Molecular Marker Nicotine Associated SNP 1 for Identifying High or Low Nicotine Content of Tobacco and its Kit as well as Use thereof
20230203601 · 2023-06-29
Inventors
- He Xie (Kunming City, CN)
- Ge Bai (Kunming City, CN)
- Yong LI (Kunming City, CN)
- Aiguo Yang (Kunming City, CN)
- Tao PANG (Kunming City, CN)
- Dahai Yang (Kunming City, CN)
- Bingguang Xiao (Kunming City, CN)
- Yongping Li (Kunming City, CN)
- Min Ren (Kunming City, CN)
- Mingliang Fei (Kunming City, CN)
Cpc classification
G16B20/20
PHYSICS
A01H1/04
HUMAN NECESSITIES
International classification
A01H1/04
HUMAN NECESSITIES
Abstract
The present invention “A Molecular marker Nicotine Associated SNP 1 for identifying high or nicotine content of tobacco and its kit as well as use thereof” belongs to field of molecular biology technology. The molecular marker Nicotine Associated SNP 1 is a SNP Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017. The present invention can accurately identify and screen tobacco germplasm resources with high or low nicotine content, and the screened tobacco can be directly used for breeding new tobacco varieties without transgenic methods. At the same time, gene sequence where the SNP site is located can also significantly activate promoters of key enzyme genes in nicotine synthesis pathway.
Claims
1. A molecular marker Nicotine Associated SNP 1 for identifying high or low nicotine content of tobacco, characterized in that, is a SNP site Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017.
2. The molecular marker Nicotine Associated SNP 1 for identifying high or low nicotine content of tobacco according to claim 1, characterized in that, a pair of specific primers for the molecular marker Nicotine Associated SNP 1 for identifying nicotine content of tobacco are shown as SEQ ID NO.1 and SEQ ID NO. 2.
3. A kit for identifying high or low nicotine content of tobacco, characterized in that, comprises a molecular marker Nicotine Associated SNP 1, the molecular marker Nicotine Associated SNP 1 is a SNP site Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017.
4. The kit for identifying high or low nicotine content of tobacco according to claim 3, characterized in that, also comprises: a pair of specific primers for the molecular marker Nicotine Associated SNP 1; and/or the specific primers for the molecular marker Nicotine Associated SNP 1 are shown as SEQ ID NO.1 and SEQ ID NO.2.
5. The kit for identifying high or low nicotine content of tobacco according to claim 4, characterized in that, the kit also comprises: reagents for PCR, reagents for sequencing, and/or reagents for KASP genotyping assayassay; and/or the reagents for PCR comprise: dNTPs, Taq enzyme, PCR buffer, ddH.sub.2O; and/or the reagents for sequencing comprise: Tris-HCl, agarose, EB; and/or the reagents for KASP genotyping assayassay comprise: KASP Master mix.
6. A method for identifying high or low nicotine content of tobacco, characterized in that, a molecular marker Nicotine Associated SNP 1 is used to screen candidate tobaccos; the molecular marker Nicotine Associated SNP 1 is a SNP site Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017.
7. The method for identifying high or low nicotine content of tobacco according to claim 6, characterized in that, comprises: a pair of specific primers for the molecular marker Nicotine Associated SNP 1 are used for PCR amplification on DNA of candidate tobaccos; the specific primers for the molecular marker Nicotine Associated SNP 1 are shown as SEQ ID NO.1 and SEQ ID NO. 2.
8. The method for identifying high or low nicotine content of tobacco according to claim 7, characterized in that, also comprises: PCR products are subjected to sequencing or KASP genotyping assay.
9. The method for identifying high or low nicotine content of tobacco according to claim 8, characterized in that, results of sequencing or KASP genotyping assay show that the candidate tobaccos whose SNP site genotype is GG is a tobacco with low nicotine content; results of sequencing or KASP genotyping assay show that the candidate tobaccos whose SNP site genotype is AA is a tobacco with high nicotine content; and/or the PCR reaction system comprises: template 0.02 .Math.L/.Math.L, forward primer 0.02 .Math.L/.Math.L, reverse primer 0.02 .Math.L/.Math.L, 5×buffer 0.2 .Math.L/.Math.L, dNTP mixture 0.02 .Math.L/.Math.L, DNA polymerase 0.02 .Math.L/.Math.L, the rest is water; The PCR amplification reaction program comprises: 98° C. 5 min; taking 98° C. 30 s, 58° C. 30 s, 72° C. 30 s as 1 cycle, a total of 35 cycles; 72° C. 5 min; and/or DNA of the candidate tobacco is extracted from tobacco leaves, seeds, roots, stems, flowers, or fruits.
10. A method for breeding tobacco varieties with high or low nicotine content, characterized in that, tobaccos with high or low nicotine content from candidate tobaccos are screened by using the molecular marker Nicotine Associated SNP 1 for identifying high or low nicotine content of tobacco according to claim 1.
11. The method for breeding tobacco varieties with high or low nicotine content according to claim 10, characterized in that, tobacco with high nicotine content is selected as female parent or male parent, and tobacco required to be improved is taken as male parent or female parent, F1 generation is obtained by crossing the female parent and the male parent.
12. The method for breeding tobacco varieties with high or low nicotine content according to claim 11, characterized in that, F2 generation plants are obtained by inbred F1 generation plants, and F2 generation plants are backcrossed with selected tobaccos with high or low nicotine content or tobaccos required to be improved.
13. The method for breeding tobacco varieties with high or low nicotine content according to claim 12, characterized in that, tobaccos with high or low nicotine content are screened from the backcrossed population through a method for identifying high or low nicotine content of tobacco characterized in that, a molecular marker Nicotine Associated SNP 1 is used to screen candidate tobaccos; the molecular marker Nicotine Associated SNP 1 is a SNP site Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017.
14. A method for activating promoters of genes involving nicotine synthesis pathway of tobacco, characterized in that, overexpressing genes containing SNP site; the SNP site are a SNP site of a molecular marker Nicotine Associated SNP 1 for identifying high or low nicotine content of tobacco; the molecular marker Nicotine Associated SNP 1 is SNP site Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017.
15. The method for activating promoters of genes involving nicotine synthesis pathway of tobacco according to claim 14, characterized in that, base of SNP site in gene containing the SNP site is A or G.
16. The method for activating promoters of genes involving nicotine synthesis pathway of tobacco according to claim 15, characterized in that, primers shown as SEQ ID NO.7 and SEQ ID NO.8 are used to amplify DNA of tobaccos with high or low nicotine content to obtain gene sequence containing the SNP site.
17. The method for activating promoters of genes involving nicotine synthesis pathway of tobacco according to claim 16, characterized in that, primers shown as SEQ ID NO.3 and SEQ ID NO.4, or SEQ ID NO.5 and SEQ ID NO.6 are used to amplify DNA of tobaccos to obtain promoter sequence of genes involving tobacco nicotine synthesis pathway; and/or gene sequence containing the SNP site is connect into overexpression vector, and sequence of gene involving nicotine synthesis pathway of tobacco is connected into expression vector; and/or the overexpression vector connecting the gene sequence containing the SNP site and the expression vector connecting the sequence of gene involving nicotine synthesis pathway of tobacco are transformed into agrobacterium and then transfected into tobacco; and/or the promoters of genes involving nicotine synthesis pathway are selected from promoters of the following genes: NtPMT2 and/or NtQPT2; and/or the overexpression vector is pB2GW7 overexpression vector; the expression vector is pGreen0800 fluorescent expression vector.
18. A method for strengthening interaction to gene promoting nicotine synthesis, characterized in that, the genes promoting nicotine synthesis and gene fragments containing SNP site are co-expressed; the SNP site is a SNP site of a molecular marker nicotine associated SNP 1 for identifying high or low nicotine content of tobacco; the molecular marker Nicotine Associated SNP 1 is a SNP site Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of the Nitab v4.5 Genome Scaffolds Edwards2017.
19. The method for strengthening interaction to gene promoting nicotine synthesis according to claim 18, characterized in that, base of SNP site in the gene containing the SNP site is A or G.
20. The method for strengthening interaction to gene promoting nicotine synthesis according to claim 19, characterized in that, primers shown as SEQ ID NO.9 and SEQ ID NO.10 are used to amplify sequence of the gene promoting nicotine synthesis; and/or primers shown as SEQ ID NO.11 and SEQ ID NO.12 are used to amplify the gene fragment containing SNP site; and/or the sequence of the gene promoting nicotine synthesis and the gene fragment containing SNP site are respectively connected into expression vector to perform the co-expression; and/or the expression vector connected with the sequence of the gene promoting nicotine synthesis and the expression vector connected with the gene fragment containing SNP site are co-transformed tobacco; and/or the gene promoting nicotine synthesis is NtMED25, and the expression vector is pCAMBIA1300-cLUC or pCAMBIA 1300-nLUC.
Description
DESCRIPTION OF DRAWINGS
[0060] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0061]
[0062]
[0063]
EMBODIMENTS
[0064] The present invention will be further illustrated with the following specific examples, but the protection scope is not limited by these examples.
Source of Biological Material
[0065] 339 tobacco materials used in experimental example 1 and the 17 tobacco materials used in experimental example 2 of the present invention are all tobacco germplasm resources owned by the applicant. The applicant promises to distribute to the public within 20 years from the filing date of the present invention for verifying effect of the present invention.
[0066] Honghua Daijinyuan tobacco used in experimental examples 3 and 4 and Yunyan 87 tobacco used in experimental examples 3 and 4 are well-known tobacco varieties, which are commercially available. Ben’s tobacco plants used in experiment example 3 are common experimental tobacco resources all over the world, which can be purchased commercially.
[0067] Agrobacterium used in experiment 3 is commercially available.
The 1.SUP.st Group of Examples: The Molecular Marker of the Invention
[0068] This group of examples provides a molecular marker nicotine associated SNP 1 (nicas1) for identifying high or low nicotine content of tobacco. All embodiments in this group have the following common features: said molecular marker nicas1 for identifying high or low nicotine content of tobacco of this invention is a SNP Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic Segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017. The nucleotide of the SNP site is G or A. It is verified that the nucleotide of said SNP site of tobacco with high nicotine content is A, and the nucleotide of said SNP site of tobacco with low nicotine content is G. Furthermore, The molecular marker nicas1 can be used to accurately screen tobacco varieties with high nicotine content or low nicotine content and confirm their genotype and phenotype. Tobacco genome version of the invention is Nitab v4.5 Genome Scaffolds Edwards2017.
[0069] In specific embodiments, sequences of primers for amplifying the molecular marker nicas1 for identifying high or low nicotine content of tobacco are as shown in SEQ ID No. 1 and SEQ ID NO.2:
TABLE-US-00001 MYC2a-F1 GTATCAAGAATCAAACAGATCTGAATTGATTTGTCT(SEQ ID NO.1), MYC2a-R1 TGATAAAGTCAGGCGAAAACGA(SEQ ID NO.2).
[0070] Said SNP genotype can be distinguished by using above primers through detecting amplification products by KASP labeling method, and person skilled in the art can also use other detection methods, such as caps labeling method, etc. He can design other available primers suitable for different detection methods according to said SNP site.
The 2.SUP.nd Group of Examples: A Kit for Identifying the Nicotine Content of Tobacco of this Invention
[0071] This group of examples provides a kit for identifying high or low nicotine content of tobacco. All embodiments in this group have the following common features: The kit comprises: said molecular marker nicas1; the molecular marker nicas1 is a SNP Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017.
[0072] Preferably, the kit also comprises: a pair of specific primers for the molecular marker Nicotine Associated SNP 1; preferably, the specific primers for the molecular marker Nicotine Associated SNP 1 are shown as SEQ ID NO. 1 and SEQ ID NO.2; [0073] Preferably, the kit also comprises: reagents for PCR, reagents for sequencing, and/or reagents for KASP genotyping assay; [0074] Preferably, the reagents for PCR comprise: dNTPs, Taq enzyme, PCR buffer, ddH2O; [0075] Preferably, the reagents for sequencing comprise: Tris-HCl, agarose, EB; [0076] Preferably, the reagents for KASP genotyping assay comprise: KASP Master mix.
The 3.SUP.rd Group of Examples: A Method for Identifying High or Low Nicotine Content of Tobacco of this Invention
[0077] This group of examples provides a method for identifying high or low nicotine content of tobacco. All embodiments in this group have the following common features: candidate tobaccos are screened by said molecular marker nicas1; the molecular marker nicas1 is a SNP Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017.
[0078] In specific embodiments, the method for identifying high or low nicotine content of tobacco comprises: a pair of specific primers for the molecular marker Nicotine Associated SNP 1 are used for PCR amplification on DNA of the tobacco material to be tested; the specific primers for the molecular marker Nicotine Associated SNP 1 are shown as SEQ ID NO. 1 and SEQ ID NO. 2; [0079] Preferably, the method for identifying high or low nicotine content of tobacco also comprises: PCR amplification products are subjected to sequencing or KASP genotyping assay; [0080] Preferably, tresult of sequencing or KASP genotyping assay shows that candidate tobacco whose SNP site genotype is GG is a tobacco with low nicotine content; result of sequencing or KASP genotyping assay shows that candidate tobacco whose SNP site genotype is AA is a tobacco material with high nicotine content;
[0081] Preferably, reaction system and reaction procedure for PCR amplification are shown in Table 1 below:
TABLE-US-00002 PCR system : 50 .Math.L, system PCR procedure TemplateDNA 1 .Math.L ① 98° C. 5 min primer-F (10 .Math.mol/L) 1 .Math.L ② 98° C. 30 s primer-R (10 .Math.mol/L) 1 .Math.L ③ 58° C. 30 s 5×buffer 10 .Math.L ④ 72° C. 30 s dNTP mixture (10 mmol/L) 1 .Math.L ②-④ 35 cycles Phusion DNA Polymerase 0.5 .Math.L ⑤ 72° C. 5 min ddH.sub.2O Up to 50 .Math.L 4° C. Forever
[0082] Preferably, DNA of candidate tobacco is extracted from tobacco leaves, seeds, roots, stems, flowers, or fruits.
[0083] KASP is a well-known technology in the art. Person skilled in the art can make routine selection and adjustment according to the specific conditions of experiment practice with reference to the conventional technical means in the art. For example,
[0084] “KASP Master mix” can be purchased and its reaction conditions can follow record of its product manual. According to fragment size of PCR amplification products obtained by the invention, suitable parameters and reaction conditions are selected and adjusted.
[0085] KASP and DNA sequencing are both well-known technologies in the art and also mature commercialized technologies in the market at present. Person skilled in the art can perform PCR amplification according to the primer sequences disclosed in the invention, send the amplification product to company that is professional for KASP and DNA sequencing for detecting PCR amplification product, so as to obtain the fragment size or specific sequence of the PCR amplification product. Whether phenotype of candidate tobacco is high nicotine content type or low nicotine content type is determined according to PCR products amplified based on DNA template of candidate tobacco show whether genotype of the SNP site is AA or GG.
[0086] Person skilled in the art can also use other conventional methods in the art to detect PCR amplification products. For example, competitive allele-specific PCR amplification, electrophoresis, DNA sequencing and other methods can be used to obtain the PCR amplification product sequence, and then learn whether phenotype of candidate tobacco is low nicotine content type tobacco or high nicotine content type tobacco.
[0087] In other embodiments, Kluster Caller genotyping instrument can be used to detect the sequence of PCR products.
[0088] The Kluster Caller genotyping instrument is a common instrument in this field that can be purchased commercially, and its operation can be performed according to the product manual of the instrument.
The 4.SUP.th Group of Examples: A Method for Selecting Tobacco Varieties with High or Low Nicotine Content of the Invention
[0089] This group of examples provides a method for selecting tobacco varieties with high or low nicotine content. All embodiments in this group have the following common features: the method for identifying high or low nicotine content in tobacco provided by any of the 3.sup.rd group of examples is used to screen tobacco with high or low nicotine content from candidate tobaccos.
[0090] Person skilled in the art can screen tobaccos at any growth stage of tobacco plants by the method of identifying high or low nicotine content of tobacco, and obtain tobaccos with high or low nicotine content.
[0091] In further embodiments, F1 generation is obtained by crossing the selected tobacco with high or low nicotine content as female parent or male parent and tobacco required to be improved as male parent or female parent.
[0092] Preferably, F2 generation plants are obtained by inbred F1 generation plants, and F2 generation plants are backcrossed with selected tobaccos with high or low nicotine content or tobaccos required to be improved;
[0093] preferably, tobaccos with high or low nicotine content are screened from the backcrossed population through the method for identifying high or low nicotine content of tobacco according to any of the 3.sup.rd group of examples, and/or the molecular marker Nicotine Associated SNP 1 for identifying high or low nicotine content of tobacco according to any of the 1.sup.St group of examples, and/or the kit for identifying high or low nicotine content of tobacco according to any of the 2.sup.nd group of examples.
The 5.SUP.th Group Examples: A Method for Activating Gene Promoters of Genes Involving Tobacco Nicotine Synthesis Pathway of this Invention
[0094] This group of examples provides a method for activating promoters of gene involving tobacco nicotine synthesis pathway. All embodiments in this group have the following common features: overexpressing genes containing SNP site; the SNP site are the SNP site of a molecular marker Nicotine Associated SNP 1 for identifying high or low nicotine content of tobacco; the molecular marker Nicotine Associated SNP 1 is a SNP Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017. [0095] In some embodiments, the base of the SNP site in the gene containing the SNP site is A or G; [0096] In specific embodiments, primers shown as SEQ ID NO.7 and SEQ ID NO.8 are used to amplify DNA of tobacco with high nicotine content or low nicotine content to obtain the gene sequence containing the SNP site; [0097] In preferable embodiments, primers shown as SEQ ID NO.3 and SEQ ID NO.4, or SEQ ID NO.5 and SEQ ID NO.6 are used to amplify DNA of tobacco to obtain sequences of genes involving tobacco nicotine synthesis pathway; [0098] In other embodiments, sequence of gene containing the SNP site is connected into a overexpression vector, and sequence of genes involving tobacco nicotine synthesis pathway is connected into a expression vector; [0099] In further embodiments, the overexpression vector connected with sequence of gene containing the SNP site and the expression vector connected with sequence of gene involving tobacco nicotine synthesis pathway are transformed into agrobacterium and then transfected tobacco; [0100] In specific embodiments, the promoters of genes involving nicotine synthesis pathway are selected from promoters of the following genes: NtPMT2 and/or NtQPT2; [0101] In further embodiments, the overexpression vector is a pB2GW7 overexpression vector; the expression vector is a pGreen0800 fluorescent expression vector.
The 6.SUP.th Group of Examples: A Method for Enhancing Gene Interaction of this Invention
[0102] This group of examples provides a method for enhancing interaction between genes promoting nicotine synthesis. All embodiments in this group have the following common features: genes promoting nicotine synthesis are co-expressed with gene fragments containing SNP site; The SNP site is the SNP site of a molecular marker nicotine associated SNP 1 for identifying high or low nicotine contents of tobacco. The molecular marker Nicotine Associated SNP 1 is a SNP Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017. [0103] In some embodiments, base of the SNP site in the gene containing the SNP site is A or G; [0104] Preferably, the primers shown as SEQ ID NO.9 and SEQ ID NO. 10 are used to amplify nicotine synthesis-promoting gene sequence; [0105] Preferably, the primers shown as SEQ ID NO. 11 and SEQ ID NO. 12 are used to amplify the gene fragment containing the SNP site; [0106] Preferably, the amplified nicotine synthesis-promoting gene sequence and the gene fragment containing the SNP site are respectively connected into an expression vector to perform the co-expression; [0107] Preferably, an expression vector connected with the nicotine synthesis-promoting gene sequence and an expression vector connected with the gene fragment containing the SNP site are co-transformed into tobacco; [0108] Preferably, the nicotine synthesis-promoting gene or the gene promoting nicotine synthesis is NtMED25, and the expression vector is pCAMBIA1300-cLUC or pCAMBIA 1300-nLUC.
[0109] Compared with AA genotype of the SNP site, GG genotype of the SNP site can significantly improve interaction effect with NtMED25 gene.
Experimental Example 1: Obtaining the Molecular Marker of the Present Invention
[0110] A SNP (Single Nucleotide Polymorphism) site associated with tobacco nicotine content traits, position of the SNP site is a SNP Nitab4.5_0002539:95304 A/G at base No. 95304 of Genomic segment No. 0002539 in tobacco genome version of Nitab v4.5 Genome Scaffolds Edwards2017.The SNP site is located at base No. 259 in coding region of gene NtMYC2a.
[0111] A method for GWAS analysis of SNP (single nucleotide polymorphism) site associated with tobacco nicotine content traits, comprising the following steps: [0112] 1. Senteion software is used for detecting population SNPs, and a total of 47140188 SNP sites have been obtained; [0113] 2. SNPs is filtered through vcftools software with conditions of Miss0.5, Het0.2, and maf0.05, and finally a total of 6,957,682 high-quality SNP site are obtained for subsequent analysis; [0114] 3. BreakDancer and CNVnator standard analysis procedures are used to perform SVs analysis on multiple natural tobacco populations; [0115] 4. Based on analysis of population structure and genetic relationship, the mixed linear model method is used to perform genome wide association study on phenotypic data of tobacco nicotine content traits. When performing genome-wide association study, significance thresholds of association between all tested traits and SNP sites are evaluated using the following formula, P=0.05/n, where n is the number of detected SNPs.
[0116] The present invention uses SNP to classify the phenotypic traits of 339 GWAS tobacco seeds and finds that there are 53 tobaccos with “GG” genotype and 286 tobaccos with “AA” genotype among 339 GWAS tobacco seeds.
[0117] The present invention conducted a detailed analysis on GWAS interval about 900 kb in tobacco genome, found that this area contains a total of 12 genes (*, **, **) and 2 obvious LD blocks (Table 2,
Experimental Example 2: SNP Molecular Marker the Present Invention Identifying Tobaccos with High or Low Nicotine Content
[0118] Determination of nicotine content in tobacco leaves
[0119] Nicotine content of tobaccos was detected according to the standard YC / T 160-2002. The selected tobacco materials were non-transgenic tobacco plants and transgenic tobacco plants with similar developmental phenotypes which were all in vigorous growing stage, and wild-type tobacco K326 was used as the control. The upper, middle and lower leaves of 5 non-transgenic tobacco plants and transgenic tobacco plants were taken as one group. For the another group, 5 non-transgenic tobacco plants and transgenic tobacco plants were topped, and then the upper, middle and lower leaves of non-transgenic tobacco plants and transgenic tobacco plants were taken.
[0120] Tobacco samples were extracted with 5% acetic acid aqueous solution. The total alkaloids (calculated as nicotine) in the extract reacted with p-amino benzene sulfonic acid and cyanogen chloride, which was produced by the on-line reaction of potassium cyanide and chloramine T. The reaction products were measured at 460 nm with a colorimeter.
[0121] Main instruments and equipment: continuous flow analyzer (American API) (German SEALAA3) (French ALLIANCE).
[0122] Reagent preparation: [0123] Buffer solution A: 2.35 g sodium chloride (NaCl) and 7.60 g sodium borate (Na.sub.2a4O.sub.3- 10 H.sub.2O)were weighed dissolved with water, transferred into a 1 L volumetric flask, and then 1 ml Brij 35 was added diluted to 1 L with distilled water, filtered with qualitative filter paper before use. [0124] Buffer solution B: 26 g disodium hydrogen phosphate (Na.sub.2HPO.sub.4), 10.4 g citric acid [COH(COOH)(CHzCOOH).sub.2′H.sub.2O], 7 g p-amino benzene sulfonic acid (NH.sub.2 C.sub.6H.sub.4SO.sub.3H) were weighed and dissolve with water, transfer into a 1 L volumetric flask, and then 1 ml Brij 35 was added diluted to 1 L with distilled water, filtered with qualitative filter paper before use.
[0125] Chloramine T solution (N-chloro-4-methylphenylthioamide sodium salt) [CH.sub.3C.sub.6H.sub.4SO.sub.2N (Na) CL3H.sub.2O]: 8.65 g of chloramine T was dissolved in water, transferred into 500 ml volumetric flask, fixed volume by adding water, and filtered with qualitative filter paper before use.
[0126] 0.22 mol / L NaOH buffer: NaOH 8.8 g, Na.sub.2HPO.sub.4 26.0 g, C.sub.6H.sub.8O.sub.7.sub.′H.sub.2O (citric acid monohydrate) were dissolved with water to 1000 ml.
[0127] P-aminobenzene sulfonic acid buffer: C.sub.6H.sub.7NO.sub.3S (p-amino benzene sulfonic acid) 7 g, Na.sub.2HPO.sub.4 26.0 g and C.sub.6H.sub.8O.sub.7•H.sub.2O(citric acid monohydrate) 10.4 g were dissolved with water to 1000 ml.
[0128] Chloramine T: chloramine T 1.2 g was dissolve with pure water to 100 ml, and stored in a brown reagent bottle.
[0129] Potassium cyanide: KCN 0.4 g was dissolved with pure water to 100 ml.
[0130] NaCO.sub.3 solution: 10 g NaCO3 was dissolved in distilled water to 1000 ml.
[0131] Analysis steps: 0.3 g tobacco was placed into 150 ml triangular bottle or plastic bottle (accurate to 0.0001 g), 50 ml of 5% acetic acid solution was added into triangular bottle or plastic bottle with stopper covered; said triangular bottle or plastic bottle was shaken and extracted on an ordinary shaking table for 30 min, with the rotating speed controlling at 170 R / min.The extract was filtered with filter paper and detected by instrument. (Dilution is required if concentration of sample solution exceeds concentration range of the working standard solution).
[0132] Calculation and expression of results:
[0133] The content of total alkaloids on a dry basis is obtained from the following formula:
[0134] Wherein: [0135] C -- observation value of total alkaloids in sample solution, unit: mg / ml; [0136] V -- volume of extract, unit: ml; [0137] M -- mass of the sample, unit: Mg; [0138] W -- moisture content of the sample, unit: %.
[0139] The average value of two detected values is taken as the determination result, and the result is accurate to 0.01%.
[0140] In this disclosure, tobaccos with nicotine content > 20 mg / g are tobaccos with high nicotine content whose genotype is AA;
[0141] Tobaccos with nicotine content ≤ 20 mg / g are tobaccos with low nicotine content whose genotype is GG.
[0142] Additional 17 candidate tobacco were verified by using the molecular marker of the invention, and the identification results are shown in Table 2 below:
TABLE-US-00003 SNP genotype tobacco variety nicotine content (mg/g) AA TI 516 31 AA TI 401 27 AA TI 383 21. 5 AA TI 1457 27. 5 AA TN90 24 AA Burley 21 22. 5 AA TI 319 22. 5 AA TI 179 21. 1 AA HondDa 21. 4 GG TI 245 17. 5 GG TW 7 2. 5 GG TI 857 13. 5 GG SC 72 13 GG K 399 18. 5 GG YanYan97 10. 25 GG YunYan87 9. 4 GG YunYan02 9. 1
[0143] Through detection of the molecular marker nicas1 and the identification method of the invention, among 17 candidate tobaccos, all of 17 tobaccos are consistent with the genotype and phenotype, wherein 9 tobaccos are of AA genotype and 8 tobaccos are of GG genotype. The SNP marker and the method of the invention identify tobaccos with high or low nicotine content with accuracy as high as 100%.
Experimental Example 3: Overexpression of SNP Site Gene Activates Nicotine Synthesis Related Enzyme Gene Promoter
[0144] Promoter fragment of tobacco NtPMT2 gene was cloned with PMT2_Pgreen_0800_F primer gtcgacggtatcgataagcttAGTATTCAAGGTATCTAAC (SEQ ID NO.3) and PMT2_Pgreen _0800 _Rprimer cgctctagaactagtggatccTTTCAAAATTAAACTAAAC (SEQ ID NO.4) , and then the fragment was cloned into pGreen0800 fluorescent vector. Promoter sequence of NtQPT2 gene was cloned with QPT2 Pgreen _0800_F primer gtcgacggtatcgataagcttGAAACTATAAATAGCTAAG ( SEQ ID NO.5 ) and QPT2 Pgreen _0800 _Rprimer cgctctagaactagtggatccGGTTTATTTTCTTGGGGCT (SEQ ID NO.6) , and then cloned into pGreen0800 vector again.
[0145] The cDNA of Honghua Daijinyuan and Yunyan 87 were amplified respectively with NtMY C2a_ F primer GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGACGGATTATAGAATACC AAC ( SEQ ID NO.7 and NtMYC2a_R primer GGGGACCACTTTGTACAAGAAAGCTGGGTCTCATCGCGATTCAGCAATTCT GGATG (SEQ ID NO. 8) , and gene sequences of NtMYC2a of different genotypes were obtained, in which genotype of SNP site of Honghua Daijinyuan was A and genotype of SNP site of Yunyan 87 was G. Two fragments were cloned into PDONR-Zeo vector by BP reaction of geteway. Sequence fragment was finally introduced into pb2gw7 overexpression vector by LR reaction. After that, was adopted to these vectors were transformed into agrobacterium the chemical transformation method. Agrobacterium mono clones were picked and cultured in 2 ml of resistance liquid medium overnight, and 2 ml of broth was put into 50 ml resistance medium for cultivation the next day, and agrobacterium sediments were collected until OD value reached 0.6.
[0146] Agrobacterium injection is prepared according to the following combination in Table 3:
TABLE-US-00004 NtPMT2 Pgreen0800 vector+ pB2GW7empty vector NtQPT2 Pgreen0800 vector + pB2GW7 empty vector NtMYC2a_A vector+NtPMT Pgreen0800 empty vector NtMYC2a_G vector +NtPMT Pgreen0800 vector NtMYC2a_A vector +NtQTP2 Pgreen0800 vector NtMYC2a_G vector +NtQPT2 Pgreen0800 vector
[0147] Leaves of 14 days old Ben’s tobacco plants were injected by instantaneous transformation method, and then the injected Ben’s tobacco was kept away from light for 24 hours, and restored to culture under light for 48 hours. Material taken from above Ben’s tobacco was put into a 1.5 ml EP tube, with2 steel balls with a diameter of 0.5 cm added, shaken and crushed at 60 Hz for 30 seconds at ultra-low temperature; 100 .Math.L PLB lysate was added to the crushed powders, vibrated by vortex vibration for 10 seconds for rapidly dissolving so as to extract total protein; it’s centrifugated at 4° C. 13000 rpm for 10 seconds and 8 .Math.L of supernatant was absorbed and added to another EP tube, and 40 .Math.L LAR II is added, mixed gently. it’s detected for the first time by fluorescence spectrophotometer; After detection, 40 .Math.L Stop&GloReagent was added, mixed gently and performed fluorescence detection again; it’s found by recording and comparing detection value that NtMYC2a_A more siginificantly than NtMYC2a_ G to activate tobacco NtPMT2 and NtQPT2 promoters (
Experimental Example 4: The Molecular Marker of the Invention Enhances the Interaction Effect with NtMED25
[0148] NtMED25 can promote synthesis of nicotine. This experimental example verifies influence of different genotypes of SNP site of the invention on the binding strength of NtMED25, and proves that AA genotype of SNP site of the invention can bind and interact with NtMED25 gene more strongly than GG genotype, thus significantly influencing nicotine content. The full-length sequence of NtMED25 was cloned with primers NtMED25 F: AAGGTACCatgtgtaaaaatgcgttgggagctg(SEQ ID NO. 9) and NtMED25 R:AAGTCGACgggcatgtttggcagtcctcgtgaa(SEQ ID NO. 10), and then cloned into 1300 nLUC vector. Two NtMYC2 A/G fragments were cloned respectively with NtMYC2 F: TTGGTACCatgacggactatagaataccaacgatgacta(SEQ ID NO. 11) and NtMYC2 R: AAGTCGACtcgcgattcagcaattctggatgtcaatgat(SEQ ID NO. 12), and then connected respectively to pCAMBIA1300-cLUC vector to obtain NtMYC2 A/G 1300-cLUC expression vector and NtMED25 1300-nLUC expression vector. NtMYC2 A/G 1300-cLUC expression vector and NtMED25 1300-nLUC expression vector are co-transformed into Ben’s tobacco leaves, and fluorescence intensity was observed 3 days later. Result is shown as
Experimental Example 5: Use of SNP Site in Breeding
[0149] In order to further indentify use of the SNP site in breeding, in this example,the high nicotine tobacco variety of Honghua dajinyuan (nicotine content is 21.4 mg/g and genotype is AA) was hybridized with the low nicotine tobacco variety of Yunyan 87 (nicotine content is 9.4 mg/g and genotype is GG), and the harvested F1 seeds were planted. Genotype and nicotine content of F2 population and F1 individuals were detected. Genotype was detected by KASP labeling method and the detection primers were MYC2a-Fl GTATCAAGAATCAAACAGATCTGAATTGATTTGTCT(SEQ ID NO.1), MYC2a-R1 TGATAAAGTCAGGCGAAAACGA(SEQ ID NO.2).
[0150] There were 54 strains with GG genotype in F2 population, and all of them had nicotine contents higher than 20 mg / g. The experimental results show that the accuracy of detecting genotype and phenotype of F2 population with the SNP site of the invention still reaches 100%.
[0151] This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted herewith as the sequence listing text file. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. §1.52(e).