COMPOSITION FOR ENHANCING IMMUNITY INCLUDING GINSENOSIDE F1 AS AN ACTIVE INGREDIENT

20170368084 · 2017-12-28

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to composition for enhancing immunity, comprising ginsenoside F1 as an active ingredient. Specifically, the composition according to the present invention promotes degranulation activity and cell-killing activity of natural killer cells, and increases expressions of cell-killing factors, thereby being effectively used as an immune enhancer.

    Claims

    1. A method for enhancing immunity, comprising administering composition for enhancing immunity comprising ginsenoside F1 as an active ingredient.

    2. The method of claim 1, wherein the immunity is innate immunity.

    3. The method of claim 1, where in composition further comprises ginsenoside Rg3.

    4. The method of claim 3, wherein the composition comprises ginsenoside F1 and ginsenoside Rg3 at a weight ratio of 1:0.1 to 1:1.

    5. The method of claim 1, wherein the composition increases activities of innate immune cells.

    6. The method of claim 5, wherein the innate immune cells are any one selected from the group consisting of natural killer cells (NK cells), immune cells, peripheral blood mononuclear cells(PBMCs), and dendritic cells.

    7. The method of claim 1, wherein the composition promotes degranulation activity of natural killer cells(NK cells).

    8. The method of claim 1, wherein the composition promotes cell-killing activity of natural killer cells(NK cells).

    9. The method of claim 1, wherein the composition increases expressions of cell-killing factors of natural killer cells.

    10. The method of claim 9, wherein the cell-killing factor is perforin or granzyme.

    11. A method of producing perforin or granzyme, comprising processing composition for producing perforin or granzyme comprising ginsenoside F1 and natural killer cells.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0063] FIG. 1 is a schematic illustration showing a degranulation phenomenon of natural killer cells.

    [0064] FIG. 2a is a graph showing a comparison of CD107a expression levels in peripheral blood mononuclear cells(PBMCs) cultured without a target cell or co-cultured with the target cell.

    [0065] FIG. 2b is a graph showing CD107a expression in peripheral blood mononuclear cells(PBMCs) treated with ginsenoside Rg3, Rh2, F1 or Rg1.

    [0066] FIG. 2c is a graph showing a comparison of CD107a expression levels in peripheral blood mononuclear cells (PBMCs) treated with ginsenoside Rg3, Rh2, F1 or Rg1.

    [0067] FIG. 3a is a graph showing cytolysis of target cells upon treatment of natural killer cells with ginsenoside F1.

    [0068] FIG. 3b is a graph showing cytolysis of target cells upon treatment of natural killer cells with ginsenoside Rg3.

    [0069] FIG. 4a is a graph showing cytolysis of target cells upon treatment of primary natural killer cells with ginsenoside F1.

    [0070] FIG. 4b is a graph showing cytolysis of target cells upon treatment of primary natural killer cells with ginsenoside Rg3.

    [0071] FIG. 4c is a graph showing cytolysis of target cells upon treatment of primary natural killer cells with ginsenoside

    [0072] FIG. 5 is a graph showing increased calcium flux in natural killer cells by ginsenoside F1.

    [0073] FIG. 6a is a graph showing a comparison of perforin(PRF1) expression levels of natural killer cells by treatment with ginsenoside F1 or ginsenoside Rg1.

    [0074] FIG. 6b is a graph showing a comparison of granzyme B (GzmB) expression levels of natural killer cells by treatment with ginsenoside F1or ginsenoside Rg1.

    [0075] FIG. 7 is a graph showing a comparison of selective reduction rates of RMA-S in mice which were administered with RMA-S and RMA cells via intraperitoneal injection, after pretreatment of ginsenoside F1 or ginsenoside Rg1.

    DETAILED DESCRIPTION OF THE INVENTION

    [0076] Hereinafter, the constitution and effects of the present invention will be described in more detail with reference to Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.

    EXAMPLE 1

    Effect of Ginsenoside F1 on Degranulation Activity of Innate Immune Cells

    [0077] Effect of ginsenoside F1 on degranulation activity of innate immune cells was measured by fluorescence activated cell sorter(FACS).

    [0078] In detail, peripheral blood mononuclear cells(PBMCs) separated from the blood and purified natural killer cells were pretreated with ginsenoside, and then co-cultured with K562 cell or 721.221 cell which is a target cell of the above cells, respectively. Thereafter, the surfaces of the peripheral blood mononuclear cells and the natural killer cells were stained with fluorochrome-conjugated anti-CD3, anti-CD56, and anti-CD107a antibodies. Meanwhile, degranulation activity of peripheral blood mononuclear cells or natural killer cells is proportional to CD107a expression on cell surface, as shown in FIG. 1. Therefore, CD107a expression levels of the peripheral blood mononuclear cells and the natural killer cells were measured by a FACS machine.

    [0079] As a result, the peripheral blood mononuclear cells cultured without the target cell showed little CD107a expression, whereas the peripheral blood mononuclear cells co-cultured with the target cell showed CD107a expression(FIG. 2a). Further, ginsenoside-treated groups showed CD107a overexpression, compared to a DMSO(vehicle)-treated group, even though co-cultured with the target cells(FIG. 2b).

    [0080] Specifically, when co-culture was conducted using a chronic myelogenous leukemia cell line, K562 or a human B cell, 721.221 as a target cell, all ginsenoside-treated groups showed increased CD1.07a expression, compared to the DMSO(vehicle)-treated group, and a ginsenoside F1-treated group showed the highest CD107a expression(FIGS. 2b and 2c). Accordingly, it was confirmed that ginsenoside F1 and Rg3 showed excellent, immune-enhancing effects, and in particular, ginsenoside F1 showed the most excellent immune-enhancing effects.

    EXAMPLE 2

    Effect of Ginsenoside F1 on Cell-killing Activity of Natural Killer Cells

    [0081] In order to examine whether ginsenoside F1 increases cell-killing activity of natural killer cells, cytolysis of target cells was measured.

    [0082] In detail, peripheral blood mononuclear cells(PBMCs) separated from the blood and purified natural killer cells were pretreated with ginsenoside F1 or Rg3, and then co-cultured with K562 cell or 721.221 cell which is an europium-labeled target cells. The natural killer cell and the target cell were mixed at a ratio of 5:1, 10:1, 20:1. and 40:1, followed by culture. Meanwhile, intensity of fluorescence emitted from the target cell is proportional to cell-killing activity of natural killer cell. Therefore, a culture medium was separated by centrifugation, and then fluorescence emitted by cell lysis of the target cell was measured by using a microplate reader.

    [0083] As a result, all ginsenoside F1 or Rg3-treated groups at the above culture ratios showed high cytolysis of target cells, compared to a DMSO-treated group(FIGS. 3a and 3b). Accordingly, it was confirmed that ginsenoside F1 and Rg3 increase cell-killing activity of natural killer cells.

    EXAMPLE 3

    Effect of Ginsenoside F1 on Cell-killing Activity of Primary Natural Killer Cells

    EXAMPLE 3-1

    Separation of Primary Natural Killer Cells

    [0084] Blood(50 ml) of a healthy donor was collected in a vacutainer cell preparation tube(BD Biosciences) containing sodium heparin. Thereafter, the blood was percoll-gradient centrifuged to recover a buffy coat which is a white thin layer consisted of platelets and white blood cells. Peripheral blood mononuclear cells obtained by washing this buffy coat with PBS were separated by using a human NK cell negative selection kit(Miltenyl Biotech). Part of the separated natural killer cells and a FACS buffer were mixed, and then purity of natural killer cells(CD3.sup.−/CD16.sup.+) and the number and ratio of CD56.sup.dim/CD16.sup.+, CD56.sup.bright/CD16.sup.−, and CD56.sup.bright/CD16.sup.+ were measured by using a FACS machine and fluorochrome-conjugated anti-CD3, anti-CD56, and anti-CD107a antibodies. Natural killer cells with purity of 95% or more were used in experiments.

    EXAMPLE 3-2

    Cell-killing Activity of Primary Natural Killer Cells

    [0085] The primary natural killer cells separated by the method of Example 3-1 were used to examine whether ginsenoside F1 increases cell-killing activity of primary natural killer cells, in the same manner as in Example 2.

    [0086] As a result, ginsenoside F1, Rg3, and Rg1-treated group showed high cytolysis of target cells, compared to a DMSO-treated group(FIGS. 4a to 4c). In particular, the ginsenoside F1-treated group showed remarkably excellent cytolysis, compared to the ginsenoside Rg3 and Rg1-treated group. Accordingly, it was confirmed that ginsenoside F1 and Rg3 show excellent cell-killing activity of primary natural killer cells, and ginsenoside F1 shows the most excellent effect.

    EXAMPLE 4

    Calcium Flux Assay by Treatment with Ginsenoside F1

    [0087] To investigate a natural killer cell-based immune enhancement mechanism of ginsenoside F1 calcium flux assay of individual cells was performed by live cell imaging using confocal microscopy.

    [0088] In detail, primary natural killer cells were purified (>97%) by the method of Example 3-1, and then treated with ginsenoside F1 or Rg1. For 30 seconds, a basal calcium level was measured, and then natural killer cells were activated using a combination of NKG2D antibody and 2B4 antibody, followed by calcium flux assay by confocal live cell imaging.

    [0089] As a result, it was confirmed that ginsenoside F1 more effectively promotes calcium flux of natural killer cells, compared to ginsenoside Rg1(FIG. 5). Accordingly, it was confirmed that ginsenoside F1 exhibits excellent immune-enhancing effects, compared to ginsenoside Rg1.

    EXAMPLE 5

    Analysis of Cell-killing Factors

    [0090] To investigate a cell-killing activation mechanism of natural killer cells by ginsenoside F1, primary natural killer cells purified by the method of Example 3-1 were treated with ginsenoside F1 or Rg1. 12 hours later, total RNA was isolated, and then expressions of perforin and granzyme B which are representative cell-killing factors of natural killer cells were analyzed by quantitative RT-PCR.

    [0091] In detail, total RNA was isolated from natural killer cells using a TRizol reagent, and cDNA was synthesized using primers of unknown sequences, which were manufactured by Toyobo, and reverse transcriptase. Thereafter, quantitative RT-PCR was performed using primers of the following Table 1 and SYBR PCR Master Mix(Toyobo).

    TABLE-US-00001 TABLE 1 Type of primer Nucleotide sequence(5′-3′) Perforin Forward CGCCTACCTCAGGCTTATCTC (SEQ ID NO: 1) Reverse CCTCGACAGTCAGGCAGTC (SEQ ID NO: 2) Granzyme Forward CCCTGGGAAAACACTCACACA B (SEQ ID NO: 3) Reverse CACAACTCAATGGTACTGT (SEQ ID NO: 4)

    [0092] PCR conditions are the same as in the following Table 2.

    TABLE-US-00002 TABLE 2 PCR conditions Temperature (° C.) Time 1 cycle 95  10 min 40 cycle Denaturation 95 30 sec Annealing 60 30 sec Extension 72 30 sec

    [0093] As a result, all ginsenoside-treated groups showed increased expressions of perforin and granzyme B. Specifically, a ginsenoside F1-treated group showed about 2 times higher expression level of perforin, compared to a non-treated group, and also a high expression level of perforin, compared to a ginsenoside Rg1-treated group(FIG. 6a). Further, the ginsenoside F1-treated group showed about 1.5 times higher expression level of granzyme B, compared to the non-treated group, and also a high expression level of granzyme B, compared to a ginsenoside Rg1-treated group(FIG. 6b). Accordingly, it was confirmed that ginsenoside F1 exhibits excellent immune enhancing effects, compared to ginsenoside Rg1.

    EXAMPLE 6

    In Vivo Natural Killer Cell-Based Immune Enhancement Activity of Ginsenoside

    [0094] To evaluate effectiveness of in vivo cell-killing activity of ginsenoside F1 natural killer cell-sensitive RMA-S(MHC class I.sup.−) and natural killer cell-resistant RMA(MHC class I.sup.+) target cell systems were used.

    [0095] In detail, mice were pretreated with ginsenoside F1 at a dose of 25 mg/kg. A mixture of RMA-S/RMA cells, each cell labeled with different fluorescence intensity, was administered into the mice via intraperitoneal injection. 8 hours later, a selective reduction rate of RMA-S by natural killer cells was analyzed by FACS.

    [0096] As a result, all ginsenoside-treated groups showed selectively reductions of RMA-S. In detail, a ginsenoside F1-treated group showed about 70% or more removability, whereas a non-treated group vehicle) showed about 35% removability, indicating that the RMA-S reduction effect of the ginsenoside F1-treated group was 2 times higher than that of the non-treated group. It was also confirmed that a group treated with an equal amount of ginsenoside showed about 52% removability (FIG. 7). Accordingly, it was confirmed that ginsenoside F1 exhibits excellent immune enhancing effects in vivo, and in particular, ginsenoside F1 exhibits higher immune enhancing effects, compared to ginsenoside Rg1.

    [0097] Based on the above description, it will be understood by those skilled in the art that the present invention may be implemented in a different specific form without changing the technical ideas or essential characteristics thereof. Therefore, it should be understood that the above embodiment is not limitative, but illustrative in all aspects. The scope of the invention is defined by the appended claims rather than by the description preceding them, and therefore all changes and modifications that fall within metes and bounds of the claims, or equivalents of such metes and bounds are therefore intended to be embraced by the claims.