GENETICALLY-MODIFIED CELL LINE FOR NK CELL ACTIVATION AND AMPLIFICATION, AND USE THEREOF

Abstract

A feeder cell for culturing natural killer (NK) cells, genetically engineered to express membrane bound interleukin-18 (mbIL-18), membrane bound interleukin-21 (mbIL-21), and/or OX40L. A method of proliferating NK cells, including: obtaining a blood sample containing a population of NK cells; and contacting at least a part of the population of NK cells with a genetically engineered cell, where the genetically engineered cell is genetically engineered to express mbIL-18, mbIL-21, and/or OX40L.

Claims

1. A feeder cell for culturing natural killer (NK) cells, genetically engineered to express membrane bound interleukin-18 (mbIL-18), membrane bound interleukin-21 (mbIL-21), and/or OX40L.

2. The feeder cell of claim 1, wherein the feeder cell is selected from the group consisting of K562, RPMI8866, EBV_LCL 721.221, HFWT, and NK-92 cells.

3. The feeder cell of claim 1, comprising a nucleic acid encoding mbIL-18 and mbIL-21.

4. A composition for culturing NK cells, comprising the feeder cell of claim 1.

5. A method of proliferating NK cells, comprising: obtaining a blood sample containing a population of NK cells; and contacting at least a part of the population of NK cells with a genetically engineered cell, wherein the genetically engineered cell is genetically engineered to express membrane bound interleukin-18 (mbIL-18), membrane bound interleukin-21 (mbIL-21), and/or OX40L.

6. The method of claim 5, wherein the contacting comprises co-culturing the genetically engineered cell and the population of NK cells to expand a subpopulation of the NK cells.

7. The method of claim 6, wherein the co-culturing is performed in the presence of cytokines.

8. The method of claim 7, wherein the cytokines are at least one selected from the group consisting of IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL8 (CXCL8), IL9, IL10, IL11, IL12, IL13, IL14, IL15, IL16, IL17, IL18, IL19, IL20, IL21, IL22, IL23, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL35, and IL36.

9. The method of claim 8, wherein the cytokines are IL-18 and IL-21.

10. The method of claim 6, wherein the co-culturing is performed for 2 to 30 days.

11. The method of claim 5, wherein the blood sample is a whole blood sample.

12. The method of claim 5, wherein the genetically engineered cell is treated with radiation of 50 Gy to 300 Gy.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0051] FIG. 1A is a graph confirming characteristics of expression of mbIL-18 and mbIL-21 in feeder cells according to an aspect.

[0052] FIG. 1B is a combined image of feeder cells according to an aspect and mIL-18 and mIL-21 (left) and a graph (right) in which the amounts of mIL-18 and mIL-21 are quantified by fluorescence intensity.

[0053] FIG. 2A is a graph showing the fold expansion of NK cells when the NK cells are exposed for a short period of time to IL-21 alone or IL-18 and IL-21, in the presence of K562-OX40L cells.

[0054] FIG. 2B is a graph showing the purity of NK cells when the NK cells are exposed for a short period of time to IL-21 alone or IL-18 and IL-21, in the presence of K562-OX40L cells.

[0055] FIG. 2C is graphs showing fold expansions of NK cells when the NK cells are exposed for a short period of time to IL-21 alone or IL-18 and IL-21, in the presence of K562-OX40L cells.

[0056] FIG. 3 is a graph comparing the expansion (left) and purity (right) of NK cells using feeder cells according to an aspect.

[0057] FIGS. 4A and 4B are graphs comparing markers expressed in healthy donor (HD)-derived NK cells expanded by using feeder cells according to an aspect.

[0058] FIG. 5A is a graph confirming cytokines expressed in a healthy donor (HD)-derived NK cells expanded by using feeder cells according to an aspect.

[0059] FIG. 5B is a graph showing the results of CD107a degranulation analysis of a healthy donor (HD)-derived NK cells expanded by using feeder cells according to an aspect.

[0060] FIG. 6A is a graph confirming the cytotoxicity of healthy donor (HD)-derived NK cells expanded by using feeder cells according to an aspect.

[0061] FIG. 6B is a graph confirming antibody-dependent cellular cytotoxicity (ADCC) of a healthy donor (HD)-derived NK cells expanded by using feeder cells according to an aspect.

MODE OF DISCLOSURE

[0062] Hereinafter, preferred embodiments are presented to help the understanding of the present disclosure. However, the following embodiments are only provided for an easier understanding of the present disclosure, and the contents of the present disclosure are not limited by the following embodiments.

EXAMPLES

Example 1. Preparation of Genetically Engineered Feeder Cells

[0063] Feeder cells expressing membrane bound interleukin-18 (mbIL-18), membrane bound interleukin-21 (mbIL-21), and/or OX40L were prepared. Specifically, a human-derived mbIL18 gene (SEQ ID NO: 1) and a human-derived mbIL21 gene (SEQ ID NO: 2) were cloned into a lentiviral vector, pCDH-CMV-RFP, to prepare recombinant lentiviral production vectors. Then, the recombinant gene (pCDH-CMV-RFP-mbIL-1821) prepared above for virus production was transfected into 293FT cells by using lipofectamin3000 (Invitrogen) together with a packaging vector. After a period of time, the medium was replaced with a fresh medium and the cells were cultured for 48 hours, and then the medium containing the virus was recovered. The recovered medium was centrifuged at 500×g for 10 minutes, and only the pure medium containing the virus was separated by using a 0.45 μm filter to produce a mbIL18-mbIL21-expressing lentivirus. Thereafter, 1 ml of the lentivirus expressing mbIL18-mbIL21 was dissolved in 9 ml of the medium containing K562-OX40L cells of Comparative Example 1 below and added with polybrene (8 μg/ml), and cell culturing was proceeded for 48 hours. Next, in order to select only infected cells, only cells expressing both green and red fluorescence were selected by using an automatic ultrafast cell sorter, and the expression of mbIL18-mbIL21 was analyzed by flow cytometry (FACS) to produce a K562 cell line expressing mbIL18-mbIL21 (hereinafter, “K562-OX40L-mbIL18-mbIL21”).

COMPARATIVE EXAMPLE

Comparative Example 1. Preparation of Genetically Engineered Feeder Cells

[0064] Feeder cells expressing OX40L were prepared. Specifically, a human-derived OX40L gene (SEQ ID NO: 3) was cloned into a lentiviral vector, pLVX-IRES-ZsGreen, to prepare a recombinant lentiviral production vector. Then, the recombinant gene (OX40L-pLVX-IRES-ZsGreen) was transfected into 293FT cells by using lipofectamin3000 (Invitrogen) together with a packaging vector for virus production. After a period of time, the medium was replaced with a fresh medium and the cells were cultured for 48 hours, and then the medium containing the virus was recovered. The recovered medium was centrifuged at 500×g for 10 minutes, and only the pure medium containing the virus was separated by using a 0.45 μm filter to produce an OX40L-expressing lentivirus. Thereafter, 1 ml of the lentivirus expressing OX40L was dissolved in 9 ml of medium (RPMI 1640) containing K562 cells and added with polybrene (8 μg/ml), and cell culturing proceeded for 48 hours. Next, in order to select only infected cells, only cells expressing green fluorescence were selected by using an automatic ultrafast cell sorter, and the expression of OX40L was analyzed by flow cytometry (FACS) to produce a K562 cell line expressing OX40L (hereinafter, “K562-OX40L”).

EXPERIMENTAL EXAMPLES

Experimental Example 1. Characteristics of Genetically Engineered Feeder Cells

[0065] In order to confirm the characteristics of expression of mbIL-18 and mbIL-21 of the genetically engineered feeder cells according to an aspect, expression levels of mRNA and surface protein were identified.

[0066] Specifically, the total RNA of the K562-OX40L-mbIL18-mbIL21 cell line prepared in Example 1 and the K562-OX40L cell line prepared in Comparative Example 1 was isolated by using an RNeasy Mini Kit (Qiagen, Venlo, Netherlands) and quantified by using an IMPLEN Nanophotometer P330 (IMPLEN, Munich, Germany). Thereafter, the isolated RNA was converted to cDNA by using a QuantiTect Reverse Transcription Kit (Qiagen), and then PCR was performed in a standard 20 μl reaction volume by using a QuantiTect SYBR Green PCR Kit (Qiagen) and Rotor-Gene Q (Qiagen). In this regard, the primers in Table 1 below were used, and all experiments were repeated three times.

TABLE-US-00001 TABLE 1 Primer Accession Gene Direction sequence (5′ to 3′) No. IL-18 Forward CATTGACCAAGGAAATCGGC NM_001562 Reverse CACAGAGATAGTTACAGCCA TACC IL-21 Forward AAGCTGAAGAGGAAACCACC NM_021803 Reverse TCTTTCTAGGAATTCTTTGGG TGG GAPDH Forward ACATCGCTCAGACACCATG NM_002046 Reverse TGTAGTTGAGGTCAATGAAG GG

[0067] FIG. 1A is a graph confirming characteristics of expression of mbIL-18 and mbIL-21 in feeder cells according to an aspect.

[0068] FIG. 1B is a combined image of the feeder cells according to an aspect and mIL-18 and mIL-21 (left) and a graph (right) in which the amounts of mIL-18 and mIL-21 are quantified by fluorescence intensity.

[0069] As a result, as shown in FIG. 1A, mbIL-18 and mbIL-21 mRNA were detected in the feeder cells of Embodiment 1, but mbIL-18 and mbIL-21 mRNA were not detected in the feeder cells of Comparative Example 1. In addition, as shown in FIG. 1B, it was confirmed that larger amounts of IL-18 and IL-21 were continuously expressed on the surface of the feeder cells of Embodiment 1 compared to the feeder cells of Comparative Example 1.

[0070] Experimental Example 2. Confirmation of NK Cell Activation Through Addition of K562-OX40L Cells, and IL18 and IL21

[0071] In order to predict the NK cell activation efficacy of the genetically engineered feeder cells according to an aspect, the degree of NK cell activation according to the addition of cytokines in K562-OX40L cells was confirmed in a preliminary experiment.

[0072] Specifically, the K562-OX40L cell line prepared in Comparative Example 1 was cultured in a T-25 flask containing 25 ml of complete RPMI 1640 medium (containing FBS, penicillin, and streptomycin) at 37° C. in an incubator supplied with 5% of CO.sub.2. Thereafter, centrifugation was performed under the condition of 400×g for 3 minutes, and the cell pellet was resuspended in 5 ml of complete RPMI 1640 medium to harvest feeder cells. Thereafter, in order to prevent excessive growth of the feeder cells, the feeder cells were irradiated with gamma rays at 100 Gy by using a Gammacell 3000 Elan radiator and used in subsequent experiments.

[0073] In order to isolate peripheral blood mononuclear cells (PBMCs), normal donor's whole blood: PBS was diluted at a ratio of 1:2 (10 ml of whole blood: 20 ml of PBS) and overlaid on a 15 ml Lymphoprep. Next, centrifugation was performed without a brake under the condition of 1200×g for 25 minutes at room temperature (acceleration 1, deceleration 0), cells were harvested from the buffy coat layer, and washed three times with PBS while being centrifuged at 400×g for 7 minutes. After inoculating the 3×10.sup.6 isolated peripheral blood mononuclear cells and 0.5×10.sup.6 K562-OX40L cells irradiated at 100 Gy onto a 24-well plate containing 1 ml of NK cell medium, 1 ml of NK cell medium containing 20 U/ml of IL-2 was added to make a total medium volume of 2 ml/well and a final concentration of IL-2 of 10 U/ml, and then after gently pipetting to mix, the mixture was cultured in a 5% CO.sub.2 incubator at 37° C. On the 7th day of culturing, 100 U/ml of IL-2 and 5 ng/ml of IL-15 were added to the medium, and cultured for 14 days, replacing with fresh medium every 2 to 3 days. Thereafter, 5 ng/ml of IL-21, and/or 25, 50, and 100 ng/ml of IL-18 were added on day 0 of the culturing and further cultured for 14 days.

[0074] The expansion of NK cells was confirmed by using fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD 3 and PE-Cy5-conjugated mouse anti-human CD 56 monoclonal antibodies, and each fold expansion was identified with the purity of the NK cells, when treating with K562 cells and IL-2/IL-15, as a baseline.

[0075] FIG. 2A is a graph showing fold expansion of NK cells when the NK cells were exposed to IL-21 alone or IL-18 and IL-21, in the presence of K562-OX40L cells for a short period of time.

[0076] FIG. 2B is a graph showing purity of NK cells when the NK cells were exposed for a short period of time to IL-21 alone or IL-18 and IL-21, in the presence of K562-OX40L cells.

[0077] As a result, as shown in FIG. 2A, the effect of short-term exposure of NK cells to IL-18 and IL-21 was not identified until the 21st day. However, the expansion of NK cells was confirmed to be significantly increased after 28 days. In addition, as shown in FIG. 2B, NK cell purity of the NK cells exposed for a short period to both II-18 and IL-21 was confirmed to be higher than that of the NK cells treated with IL-21 only on the 28th day.

[0078] FIG. 2C is graphs showing fold expansions of NK cells when the NK cells were exposed for a short period of time to IL-21 alone or IL-18 and IL-21, in the presence of K562-OX40L cells.

[0079] As a result, as shown in FIG. 2C, activity of NK cells was confirmed to be increased by about 2 to 4 times when K562-OX40L cells were treated with both of IL-18 and IL-21, compared to when IL-18 or IL-21 was each treated.

[0080] These results indicate that OX40L-expressing cells not only significantly increase the activity of NK cells, but also synergistically increase the activity of NK cells with additional treatment of IL-18 and IL-21 for a short period of time. That is, feeder cells expressing OX40L may exhibit a synergistic effect on the activity of NK cells by treatment with IL-18 and IL-21.

[0081] Experimental Example 3. NK Cell Activation and Expansion by Using K562-OX40L-mbIL18-mbIL21 Cells

[0082] Based on the results of Experimental Example 2, the effect of K562-OX40L-mbIL18-mbIL21 cells prepared in Example 1 on activity of NK cells was identified.

[0083] Specifically, the K562-OX40L-mbIL18-mbIL21 cell line of Embodiment 1 was cultured in a T-25 flask containing 25 ml of complete RPMI 1640 medium in an incubator supplied with 5% CO.sub.2 at 37° C. Thereafter, centrifugation was performed under the condition of 400×g for 3 minutes, and the cell pellet was resuspended in 5 ml of complete RPMI 1640 medium to harvest feeder cells. Thereafter, in order to prevent excessive growth of the feeder cells, the feeder cells were irradiated with gamma rays at 100 Gy by using a Gammacell 3000 Elan radiator and used in subsequent experiments. After inoculating the 3×10.sup.6 isolated peripheral blood mononuclear cells and 0.5×10.sup.6 K562-OX40L cells irradiated at 100 Gy onto a 24-well plate containing 1 ml of NK cell medium in the same manner as in Experimental Example 2, 1 ml of NK cell medium containing 20 U/ml of IL-2 was added to make a total medium volume of 2 ml/well and a final concentration of IL-2 of 10 U/ml, and then after gently pipetting to mix, the mixture was cultured in a 5% CO.sub.2 incubator at 37° C. On the 7th day of culture, 100 U/ml of IL-2 and 5 ng/ml of IL-15 were added to the medium, and cultured for 14 days, replaced with a fresh medium every 2 to 3 days. As a control group, K562 cells were used. The degree of activation of NK cells was confirmed in the same manner as in Experimental Example 2 by identifying the purity and fold expansion of NK cells.

[0084] FIG. 3 is graphs comparing the expansion (left) and purity (right) of NK cells using the feeder cells according to an aspect.

[0085] As a result, as shown in FIG. 3, with the feeder cells of Embodiment 1, the fold expansion of NK cells was confirmed to be significantly increased compared to the control group. In particular, in the case of the control group, NK cells did not show any further increase after increasing until day 35 after culturing. However, Embodiment 1 showed a significant increase until the 42nd day after culturing and showed a decreasing pattern thereafter, but it was confirmed that continuous expansion is possible. In addition, it was confirmed that the purity of the NK cells cultured by using the feeder cells of Embodiment 1 was significantly higher than that of the NK cells cultured by using the cells of the control group.

[0086] That is, the feeder cells according to an aspect not only significantly increase the activity of NK cells, but also allow long-term culturing of NK cells, so that NK cells may be mass-proliferated and used as a cell therapeutic agent.

[0087] Experimental Example 4. Phenotypic Characteristics of NK Cells Expanded by K562-OX40L-mbIL18-mbIL2 Cells

[0088] Phenotypic characteristics of NK cells expanded by K562-OX40L-mbIL18-mbIL2 cells were identified. Specifically, after washing the 2×10.sup.5 NK cells, which is derived from a healthy donor (HD) and expanded in Experimental Example 2, with FACS buffer (PBS containing 1% of FBS), the NK cells were treated with APC-Cyanine7-conjugated mouse anti-human CD3 and PE-Cyanine7-conjugated anti-human CD56 membrane antibodies for 15 minutes. Then, cells were harvested and further stained with different fluorescence-conjugated anti-human CD16, CD69, NKG2D, NKp30, NKp44, NKp46, CD94, CD158a, and CD158b membrane antibodies, for 30 minutes. Thereafter, the cells were washed with FACS buffer, and data were acquired by using a FACS Calibur and analyzed with Kaluza.

[0089] FIGS. 4A and 4B are graphs comparing markers expressed in a healthy donor (HD)-derived NK cells expanded by using the feeder cells according to an aspect.

[0090] As a result, as shown in FIG. 4, NK cells expanded by feeder cells expressing OX40L, mbIL18 and mbIL21 were confirmed not only to exhibit high NK purity (>90%), but also to show increased expression of NK cell activation markers at day 14 compared to the initial stage of the culturing.

[0091] That is, it may be seen that the NK cells expanded by the feeder cells according to an aspect have the complete functional characteristics of NK cells.

Experimental Example 5. Identification of Degree of Activation of NK Cells Amplified by K562-OX40L-mbIL18-mbIL2 Cells

[0092] As expression of the activating receptor increases, activation of the expanded NK cells must also increase, and thus, immunomodulatory activity by cytokine release and cytotoxicity of NK cells was evaluated, wherein the NK cells were derived from cells of a healthy donor HD and expanded by using the feeder cells of Example 1.

[0093] 5-1. Measurement of Intracellular IFN-γ

[0094] In order to evaluate the immunomodulatory activity, intracellular IFN-γ was measured to evaluate the cytotoxicity of NK cells. Specifically, 2×10.sup.5 NK cells derived from a healthy donor HD expanded by using the feeder cells of Embodiment 1 were cultured in a 96-well round bottom plate in the presence of brefeldin A (BD Biosciences) and Monensin (BD Biosciences) at 37° C. and under the condition of 5% CO.sub.2 for 5 hours. The cells were then harvested, washed with FACS buffer, and stained with anti-human CD3 and CD56 membrane antibodies for 20 minutes. After washing, fixing and permeabilization, NK cells were further stained with PE-conjugated anti-human IFN-γ antibody on ice for 30 min. Thereafter, the cells were washed and analyzed by using a FACS Calibur flow cytometer.

[0095] FIG. 5A is a graph confirming cytokines expressed in a healthy donor (HD)-derived NK cells expanded by using the feeder cells according to an aspect.

[0096] As a result, as shown in FIG. 5A, it was confirmed that the expression level of IFN-γ in NK cells derived from a healthy donor was significantly increased while the NK cells were being expanded.

[0097] 5-2. Confirmation of Degranulation of CD107a and Cytotoxicity

[0098] The 2×10.sup.5 NK cells derived from a healthy donor HD expanded in Experimental Example 5-1, 2×10.sup.5 target cells (K562, U266, RPMI8226), and PE-conjugated anti-human CD107a were cultured in a 96-well U-bottom plate. After 1 hour, Monensin and brefeldin A (BD Biosciences) were added, and the cells were additionally cultured for 4 hours. Then, NK cells were obtained by staining with anti-human CD3 and CD56 antibodies.

[0099] FIG. 5B is a graph showing the results of CD107a degranulation analysis of a healthy donor (HD)-derived NK cells expanded by using the feeder cells according to an aspect.

[0100] As a result, as shown in FIG. 5B, after 14 days compared to the initial stage of culturing (day 0), CD107a expression was confirmed to be significantly increased in all the cells (K562, U266, RPMI8226) cultured with healthy donor-derived NK cells.

[0101] That is, the results indicate that NK cells with increased activity were successfully generated from peripheral blood mononuclear cells of a healthy donor. Therefore, the feeder cells expressing OX40L, mbIL18, and mbIL21 according to an embodiment are effective for generating NK cells with increased activity.

Experimental Example 6. Confirmation of Cytotoxicity of NK Cells Expanded by K562-OX40L-mbIL18-mbIL2 Cells

[0102] Cytotoxicity was confirmed in order to identify the efficacy of the NK cells expanded by the feeder cells according to an aspect as an antibody therapeutic agent.

[0103] Specifically, cytotoxicity of NK cells for target cells on day 14 was measured by a CFSE-based assay for 4 hours. Specifically, target cells were stained with 0.5 μM of carboxyfluorescein succinimidyl ester (CFSE) at 37° C. for 10 minutes in FACS buffer, and washed twice with completed medium. Then, 5×10.sup.4 target cells were placed in a 96-well round bottom plate in triplicate, and the NK cells derived from a healthy donor (HD) and NK cells derived from multiple myeloma (MM) patient were each mixed in an effector-to-target (E:T) ratio of 0.5:1, 1:1 and 2:1. The plate was centrifuged at 1,500 rpm for 3 minutes and then incubated for 4 hours in a 5% CO 2 incubator at 37° C. Thereafter, the mixed cells were then transferred to FACS tubes and 1 μl of 1 mg/mL propidium iodide (PI) (SigmaAldrich, St. Louis, Mo., USA) was added to each tube. Cells were then harvested by using a FACS Calibur and analyzed with Kaluza software. The percentage of target cells that died (CFSF-positive and PI-positive) was calculated after subtracting the percentage of target cells that died spontaneously.

[0104] FIG. 6A is a graph confirming the cytotoxicity of a healthy donor (HD)-derived NK cells expanded by using the feeder cells according to an aspect.

[0105] FIG. 6B is a graph confirming antibody-dependent cellular cytotoxicity (ADCC) of a healthy donor (HD)-derived NK cells expanded by using the feeder cells according to an aspect.

[0106] As a result, as shown in FIG. 6A, the NK cells expanded by using the feeder cells of Example 1 were confirmed to exhibit the same cytotoxicity as the NK cells expanded by using the K562 feeder cells. In addition, as shown in FIG. 4B, the NK cells expanded by using the feeder cells of Embodiment 1 were confirmed to exhibit similar ADCC activity in Raji cells bound to Rituximab as the NK cells expanded by using the K562 feeder cells.

[0107] That is, the NK cells expanded by the feeder cells according to an aspect exhibit cytotoxicity, and thus may be utilized as an antibody therapeutic agent.

[0108] The above description of the present disclosure is for illustrative purposes, and those with average knowledge in the art to which the present disclosure belongs will be able to understand that the embodiments and examples may be easily modified without changing the technical idea or essential features of the disclosure. Therefore, it should be understood that the above examples are not limitative, but illustrative in all aspects.