitoring Centre. VigiAccess: Uppsala Monitoring Centre. 2019. Available from: http://www.vigiaccess.org/.

[0595] Centers for Disease Control and Prevention (CDC). Hepatitis temporally associated with an herbal supplement containing artemisinin—Washington, 2008. MMWR Morb Mortal Wkly Rep. 2009; 58(31):854-856.

[0596] Kumar S. Cholestatic liver injury secondary to artemisinin. Hepatology. 2015; 62(3):973-974.

[0597] US Food and Drug Administration. “Pharmacy Compounding Advisory Committee,” in Compounders under section 503A of the FD&C act: quality, standards and FDA findings., 2017; 31-43.

[0598] Stebbings S, Beattie E, McNamara D, Hunt S. A pilot randomized, placebo-controlled clinical trial to investigate the efficacy and safety of an extract of Artemisia annua administered over 12 weeks, for managing pain, stiffness, and functional limitation associated with osteoarthritis of the hip and knee. Clin Rheumatol. 2016; 35(7):1829-1836.

[0599] Hunt S, Stebbings S, McNamara D. An open-label six-month extension study to investigate the safety and efficacy of an extract of Artemisia annua for managing pain, stiffness and functional limitation associated with osteoarthritis of the hip and knee. N Z Med J. 2016; 129(1444):97-102.

[0600] Heinrich M., Barnes J., Gibbons S., Prieto J., Williamson E. Methods in natural product analytical chemistry. In Fundamentals of Pharmacognosy and Phytotherapy, 3rd edition. Edinburgh: Elsevier. 2018; 106.

[0601] Zhang X, Zhao Y, Guo L, Qiu Z, Huang L, Qu X. Differences in chemical constituents of Artemisia annua L from different geographical regions in China. PLoS One. 2017; 12(9):e0183047.

[0602] DerMarderosian A., Beutler J. A., (eds). The Review of Natural Products. 8th ed. St. Louis, Mo.: Clinical Drug Information, LLC. 2014.

[0603] Iqbal S, Younas U, Chan K W, Zia-Ul-Haq M, Ismail M. Chemical composition of Artemisia annua L. leaves and antioxidant potential of extracts as a function of extraction solvents. Molecules. 2012; 17(5):6020-6032.

[0604] Promisia. Arthrem®. 2019. Available from: http://arthrem.co.nz/Arthrem/Product.

[0605] GO Healthy. GO Arthri Remedy 1-A-Day. 2019. Available from: https://www.healthporter.co.nz/go-healthy-go-arthri-remedy-1-a-day-60-capsules.

[0606] Sehailia M, Chemat S. In-silico Studies of Antimalarial-agent Artemisinin and Derivatives Portray More Potent Binding to Lys353 and Lys31-Binding Hotspots of SARS-CoV-2 Spike Protein than Hydroxychloroquine: Potential Repurposing of Artenimol for COVID-19. ChemRxiv. 2020. Preprint.

[0607] Alazmi M, Motwalli O. Molecular basis for drug repurposing to study the interface of the S protein in SARS-CoV-2 and human ACE2 through docking, characterization, and molecular dynamics for natural drug candidates. J Mol Model. 2020; 26:338.

[0608] Cao Y, Feng Y H, Gao L W, et al. Artemisinin enhances the anti-tumor immune response in 4T1 breast cancer cells in vitro and in vivo. Int Immunopharmacol. 2019; 70:110-116.

[0609] Wang M, Cao R, Zhang L, et al. Remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro. Cell Res. 2020; 30(3):269-271.

[0610] Cao R, Hu H, Li Y, et al. Anti-SARS-CoV-2 Potential of Artemisinins In Vitro. ACS Infect Dis. 2020; 6(9):2524-2531.

[0611] Gilmore K, Zhou Y, Ramirez S, et al. In vitro efficacy of Artemisinin-based treatments against SARS-CoV-2. bioRxiv. 2020. 10.05.326637.

[0612] Li G, Yuan M, Li H, et al. Safety and efficacy of artemisinin-piperaquine for treatment of COVID-19: an open-label, non-randomised and controlled trial. Int J Antimicrob Agents. 2020; 106216.

[0613] MGC Pharmaceutical Ltd. ArtemiC™ Phase II Clinical Trial Results on COVID-19 patients confirm 100% of treatment group successfully met primary and secondary endpoints. Press Release. 14 Dec. 2020.

[0614] Liu, J. et al. Hydroxychloroquine, a less toxic derivative of chloroquine, is effective in inhibiting SARS-CoV-2 infection in vitro. Cell. Discov. 6, 16 (2020).

[0615] Yao, X. et al. In Vitro antiviral activity and projection of optimized dosing design of hydroxychloroquine for the treatment of severe acute respiratory syndrome coronavirus 2 (SARSCoV-2). Clin. Infect. Dis., (2020) doi: 10.1093/cid/ciaa237.

[0616] Al-Kofahi M. et al. Finding the dose for hydroxychloroquine prophylaxis for COVID-19; the desperate search for effectiveness. Clinical Pharmacology & Therapeutics. (2020) (In press).https://doi.org/10.1002/cpt.1874.

[0617] CHEN J. et al. A pilot study of hydroxychloroquine in treatment of patients with common coronavirus disease-19 (COVID-19). J Zhejiang Univ (Med Sci) 49, 0-(2020).

[0618] Gautret, P. et al. Hydroxychloroquine and azithromycin as a treatment of COVID-19: results of an open-label non-randomized clinical trial. Int. J. Antimicrob. Agents. 105949 (2020) doi:10.1016/j.ijantimicag.2020.105949.

[0619] Wang M. et al. Remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro. Cell Res 2020; 30:269-71.

[0620] Wang Y. et al. Remdesivir in adults with severe COVID-19: a randomised, double-blind, placebo-controlled, multicentre trial. Lancet (2020) https://doi.org/10.1016/S0140-6736(20)31022-9

[0621] Zhou F et al. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study. Lancet 2020; 395:1054-62 9. Hamacher J, Lucas R, Lijnen H R, Buschke S, Dunant Y, Wendel A, et al. Tumor necrosis factoralpha and angiostatin are mediators of endothelial cytotoxicity in bronchoalveolar lavages of

patients with acute respiratory distress syndrome. Am J Respir Crit Care Med (2002) 166:651-6. doi:10.1164/rccm.2109004

[0622] Wagener B M, Roux J, Caries M, Pittet J F. Synergistic inhibition of beta2-adrenergic receptormediated alveolar epithelial fluid transport by interleukin-8 and transforming growth factor-beta. Anesthesiology (2015)122:1084-92. doi:10.1097/ALN.0000000000000595

[0623] Fahy R J, Lichtenberger F, McKeegan C B, Nuovo G J, Marsh C B, Wewers M D. The acute respiratory distress syndrome: a role for transforming growth factor-beta 1. Am J Respir Cell Mol Biol (2003) 28:499-503. doi:10.1165/rcmb.2002-0092OC.

[0624] Wakefield L M, Letterio J J, Chen T, Danielpour D, Allison R S, Pal L H, et al. Transforming growth factor-beta1 circulates in normal human plasma and is unchanged in advanced metastatic breast cancer. Clin Cancer Res (1995)1:129-36.

[0625] Schwartze J T, Becker S, Sakkas E, Wujak L A, Niess G, Usemann J, et al. Glucocorticoids recruit Tgfbr3 and Smad1 to shift transforming growth factor-beta signaling from the Tgfbr1/Smad2/3 axis to the Acvrl1/Smad1 axis in lung fibroblasts. J Biol Chem (2014) 289:3262-75. doi:10.1074/jbc.M113.541052.

[0626] Matsuki K, Hathaway C K, Lawrence M G, Smithies O, Kakoki M. The role of transforming growth factor betal in the regulation of blood pressure. Curr Hypertens Rev (2014) 10:223-38. doi:10.2174/157340211004150319123313.

[0627] Kaminski N, Allard J D, Pittet J F, Zuo F, Griffiths M J, Morris D, et al. Global analysis of gene expression in pulmonary fibrosis reveals distinct programs regulating lung inflammation and fibrosis. Proc Natl Acad Sci U S A (2000) 97:1778-83. doi:10.1073/pnas.97.4.1778.

[0628] Annes J P, Chen Y, Munger J S, Rifkin D B. Integrin alphaVbeta6-mediated activation of latent TGF-beta requires the latent TGF-beta binding protein-1. J Cell Biol (2004) 165:723-34. doi: 10.1083/jcb.200312172.

[0629] Annes J P, Rifkin D B, Munger J S. The integrin alphaVbeta6 binds and activates latent TGFbeta3.FEBS Lett (2002) 511:65-8. doi:10.1016/S0014-5793(01)03280-X.

[0630] Munger J S, Huang X, Kawakatsu H, Griffiths M J, Dalton S L, Wu J, et al. The integrin alpha v beta 6 binds and activates latent TGF beta 1: a mechanism for regulating pulmonary inflammation and fibrosis. Cell (1999) 96:319-28. doi:10.1016/S0092-8674(00)80545-0.

[0631] Breuss J M, Gallo J, DeLisser H M, Klimanskaya I V, Folkesson H G, Pittet J F, et al. Expression of the beta 6 integrin subunit in development, neoplasia and tissue repair suggests a role in epithelial remodeling. J Cell Sci (1995) 108(Pt 6):2241-51.

[0632] Barcellos-Hoff M H, Dix T A. Redox-mediated activation of latent transforming growth factorbeta 1. Mol Endocrinol (1996) 10:1077-83. doi:10.1210/me.10.9.1077.

[0633] Frank J, Roux J, Kawakatsu H, Su G, Dagenais A, Berthiaume Y, et al. Transforming growth factor-betal decreases expression of the epithelial sodium channel alphaENaC and alveolar epithelial vectorial sodium and fluid transport via an ERK1/2-dependent mechanism. J Biol Chem (2003) 278:43939-50. doi:10.1074/jbc.M304882200.

[0634] Pittet J F, Griffiths M J, Geiser T, Kaminski N, Dalton S L, Huang X, et al. TGF-beta is a critical mediator of acute lung injury. J Clin Invest (2001) 107:1537-44. doi:10.1172/JCI11963.

[0635] Peters D M, Vadasz I, Wujak L, Wygrecka M, Olschewski A, Becker C, et al. TGF-beta directs trafficking of the epithelial sodium channel ENaC which has implications for ion and fluid transport in acute lung injury. Proc Natl Acad Sci USA (2014) 111:E374-83. doi:10.1073/pnas.1306798111.

[0636] Frank J A, Matthay M A. TGF-beta and lung fluid balance in ARDS. Proc Natl Acad Sci USA(2014) 111:885-6. doi:10.1073/pnas.1322478111. [0637] Staub N C. Pulmonary edema: physiologic approaches to management. Chest. 1978; 74(5):559-564.

[0638] Prewitt R M, McCarthy J, Wood L D. Treatment of acute low pressure pulmonary edema in dogs:relative effects of hydrostatic and oncotic pressure, nitroprusside, and positive end-expiratory pressure. J Clin Invest. 1981; 67(2):409-418.

[0639] Wiedemann H P, et al. Comparison of two fluid management strategies in acute lung injury. N Engl J Med. 2006; 354(24):2564-2575.

[0640] Wheeler A P, et al. Pulmonary-artery versus central venous catheter to guide treatment of acute lung injury. N Engl J Med. 2006; 354(21):2213-2224.

[0641] Pittet J F, Griffiths M J, Geiser T, Kaminski N, Dalton S L, Huang X, et al. TGF-beta is a critical mediator of acute lung injury. J Clin Invest (2001) 107(12):1537-44. doi:10.1172/jci11963.

[0642] Hu X, Huang X. Alleviation of Inflammatory Response of Pulmonary Fibrosis in Acute Respiratory Distress Syndrome by Puerarin via Transforming Growth Factor (TGF-b1). Med Sci Monit, 2019; 25: 6523-6531.

[0643] Mizutani T, Fukushi S, Iizuka D, Inanami O, Kuwabara M, Takashima H, Yanagawa H, Saijo M, Kurane I, Morikawa S. Inhibition of cell proliferation by SARS-CoV infection in Vero E6 cells.FEMS Immunol Med Microbiol. 2006; 46(2):236-243.

[0644] Surjit M, Liu B, Chow V T, Lal S K. The nucleocapsid protein of severe acute respiratory syndrome-coronavirus inhibits the activity of cyclin-cyclin-dependent kinase complex and blocks S phase progression in mammalian cells. J. Biol. Chem. 2006; 281(16):10669-10681.

[0645] Dove B, Brooks G, Bicknell K, Wurm T, Hiscox J A. Cell cycle perturbations induced by infection with the coronavirus infectious bronchitis virus and their effect on virus replication. J. of Virology. 2006; 80(8): 4147-4156.

[0646] Huang K J, Su I J, Theron M, Wu Y C, Lai S K, Liu C C, Lei H Y. An interferon-gamma related cytokine storm in SARS patients. J. Med. Virol. 2005; 75(2):185-194.

[0647] He L, Ding Y, Zhang Q, Che X, He Y, Shen H, Wang H, Li Z, Zhao L, Geng J, Deng Y, Yang L, Li J, Cai J, Qiu L, Wen K, Xu X, Jiang S. Expression of elevated levels of pro-inflammatory cytokines in SARS-CoV infected ACE2+cells in SARS patients: relation to the acute lung injury and pathogenesis of SARS. J. Pathol. 2006; 210(3):288-297.

[0648] Zhao X, Nicholls J M, Chen Y G. Severe acute respiratory syndrome-associated coronavirus nucleocapsid protein interacts with Smad3 and modulates transforming growth factor-beta signalling. J. Biol. Chem. 2008; 283(6):3272-3280.

[0649] Li S W, Yang T C, Wan L, Lin Y J, Tsai F J, Lai C C, Lin C W. Correlation between TGF-β1 expression and proteomic profiling induced by severe acute respiratory syndrome coronavirus papain-like protease. Proteomics. 2012; 12(21):3193-3205.

[0650] Wang C Y, Lu C Y, Li S W, Lai C C, Hua C H, Huang S H, Lin Y J, Hour M J, Lin C W. SAR coronavirus papain-like protease up-regulates the collagen expression through non-Samd TGF-β1 signaling. Virus Research. 2017; 235:58-66.

[0651] Li S W, Wang C Y, Jou Y J, Yang T C, Huang S H, Wan L, Lin Y J, Lin C W. SARS coronavirus papain-like protease induces Egr-1-dependent up-regulation of TGF-β1 via ROS/p38 MAPK/STAT3 pathway. Scientific Reports. 2016; 6:25754.

[0652] Pang B S, Wang Z, Zhang L M, Tong Z H, Xu L L, Huang X X, Guo W J, Zhu M, Wang C, Li X W et al (2003) Dynamic changes in blood cytokine levels as clinical indicators in severe acute respiratory syndrome. Chin Med J 116:1283-1287.

[0653] Baas T, Taubenberger J K, Chong P Y, Chui P, Katze M G (2006) SARS-CoV virus-host interactions and comparative etiologies of acute respiratory distress syndrome as determined by transcriptional and cytokine profiling of formalin-fixed paraffin-embedded tissues. J Interferon Cytokine Res 26:309-317.

[0654] Chen X. et al. Detectable serum SARS-CoV-2 viral load (RNAaemia) is closely associated with drastically elevated interleukin 6 (IL-6) level in critically ill COVID-19 patients. medRxiv preprint doi: htts://doi.org/10.1101/2020.02.29.20029520.

[0655] Cao Y. et al. Artemisinin enhances the anti-tumor immune response in 4T1 breast cancer cells in vitro and in vivo. Int. Immunopharmacology 70 (2019) 110-116.

[0656] Zheng S., J. Yang, X. Hu, M. Li, Q. Wang, R. C. A. Dancer, D. Parekh, F. Gao-Smith, D. R.

[0657] Sazani P, Kole R. Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing. J Clin Invest. 2003; 112(4):481-486.

[0658] Juliano R, Alam M R, Dixit V, Kang H. Mechanisms and strategies for effective delivery of antisense and siRNA oligonucleotides. Nucleic Acids Res. 2008; 36(12):4158-4171.

[0659] Chan J, Lim S, Wong W S. Antisense oligonucleotides: from design to therapeutic applications. Clin Exp Pharmacol Physiol. 2006; 33(5-6):533-540.

[0660] Kurreck J. Antisense technologies. Improvement through novel chemical modifications. Eur J Biochem. 2003; 270(8):1628-1644.

[0661] Crooke S T. Progress in antisense technology. Annu Rev Med. 2004; 55:61-95.

[0662] Ratmeyer L, Vinayak R, Zhong Y Y, Zon G, Wilson W D. Sequence specific thermodynamic and structural properties for DNA.RNA duplexes. Biochemistry. 1994; 33(17):5298-5304.

[0663] Tu G C, Cao Q N, Zhou F, Israel Y. Tetranucleotide GGGA motif in primary RNA transcripts. Novel target site for antisense design. J Biol Chem. 1998; 273(39): 25125-25131.

[0664] Benimetskaya L, Berton M, Kolbanovsky A, Benimetsky S, Stein C A. Formation of a G-tetrad and higher order structures correlates with biological activity of the RelA (NF-kappaB p65) ‘antisense’ oligodeoxynucleotide. Nucleic Acids Res. 1997; 25(13): 2648-2656.

[0665] Wang W, Chen H J, Sun J, Benimetskaya L, Schwartz A, Cannon P, Stein C A, Rabbani L E. A comparison of guanosine-quartet inhibitory effects versus cytidine homopolymer inhibitory effects on rat neointimal formation. Antisense Nucleic Acid Drug Dev. 1998; 8(3):227-236.

[0666] Williamson J R, Raghuraman M K, Cech T R. Monovalent cation-induced structure of telomeric DNA: the G-quartet model. Cell. 1989; 59(5):871-880.

[0667] Schultze P, Macaya R F, Feigon J. Three-dimensional solution structure of the thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG). J Mol Biol. 1994; 235(5): 1532-1547.

[0668] Chou S H, Zhu L, Reid B R. The unusual structure of the human centromere (GGA)2 motif. Unpaired guanosine residues stacked between sheared G.A pairs. J Mol Biol. 1994; 244(3): 259-268.

[0669] Griffin L C, Toole J J, Leung L L. The discovery and characterization of a novel nucleotide-based thrombin inhibitor. Gene. 1993; 137(1):25-31.

[0670] Wyatt J R, Vickers T A, Roberson J L, Buckheit R W Jr, Klimkait T, DeBaets E, Davis P W, Rayner B, Imbach J L, Ecker D J. Combinatorially selected guanosine-quartet structure is a potent inhibitor of human immunodeficiency virus envelope-mediated cell fusion. Proc Natl Acad Sci USA. 1994; 91(4):1356-1360.

[0671] Tam R C, Lin C J, Lim C, Pai B, Stoisavljevic V. Inhibition of CD28 expression by oligonucleotide decoys to the regulatory element in exon 1 of the CD28 gene. J Immunol. 1999; 163(8): 4292-4299.

[0672] Bates P J, Kahlon J B, Thomas S D, Trent J O, Miller D M. Antiproliferative activity of G-rich oligonucleotides correlates with protein binding. J Biol Chem. 1999; 274(37): 26369-26377.

[0673] Murchie A I, Lilley D M. Tetraplex folding of telomere sequences and the inclusion of adenine bases. EMBO J. 1994; 13(4): 993-1001.

[0674] Olivas W M, Maher L J 3rd. Overcoming potassium-mediated triplex inhibition. Nucleic Acids Res. 1995; 23(11):1936-1941.

[0675] Stein C A, Tonkinson J L, Yakubov L. Phosphorothioate oligodeoxynucleotides—anti-sense inhibitors of gene expression? Pharmacol Ther. 1991; 52(3):365-384.

[0676] Crooke S T, Lebleu B, eds. Antisense Research and Applications. Boca Raton Fla.: CRC Press. 1993.

[0677] Srinivasan S K, Iversen P. Review of in vivo pharmacokinetics and toxicology of phosphorothioate oligonucleotides. J Clin Lab Anal. 1995; 9(2):129-137.

[0678] Bonham M A, Brown S, Boyd A L, Brown P H, Bruckenstein D A, Hanvey J C, Thomson S A, Pipe A, Hassman F, Bisi J E, Froehler B C, Matteucci M D, Wagner R W, Nobel S A, Babiss L E. An assessment of the antisense properties of RNase H-competent and steric-blocking oligomers. Nucleic Acids Res. 1995; 23(7):1197-1203.

[0679] Yaida Y, Nowak T S Jr. Distribution of phosphodiester and phosphorothioate oligonucleotides in rat brain after intraventricular and intrahippocampal administration determined by in situ hybridization. Regul Pept. 1995; 59(2):193-199.

[0680] Crooke S T, Lemonidis K M, Neilson L, Griffey R, Lesnik E A, Monia B P. Kinetic characteristics of Escherichia coli RNase H1: cleavage of various antisense oligonucleotide-RNA duplexes. Biochem J. 1995; 312(Pt 2):599-608.

[0681] Gura T. Antisense has growing pains. Science. 1995; 270(5236):575-577.

[0682] Krieg A M, Stein C A. Phosphorothioate oligodeoxynucleotides: antisense or anti-protein? Antisense Res Dev. 1995; 5(4):241.

[0683] Krieg A M, Yi A K, Hartmann G. Mechanisms and therapeutic applications of immune stimulatory cpG DNA. Pharmacol Ther. 1999; 84(2):113-120.

[0684] Lipford G B, Bauer M, Blank C, Reiter R, Wagner H, Heeg K. CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants. Eur J Immunol. 1997; 27(9):2340-2344.

[0685] Sun S, Zhang X, Tough D F, Sprent J. Type I interferon-mediated stimulation of T cells by CpG DNA. J Exp Med. 1998; 188(12):2335-2342.

[0686] Bendigs S, Salzer U, Lipford G B, Wagner H, Heeg K. CpG-oligodeoxynucleotides co-stimulate primary T cells in the absence of antigen-presenting cells. Eur J Immunol. 1999; 29(4): 1209-1218.

[0687] Jakob T, Walker P S, Krieg A M, von Stebut E, Udey M C, Vogel J C. Bacterial DNA and CpG-containing oligodeoxynucleotides activate cutaneous dendritic cells and induce IL-12 production: implications for the augmentation of Thl responses. Int Arch Allergy Immunol. 1999; 118(2-4):457-461.

[0688] Krieg A M, Matson S, Fisher E. Oligodeoxynucleotide modifications determine the magnitude of B cell stimulation by CpG motifs. Antisense Nucleic Acid Drug Dev. 1996; 6(2): 133-139.