Ligase reaction mediated amplification method and use thereof
09850533 · 2017-12-26
Assignee
Inventors
Cpc classification
C12Q2525/161
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q2525/155
CHEMISTRY; METALLURGY
C12Q1/6848
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q2525/155
CHEMISTRY; METALLURGY
C12Q2525/161
CHEMISTRY; METALLURGY
International classification
Abstract
The reaction-medicated amplification methods and applications include a new type of ligase. The general amplification and detection of the downstream with the ligase reaction includes 3 linking probes. It achieves the effect of eliminating nonspecific signal interference by respectively filling the detection tag sequence, upstream primer tag sequence, and downstream primer combination tag sequence into 3 different linking probes. Wherein the linking probe containing detection tag sequence forms a cystic structure and the specific hybridization sequences on both sides of the cystic structure form a “hybridization community” when being hybrid to the target sequences. Being hybrid closely at the adjacent positions to the target sequences, 3 linking probes finally form a complete probe chain containing 3 “tag” sequences with the effect of ligase. This technique achieves the goals of reducing reaction background, enhancing signal-noise-ration and avoiding false positive.
Claims
1. A method for detecting a target sequence using ligase chain reactions, the method comprising: selecting the target sequence as a template; dividing the target sequence in an order of segment A, segment B, segment C, and segment D from one end to another end of the target sequence, wherein a length of each of segment A and segment D is 8-42 nt, and wherein the length of segment B is 8-21 nt, and wherein the length of segment C is 8-21 nt; providing a first linking probe, the first linking probe including a first reverse complement of the segment A and an upstream primer tagging sequence; providing a second linking probe, the second linking probe including a third reverse complement of the segment C, a detection tagging sequence between the segment B and the segment C, and a second reverse complement of the segment B, wherein the detection tagging sequence is: 55-70° C. Tm value, and 18-35 bp length; and the detection tagging sequence forms a cystic structure when hybridized to the target sequence; providing a third linking probe, the third linking probe including a downstream primer combination tagging sequence and a fourth reverse complement of the segment D; forming a probe chain with three linking probes, the first, the second, and the third linking probes in a ligation chain reaction with the effect of ligase; amplifying the probe chain with a plurality of universal primers; and providing a detection probe comprising a sequence complementary to the detection tagging sequence: wherein the upstream primer tagging sequence, the detection tagging sequence, and the downstream primer combination tagging sequence do not hybridize with the target sequence; and wherein there is no primer tagging sequence and primer combination tagging sequence on both ends of the second linking probe which leads to a detection reaction, and wherein there is no nonspecific amplification; wherein the detection tagging sequence is based on hybridizing the detection probe to the detection tagging sequence.
2. The method according to claim 1, wherein the upstream primer tagging sequence, the downstream primer combination sequence, and the detection tagging sequence meet the following conditions: a melting temperature of 55-70° C., a length of 18-35 nt, and a homology with a target genome below 50%.
3. The method according to claim 1, wherein the first, the second, the third, and the fourth reverse complements meet the following conditions: a melting temperature of 55-70° C. and specific hybridization with the target sequences.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
DETAILED DESCRIPTION OF THE DRAWINGS
(5) The embodiments of this invention will be described in detail with embodiments in the following. However, as the technical personnel in this field will understand, the following embodiments are only to introduce this invention, but should not be regarded as to define the scope of this invention. Any part in the embodiments, indicated with no specific technologies or conditions, should be conducted according to the technologies or conditions described in the literatures of this field (such as in Reference: J. Same Brooke et al. Huang Yian et al (translators). The Experimental Guide of Molecular Cloning, third edition. Science press.), or product instructions. The applied reagents or instruments, indicated with no manufacturer, are all conventional products that can be purchased in the public market.
(6) The applied instruments in the embodiments: real-time fluorescence PCR (Rotor-gene 600, QIAGEN, Germany), ultraviolet visible spectrophotometer (ND-1000, NanoDrop, the United States), and benchtop microcentrifuge (Eppendorf, Germany). All the synthesized sequences in the embodiments of this invention are from Sangon Biotech. Ligase is AmpligaseDNA Ligase Kit (5 U/MI, 1000 U, Epicentre). The applied genomic DNA samples, all acquired by using DNeasy™ Blood Kit from Oiagen, are from peripheral blood extraction from average people, according to the extraction methods in the instructions. Peripheral blood samples are provided by Xiamen Matemal and Child Health Hospital. All the applications of samples have obtained the permissions from the parties involved or their guardians.
Embodiment 1: Melting Curve Comparison Among Multiple Linking Probes
(7) Target sequence:
(8) ##STR00001## Linking probe 1 (completely complimentary hybridization with the target sequence):
(9) TABLE-US-00003 (SEQ ID NO: 2) GCAAGATCCAATCTAGACATTTCCCTGCAG Linking probe 2 (hybrid with the target sequence to form a cystic structural hybridization community, with the cystic structure in the middle; base in the dotted-line part constitutes a cystic structure):
(10) ##STR00002## Linking probe 3 (hybrid with the target sequence to form a cystic structural hybridization community; base in the dotted-line part constitutes a cystic structure):
(11) ##STR00003## Linking probe 4 (hybrid with the target sequence to form a cystic structural hybridization community; base in the dotted-line part constitutes a cystic structure):
(12) ##STR00004## Linking probe 5:
(13) TABLE-US-00004 (SEQ ID NO: 6) GCAAGATCCAATCTAGACA Observe the melting process of the claimed linking probes and the target sequence with Sybrgreen dye.
(14) 25 μL melting systems include: 75 mmol/L Tris-HCl pH 9.0, 20 mmol/L (NH.sub.4).sub.2SO.sub.4, 0.01% Tween 20, 50 mmol/L KCl, 4 mmol/L Mg.sup.2+, 0.4 μmol/L linking probes, 0.2 μmol/L target sequence, and 0.2 μL Sybrgreen fluorochrome. The melting analysis procedures include: 95° C. for 1 minute; 40° C. for 1 minute; heat up the temperature from 40° C. to 90° C., and collect the corresponding fluorescence signals throughout the entire heating process.
(15) Results show: 1. See the ordinary and cystic structural hybridization sequence melting curve graph 2A, wherein 8 is the linking probe 2 melting curve, and 9 is the linking probe 1 melting curve. The melting curve of linking probes 1 and 2 after being hybrid with the target sequence shows: the melting of cystic structural probes, the same as that of ordinary probes, is an independent melting process rather than the respective melting process on both sides of a cystic structure, whose melting peak is an independent unimodal. The Tm value of cystic structural probe is about 8° C. lower than that of other normal probes. 2. See the ordinary and cystic structural hybridization sequence melting curve graph 2B, wherein 10 is the linking probe 3 melting curve, 11 is the linking probe 4 melting curve, and 12 is the linking probe 2 melting curve. The melting curve of linking probes 2, 3 and 4 after being hybrid with the target sequence shows: the position of the cystic structure in the probe affects the Tm value of hybridization, and when it is in the middle of the probe, the Tm value of the corresponding “hybridization community” reaches its minimum. 3. See the ordinary and cystic structural hybridization sequence melting curve graph 2C, wherein 13 is the linking probe 4 melting curve, 14 is the linking probe 5 melting curve. The melting curve of linking probes 4 and 5 after being hybrid with the target sequence shows: the hybridization Tm value of the cystic structure is higher than that of a single side, further illustrating the holistic melting phenomenon of cystic structural probes.
Embodiment 2: Quantitative Detection of Target Sequences
(16) Select a segment of synthesized DNA sequence as the object of the study, design 3 linking probes against the sequence and respectively hybrid them on the adjacent positions to the target sequence: Target sequence:
(17) TABLE-US-00005 (SEQ ID NO: 7) CTACACAGTCTCCTGTACCTGGGCAATATGATGCTACCAAATTTAAGCAG TATAGCAGACATGTTGAGGAATATGA Linking probe a:
(18) ##STR00005## Linking probe b:
(19) ##STR00006## Linking probe c:
(20) ##STR00007## Wherein the upstream primer tag sequence of linking probe a is the universal primer F sequence, and the downstream primer combination tag sequence of linking probe c is the reversed complimentary sequence of universal primer R:
(21) TABLE-US-00006 (SEQ ID NO: 11) Universal primer F: TGGAGCGACGATACGAAGATA (SEQ ID NO: 12) Universal primer R: GCTCCAAGATCCTATCTAGA The detection tag sequence of the linking probe in the middle is the FAM-tagged Taqman probe sequence (FAM-AACTTCGGTCCTTCATCGCT-BHQ, sequence part is SEQ ID NO: 13). The 3 linking probes are hybrid on the adjacent positions to the target sequence. And the goal of quantitative detection is achieved by PCR amplification after ligase reaction.
(22) Target sequence obtains DNA with content of 1.0′10.sup.7, 1.0′10.sup.6, 1.0′10.sup.5, 1.0′10.sup.4, 1.0′10.sup.3 and 1.0′10.sup.2 copy respectively by ten-time gradient dilution. Select the DNA at this gradient as the template of quantitative detection.
(23) Experiment systems: 1. Ligation: 10 μL reaction systems include 1 μL hybridization linking buffer solution, 25 fmol linking probes, 1 u ligase, 5 μL DNA template; ligation procedures include 95° C. for 1 minute, 60° C. for 10 minutes, 55° C. for 10 minutes, and 50° C. for 10 minutes. 2. PCR reaction: 25 μL reaction systems include 2 μL linking products of the first step, 75 mmol/L Tris-HCl pH 9.0, 20 mmol/L (NH.sub.4).sub.2SO.sub.4, 0.01% Tween 20, 50 mmol/L KCl, 1 u Tag enzyme, 3 mmol/L Mg.sup.2+, 0.2 μmol/L Tagman probe, 0.4 μmol/L universal primer F and 0.4 μmol/L universal primer R; PCR reaction procedure includes 95° C. for 3 minutes, 95° C. for 15 seconds, 58° C. for 30 seconds, 50 cycles: and collect fluorescence signals throughout the process of annealing extension at 58° C.
(24) Amplification curve of gradient dilution template is: all FAM channels present amplification signals with amplification curve presenting gradient, and Ct value of the amplification curve (the corresponding cycle number when the fluorescence signals in the PCR reaction tubes reach its set threshold) is gradually increasing with the reduction of template copy number. NTC (negative control) presents no amplification signal (as shown in
Embodiment 3: SNP Genotyping Results of 3 Human Genomic DNA Samples
(25) Select the SNP site (rs740598) as the object of the study and design 4 linking probes as follow: Linking probe a:
(26) ##STR00008## Linking probe b-1:
(27) ##STR00009## Linking probe b-2:
(28) ##STR00010## Linking probe c:
(29) ##STR00011## Wherein the tag sequences of linking probes a and c are the same according to Embodiment 1; the detection sequence of linking probe b-1 is FAM-tagged Taqman probe sequence (FAM-CATCTCTAAGGCAAGGCTC-BHQ, sequence part is SEQ ID NO: 18), correspondingly being hybrid to template whose genotype is A; the detection sequence of linking probe b-2 is TET-tagged Taqman probe sequence (TET-ACCTTCCGTCTGTACTCGT-BHQ, sequence part is SEQ ID NO: 19), correspondingly being hybrid to the template whose genotype is G. Linking probe a and c are hybrid on the adjacent positions on both sides of linking probe b. The goal of genotyping is achieved by PCR amplification after ligase reaction.
(30) Select 3 human genomic samples with known genotypes (each concentration is 10 ng/μL) as the validating objects. Genotype of sample A is AA, sample B GG, and sample C AG.
(31) Experiment systems: 1. Genomic DNA denaturation: take 5 μL of each genome (50 ng in total) and put them into warm bath at 98° C. for 5 minutes, then lower the temperature to 25° C. and preserve the genomes; 2. Ligation: 10 μL reaction systems include 1 μL hybridization linking buffer solution, 25 fmol linking probes, 1 u ligase, 5 μL denatured genomic templates at the step 1; ligation procedures includes 95° C. for 1 minutes, 60° C. for 10 minutes, 55° C. for 10 minutes, and 50° C. for 10 minutes; 3. PCR reaction: 25 μL reaction systems include 2 μL linking products from step 2, 75 mmol/L Tris-HCl pH 9.0, 20 mmol/L (NH.sub.4).sub.2SO.sub.4, 0.01% Tween 20, 50 mmol/L KCl, 1 u Tag enzyme, 3 mmol/L Mg.sup.2+, 0.15 μmol/L of each Tagman probe, 0.4 μmol/L universal primer F and 0.4 μmol/L universal primer R; PCR reaction procedures include 95° C. for 3 minutes, 95° C. for 15 seconds, 58° C. for 30 seconds, 50 cycles; and collect two-colored fluorescence signals of FAM and TET throughout the process of annealing extension at 58° C.
(32) See