CORONAVIRUS RNA REPLICONS AND USE THEREOF AS VACCINES
20230203536 · 2023-06-29
Inventors
- Luis ENJUANES SÁNCHEZ (Madrid, ES)
- María Isabel SOLA GURPEGUI (Madrid, ES)
- Sonia ZÚÑIGA LUCAS (Madrid, ES)
- Francisco Javier GUTIÉRREZ ÁLVAREZ (Madrid, ES)
- José Manuel HONRUBIA BELENGUER (Madrid, ES)
- Raúl FERNÁNDEZ DELGADO (Madrid, ES)
Cpc classification
C12N2770/20043
CHEMISTRY; METALLURGY
A61K39/215
HUMAN NECESSITIES
C12N2770/20034
CHEMISTRY; METALLURGY
C12N2770/20042
CHEMISTRY; METALLURGY
C12N2770/20022
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
Abstract
RNA replicon derived from a coronavirus with complete or partial deletion of: the gene encoding the E protein and at least 4 genes encoding genus accessory proteins selected from: 3, 4a, 4b and 5, in the case of MERS-CoV. Method of preparation thereof, and their use in vaccine compositions.
Claims
1. An RNA replicon derived from a coronavirus to which it has been deleted comprising: partially the gene encoding the E protein retaining the last 52 nucleotides of the sequence of this gene and total or partially at least 4 genes encoding genus accessory proteins selected from 3, 4a, 4b and 5 of MERS CoV retaining 39 nucleotides of the sequence of the gene encoding genus accessory protein 3, said 39 nucleotides are located in position 33409-33447 of SEQ_ID 1, and an identity of at least 95% or 96% or 97% or 98% or 99% with respect to the sequence SEQ_ID 1, namely with respect to the fragment comprised from nucleotides 7890 to 35838.
2.-8. (canceled)
9. The RNA replicon according to claim 1, having a size between 18 and 29 kb.
10.-11. (canceled)
12. The RNA replicon according to claim 1, wherein the RNA replicon is wrapped within a VLP-E+, comprising E protein provided in trans.
13.-14. (canceled)
15. A method for preparing an RNA replicon defined in claim 1 comprising: constructing the full-length cDNA from the gRNA of a coronavirus and inserting it into an expression vector obtaining an infectious clone; partially deleting the gene encoding the E protein; and totally or partially deleting of at least 4 genes encoding genus accessory proteins selected among 3, 4a, 4b and 5 of MERS-CoV; and transfecting the upstream expression vector into a host cell under conditions suitable for its expression.
16. (canceled)
17. The method according to claim 15, comprising total or partial deletion of the gene encoding E protein retaining the last 52 nucleotides of the sequence of this gene and genes encoding genus accessory proteins of 3, 4a, 4b and 5 of MERS-CoV retaining 39 nucleotides of the sequence of the gene encoding genus accessory protein 3, said 39 nucleotides are located in position 33409-33447 of SEQ_ID 1.
18. The method according to claim 15, wherein the full-length cDNA is obtained by chemically synthesizing several fragments and introducing said fragments into an expression vector.
19. The method according to claim 15, wherein the total or partial deletion of genes from the genome is selected between: use of restriction enzymes, vectors recombination and CRISPR technology.
20. (canceled)
21. An expression vector comprising the cDNA sequence complementary to the RNA replicon defined in claim 1.
22. (canceled)
23. The expression vector according to claim 21, which is selected from a bacterial artificial chromosome, a cosmid and a P1-derived artificial chromosome.
24. The expression vector according to claim 23, comprising a selection system for cells carrying said vector selected from the group of: an antibiotic resistance gene, preferably chloramphenicol, kanamycin or neomycin, a selection system based on the complementation of auxotrophic markers, preferably the DapD or tpiA gene a toxin/antitoxin mechanism, preferably, the hok/sok system or ccdB/ccdA, a ColE1-based repression mechanism, and a mechanism based on the counter-selection marker sacB.
25. A vaccine composition capable of inducing protection in a subject, against infection caused by a coronavirus, such that said vaccine composition, comprising an RNA replicon according to claim 1, together with, optionally: at least one pharmaceutically acceptable excipient and/or. at least one chemical or biological adjuvant or immunostimulant.
26. The vaccine composition according to claim 25, for its administration to a subject topically, intranasally, orally, subcutaneously or intramuscularly.
27. The vaccine composition according to claim 26, for its administration to the subject simultaneously together with a chemical or biological adjuvant or immunostimulator.
28. The vaccine composition according to claim 25, for its administration to the subject before or after the chemical or biological adjuvant or immunostimulator.
29. The vaccine composition according to claim 25, which is in liquid or lyophilized form.
30. The vaccine composition according to claim 25, wherein the subject is a mammal, selected from a human or a domestic animal selected from a dog, and/or a cat.
31. Method of use of the RNA replicon defined in claim 1 as a vaccine composition comprising its administration to a subject topically, intranasally, orally, subcutaneously or intramuscularly.
32. The RNA replicon according to claim 1, having a size between 20 and 27 kb.
33. The RNA replicon according to claim 1, having a size between 22 and 26 kb.
34. The RNA replicon according to claim 1, having a size between 22 and 24 kb.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0184]
[0185]
[0186] The vertical bands within the boxes represent the point mutations throughout the genome that have been introduced into the cDNA. It is important to highlight that a deletion within gene 5 (in white) and a stop codon (asterisk) have been introduced in MERS-MA30 during adaptation, which prevents the expression of protein 5 in the MERS-MA30. Black vertical lines within the boxes indicate silent mutations. (B) The upper image represents the mouse-adapted MERS-CoV genome cDNA (MERS-MA30), GenBank accession number MT576585, as shown in panel A, flanked by the cytomegalovirus (CMV) promoter and the hepatitis delta virus ribozyme (Rz) and bovine growth hormone (BGH) termination sequence. pA, poly(A) tail. The lower image represents the six fragments (F1 to F6, in dark gray) originally designed to assemble the infectious cDNA of MERS-CoV (Almazan, et al, 2013), flanked by the indicated restriction sites (the positions in the viral genome are indicated by numbers in parentheses). Above them there are light gray boxes indicating the synthetic mouse-adapted fragments chemically synthesized with the mutations mentioned in
[0187]
[0188]
[0189] The identity between both sequences and the modifications in the S gene of each replicon are also shown: S* opt: S gene sequence with optimised codons.
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
EXAMPLES
[0200] Materials and Methods
[0201] The materials and protocols common to the different examples are described below and will be those used unless explicitly stated otherwise.
[0202] Eukaryotic Cell Lines
[0203] The following cell lines were used: Huh-7 cells derived from human (Homo sapiens) hepatocarcinoma, BHK21 cells derived from newborn golden hamster (Mesocricetus auratus) kidney, Vero-81 and Vero E6 cells derived from green cercopithecus (Chlorocebus aethiops) kidney, human embryonic kidney HEK293 cells, human lung adenocarcinoma-derived Calu3 and Calu3 2B4 cells, and human lung fibroblast-derived MRC-5 cells.
[0204] Cell lines were grown in an incubator at 37° C. with 5% CO.sub.2 partial pressure and 97% humidity in Dulbecco's modified Eagle medium (DMEM) with 25 mM HEPES [4-(2-hydroxyethyl)piperazin-1-ylethanesulfonic acid] buffer and 4.5 g/L glucose (BioWhittaker, Lonza). For cell culture assays, the medium was supplemented with 2 mM glutamine (Sigma-Aldrich), 1% p/v non-essential amino-acids (Sigma-Aldrich) and 10% v/v FBS. 100 IU/mL gentamicin (Sigma-Aldrich) was added to the medium for line maintenance between assays. All cell lines were cryopreserved in liquid nitrogen at a density of 1×10.sup.6 cells/mL in FBS with 10% v/v dimethyl sulfoxide (DMSO) (Sigma-Aldrich).
[0205] Bacteria
[0206] For the cloning of the different plasmids, Escherichia coli strain DH10B (Invitrogen, Thermo Fisher Scientific) was used, this strain has the following phenotype:
[0207] [F-mcrAΔ(mrr-hsdRMS-mcrBC)ø80dlacZΔM15ΔlacX74deoRrecA1endA1araD139 (ara,leu)7697galUgalKλ-rpsLnupG]
[0208] Bacteria were grown at 30 or 37° C. in Luria-Bertani (LB) liquid medium (Sambrook and Russell, 2001), or in LB-agar solid medium (15 g/L) for colony isolation. When necessary, the medium was supplemented with antibiotics for the selection and growth of individual colonies (100 μg/mL ampicillin or 12.5 μg/mL chloramphenicol; Sigma-Aldrich).
[0209] Generation of Competent Bacteria
[0210] For the preparation of DH10B bacteria competent for electroporation, a pre-inoculum was grown at 37° C. overnight from an individual colony isolated on solid LB-agar medium, in 50 mL of Super Optimal Broth (SOB) medium [20 g/L tryptone (Becton, Dickinson and Company), 5 g/L yeast extract (Becton, Dickinson and Company), 0.5 g/L NaCl (Sigma-Aldrich), 0.18 g/L KCI (Sigma-Aldrich)]. The next day, two liters of SOB medium were inoculated with 1 mL of the pre-inoculum and amplified to an optical density at 550 nm (OD.sub.550 nm) of 0.7. They were then sedimented by centrifugation at 4000×g for 10 min at 4° C. and washed three times with a 10 (Yov/v glycerol solution. In the first wash the bacteria were resuspended in a volume equivalent to that of the initial culture, which was halved in successive washes (2 L, 1 L, 0.5 L and 0.25 L, respectively). After initial sedimentation and between washes, the bacteria were kept on ice at all times. The final sediment was resuspended in a volume of 6 mL of 10% v/v glycerol at 4° C., the bacteria were divided into aliquots and frozen at −80° C. until use.
[0211] Transformation of Bacteria by Electroporation
[0212] Electroporation-competent DH10B bacteria were transformed with a salt-free DNA. That DNA was dialyzed for 20 min against distilled H.sub.2O using hydrophilic cellulose ester membranes with a pore size of 0.025 μm (Merck-Millipore). Dialyzed DNA was mixed with 50 μL of competent bacteria and transferred to a 0.2-cm electroporation cuvette (Bio-Rad). For electroporation, an electric pulse of 25 μF, 2.5 KV and 200Ω was applied to the cuvette with the DNA-bacteria mixture with a MicroPulser Electroporator electroporator (Bio-Rad). The electroporated cells were then resuspended in 1 mL of LB and grown for 45 min at 37° C. under shaking. After incubation, the electroporated bacteria were seeded on a plate of LB-agar medium with the corresponding selection antibiotic.
[0213] DNA Manipulation and Analysis
[0214] Plasmids
[0215] The plasmid TRE-Auto-rtTA-V10-2T was used for the expression of the envelope protein (E) of MERS-CoV and its variants. The sequence of the resulting constructs was verified by Sanger sequencing (Macrogen).
[0216] The gene of interest was under the influence of an inducible promoter in the plasmid TRE-Auto-rtTA-V10-2T (Das et al., 2016b). This vector was based on the tetracycline-controlled inducible expression system Tet-On (Das et al., 2016a). Two EcoRl restriction sites were introduced by PCR to clone the gene encoding the E protein or its variants into the plasmid. Oligonucleotides used for cloning were: VS-EcoRI-E-MERS-rtTA-V10-2T (5′-CCGGAATTCGAGCTCGGT ACCCGGGGATCCACCGGTCGCCACCATGTTACCCTTTGTC-3′) SEQ_ID 22 and RS-EcoRI-EMERS-rtTA-V10-2T, SEQ_ID 23. The resulting PCR product was cloned into the vector using the EcoRI restriction sites. The correct orientation of the insert in the vector was checked by PCR using an internal (RS-E-MERS: 5′-TTAAACCCACTCGTCAGG-3′) SEQ_ID 24 and an external (VS-TRE-Auto-2380: 5′-ATCCACGCTGTTTTGACCTC-3′) SEQ_ID 25 oligonucleotide with respect to the inserted fragment. The TRE-Auto-rtTA-V10-2T plasmid contained a gene encoding a transactivator (rtTA) downstream of the gene encoding the E protein. In the presence of an inducer (doxycycline, a tetracycline-derived antibiotic), this transactivator was able to bind to the inducible promoter and initiate transcription of the gene of interest. Between the two genes there was an Internal Ribosome Entry Site (IRES), which generated a positive feedback loop that increased the expression levels of both the E protein and the transactivator.
[0217] The high copy number plasmid pUC57 (GenScript) was used for cloning and modification of some DNAs complementary to the viral RNA (cDNA). To clone the cDNA of MERS-CoV strain EMC/2012, MERS-MA30, and its corresponding variants, the plasmid pBeloBAC11 (pBAC) (Wang et al., 1997) was used. This 7507 bp plasmid contains the E. coli factor F origin of replication (oirS), the chloramphenicol resistance gene (cat) and the genes necessary to maintain a single copy of the plasmid per cell (parA, parB, parC and repE). This vector was also used for cloning and modification of large viral cDNAs or those containing toxic sequences for bacteria, as previously described (Almazán et al., 2000; Gonzalez et al., 2002).
[0218] Plasmid and DNA Fragment Purification
[0219] For the extraction and purification of plasmids from small- to medium-scale bacterial cultures, the Plasmid Mini Kit and Plasmid Midi Kit (Qiagen) reagents were used, respectively.
[0220] For large-scale purification of pBAC-based plasmids, a 400 mL bacterial culture grown for 18 h at 30° C. under agitation in LB medium supplemented with 15 μg/mL chloramphenicol (Sigma-Aldrich) was used. The Large Construct Kit reagent (Qiagen) was used for purification. This reagent allows purification of large DNA fragments free of bacterial chromosomal DNA by an exonuclease treatment.
[0221] PCR products and DNA fragments extracted from agarose gels were purified with the QIAquick Gel Extraction Kit reagent (Qiagen). When the fragment was larger than 10 kb, QIAEX II reagent (Qiagen) was used.
[0222] In all cases, the manufacturer's instructions were followed and DNA was eluted in ultrapure distilled H.sub.2O MilliQ (Merck-Millipore) or EB elution buffer (10 mM Tris-Cl, pH 8.5; Qiagen).
[0223] Restriction Enzymes, DNA Modification and DNA Ligation.
[0224] All restriction enzymes used in cloning and restriction patterning were obtained from Roche, New England Biolabs, and Thermo Fisher Scientific. For DNA ligation reactions, the DNA ligase enzyme from phage T4 (Roche) was used. Dephosphorylation of DNA molecules ends was performed with shrimp alkaline phosphatase (Applied Biosystems, Thermo Fisher Scientific). Restriction enzyme treatments, dephosphorylation and DNA ligation were carried out following each manufacturer's instructions and standard protocols previously described (Sambrook and Russell, 2001). The sequence of the resulting constructs was analyzed and verified by Sanger sequencing (Macrogen).
[0225] Polymerase Chain Reaction for the Amplification of DNA Fragments.
[0226] Amplification reactions were performed on a 2720 Thermal cycler or a SimpliAMP thermal cycler (Applied Biosystems, Thermo Fisher Scientific). The final volume of the reactions was 25 μL. In those preparative reactions in which it was necessary to obtain a larger amount of PCR product, the final volume was increased to 50 μL. Between 50 and 150 ng of template DNA were used per reaction. The melting temperature of the oligonucleotides (Tm) and the length of the fragment to be amplified determined the hybridization temperature (4 to 5° C. less than the Tm of the oligonucleotide with lower Tm) and the elongation time (about 1 min per 1 kb of amplified DNA), respectively. The reaction conditions were adjusted as follows: (a) initial denaturation of 5 minutes at 95° C.; (b) 25-35 cycles of: i) denaturation, 30 seconds at 95° C.; ii) hybridization, 30 seconds at the calculated temperature; iii) elongation, 1 minute/kb at 72° C.; (c) final elongation, 10 minutes at 72° C.
[0227] Reactions for analytical purposes, including genotyping, were carried out with AmpliTaq DNA polymerase enzyme (Applied Biosystems, Thermo Fisher Scientific). 0.025 U/μL of polymerase in its corresponding reaction buffer (GeneAmp 10× PCR Buffer II, Applied Biosystems, Thermo Fisher Scientific) in the presence of 2.5 mM MgCl.sub.2, 0.3 μM of each oligonucleotide and a mixture of deoxynucleotide triphosphates (dNTPs) (Roche) at a final concentration of 0.2 mM of each were used.
[0228] For preparative and sequencing reactions, Vent polymerase enzyme (New England Biolabs) was used, which exhibits higher fidelity due to its error-correcting 3′-5′ exonuclease activity. 0.016 U/μL of polymerase in its corresponding reaction buffer (ThermoPol Reaction Buffer, New England Biolabs; final composition 1×: Tris-HCl 20 mM, (NH.sub.4).sub.2SO.sub.4 10 mM, KCl 10 mM, Triton® X-100 0.1%, pH 8. 8) in the presence of 2 mM MgSO.sub.4, 0.2 μM of each oligonucleotide and a dNTPs mixture at a final concentration of 0.3 mM of each.
[0229] DNA Electrophoresis on Agarose Gels.
[0230] Separation of DNA fragments for analytical studies or purification was performed by electrophoresis on 0.7-1.5% wt/v low-EGD agarose gels (Pronadisa, CONDA Laboratories) in TAE buffer (40 mM Tris-acetate, 1 mM ethylenediaminetetraacetic acid—EDTA—1 mM). For visualization of DNA bands on a ChemiDoc imager (Bio-Rad) SYBR Safe DNA gel stain 1× (Invitrogen, Thermo Fisher Scientific) was incorporated into the agarose solution.
[0231] Viruses
Viral Isolates
[0232] Recombinant viruses rescued from transfection of the MERS-CoV infectious clone (MERS-CoV) (Almazán et al., 2013) have the genetic background of the MERS-CoV isolate EMC/2012 (GenBank: JX869059) (van Boheemen et al., 2012). Recombinant viruses rescued from transfection of the mouse-adapted MERS-CoV infectious clone (MERS-MA30) exhibit the genetic background of the MERS-CoV-6-1-2 isolate after 30 passages in hDPP4-knockin mice (Li et al., 2017).
[0233] Virus Manipulation in Cell Culture.
[0234] Viruses were grown in cells following standard protocols. For this purpose, cells were grown to 100% confluence in preferably screw-capped culture flasks or culture plates. They were then brought to the NCB3 laboratory and infected with the desired amount of virus. In the case of culture plates, they were placed in heat-sealable plastic bags. Both flasks and plates were placed in methacrylate boxes for spill containment and incubated at 37° C. for the indicated period of time.
[0235] Batches of virus were generated in screw-capped culture flasks of the desired final batch volume. At 24 hours after seeding the cells and verifying that they had reached 100% confluence, they were infected at a multiplicity of infection (MOI) of 0.001 plaque-forming units (PFU) per cell (PFU/cell). The supernatant was collected 72 hours post infection (hpi) and distributed into aliquots that were stored at −80° C. until use. The sequence of the virus batches was analyzed by Sanger sequencing (Macrogen) to verify that no changes had occurred.
[0236] Viral Titration by Plaque-Forming Assay
[0237] Titrations by plaque-forming assay were carried out following standard protocols adapted to the virus strains used in the laboratory (Coleman & Frieman, 2015). Twelve-well plates were seeded with Huh-7 or Vero 81 cells, grown to 100% confluence and infected in triplicate with factor-10 serial dilutions of the virus supernatant. After 45 min of adsorption at 37° C., the medium was removed and DMEM supplemented with 4 mM glutamine, 1%v/v non-essential amino acids, 2%v/v FBS, 0.16 mg/mL DEAE-Dextran and 0.6% p/v low-electroendoosmosis point agarose (Pronadisa, CONDA Laboratories) was added, forming an agarose layer. Huh-7 or Vero E6 and Vero81 cells were infected with MERS-CoV and incubated for 72-96 hours. After incubation, the cells were fixed and inactivated with 10% v/v formaldehyde (Sigma-Aldrich) in phosphate buffered saline (PBS) for at least 45 min at room temperature. The formaldehyde and agarose plug were then removed to stain the cells with a crystal violet solution (1 mg/mL crystal violet in 20% methanol in distilled H.sub.2O) for 15 min at room temperature. The number of lysis plates formed in each of the dilutions was determined. The titer was expressed as the number of PFU multiplied by the dilution factor in a volume of 1 mL (PFU/mL).
[0238] Viral Titration by Immunofluorescence Focus Formation Detection Assay
[0239] The immunofluorescence focus formation detection assay is particularly useful for the detection and titration of those spreading-deficient viruses unable to form visible plaques. For this purpose, 5×10.sup.4 cells per well were seeded in a 96-well plate in a final volume of 50 μL of medium. The next day, cells were infected with 20 μL of factor-10 serial dilutions of the virus-containing supernatant. At 16 h post infection (hpi), cells were fixed and inactivated with 4% p/v paraformaldehyde (Merck-Millipore) in PBS for 45 min at room temperature, washed with PBS, and permeabilized with cold methanol for 20 min at room temperature. Nonspecific binding sites were blocked with 10% v/v FBS in PBS for one hour at room temperature. Cells were then incubated overnight at 4° C. with a rabbit polyclonal antibody against the nucleocapsid (N) protein (BioGenes) at a 1:500 dilution in 5% FBS in PBS. The next day, the antibody was removed, cells were washed with PBS and incubated with a goat anti-rabbit monoclonal antibody conjugated with Alexa Fluor®488 fluorochrome (Invitrogen, Thermo Fisher Scientific) at a 1:500 dilution in 5% FBS in PBS for 45 minutes at room temperature. Infection foci formed at the different dilutions were counted using an Axio Vert.A1 fluorescence microscope (Zeiss). The titer was expressed as the number of focus-forming units (FUs) multiplied by the dilution factor in a volume of 1 mL (FUs/mL), equivalent to PFU/mL.
[0240] Viral Titration by the 50% Tissue Culture Infective Dose Method
[0241] The 50% tissue culture infective dose (TCID.sub.50) is the dilution at which the virus produces a cytopathic effect in 50% of the wells with inoculated cells. To perform titration by this method, 5×10.sup.4 cells per well were seeded in a 96-well plate in a final volume of 50 μL of medium. The next day, the medium was removed and the cells were infected with 100 μL of factor-10 serial dilutions of the virus supernatant (from 1:10 to 1:10.sup.8) and incubated for 72 hours at 37° C. For each of the dilutions of each virus, 10 wells were inoculated. At 72 hpi, the medium was removed from the cells and they were fixed and inactivated with 10% v/v formaldehyde (Sigma-Aldrich) in PBS for at least 45 min at room temperature. The formaldehyde was then removed to stain the cells with a crystal violet solution (1 mg/mL crystal violet in 20% methanol in distilled H2O) for 15 min at room temperature. To obtain the titer, the dilution of virus at which 50% of the wells with cells showed cytopathic effect (TCID.sub.50) was calculated following the method described by Reed-Muench (Reed and Muench, 1938), multiplied by the dilution factor and expressed as TCID.sub.50 per milliliter of virus (TCID.sub.50/mL).
[0242] Transfection of Infective cDNAs and Rescue of MERS-CoV and MERS-MA30 Viruses.
[0243] BHK21 cells grown to 95% confluence in 12.5 cm.sup.2 culture flasks were transfected with 6 μg of the infective cDNA of one of the viruses and 18 μL of the transfection reagent Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific), according to the manufacturer's specifications. At 5-6 hours after transfection (hdt), transfected BHK21 cells were detached from the plate with 500 μL of trypsin-EDTA (25%), added onto a monolayer of confluent Huh-7 or Vero 81 cells grown in 12.5 cm.sup.2 culture flasks and incubated at 37° C. After 72 hours, supernatants were collected (passage 0) and stored at −80° C. One third of the supernatant was reserved to make a passage to a new flask of confluent Huh-7 or Vero 81 cells, which were incubated, again, at 37° C. for 72 hours. After incubation, the supernatants (passage 1) were collected and stored at −80° C. The rescued viruses were amplified directly from passage 1. Only selected viruses were cloned prior to amplification by three lysis plate purification steps in semi-solid DMEM medium at 0.6% w/v of low electroendoosmosis point agarose (Pronadisa, CONDA Laboratories). Passages 0 and 1, as well as the amplification batches of each virus, were titered and sequenced to verify that rescue had occurred correctly.
[0244] Rescue of MERS-CoV Derived Replicons
[0245] For the rescue of MERS-CoV replicons with the gene encoding the E protein deleted, Huh-7 cells were transfected with the plasmid pcDNA3.1-E-MERS-CoV. This plasmid was used to provide in trans the E protein in order for the replicon to form VLPs carrying the E protein on its surface. In this way, the generated replicon was self-sufficient to infect on its own. Alternatively, to rescue the replicon within VLPs, Huh-7 cells were cotransfected with the MERS-CoV replicons and the TRE-Auto-rtTA-V10-2T-E-MERS-CoV plasmid that provides the E protein in trans. At 5-6 hpt, the medium with the plasmid-Lipofectamine complexes was removed from the transfected Huh-7 cells, cells were washed, and fresh medium was added. For cells transfected with the TRE-Auto-rtTA-V10-2T-EMERS-CoV plasmid, the medium was supplemented with doxycycline at a concentration of 1 μg/mL to induce E protein expression. In an alternative process, the same plasmids were first transfected onto BHK21 cells, and after 6 hours cells were detached from the plate, by incubating with 500 μL of trypsin-EDTA (25%), and added onto Huh-7 cells transfected with the E protein expression plasmids and incubated at 37° C. for 72 hours. The prior transfection of the plasmids on BHK21 cells was done to increase transfection efficiency, since a high percentage of BHK21 transfected cells was obtained. For both rescue and successive amplification passages and batch generation of the viruses, Huh-7 cells were transfected with the E protein expression plasmids at a DNA:Lipofectamine 2000 ratio of 1:3 (micrograms:microliters).
Transmission Electron Microscopy
[0246] Huh-7 cells were seeded in 24-well plates. The next day, the confluence level was checked to be almost 100%. At that time, the cells were infected with 0.1 and 1.0 MOls of the viruses and MERS-CoV and MERS-CoV-ΔE, respectively, obtaining similar results in both cases. At 17 hpi, the medium was removed, several washes were made with PBS buffer, and cells were fixed in situ for 2 h at room temperature with a solution of 4% w/v PFA and 2% w/v glutaraldehyde in 0.1 M Sörensen's phosphate buffer at pH 7.4. They were stored at 4° C. for 24 h for fixation. Inclusion of the cells was done directly on the plate in plane, without detaching the cells. For this purpose, the fixative was removed and the cells were embedded in TAAB 812 epoxy resin (TAAB Laboratories). The resin blocks were removed from the plate for ultrathin cuts (70-80 nm) with an Ultracut E ultramicrotome (Leica) that were counterstained with a solution of 2% uranyl acetate in water and Reynolds lead citrate. The grids with the slices were examined at 80 kV in a JEM1010 transmission electron microscope (Jeol) and pictures were taken with a CMOS TemCam F416 digital camera (TVIPS).
[0247] RNA Manipulation and Analysis
[0248] Extraction and Purification of Intracellular Total RNA
[0249] Total RNA from infected mouse cells or lungs was extracted and purified with the RNeasy Mini Kit reagent (Qiagen) for sequence verification and stability analysis of the rescued viruses, as well as for quantification of viral and cellular gene expression. The purification yield was quantified with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies). All purified RNAs were stored at −80° C. until use.
[0250] Synthesis of cDNAs from RNA by RT-PCR
[0251] The cDNAs were synthesized from purified RNAs by reverse transcription (RT)-PCR with the High Capacity DNA RT reagent kit (Applied Biosystems, Thermo Fisher Scientific) in a final volume of 30 μL, with 150 ng of RNA as template and random hexanucleotides, provided in the kit, as primers. RT-PCR conditions were: 10 minutes at 25° C., 120 minutes at 37° C. and 5 minutes at 85° C. for enzyme inactivation. The cDNAs generated were used immediately and the remainder was stored at −20° C. A fraction of the cDNAs (2 μL) was used as a template for PCR amplification using specific oligonucleotides. The products of this PCR were analyzed by agarose gel electrophoresis and Sanger sequencing (Macrogen) to study the stability and sequence of the mutants generated.
[0252] Quantification of RNAs by Quantitative RT-PCR (RT-qPCR)
[0253] Using TaqMan technology, viral genomic (gRNA) and subgenomic (sgmRNA) RNA present in mouse lung samples was transcribed to cDNA by reverse transcription and analyzed by quantitative PCR (RT-qPCR). For gRNA and N-gene sgmRNA (sgmRNA-N), TaqMan assays were composed of two oligonucleotides (Sigma-Aldrich) and a fluorophore-conjugated probe with a fluorescence deactivator (Eurofins Genomics). Both the oligonucleotides and the probe were specific for MERS-CoV and MERS-MA30 viruses (Table 2).
TABLE-US-00004 TABLE 2 TaqMan assays. Probe Sequence 5′.fwdarw.3′ probe Oligonucleotides Sequence 5′.fwdarw.3′ probes gRNA- TGCTCCAACAGTTACAC VS MERS gARN GCACATCTGTGGTTCTCCTCTCT MERS SEQ_ID 28 SEQ_ID RS MERS gARN AAGCCCAGGCCCTACTATTAGC 26 SEQ_ID 29 sgmRNA- CTTTGATTTTAACGAATC Leader sgARN CTTCCCCTCGTTCTCTTGCA N-MERS SEQ_ID 30 SEQ_ID sgARN-N TCATTGTTATCGGCAAAGGAAA 27 SEQ_ID 31
[0254] To normalize and viral RNA quantifications, a commercial mouse 18-S ribosomal RNA-18-S (rRNA-18S) TaqMan assay (reference: Mm03928990-g1; Applied Biosystems, Thermo Fisher Scientific) was used as an internal control.
[0255] We took 2 μL of a 1/10 dilution of the cDNA synthesized by reverse transcription for quantification of viral RNAs, and 2 μL of a 1/100 dilution for quantification of 18S ribosomal RNA (rRNA-18S). The qPCR was performed on a 7500 Real Time PCR System (Applied Biosystems, Thermo Fisher Scientific) using the following conditions: (a) 2 minutes at 50° C.; 10 minutes at 95° C.; (b) 40 cycles of: (i) 15 seconds at 95° C.; (ii) 1 minute at 60° C. In all cases the reaction was carried out with GoTaq qPCR Master Mix reagent (Promega) and three biological replicates and three technical replicates of the above were analyzed to ensure the precision of the analysis. Values corresponding to the means of the cut-off cycle (Ct) were analyzed with 7500 software v2.0.6. (Applied Biosystems, Thermo Fisher Scientific) and used to calculate relative expression values using the 2.sup.−ΔΔCt method (Livak and Schmittgen, 2001).
[0256] Mouse Assays
[0257] Experimental Mouse Models and Inoculation Protocols.
[0258] For the evaluation of MERS-MA30 pathogenesis and MERS-MA30 replicon-based vaccine candidates, C57BL/6NTac-Dpp4.sup.tm3600(DPP4)Arte knock-in mice were used (Li et al., 2017) (KI mice), in which exons 10-12 of the murine Dipeptidyl peptidase 4 gene (Dpp4, Cd26 or mDpp4) were replaced with the corresponding exons of the human homologous gene, DPP4, thus generating a humanized chimeric protein (huDpp4). The substituted exons encode the RBD-recognized region of the MERS-CoV S protein. These mice are very useful for the study of the pathology produced by M ERS-CoV, since they reproduce very well the clinical signs and lung damage observed in human MERS-CoV infection, (Li et al., 2017). SJL-Tg(K18-DPP4) (K18) transgenic mice were also used (Li et al., 2016) in the protection evaluations with similar results to the experiments performed on KI mice, described above for immunizations.
[0259] Mice experiments were performed on 16- to 30-week-old females free of specific pathogens. In all the experimental procedures performed, mice were anesthetized with a mixture of isoflurane and oxygen. All viruses were inoculated intranasally in a maximum final volume of 50 μL of DMEM by depositing small droplets of the virus suspension into the nostrils, which the mouse inhaled naturally within 2 to 3 seconds. Depending on each experiment, the dose used varied between, 1×10.sup.4 PFU for immunizations or attenuation studies and 1×10.sup.5 PFU/mouse for challenge.
[0260] Disease Monitoring, Virulence Analysis and Sample Collection
[0261] Infected mice were monitored for weight, clinical signs of disease and survival for a period of 14 days. Those animals that during the course of the experiment suffered weight losses greater than 25% of the initial weight were sacrificed according to the established endpoint criteria.
[0262] At the indicated days, three mice from each experimental group were sacrificed by cervical dislocation for lung sampling. For viral load counting in the lungs of infected mice, half of the right lung was taken and stored at −80° C. until use. The rest was embedded in RNAlater preservation solution (Sigma-Aldrich) for 48 hours at 4° C. and stored at −80° C. until further processing to ensure the integrity of the RNA molecules. The left lung was fixed in 10% zinc formalin solution (Sigma-Aldrich) for 24-48 hours at 4° C. for virus inactivation and subsequent histopathological analysis.
[0263] Sample Processing for Lung Virus Quantification
[0264] Lung samples were thawed and homogenized in 2 mL of PBS supplemented with 50 μg/mL gentamicin (Sigma-Aldrich), 0.25 μg/mL amphotericin B (Gibco, Thermo Fisher Scientific), 100 IU/mL penicillin (Sigma-Aldrich) and 100 μg/mL streptomycin (Sigma-Aldrich) in a gentleMACS Dissociator homogenizer (Miltenyi Biotec) with the corresponding tubes, following the manufacturer's instructions. Samples were centrifuged at 3000×g for 10 min at 4° C. Supernatants were divided into aliquots and stored at −80° C. until virus titration by the methods described above. Titers were expressed as plaque-forming units per gram of lung (PFU/g).
[0265] Lung RNA Extraction
[0266] The RNA preservation solution was removed from the lung samples and homogenised in 2 mL of RLT lysis buffer (Qiagen) with 1% v/v β-mercaptoethanol in a gentleMACS Dissociatorhomogeniser (Miltenyi Biotec), using the appropriate tubes and following the manufacturer's instructions. The homogenised samples were centrifuged at 3000×g for 10 minutes at 4° C. Total RNA was purified from the supernatant using the RNeasy Mini Kit reagent (Qiagen). The purified total RNA was used to quantify viral and cellular RNAs.
[0267] Virulence Assessment of Vaccine Candidates
[0268] For attenuation assessment of the vaccine candidates, 11 mice were infected with each virus generated: five for disease monitoring, three for lung sampling at 3 days post infection (dpi), and three for lung sampling at 6 dpi. KI mice were inoculated with 1×10.sup.4 PFU/mouse of the replication-competent propagation-defective virus based candidates.
[0269] As a control during disease follow-up, five K18 mice were inoculated with 5×10.sup.3 PFU/mouse of MERS-CoV and five KI mice with 1×10.sup.4 PFU/mouse of MERS-MA30.
[0270] Assessment of Protection of Vaccine Candidates
[0271] At 21 days post-immunisation (dpim), the five mice immunised with each vaccine candidate were challenged with a high dose (1×10.sup.5 PFU/mouse) of MERS-CoV or MERS-MA30, depending on whether they were K18 or KI mice, respectively. After assessment of the degree of protection, one candidate of each vaccine type was selected to immunise 12 mice and samples were taken at days 2, 4, 6, 8 and 12 days post-challenge (dpc). The collected samples were used to measure viral RNA levels, viral load and to assess the ability of the selected candidates to induce sterilising immunity.
[0272] Virus Neutralisation Assay
[0273] Blood samples were obtained from the submandibular vein at 0 and 21 days after immunisation. Blood samples were incubated at 37° C. for 1 hr in a water bath and then at 4° C. overnight to facilitate coagulation and separation of serum. The serum was clarified by centrifugation and stored at −80° C. One day before the assay, 5×10.sup.4 Huh-7 cells per well were seeded in 96-well plates. On the day of the assay, serum samples were thawed and incubated at 56° C. for 30 min to inactivate complement. Twofold dilutions of each serum were prepared in complete DMEM supplemented with 2% FBS in a final volume of 60 μL. Serum dilutions were incubated for 1 hr at 37° C. with 100 TCID.sub.50 of MERS-MA 30 in a 1:1 proportion. Medium was removed from Huh-7 cells, and cells were incubated with 60 μL of serum:virus mixtures for 1 hr at 37° C. After incubation, the serum:virus mixture was replaced with fresh complete DMEM medium, and cells were incubated at 37° C. for 72 hr. Finally, cells were fixed with 10% v/v formaldehyde in PBS and stained with crystal violet. The titer of neutralising antibodies in mouse serum was determined as the highest dilution showing complete neutralisation of the cytopathic effect in 50% of the wells (TCID.sub.50).
[0274] Statistical Analysis
[0275] To analyse the differences between the means of two groups, the two-tailed Student's t-test for unpaired samples was used. For the comparison of means of three or more groups, one-way analysis of variance (ANOVA) was used. P values<0.05 were considered significant. Differences in weight loss were represented as the mean±standard error of the mean (SEM). All other results were expressed as the mean±standard deviation (SD).
EXAMPLES
[0276] As it was stated above, MERS-Cov is one of the deadliest coronavirus for humans,
[0277] Several examples of the method of the invention by which MERS-CoV derived RNA replicons are obtained and their use as vaccines for the generation of immunity in animal models are described below.
[0278] 1. Engineering of Mouse-Adapted MERS-CoV Infective Clones Isolated after 30 Passages in hDPP4-Knockin Mice (MERS-MA30)
[0279] The use of coronavirus-derived RNA replicons as vaccines requires the use of animal models. In this first example, mice (Mus musculus) are not susceptible to MERS-CoV infection, since the S protein of MERS-CoV does not recognise the murine homologous protein of the human receptor. For this reason, two mouse models genetically modified to be susceptible to MERS-CoV infection have been used and a derivative of MERS-CoV that is pathogenic in these animals has been used.
[0280] From the MERS-CoV Genbank JX869059 virus sequence, a mouse-adapted strain was generated, causing the death of all infected mice, by passing the MERS-CoV virus for 30 consecutive times in mice (Li et al., 2017). This virus was named MERS-MA30-6-1-2 (SEQ_ID 21). In the present invention, the full-length cDNA of the coronavirus genome described in the attached SEQ_ID 21 has been generated and deposited in GenBank under accession number MT576585. By the design of nine fragments chemically synthesised (GeneArt, Thermo Fisher Scientific) containing the mutations present in the MERS-MA30-6-1-2 virus (
[0281] The cDNA was cloned into a BAC (Almazán et al., 2013) under the cytomegalovirus (CMV) immediate early promoter and an untranslated region (UTR) and is flanked at the 3′ end by the bovine growth hormone (BGH) termination and polyadenylation sequences separated from the poly A tail (with 24 adenine residues) by the HDV ribozyme sequence (Rz).
[0282] Each of these fragments was cloned into a pBAC intermediate plasmid (Almazán et al., 2013) using selected restriction enzymes (
TABLE-US-00005 TABLE 3 DNA fragments containing the mutations of the mouse-adapted MERS-CoV, MERS-MA30. Synthes. fragment Fragment Intermediate Viral (FS) .sup.(a) size (bp) 5′ end .sup.(b) 3′ end .sup.(b) plasmid .sup.(c) genome .sup.(d) 1 1424 AscI BamHI pBAC-SA-F1 1-806 nt 2 1725 PfI23II Pfl23II pBAC-SA-F2 807-7622 nt 3 918 NsiI NsiI pBAC-SA-F4 9075-20901 nt 4 2915 Bsu36I Bsu36I pBAC-SA-F4 9075-20901 nt 5 1488 SphI SphI pBAC-SA-F4 9075-20901 nt 6 3493 ApaLI ApaLI pBAC-SA-F5 20902-25840 nt 7 191 MfeI BgIII pBAC-SA-F6 25841-30162 nt 8 887 NdeI KfII pBAC-SA-F6 25841-30162 nt 9 2635 KfII/SanD1 RsrII pBAC-SA-F6 25841-30162 nt .sup.(a) According to the scheme in FIG. 2B. .sup.(b) Restriction enzymes used to clone the synthesised fragments into the intermediate plasmids. .sup.(c) Intermediate plasmid into which the synthesised fragment has been cloned (Almazán et al., 2013). .sup.(d) Nucleotides of the viral genome included in the intermediate pBAC. nt: nucleotide. The virus genome starts at position 7890 of pBAC-MERS-MA30-FL.
[0283] In addition to the genome of the MERS-MA30-6.1.2 clone, in which the ORF5 gene is mutated and not expressed (Li et al., 2017), other infectious cDNAs were generated: one with the full ORF5 gene (pBAC-MERS-MA30-5FL) and one with the ORF5 gene deleted (pBAC-MERS-MA30-Δ5) (not shown).
[0284] 2. Assessment of MERS-MA30 Virulence In Vivo
[0285] MERS-CoV, which infected KI mice without causing death, was adapted to grow in these mice by 30 sequential virus passages, resulting in the virus named MERS-MA30 (mouse adapted MERS-CoV). After this process, the virus caused the death of infected KI mice. Subsequently, it was cloned three times by lysis plaque isolation, and a clone was selected for further work,named MERS-MA30-6-1-2.
[0286] With the aim of testing possible changes in the virulence of MERS-MA30 i.e. the recombinant virus obtained in the present invention by chemical synthesis, incorporating the mutations acquired by a MERS-CoV when passed 30 times in knockin (KI) mice, an inoculation was performed in humanised KI mice with the passaging-derived virus (MERS-MA30-6-1-2), which best reproduces in the mouse the clinical signs observed in humans (Li et al., 2017), and with the chemically synthesised and genetically engineered virus (MERS-MA30). Mice were intranasally inoculated with 1×10.sup.5 PFU/mouse. It was observed that weight losses and survival were similar with the two viruses, indicating that the virus recovered from the engineered infectious cDNA (MERS-MA30) behaved virtually the same as the isolated virus (MERS-MA30-6-1-2), with slightly, but not significantly, higher virulence (
[0287] 3. Construction of RNA Replicons from the Recombinant MERS-MA30 Infectious Clone
[0288] The specific data for each of the genes, present in the pBAC, encoding MERS-CoV are shown in Table 1.
[0289] The pBAC-MERS-MA30-FL was used as the basis for engineering the different MERS-MA30 replicons and mutant viruses (
[0295] For the generation of the infectious cDNA of MERS-MA30-ΔE and MERS-MA30-Δ5-ΔE, a 502-bp chemically synthesised fragment (GeneArt, Thermo Fisher Scientific) flanked by KfII/SanD1 and Pfl23II restriction sites was designed. This fragment included the MERS-MA30 mutations between nucleotides 27535 and 28236 of the viral genome, the CS deletion of the transcription regulating sequence (TRS) of the gene encoding E protein, and the deletion of the first 197 nucleotides of the sequence of the gene encoding E protein. The designed fragment is shorter in length as it does not comprise the entire E gene sequence. This fragment was inserted at position 27535 and 28236 as there is one restriction site for KfII/SandD1 (see
[0296] The last 52 nucleotides of the sequence of the gene encoding E protein were maintained as they include part of the TRS of M gene. The synthesised fragment was cloned into the intermediate plasmid pBAC-SA-F6 (positions 25841 to 30162 of the viral genome) to generate a pBAC-SA-F6-MA30-ΔE, and into pBAC-SA-F6-MA30-Δ5 to generate a pBAC-SA-F6-MA30-Δ5-ΔE. The PacI-RsrII fragment of pBAC-SA-F6-MA30-ΔE and pBAC-SA-F6-MA30-Δ5-ΔE, which includes the KfII-Pfl23II region, was cloned into pBAC-MERS-MA30-FL to obtain the corresponding pBAC-MERS-MA30-ΔE and pBAC-MERS-MA30-Δ5-ΔE. Digestions of vectors with restriction enzymes were performed according to the manufacturer's instructions.
[0297] For the construction of MERS-MA30-Δ[3,4a,4b,5] and MERS-MA30-Δ[3,4a,4b,5,E] infectious cDNAs, an intermediate plasmid pUC57-F5-Δ3-MERS-MA30 was previously generated from pUC57-F5-Δ3-MERS (Almazan et al., 2013). The pUC57-F5-Δ3-MERS-MA30 includes the mutations acquired by MERS-MA30-6-1-2 in the region of the viral genome between nucleotides 20902 and 25840, as well as the deletion of the ORF3 gene. This region, flanked by SwaI and PacI restriction sites, was cloned into pBAC-MERS-MA30-FL and pBAC-MERS-MA30-ΔE to obtain a pBAC-MERS-MA30-Δ3 and a pBAC-MERS-MA30-Δ3-ΔE, respectively. Finally, a digestion with PacI and KfII/SanD1 was performed to delete genes 4a, 4b and 5, the fragments were separated by agarose gel electrophoresis and the digested vectors were purified. Since the ends resulting from the digestion were not cohesive with each other, blunt ends were generated with T4 phage DNA polymerase (New England Biolabs). For this, 300 ng of each digested plasmid were incubated with 1 U of enzyme per 1 μg of DNA for 30 minutes at 37° C. in the presence of dNTPs excess. The enzyme was then inactivated by treatment at 75° C. for 20 minutes and T4 phage DNA ligase (Roche) was added to ligate the ends, generating plasmids pBAC-MERS-MA30-Δ[3-5] and pBAC-MERS-MA30-Δ[3,4a,4b,5,E].
[0298] Optionally this replicon may comprise the polynucleotide sequence of the gene encoding S protein optimised for expression in mammalian cells by the procedure described in the next section.
[0299] 4. Obtaining V1-CD and V1-VLP RNA Replicons
[0300] To generate the V1-CD and V1-VLP replicons, two 4945 bp fragments, flanked by SwaI and PacI restriction sites, were chemically synthesised (GeneArt, Thermo Fisher Scientific) (
[0301] To include the nsp1-ΔD deletion, two fragments flanked by AscI and BbvCI restriction sites were chemically synthesised (GeneArt, Thermo Fisher Scientific): T7-nsp1-ΔD and nsp1-ΔD. These fragments contained the T7 promoter (T7P) or CMV promoter, respectively, and nucleotides 1 to 3123 of the MERS-MA30 genome, plus the deletion of nucleotides 792 to 827 of the MERS-MA30 genome. These fragments were digested with AscI and BbvCI enzymes and cloned into the same sites of the plasmids pBAC-MERS-MA30-Sopt-CD-Δ[3,4a,4b,5,E], for T7-nsp1-ΔD, and pBAC-MERS-MA30-Sopt-VLP-Δ[3,4a,4b,5,E], for nsp1-ΔD, leading to plasmids pBAC-MERS-MA-V1-CD and pBAC-MERS-MA-V1-VLP, respectively. These plasmids contained the sequences of the V1-CD and V1-VLP replicons (
[0302] To include the nsp1-ΔC deletion, two fragments flanked by AscI and BbvCI restriction sites were generated by chemical synthesis (GeneArt, Thermo Fisher Scientific): T7-nsp1-ΔC and nsp1-ΔC. These fragments contained the T7 promoter (T7P) or CMV promoter, respectively, and nucleotides 1 to 3123 of the MERS-MA30 genome, plus the deletion of nucleotides 708 to 734 of the MERS-MA30 genome.
[0303] To include a deletion in the nsp1 gene, two fragments flanked by the restriction sites AscI and BbvCI: T7-nsp1-Δ and nsp1-Δ were generated by chemical synthesis (GeneArt, Thermo Fisher Scientific). These fragments contained the T7 promoter (T7P) or CMV, respectively, and nucleotides 1 to 3123 of the MERS-MA30 genome, plus a deletion of between 27 and 36 nucleotides between positions 528 and 848 of the MERS-MA30 genome.
[0304] The above deletions in the gene encoding the nspl protein can be combined in any way and are included in the same fragment containing the T7 or CMV promoter.
[0305] 5. In Vitro Transcription of the V1-CD Replicon RNA
[0306] A previously described protocol for in vitro transcription of coronavirus RNAs (Eriksson K. K. et al, 2008, Methods in Mol. Biol. 454:237-254) was followed, with minor modifications. All processes were performed under RNase-free conditions and with RNase-free reagents. In the transcription reaction, 1 μg of undigested pBAC-MERS-MA-V1-CD plasmid as template, a Ribo m.sup.7G cap analogue (Promega) and the RiboMAX Large Scale RNA production system kit (Promega) were used. The final volume of each reaction was 50 μl, which were incubated for 2 h at 30° C. Subsequently, the template DNA was removed by adding 2 μl of RNase-free DNase and incubating the mixture at 37° C. for 20 min. Finally, the RNA was precipitated with LiCl, resuspended in 30 μl of RNase-free water and stored at −80° C. until use.
[0307] For administration into cell cultures, Lipofectamine 2000 (Life Technologies) was used under the same conditions as those used to transfect DNA. For administration to mice, the in vivo-jetRNA reagent (Polyplus transfection) was used, following the manufacturer's recommendations.
[0308] 6. Replication capacity or amplification of MERS-MA30-derived replicons in the presence or absence of the E protein. The replicative capacity of the constructed mutants was assessed in Huh-7 cells. These cells had previously been transiently transfected with the inducible plasmid TRE-Auto-rtTA-V10-2T-E-MERS-CoV expressing the E protein. The growth medium contained doxycycline at a concentration of 1000 ng/mL for induction of E protein expression. At 5 hpt, cells were infected with virus at an MOI (multiplicity of infection) of 0.001 and infection was monitored for 72 hours.
[0309] Other methods have been developed for the generation of packaging cell lines based on E protein mutants that inactivate E protein toxicity and provide highly efficient packaged MERS-CoV-derived RNA replicons.
[0310] In cells grown in medium without doxycycline, i.e. in the absence of the externally added E protein, MERS-MA30, and MERS-MA30-Δ[3,4a,4b,5] viruses followed very similar growth kinetics, with no significant differences (
[0311] No major differences were observed in the titers of the MERS-MA30-Δ[3,4a,4b,5] mutant, which only increased 2- to 4-fold in the presence of the E protein, and remained below the MERS-MA30 virus titers (
[0312] Complementation with the E protein in trans allows replicons with the gene encoding the E protein deleted to achieve at late times similar titers to those of the viruses from which they are derived. Moreover, deletion of accessory genes 3, 4a, 4b, and 5 resulted in attenuated growth of the MERS-MA30-Δ[3,4a,4b,5] mutant and the MERS-MA30-Δ[3,4a,4b,5,E] replicon, compared to the MERS-MA30 virus and the MERS-MA30-ΔE replicon, respectively, which included these genes. The absence of gene 5 did not appear to affect the growth of MERS-CoV in cell culture in the case of the MERS-MA30-Δ[5,E] replicon.
[0313] 7. Analysis of Virion Production by MERS-CoV-ΔE Replicon Compared with MERS-CoV WT Virus.
[0314] A comparative study of the morphogenesis of MERS-CoV WT virus and MERS-CoV-ΔE replicon was carried out. For this purpose, Huh-7 cells were infected in the absence of E protein. At 17 hpi, cells were embedded in resin, and sections were taken for observation by transmission electron microscopy (TEM) (
[0315] MERS-CoV-ΔE and MERS-MA30-Δ[3,4a,4b,5,E] formed virions inside the cell that were apparently similar to those formed by MERS-CoV WT, although only the VLPs formed by MERS-CoV-ΔE are shown. In cells infected with an MOI 1, MERS-CoV VVT showed a high cytopathic effect, with virus vesicles filled with spherical-shaped virions, whereas MERS-CoV-ΔE replicon vesicles were less frequent, with elongated shapes and fewer immature virions. A similar pattern was observed in cells infected with a MOI of 0.1 (results not shown), although the cytopathic effect in MERS-CoV WT infection was lower compared to infection at MOI 1. These results demonstrated that the MERS-CoV-ΔE replicon formed polymeric structures with high immunogenic potential.
[0316] 8. Attenuation of MERS-MA30 Mutants in KI Mice.
[0317] The pathogenicity of MERS-MA30-Δ[3,4a,4b,5] virus and MERS-MA30-ΔE, MERS-MA30-Δ[5,E] and MERS-MA30-Δ[3,4a,4b,5,E] replicons was evaluated in 16-week-old KI mice (Li et al., 2017). MERS-MA30 was used as a virulent reference virus. Of each virus or replicon, 1×10.sup.4 PFU were intranasally inoculated, and weight loss and survival were monitored for the next 13 days (
[0318] All mice inoculated with MERS-MA30 virus lost weight and died between 6 and 8 dpi. In contrast, mice infected with MERS-MA30-Δ[3,4a,4b,5] or with MERS-MA30-ΔE, MERS-MA30-Δ[5,E] or MERS-MA30-Δ[3,4a,4b,5,E] replicons did not lose weight, and all of them survived, indicating that all generated deletion mutants were attenuated. Lungs of mice inoculated with MERS-MA30 and MERS-MA30-Δ[3,4a,4b,5,E] were sampled at 3 and 6 dpi. From these samples, viral titer (
[0319] 9. Protection Provided by MERS-MA30 Deletion Mutants in KI Mice.
[0320] Mice immunised with the different deletion mutants were challenged 21 days post-immunisation (dpim) with a lethal dose of MERS-MA30 (1×10.sup.5 PFU per mouse) (
[0321] During the challenge, samples were taken at 2, 4 and 6 days post-challenge (dpc) from the lungs of challenged mice to analyse the protection conferred by MERS-MA30-Δ[3,4a,4b,5,E], and were used to measure viral replication and transcription, and virus titer. In the lungs of non-immunised mice, elevated replication and transcription levels were detected, which decreased slightly more than tenfold at days 4 and 6, but were still significantly high (
[0322] Neutralising antibody levels were determined in serum from mice immunised with the MERS-MA30-Δ[3,4a,4b,5,E] replicon and control mice (without the replicon) at 0 and 21 dpim by a neutralisation assay. Antibody titers are expressed as the highest dilution showing complete neutralisation of the cytopathic effect in 50% of the wells (TCID.sub.50) (
[0323] Taken together, these results demonstrated that virus MERS-MA30-Δ[3,4a,4b,5] and replicons MERS-MA30-ΔE, MERS-MA30-Δ[5, E] and MERS-MA30-Δ[3,4a,4b,5, E] induced protection in the experimental KI mouse model against a lethal dose of MERS-MA30 virus, and that the MERS-MA30-Δ[3,4a,4b,5,E]-derived RNA replicon is a safe, effective and very promising vaccine candidate. Similar results were obtained with the humanised transgenic mouse model (K18) and the replicon with the human virus sequence, not adapted to mice.
LIST OF SEQUENCES
[0324] This specification comprises the following sequences:
[0325] SEQ_ID 1: Nucleotide sequence of the vector containing the complete pBAC-MERS-CoV-Δ[3,4a,4b,5,E] replicon. Includes pBAC sequence (nucleotides 1 to 7889), RNA replicon (nucleotides 7890 to 35838) and pBAC sequence (nucleotides 35839 to 36179)
[0326] SEQ_ID 2: Nucleotide sequence of the vector containing the full-length pBAC-MERS-MA30-Δ[3,4a,4b,5,E] replicon. Includes pBAC sequence (nucleotides 1 to 7889), RNA replicon (nucleotides 7890 to 35838) and pBAC sequence (nucleotides 35832 to 36173)
[0327] SEQ_ID 3: Nucleotide sequence of the gene encoding the S protein of MERS-MA30-CoV with codons optimised for expression in mammalian cells
[0328] SEQ_ID 4: Nucleotide sequence of the gene encoding MERS-MA30-CoV S protein with codons not optimised for expression in mammalian cells
[0329] SEQ_ID 5: Nucleotide sequence of the gene encoding MERS-CoV protein S with codons optimised for expression in mammalian cells
[0330] SEQ_ID 6: Nucleotide sequence of the gene encoding MERS-CoV Protein S with codons not optimised for expression in mammalian cells
[0331] SEQ_ID 7: Nucleotide sequence of the gene encoding MERS-MA30-CoV protein S with codons optimised for expression in mammalian cells and modifications 24633_24634 delins CC and 24637_24638 delins CC
[0332] SEQ_ID 8: Nucleotide sequence of the gene encoding the S protein of MERS-CoV with codons optimised for expression in mammalian cells and modifications 24633_24634 delins CC and 24637_24638 delins CC
[0333] SEQ_ID 9: Nucleotide sequence of the chemically defined MERS-MA30-V1-CD replicon
[0334] SEQ_ID 10: Nucleotide sequence of the chemically defined MERS-CoV-V1-CD replicon
[0335] SEQ_ID 11: Nucleotide sequence of the MERS-MA30-V1-VLP replicon
[0336] SEQ_ID 12: Nucleotide sequence of the MERS-CoV-V1-VLP replicon
[0337] SEQ_ID 13: Nucleotide sequence of the T7P promoter
[0338] SEQ_ID 14: Nucleotide sequence of the 5′UTR
[0339] SEQ_ID 15: MISC nucleotide sequence
[0340] SEQ_ID 16: DLP nucleotide sequence
[0341] SEQ_ID 17: P2A nucleotide sequence
[0342] SEQ_ID 18: 3′UTR nucleotide sequence
[0343] SEQ_ID 19: PolyA tail nucleotide sequence
[0344] SEQ_ID 20: T7 terminator nucleotide sequence
[0345] SEQ_ID 21: Nucleotide sequence of MERS-MA30 virus
[0346] SEQ_ID 22: Primer nucleotide sequence (PCR primer) of VS-EcoRI-E-MERS-rtTA-V10-2T
[0347] SEQ_ID 23: Primer nucleotide sequence (PCR primer) of RS-EcoRI-EMERS-rtTA-V10-2T
[0348] SEQ_ID 24: Primer nucleotide sequence (PCR primer) of RS-E-MERS
[0349] SEQ_ID 25: Primer nucleotide sequence (PCR primer) of VS-TRE-Auto-2380
[0350] SEQ_ID 26: Primer nucleotide sequence (Taqman probes) gRNA-MERS
[0351] SEQ_ID 27: Primer nucleotide sequence (Taqman probes) sgmRNA-N-MERS
[0352] SEQ_ID 28: Primer nucleotide sequence (PCR primer) of VS MERS gRNA
[0353] SEQ_ID 29: Primer nucleotide sequence (PCR primer) of RS MERS gRNA
[0354] SEQ_ID 30: Primer nucleotide sequence (PCR primer) of Leader sgRNA
[0355] SEQ_ID 31: Primer nucleotide sequence (PCR primer) of sgRNA-N
REFERENCES
[0356] Almazán, F., DeDiego, M. L., Sola, I., Zuniga, S., Nieto-Torres, J. L., Marquez-Jurado, S., Andres, G., Enjuanes, L., 2013. Engineering a replication-competent, propagation-defective Middle East respiratory syndrome coronavirus as a vaccine candidate. MBio 4, e00650-00613.
[0357] Almazán, F., González, J. M., Penzes, Z., Izeta, A., Calvo, E., Plana-Duran, J., Enjuanes, L., 2000. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc. Natl. Acad. Sci. USA 97, 5516-5521.
[0358] Almazán, F., Marquez-Jurado, S., Nogales, A., Enjuanes, L., 2015. Engineering infectious cDNAs of coronavirus as bacterial artificial chromosomes. Methods Mol. Biol. 1282, 135-152.
[0359] Almazán, F., Sola, I., Zuñiga, S., Marquez-Jurado, S., Morales, L., Becares, M., Enjuanes, L., 2014. Coronavirus reverse genetic systems: Infectious clones and replicons. Virus Res. 189, 262-270.
[0360] Das, A. T., Tenenbaum, L., Berkhout, B., 2016a. Tet-On Systems For Doxycycline-inducible Gene Expression. Curr. Gene Ther. 16, 156-167.
[0361] Das, A. T., Zhou, X., Metz, S. W., Vink, M. A., Berkhout, B., 2016b. Selecting the optimal Tet-On system for doxycycline-inducible gene expression in transiently transfected and stably transduced mammalian cells. Biotechnol. J. 11, 71-79.
[0362] González, J. M., Penzes, Z., Almazán, F., Calvo, E., Enjuanes, L., 2002. Stabilization of a full-length infectious cDNA clone of transmissible gastroenteritis coronavirus by insertion of an intron. J. Virol. 76, 4655-4661.
[0363] Jimenez-Guardeño J M, Regla-Nava J A, Nieto-Torres J L, DeDiego M L, Castaño-Rodriguez C, Fernandez-Delgado R, Perlman S, Enjuanes L. Identification of the Mechanisms Causing Reversion to Virulence in an Attenuated SARS-CoV for the Design of a Genetically Stable Vaccine. PLoS Pathog. 2015 Oct. 29; 11(10):e1005215. doi: 10.1371/journal.ppat.1005215. PMID: 26513244; PMCID: PMC4626112.
[0364] Li, K., Wohlford-Lenane, C. L., Channappanavar, R., Park, J. E., Earnest, J. T., Bair, T. B., Bates, A. M., Brogden, K. A., Flaherty, H. A., Gallagher, T., Meyerholz, D. K., Perlman, S., McCray, P. B., Jr., 2017. Mouse-adapted MERS coronavirus causes lethal lung disease in human DPP4 knockin mice. Proc. Natl. Acad. Sci. USA 114, E3119-E3128.
[0365] Livak, K. J., Schmittgen, T. D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.
[0366] Lundstrom, K., 2018. Self-replicating RNA viruses for RNA therapeutics. Molecules 23, 3310.
[0367] Mairhofer, J., Grabherr, R., 2008. Rational vector design for efficient non-viral gene delivery: challenges facing the use of plasmid DNA. Mol. Biotechnol. 39, 97-104.
[0368] Mairhofer, J., Pfaffenzeller, I., Merz, D., Grabherr, R., 2008. A novel antibiotic free plasmid selection system: advances in safe and efficient DNA therapy. Biotechnol. J. 3, 83-89.
[0369] Ortego, J., Escors, D., Laude, H., Enjuanes, L., 2002. Generation of a replication-competent, propagation-deficient virus vector based on the transmissible gastroenteritis coronavirus genome. J. Virol. 76, 11518-11529.
[0370] Pallesen J, Wang N, Corbett K S, et al. Immunogenicity and structures of a rationally designed prefusion MERS-CoV spike antigen. Proc Natl Acad Sci USA. 2017; 114(35):E7348-E7357. doi:10.1073/pnas.1707304114
[0371] Reed, L. J., Muench, H., 1938. Virus titers (50% tissue culture infectious doses/ml, TCID50/ml) were calculated using the method of Reed & Muench. Am. J. Hyg. 27, 493-497.
[0372] Sambrook, J., Russell, D. W., 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
[0373] van Boheemen, S., de Graaf, M., Lauber, C., Bestebroer, T. M., Raj, V. S., Zaki, A. M., Osterhaus, A. D., Haagmans, B. L., Gorbalenya, A. E., Snijder, E. J., Fouchier, R. A., 2012. Genomic characterization of a newly discovered coronavirus associated with acute respiratory distress syndrome in humans. MBio 3, e00473-00412.
[0374] Wang, K., Boysen, C., Shizuya, H., Simon, M. I., Hood, L., 1997. Complete nucleotide sequence of two generations of a bacterial artificial chromosome cloning vector. Biotechniques 23, 992-994.