GENETICALLY MANIPULATED CELL STRAIN FOR ACTIVATING AND AMPLIFYING NK CELLS AND USE THEREOF

Abstract

A cell genetically engineered for activating natural killer (NK) cells. The genetically engineered cell for activating NK cells synergistically induces the proliferation and activation of NK cells in a sample, thereby producing effects that can be usefully utilized in a method of proliferating NK cells, a method of measuring NK cells proliferated by the method, or an activation degree of NK cells, or a method of diagnosing an NK cell activity-related disease. A feeder cell for culturing a natural killer (NK) cell, genetically engineered to express membrane bound interleukin-18 (mbIL-18) and membrane bound interleukin-21 (mbIL-21).

Claims

1. A feeder cell for culturing a natural killer (NK) cell, genetically engineered to express membrane bound interleukin-18 (mbIL-18) and membrane bound interleukin-21 (mbIL-21).

2. The feeder cell of claim 1, wherein the feeder cell is at least one selected from the group consisting of K562, RPMI8866 EBV_LCL, 721.221, HFWT, and NK-92 cells.

3. The feeder cell of claim 1, wherein the feeder cell includes a nucleic acid encoding mbIL-18 and mbIL-21.

4. A composition for culturing a natural killer (NK) cell, comprising the feeder cell of claim 1.

5. A method of proliferating a natural killer (INK) cell, the method comprising: obtaining a blood sample containing a population of NK cells; and contacting at least a portion of the population of NK cells with a cell genetically engineered to activate NK cells, wherein the genetically engineered cell is genetically engineered to express membrane bound interleukin-18 (mbIL-18) and membrane bound interleukin-21 (mbIL-21).

6. The method of claim 5, wherein the contacting comprises co-culturing the genetically engineered cell and the population of NK cells to expand a subpopulation of NK cells.

7. The method of claim 6, wherein the co-culturing is performed in the presence of cytokines.

8. The method of claim 7, wherein the cytokines comprise at least one selected from the group consisting of IL1 IL2, IL3, IL4, IL5, IL6, IL7, IL8 (CXCL8), IL9, IL10, IL11, IL12, IL13, IL14, IL15, IL16, IL17, IL18, IL19, IL20, IL21, IL22, IL23, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL35, and IL36.

9. The method of claim 8, wherein the cytokines comprise IL-18 and IL-21.

10. The method of claim 6, wherein the co-culturing is performed for 2 days to 30 days.

11. The method of claim 5, wherein the blood sample is a whole blood sample.

12. The method of claim 5, wherein the genetically engineered cell is treated with radiation in a range of about 50 gray (Gy) to about 300 Gy.

13. A method of examining activity of a natural killer (NK) cell, the method comprising: obtaining a blood sample containing a population of NK cells; contacting at least a portion of the population of NK cells with a cell genetically engineered to activate NK cells, to activate NK cells, the genetically engineered cell being genetically engineered to express membrane bound interleukin-18 (mbIL-18) and membrane bound interleukin-21 (mbIL-21); and analyzing an activation degree of the activated NK cells.

14. The method of claim 13, wherein the blood sample is a whole blood sample.

15. The method of claim 13, wherein the analyzing of the activation degree of the activated NK cells comprises measuring at least one selected from the group consisting of degranulation activity, cytotoxic activity, and cytokines secreted by NK cell stimulation.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0064] FIG. 1A is a schematic diagram showing the gene of a lentivirus that produces mbIL-18 and mbIL-21 in order to prepare feeder cells according to an aspect.

[0065] FIG. 1B is a graph confirming the expression characteristics of mbIL-18 and mbIL-21 in feeder cells according to an aspect.

[0066] FIG. 2A is graphs showing the fold expansion (left) and purity (right) of NK cells when feeder cells according to an aspect and NK cells are cultured in a complete RPMI 1640 medium.

[0067] FIG. 2B is graphs showing the fold expansion (left) and purity (right) of NK cells when feeder cells according to an aspect and NK cells are cultured in a DS medium.

[0068] FIG. 2C is graphs comparing the fold expansion (left) and purity (right) of NK cells when feeder cells according to an aspect and NK cells are cultured in a complete RPMI 1640 medium and a DS medium.

[0069] FIGS. 3A and 3B are graphs comparing markers expressed in expanded NK cells, wherein the NK cells are expanded by using feeder cells (blue) according to an aspect and K562 feeder cells (red) in an RPMI 1640 medium and a DS medium.

[0070] FIG. 4A is a graph confirming the cytotoxicity of NK cells from healthy donors (HDs) expanded by using feeder cells according to an aspect.

[0071] FIG. 4B is a graph confirming the antibody-dependent cellular cytotoxicity (ADCC) of NK cells from HDs expanded by using feeder cells according to an aspect.

[0072] FIGS. 5A and 5B are graphs measuring the expression of CD107a in NK cells stimulated by feeder cells according to an aspect.

[0073] FIGS. 5C and 5D are graphs measuring the lysis rates of target cells by NK cells stimulated by feeder cells according to an aspect.

MODE OF DISCLOSURE

[0074] Hereinafter, preferable Examples are presented to help understanding of the present disclosure. However, the following examples are only presented for easier understanding of the present disclosure, and the contents of the present disclosure are not limited by the following examples.

EXAMPLES

Example 1. Preparation of Genetically Engineered Feeder Cells

[0075] Feeder cells that express membrane bound interleukin-18 (mbIL-18) and membrane bound interleukin-21 (mbIL-21) were prepared.

[0076] In detail, a human-derived mbIL18 gene (SEQ ID NO: 1) and a human-derived mbIL21 gene (SEQ ID NO: 2) were cloned into a lentiviral vector, pCDH-CMV-RFP, to prepare a recombinant vector for producing a lentivirus (FIG. 1A). Then, the recombinant gene (pCDH-CMV-RFP-mbIL-1821) prepared for virus production was transfected into 293FT cells by using lipofectamin3000 (Invitrogen) together with a packaging vector. After a period of time, the medium was replaced with a fresh medium to culture the cells for 48 hours, and then the medium containing the virus was recovered. The recovered medium was centrifuged at a speed of 500×g for 10 minutes, and only the pure medium containing the virus was separated through a 0.45 μm filter to produce an mbIL18-mbIL21-expression lentivirus. Then, 1 ml of the mbIL18-mbIL21 expression lentivirus was dissolved in 9 ml of a medium containing K562 cells, and polybrene (8 μg/ml) was added thereto, followed by cell culture for 48 hours. Next, in order to select only infected cells, only cells expressing red fluorescence were selected by using an automated high-speed cytomer sorting system, and whether the mbIL18-mbIL21 was expressed was analyzed by using a fluorescence activated cell sorter (FACS), so as to produce a K562 cell line (hereinafter referred to as “K562-mbIL18-mbIL21”).

EXPERIMENTAL EXAMPLES

Experimental Example 1. Cellular Characteristics of Genetically Engineered Feeder Cells

[0077] In order to confirm the characteristics of the mbIL-18 and mbIL-21 expression of the genetically engineered feeder cells according to an aspect, the mRNA and surface protein expression levels were measured.

[0078] In detail, the total RNA of the K562-mbIL18-mbIL21 cell line and K562 feeder cell line prepared in Example 1 was isolated by using an RNeasy Mini Kit (Qiagen, Venlo, Netherlands) and then quantified by using an IMPLEN Nanophotometer P330 (IMPLEN, Munich, Germany). Afterwards, the isolated RNA was converted to cDNA by using a QuantiTect Reverse Transcription Kit (Qiagen), and PCR was performed thereon with a standard reaction volume of 20 μl by using a QuantiTect SYBR Green PCR Kit (Qiagen) and Rotor-Gene Q (Qiagen). Here, primers shown in Table 1 were used, and all experiments were repeated three times.

TABLE-US-00001 TABLE 1 Primer Accession Gene Direction sequence (5′ to 3′) No. IL-18 Forward CATTGACCAAGGAAATCGGC NM_001562 Reverse CACAGAGATAGTTACAGCCA TACC IL-21 Forward AAGCTGAAGAGGAAACCACC NM_021803 Reverse TCTTTCTAGGAATTCTTTGGG TGG GAPDH Forward ACATCGCTCAGACACCATG NM_002046 Reverse TGTAGTTGAGGTCAATGAAG GG

[0079] FIG. 1B is a graph confirming the expression characteristics of mbIL-18 and mbIL-21 in the feeder cells according to an aspect.

[0080] As a result, as shown in FIG. 1B, the mbIL-18 and mbIL-21 mRNA was detected in the feeder cells of Example 1, whereas the mbIL-18 and mbIL-21 mRNA was not detected in the K562 feeder cells. That is, it was confirmed that the genetically engineered feeder cells according to an embodiment had the expression characteristics of mbIL-18 and mbIL-21.

Experimental Example 2. Activation and Expansion of NK Cells by K562-mbIL18-mbIL21 Cell

[0081] The activation and expansion of NK cells depending on a medium in which the genetically engineered feeder cells according to an aspect were included were confirmed.

[0082] 2-1. Complete RPMI 1640 Medium

[0083] In detail, the K562-mbIL18-mbIL21 cell line prepared in Example 1 was cultured in a T-75 flask containing 25 ml of complete RPMI 1640 medium at 37° C. in an incubator supplied with 5% CO.sub.2. Next, centrifugation was performed under 400×g conditions for 3 minutes, and the cell pellets were resuspended in 5 ml of the complete RPMI 1640 medium to collect feeder cells. Then, in order to prevent excessive growth of the feeder cells, the feeder cells were irradiated with gamma rays at 100 gray (Gy) by using a Gammacell 3000 Elan radiator, and the irradiated feeder cells were used in subsequent experiments.

[0084] For isolation of peripheral blood mononuclear cells (PBMCs), whole blood of a healthy donor was diluted with PBS at a ratio of 1:2 (10 ml of whole blood:20 ml of PBS), and then overlaid on 15 ml Lymphoprep. Next, the centrifugation was performed without brake at a speed condition of 1200×g for 25 minutes at room temperature (acceleration level: 1 and deceleration level: 0), and the cells were collected from a buffy coat layer and washed with PBS three times each at a speed of 400×g for 7 minutes. 3×10.sup.6 of the isolated PBMCs and 0.5×10.sup.6 of the 100 Gy-irradiated K562-mbIL18-mbIL21 were inoculated onto a 24-well plate containing 1 ml of NK cell medium in each well. Then, 1 ml of NK cell medium containing 20 U/ml of IL-2 was added to each well so that the total medium volume of 2 ml/well and the final concentration of IL-2 was 10 U/ml. After mixing by pipetting gently, the cells were cultured in a 5% CO.sub.2 incubator at 37° C. The culture was continued for 14 days. Meanwhile, 100 U/ml of IL-2 and 5 ng/ml of IL-15 were added to the medium on the 7th day of the culture, and the medium was replaced with a fresh medium every 2 to 3 days. Here, the K562 cells were used as a control group.

[0085] The expansion of the NK cells was confirmed by using fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD3 and PE-Cy5-conjugated mouse anti-human CD56 monoclonal antibodies. The purity of the NK cells that were treated with the K562 cells and the IL-2/IL-15 was considered as a baseline, and accordingly, the fold expansion for each treatment was confirmed.

[0086] FIG. 2A is a graph showing the fold expansion (left) and purity (right) of the NK cells when the feeder cells according to an aspect and the NK cells were cultured in the complete RPMI 1640 medium.

[0087] As a result, as shown in FIG. 2A, it was confirmed that the expansion of the NK cells cultured with the K562 feeder cells increased until the 35th day after the culture, but did not occur thereafter. Meanwhile, it was confirmed that the NK cells cultured with the feeder cells of Example 1 showed an increasing pattern in the fold expansion until the 42nd day after the culture. In addition, it was confirmed that, as compared with the NK cells cultured with the K562 feeder cells, the NK cells cultured with the feeder cells of Example 1 had significantly high purity. That is, the feeder cells according to an aspect not only significantly increased the activity of NK cells, but also allowed long-term culture of NK cells, so that the NK cells may be mass-proliferated and utilized as cell therapeutic agents.

[0088] 2-2. DMEM+Supplements (DS) Medium

[0089] An experiment was performed in the same manner as in Experimental Example 2-1, except that a DS medium published by Miller group (JOURNAL OF HEMATOTHERAPY 4:149-158 (1995)) in which a DMEM culture medium was supplemented with 4.5 g/L of glucose and 584 mg/L of glutamine was used.

[0090] FIG. 2B is a graph showing the fold expansion (left) and purity (right) of NK cells when the feeder cells according to an aspect and NK cells were cultured in the DS medium.

[0091] As a result, as shown in FIG. 2B, it was confirmed that both the feeder cells of Example 1 and the cells of Comparative Example 1 increased the expansion fold of the NK cells until the 42nd day. However, it was confirmed that, as compared to the cells of Comparative Example 1, the fold expansion of the NK cells cultured with the feeder cells of Example 1 was significantly increased by about 2 times to about 6 times or more. In addition, it was confirmed that, as compared with the NK cells cultured with the K562 feeder cells, the NK cells cultured with the feeder cells of Example 1 had significantly high purity.

[0092] Based on the results above, the expansion efficiency of the NK cells in the RPMI 1640 medium was compared with that of the NK cells in the DS medium.

[0093] FIG. 2C is a graph comparing the fold expansion (left) and purity (right) of the NK cells when the feeder cells according to an aspect and the NK cells were cultured in the complete RPMI 1640 medium and the DS medium.

[0094] As a result, as shown in FIG. 2c, it was confirmed that the cells of Example 1 increased the fold expansion and purity of the NK cells as compared to the K562 feeder cells, regardless of the type of medium. However, when comparing the same cells cultured in different media, it was confirmed that the cells of Example 1 had significantly high fold expansion of the NK cells in the DS medium as compared to the NK cells in the complete RPMI 1640 medium. That is, the feeder cells according to an aspect were able to selectively expand NK cells according to the type of medium, and thus may have medium-selective characteristics.

Experimental Example 3. Phenotypic Characteristics of NK Cells Expanded by K562-mbIL18-mbIL21 Cells

[0095] The phenotypic characteristics of the NK cells expanded by the K562-mbIL18-mbIL2 cells in the RPMI 1640 medium and the DS medium were confirmed.

[0096] In detail, for isolation of PBMCs, whole blood of a healthy donor was diluted with PBS at a ratio of 1:2 (10 ml of whole blood:20 ml of PBS), and then overlaid on 15 ml Lymphoprep. Next, the centrifugation was performed without brake at a speed condition of 1200×g for 25 minutes at room temperature (acceleration level: 1 and deceleration level: 0), and the cells were collected from a buffy coat layer and washed with PBS three times each at a speed of 400×g for 7 minutes. Then, 2×10.sup.5 of expanded NK cells derived from a healthy donor were washed with an FACS buffer (PBS with 1% FBS), and then, treated with APC-Cyanine7-conjugated mouse anti-human CD3 and PE-Cyanine7-conjugated anti-human CD56 membrane antibodies for 15 minutes. Cells were then collected and further stained with different fluorescence-conjugated anti-human CD16, CD57, CD69, NK2G2A, NK2G2C, NKG2D, DNAM-1, NKp30, NKp46, KIR2DL1, KIR2DL2/3, and KIR3DL1 membrane antibodies, each for 30 minutes. Afterwards, the cells were washed with FACS buffer, and data were acquired by using an FACS Calibur instrument and analyzed by using a Kaluza software.

[0097] FIGS. 3A and 3B are graphs comparing markers expressed in the expanded NK cells, wherein the NK cells were expanded by using the feeder cells according to an aspect (blue) and the K562 feeder cells (red) in the RPMI 1640 medium and the DS medium.

[0098] As a result, as shown in FIGS. 3A and 3B, it was confirmed that the surface markers, such as CD16, CD57, CD69, NK2G2A, NK2G2C, NKG2D, DNAM-1, NKp30, NKp46, KIR2DL1, KIR2DL2/3, and KIR3DL1, were expressed in the NK cells expanded by using the feeder cells according to an aspect.

[0099] That is, it was confirmed that the NK cells expanded by the feeder cells according to an aspect had complete functional properties of the NK cells.

Experimental Example 4. Confirmation of Cytotoxicity of NK Cells Expanded by K562-mbIL18-mbIL21 Cells

[0100] In order to confirm the efficacy of the NK cells, which were expanded by the feeder cells according to an aspect, as antibody therapeutic agents, the cytotoxicity of the NK cells against target cells on Day 14 was measured for 4 hours by a CFSE-based assay.

[0101] In detail, target cells were added to an FACS buffer, stained with 0.5 μM CFSE at 37° C. for 10 minutes, and washed twice with a complete medium (RPMI or DS). Then, 5×10.sup.4 of target cells were placed threefold on a 96-well round-bottom plate, and then mixed with the NK cells derived from healthy donors (HD) of Experimental Example 3 so that the effector-to-target (E:T) cells became 0.5:1, 1:1 and 2:1. The plate was centrifuged at a speed of 1,500 rpm for 3 minutes, and cultured for 4 hours at 37° C. in a 5% CO.sub.2 incubator. Next, the mixed cells were transferred to FACS tubes, and 1 μl of 1 mg/mL propidium iodide (PI) (Sigma Aldrich, St. Louis, Mo., USA) was added to each tube. The cells were then collected in an FACS Calibur instrument and analyzed by using a Kaluza software. The percentage of dead target cells (CFSF-positive and PI-positive) was calculated after subtracting the percentage of spontaneously dead target cells.

[0102] FIG. 4A is a graph confirming the cytotoxicity of the HD-derived NK cells that were expanded by using the feeder cells according to an aspect.

[0103] FIG. 4B is a graph confirming the antibody-dependent cellular cytotoxicity (ADCC) of the HD-derived NK cells that were expanded by using the feeder cells according to an aspect.

[0104] As a result, as shown in FIG. 4A, it was confirmed that the NK cells expanded by using the feeder cells of Example 1 showed the same cytotoxicity as the NK cells expanded by using the K562 feeder cells. It was also confirmed that the cytotoxicity of the NK cells cultured in the DS medium exhibited the same cytotoxicity as the NK cells cultured in the RPMI medium. In addition, as shown in FIG. 4B, it was confirmed that the NK cells expanded by using the feeder cells of Example 1 exhibited the similar ADCC activity against Rituximab-bound Raji cells as the NK cells expanded by using the K562 feeder cells. It was also confirmed that the ADCC activity of the NK cells cultured in the DS medium exhibited the similar ADCC activity as the NK cells cultured in the RPMI medium. That is, the NK cells expanded by the feeder cells according to an aspect exhibit the cytotoxicity, and thus can be utilized as antibody therapeutic agents.

Experimental Example 5. Confirmation of Activity of NK Cells Stimulated by K562-mbIL18-mbIL21 Cells

[0105] 5-1. Confirmation of Degranulation Activity by CD107a Expression

[0106] In order to confirm the cell activity in whole blood of NK cells that were stimulated by the genetically engineered feeder cells according to an aspect, the expression level of CD107a on the surface of the NK cells proportional to the degranulation was measured. In detail, 100 μl of HD-derived whole blood of Experimental Example 3, 2×10.sup.5 of either of the K562 feeder cells or the K562-mbIL18-mbIL21 feeder cell lines of Example 1, and PE-conjugated anti-human CD107a were cultured in an FACS tube. After 1 hour, Monensin and brefeldin A (BD Biosciences) were added and further cultured for 4 hours. Then, NK cells were obtained after staining with anti-human CD3 and CD56 antibodies, and the expression level of CD107a was measured.

[0107] FIGS. 5A and 5B are graphs showing the measured expression level of CD107a in the NK cells that were stimulated by the feeder cells according to an aspect.

[0108] As a result, as shown in FIG. 5A, it was confirmed that the NK cells stimulated by the feeder cells of Example 1 increased the expression of CD107a in an IL-2 concentration-dependent manner. In detail, as shown in FIG. 5B, it was confirmed that the NK cells stimulated by the feeder cells of Example 1 showed significantly high expression levels of CD107a at the same concentration of IL-2 as compared to the NK cells stimulated by the K562 feeder cells.

[0109] That is, using the feeder cells according to an aspect to activate the NK cells can be more usefully utilized as a method of diagnosing the NK cell activity than using the K562 feeder cells.

[0110] 5-2. Confirmation of Cytotoxicity by Cell Lysis

[0111] In order to confirm the cellular activity in whole blood of NK cells that were stimulated by the genetically engineered feeder cells according to an aspect, the cytotoxicity of target cells was measured for about 16 hours to about 20 hours according to the CFSE-based assay. In detail, target cells (e.g., the K562 feeder cells or the feeder cells of Example 1) were added to a FACS buffer, stained with 0.5 μM CFSE at 37° C. for 10 minutes, and then washed twice with a complete medium (e.g., an RPMI medium or a DS medium). Then, 5×10.sup.4 of the target cells were placed threefold in FACS tubes, and the complete medium supplemented with IL-2 and the HD-derived whole blood were mixed therein to have a volume ratio of 200 ul, 100 ul, and 50 ul. The cells in the FACS tubes were cultured for about 16 hours to about 20 hours at 37° C. in a 5% CO.sup.2 incubator. Next, the mixed cells were transferred to FACS tubes, and 1 μl of 1 mg/mL PI (Sigma Aldrich, St. Louis, Mo., USA) was added to each tube. The cells were then collected in an FACS Calibur instrument and analyzed by using Kaluza software. The percentage of dead target cells (CFSF-positive and PI-positive) was calculated after subtracting the percentage of spontaneously dead target cells.

[0112] FIGS. 5C and 5D are graphs showing the measured lysis rates of the target cells by the NK cells stimulated by the feeder cells according to an aspect.

[0113] As a result, as shown in FIG. 5C, it was confirmed that the NK cells stimulated by the feeder cells of Example 1 increased the cell lysis rate of the target cells in an IL-2 concentration-dependent manner. In detail, as shown in FIG. 5D, it was confirmed that, as compared to the NK cells stimulated by the K562 feeder cells, the NK cells stimulated by the feeder cells of Example 1 showed significantly high cell lysis rate of the target cells at the same concentration of IL-2.

[0114] That is, using the feeder cells according to an aspect to activate the NK cells can be more usefully utilized as a method of diagnosing the NK cell activity than using the K562 feeder cells.

[0115] The foregoing descriptions are only for illustrating the present disclosure, and it will be apparent to a person having ordinary skill in the art to which the present invention pertains that the embodiments disclosed herein can be easily modified into other specific forms without changing the technical spirit or essential features. Therefore, it should be understood that Examples described herein are illustrative in all respects and are not limited.